155 , No. 1 and leotide Sequence of the Control Regions for the ginA glnL Genes of Salmonella typhimurium ROBERT HANAU , t RAJU K. KODURIJ NANCY HO , § AND JEAN E. BRENCHLEY 1 Department of Biological Sciences , Purdue University , West Lafayette , Indiana 47907 Received 13 December 1982/Accepted 12 April 1983 Nuc We have partially characterized a DNA fragment encoding glutamine synthe-tase in Salmonella typhimurium .
Restriction mapping and RNA polymerase binding studies identified two regions within the fragment which exhibit promoter activity when fused to lacZ in pMC1403 , a plasmid used to detect transcriptional and translational control signals .
DNA sequence analysis revealed that one region encodes amino-acids corresponding to the amino terminus of the glutamine synthetase protein .
The second region codes for the amino-acids corresponding to the carboxy terminus of glutamine synthetase followed by a 330-nucleotide sequence containing an ideal Pribnow heptamer and a possible translation initiation signal .
The location of this region is analogous to the position of the beginning of the glnL gene identified in Escherichia coli , and it is likely that the Pribnow heptamer is the RNA polymerase binding site for the glnL gene .
Studies of Salmonella typhimurium by Kustu et al. ( 13 ) and of Escherichia coli by Pahel and Tyler ( 23 ) have shown that the product of a regulatory locus distinct from , but closely linked to , the glnA ( glutamine synthetase ) gene is required for normal expression of glnA and other genes under nitrogen control .
Subsequent investigations ( 16 , 18 ) demonstrated that this rsgulatory locus is composed of two cistrons , ntrB and ntrC ( also referred to as glnL and glnG , respectively , in studies of E. coli [ 5 , 16 , 22 ] ) , and that the products are involved in mediating both positive and negative control of gInA.-Recent genetic studies by Magasanik and coinvestigators ( 5 , 22 ) and by Gutterman et al. ( 9 ) have demonstrated that glnA , glnL , and ginG comprise a single , complex operon .
Their results indicate that ( i ) derepression of glnA leads to increased levels of glnL and glnG products due to transcription initiated at the glnA promoter , which proceeds in the direction of glnL and glnG ; ( ii ) during-growth-conditions causing the repression of glnA , the regulatory products encoded by glnL and glnG are controlled by a second promoter located downstream from glnA at glnL .
ogy , Purdue University , West Lafayette , IN 47907 .
§ Present address : Laboratory of Renewable Resources Engineering , Purdue University , West Lafayette , IN 47907 .
We have previously reported the cloning of glnA from S. typhimurium into plasmid pBR322 and a preliminary biochemical characterization of the PNA ( 12 ) .
In this report , we extend our studies of the DNA from the glnA region of S. typhimurium .
Our results support recent genetic findings and provide physical evidence for the existence of a promoter closely linked to but distal from the glnA gene .
MATERALS AND METHODS Chemical and DNA modling enzymes .
All chemicals were reagent grade and commercially available .
Nitrocefin ( Glaxo Research Ltd. ) was a gift from H. Zalkin .
The RNA polymerase holoenzymes , the large fragment of E. coli DNA polymerase I , T4 DNA ligase , and restriction endonuclease PvuI were purchased from New England BioLabs .
Other restriction end6nucleases and bacterial alkaline phosphatase ( BAP MATE ) were purchased from Bethesda Research Laboratories .
Polynucleotide kinase and calf intestine alkaline phospiatase were obtained from Boehringer Mannheim .
Terminal transferase and nonradioactive deoxynucleoside triphosphates were purchased from P-L Biochemicals .
] ATP ( -7,500 Ci/nmol ) and a -32 P-labeled deoxynucleQside triphosphates ( -3,000 Ci/nmol ) were purchased from New England Nuclear .
Cordycepin 5 ' - [ a-32P ] triphosphate ( -3,000 Ci/nmol ) was purchased from Amersham Corp. .
Plasmids and bacterhl strins .
The pBR322 ( 1 ) derivin atives used this study , pJB8 ( 12 ) and pMCl403 ( 3 ) , have both been previously described .
E. coli strain CU697 , rbs met ara A ( pro-lac ) thi ( obtained from H. E. Umbarger ) , was used as a recipient in transformations to detect the cloning of 5 ' control sequences from pJB8 into the lac fusion vector pMC1403 .
Hybrid t Present address : Department of Botany and Plant Pathol ¬ 8 VOL .
155 , 1983 DNA SEQUENC plasmids representing the desired fusions between DNA from pJB8 and lac in pMC1403 were subsequently used to transform strain JB1396 , a Gln + Reg ' hsr ile leu met val trp derivative of S. typhimurium LT-2 .
Previously published procedures were used for large-scale isolation and purification of plasmid DNA ( 8 ) .
Restriction endonuclease digests were performed according to the recommendations provided by the commercial sources .
DNA sequence was determined by the method of Maxam and Gilbert ( 17 ) from fragments labeled with 32P at either the 5 ' ends with polynucleotide kinase ( 4 ) or the 3 ' ends by incubation with the large fragment of DNA polymerase ( 26 ) or terminal transferase ( 30 ) .
A total Sall-SmaI digest of pJB8 DNA was used for in-vitro RNA polymerase binding studies ( 26 ) , and the reactions were performed as described previously ( 12 ) .
Plasmids pJB14 , pJB15 , and pJB16 were constructed by cloning HincII restriction fragments from pJB8 into the SmaI site of pMC1403 .
Approximately 3 pmol of pMC1403 DNA was digested with SmaI and treated with 200 U of bacterial alkaline phosphatase ( BAP MATE ) .
The pMC1403 DNA was suspended in a 30 - , ul ligase reaction volume containing 400 U of T4 DNA ligase and 3 pmol of pJB8 DNA that had been digested with HincII .
After incubation for 18 h at 20 °C , an additional 400 U of ligase in 30 1 .
l of buffer was added to the reaction , and the mixture was incubated at 20 °C for an additional 20 h. Samples of the ligation mixture were used to transform strain CU697 according to the method described by Davis al. et ( 8 ) .
Ampicillin-resistant transformants were simultaneously screened for the acquisition of the Lac ' phenotype by plating on LB ( 2 ) agar containing 50 , ug of ampicillin and 4 , ug of X-gal ml - ' ( 19 ) .
Of 272 transformed colonies , 6 were Lac ' ( blue color on X-gal-containing media ) , and the plasmid DNA from each of the 6 was analyzed by using a rapid isolation procedure for small amounts of plasmid DNA ( 11 ) .
Two classes of clones representing distinct gene fusions were identified , and these correspond to vectors pJB14 and pJB16 .
Vector pJB15 was derived from pJB14 by digesting 10 jig of pJB14 DNA with SmaI followed by incubation with 400 U of T4 DNA ligase in a 50 - , ul reaction volume for 24 h at 20 °C .
This mixture was used to transform CU697 , and Ampr Lac ' derivatives were isolated as described above .
Subsequently , plasmid DNA prepared from the pJB15 and pJB16 transformants of CU697 was used to transform JB1396 .
LB and minimal salts media have been described previously Cells for ( 2 ) .
physiology experiments were grown overnight at 37 °C in minimal-medium containing 20 mM glucose as the carbon source and either 20 mM ( NH4 ) 2SO4 or 20 mM proline as the nitrogen source .
Cells were then diluted into the same medium ( cell density , ca. 10 Klett turbidity units ) and grown at 37 °C with vigorous shaking until they reached a density of about 100 Klett units .
The cells were chilled on ice for 15 min and harvested by centrifugation at 12,000 x g for 10 min , washed in cold 0.85 % NaCl , and resuspended in 1/50 volume of cold 25 mM N-tris ( hydroxymethyl ) methyl-2-aminoethanesulfonic acid , pH 7.3 .
Ultrasonic disrupted cell extracts were then prepared from the cell suspensions as described previously ( 2 ) .
1-Galactosidase activity ( 24 ) , gluta-mine synthetase activity ( 28 ) , and protein ( 15 ) were OF glnA AND glnL CONTROL REGIONS 83 determined by using previously published procedures .
P-Lactamase ( 6 ) activity was determined by measuring the increase in optical density at 486 nm resulting from the hydrolysis of nitrocefin ( 21 ) .
The reactions were performed at 25 °C in cuvettes containing 1 ml of 100 mM KH2PO4 ( pH 7.0 ) , 0.05 , umol of nitrocefin , and 2.5 to 10 , ul of sonic extract ( 10 to 30 jig of protein ) .
The molar extinction coefficient from the hydrolyzed form of nitrocefin was determined to be 1.41 x 107 mol-1 .
E RESULTS Restriction endonuclease map of the ginA region .
We previously described the cloning of the glutamine synthetase gene from S. typhimurium into pBR322 ( 12 ) .
One plasmid , pJB8 , containing a 2.3-kilobase ( kb ) ( HindIII to SalI ) insert that exhibited normal regulation of glutamine synthe-tase was used to construct a detailed restriction endonuclease map of the glnA region ( Fig. 1 ) .
This map was used in subsequent studies to identify regions that would bind RNA polymer-ase and promote transcription of the lac genes in plasmid vector pMC1403 and for isolating specific fragments for DNA sequence analysis .
RNA polymerase binding studies .
Previous work ( 12 ) suggested that RNA polymerase binding sites were present on two distinct HincII fragments contained within the 2.3-kb insert in pJB8 ( see Fig. 1 ) .
To localize these binding sites more precisely , additional RNA polymerase binding studies were performed on pJB8 DNA that had been digested with SmaI and SalI to generate smaller DNA fragments .
Figure 2 , lane B , shows the pattern of pJB8 DNA retained by nitrocellulose filters after diwith gestion endonucleases SmaI and Sall and incubation with RNA polymerase .
For comparison , pJB8 DNA digested with SmaI and SalI is shown in Fig. 2 , lane A. Band I is a 3.8-kb fragment containing primarily pBR322 DNA .
Bands II , III , and IV are the 1.4 - , 0.6 - , and 0.2-kb fragments from the S. typhimurium DNA insert ( refer to Fig. 1 ) .
The relative efficiency of RNA polymerase binding was greater for the 0.6-kb fragment than for the 1.4-kb fragment .
Binding of RNA polymerase to the 0.2-kb fragment was undetectable .
The RNA polymerase binding to the 1.4-kb SmaI-SmaI fragment was expected and predicted on the basis of our previous results , which indicated the presence of an RNA polymerase binding site between HinclI restriction endonuclease sites at 300 and 1,200 nucleotides ( Fig. 1 ) .
The binding of RNA the 0.6-kb to polymerase SmaI-SalI fragment verified the presence and more accurately describes the location of a second , potential control region within the pJB8 insert .
DNA sequence analysis of the region located between HincH endonuclease sites at 300 and 1,200 nucleotides .
The nucleotide sequence wa determined for several fragments located between the HincII endonuclease sites at 300 and 1,200 nucleotides ( Fig. 1 ) .
A sequence corresponding to the amino-terminal amino-acids of glutamine synthetase ( 13 ) was identified and is shown in Fig. 3 .
The results indicate that the translational initiation site for the peptide is located at nucleotide 780 of the pJB8 insert .
DNA sequence analysis of the region located between endonuclease sites SmaI and SaIl at 1,730 and 2,300 nucleotides .
The assignment of the carboxy terminus of the glnA gene was confirmed by DNA sequence analysis of fragments obtained after digestion of the 0.6-kb SmaI-SalI fragment with AluI ( refer to Fig. 1 ) .
Additional sequence information characterizing this region was obtained from fragments isolated after digestion of pJB8 DNA with restriction endonucleases PvuI and Sall .
A portion of the sequence from the PvuI site at 1,900 towards the SalI site ( Fig. 1 ) codes for the 14 carboxyl-terminal amino-acids of glutamine synthetase ( Fig. 4 ) ( 13 ; R. Heinrikson , personal communication ) .
This region is followed by a sequence containing a consensus Pribnow heptamer ( 27 ) and additional sequences which represent a possible ribosome binding site ( GGAG ) ( 29 ) and a possible methionine initiation codon .
These findings strongly suggest that this portion of the sequence corresponds to a control region for a gene ( s ) located downstream from ginA , presumably ginL and glnG ( 16 ) .
Construction of gln-lac gene fusions .
Our sequence analysis places the amino terminus and carboxy terminus of ginA at 780 and 1,965 nucleotides , respectively , on the restriction map ( Fig. 1 ) .
These findings together with the results of the RNA polymerase binding studies and the presence of a Pribnow heptamer in the region after the glnA structural gene indicate that control regions may be present on each of the two HincII fragments contained within the pJB8 insert .
To determine whether DNA within either of the HincII fragments possesses the ability to regulate gene expression , both of these fragments were fused to lacZ by subcloning into the plasmid vector pMC1403 as described above ( Materials and Methods ) .
The position and orientation of the pJB8 DNA in the subclones were verified by restriction analysis .
The lac fusion in pJB15 contains a portion of pJB8 DNA which corresponds to a region located between 1,730 and 2,300 nucleotides on the restriction map in Fig. 1 ( Fig. 5A ) .
This fusion brings the fragment containing the Pribnow heptamer into continuity with lacZ .
The pJB8 DNA contained within the pJB16 fusion corresponds to the HincII fragment located between nucleotides 300 and 1,200 ( Fig. 1 ) , which contains at least a portion of the ginA control region .
Regulation of P-galatosidase in pJB15 and pJB16 .
Strain JB1396 was transformed with pJB15 and pJB16 , the transformants were grown in glucose minimal-medium with either 20 mM ( NH4 ) 2SO4 or 20 mM proline as the nitrogen source , and the glutamine synthetase and pgalactosidase activities were measured .
The glu tamine synthetase levels increased approximately 20-fold in cultures of JB1396 grown in glucose-proline medium as well as in comparable cultures of JB1396 transformed with PJB15 and pJB16 ( Table 1 ) .
However , the P-galacto-sidase activities showed little variation when cultures of JB1396 transformed with pJB16 were grown in glucose-NH4 ' and glucose-proline media ( Table 1 ) .
In contrast to the 20-fold increase in glutamine synthetase , cultures of JB1396 transformed with pJB16 showed only a slight increase in P-galactosidase ( cf. lines 5 and 6 ) when proline replaced NH4 ' as the nitrogen source .
H-4 0 E 0 0 E E Un .
c I U ) U ) 1-1 C4 1-4 S H 1-4 l 1 - : 3 l0 c I 0 , CI A ii u. w I I m I 0 I I a I I b o `` Io 500 2000 1500 , ' 0 x -4 w0 ~ I : m 9 \ 0 > < \ \ / / I / / 0 N ~ ~ I % ' 700 900 4c , I I. 300 I 2300 5 1900 500 2100 ¬ 1700 3 ' l ~ ~ ~ 3 ~ ~ - s 4 .
Diagram of the restriction endonuclease sites in a 2,300-base pair HindIII to Sall DNA fragment in pJB8 carrying the glnA region of S. typhimurium .
The segments between 300 to 900 and 1,700 to 2,300 nucleotides are expanded to show more detail and sites for additional restriction endonucleases .
Arrows correspond to regions that were sequenced .
The tail of the arrow represents the 32P-labeled end of the fragment , and the arrowhead represents the direction and extent to which each fragment was sequenced .
The DNA strand labeled with 32p iS indicated by the 5 ' and 3 ' designation .
i31 ¬ 4 In addition to measuring glutamine synthetase and P-galactosidase activities , we examined the levels of f-lactamase ( 6 ) in cultures of JB1396 transformed with pJB15 and pJB16 .
For pBR322 and its derivatives , the level of P-lactamase in cultures of transformants is directly proportional to plasmid copy number ( 20 , 31 , 32 ) .
P-Lacta-mase levels were 17-fold lower when proline replaced NH4 ' as the nitrogen source in cultures of JB1396 transformed with pJB16 ( Table 1 ) .
Similarly , when cultures of JB1396 transformed with pJB15 were grown in glucose-NH4 ' and glucose-proline media , the levels of P-lactamase were sevenfold lower in the glucose-proline cultures ( Table 1 ) .
These results indicate that the glucose-proline cultures of JB1396 transformants contained 7-and 17-fold fewer copies of pJB15 and pJB16 , respectively , than similar cultures grown in glucose-NH4 + .
We used the levels of,-lactamase as an indication of relative gene copy responsible for directing the synthesis of P-galactosidase .
Table 1 shows the P-galactosidase levels measured in glucose-NH4 ' and glucose-proline cultures of JB1396 transformed with pJB15 and pJB16 which have been normalized with regard to plasmid copy number .
The specific activity of,3-galactosidase per copy of pJB16 is about 20-fold higher in glucose-proline medium than in glu-cose-NH4 + medium , and this increase is comparable to that observed for glutamine synthetase in these cultures .
The specific activity of pgalactosidase per copy of pJB15 is similar in both media , although slightly higher in glucose-NH4 ' than in glucose-proline .
These results are expected if pJB16 and pJB15 represent lac fusions of the glnA and glnL control regions , respectively , and are similar to the results described by Pahel et al. ( 22 ) in studies of E. coli .
A R I - ' t ¬ 3.8 kb 1.4 kb IEU ' ¬ 0.6 kb 0.2 kb FIG. 2 .
Agarose gel analysis of RNA polymerase binding to DNA fragments from pJB8 .
The samples in lanes A and B each contained 5 , ug of pJB8 DNA digested with SmaI and SalI .
Before electrophoresis , the sample in lane B was incubated with 5 , ug of RNA polymerase and filtered through a nitrocellulose filter .
Bands I , II , and III represent DNA fragments retained by the filter after RNA polymerase binding .
Band IV corresponds to the 0.2-kb Smal-SmaI fragment within the pJB8 insert and was not retained by the filter .
DISCUSSION Two RNA polymerase binding sites are pres-ent in the pJB8 insert .
One site is located between HincII restriction sites at nucleotides 300 and 1,200 .
DNA sequence analysis of restriction fragments from this region shows that nucleo-tides encoding the amino-terminal amino-acid of glutamine synthetase are located at nucleotide 780 .
Because this represents the start of the glutamine synthetase structural gene , it is reasonable to assume that the RNA polymerase binding occurs in a region located between nucleotides 300 and 780 and that this segment contains sequences which correspond to or represent a portion of the gInA promoter .
A second RNA polymerase binding site is located between the SmaI and Sail restriction sites at nucleotides 1,730 and 2,300 .
DNA sequence analysis of this region shows that the carboxy-terminal portion of glnA is located at nucleotide 1,965 .
The mapping of the glnA coding sequences between nucleotides 780 and 1,965 is consistent with biochemical studies of the glutamine synthetase protein ( 7 , 14 ) which predict the size of the structural gene to approximately 1,200 nucleotide pairs .
Further analysis of the sequence from fragments isolated from the SmaI-SalI region indicates the presence of a Pribnow heptamer , downstream from ginA , centered at about nucleotide 2,200 .
In addition , our results show that the Pribnow heptamer is followed by sequences which represent a possible ribosome binding site and a possible translation initiation codon .
The HincII and SmaI-Sall restriction fragments were fused to lacZ by cloning into pMC1403 .
The eight amino-terminal codons of lacZ are absent in pMC1403 ( 3 ) .
P-Galactosidase activity resulting from the gene fusions is therefore dependent upon the presence of 5 ' - control sequences located within the insert .
The results in Table 1 show that the fusions in both pJB15 and pJB16 are capable of directing the synthesis of hybrid P-galactosidase in cells transformed with these plasmids FIG. 2 .
Agarose gel analysis of RNA polymerase binding to DNA fragments from pJB8 .
The samples in lanes A and B each contained 5 , ug of pJB8 DNA digested with SmaI and SalI .
Before electrophoresis , the sample in lane B was incubated with 5 , ug of RNA polymerase and filtered through a nitrocellulose filter .
Bands I , II , and III represent DNA fragments retained by the filter after RNA polymerase binding .
Band IV corresponds to the 0.2-kb Smal-SmaI fragment within the pJB8 insert and was not retained by the filter .
HaeIII 725 Bg1II 750 5 ' TTACGGCGACACGGCCAGCAGAATTGAAGATCTCGTTACCACGACGACCGATCATGACCA AATGCCGCTGTGCCGGTCGTCTTAACTTCTAGAGCAATGGTGCTGCTGGCTAGTACTGGT 775 8oo I I ATCCGGGAGAGTACAAGTATGTCCGCTGAACACGTTTTGACGATGCTGAACGAGCACGAA ' 3 TAGGCCCTCTCATGTTCATACAGGCGACTTGTGCAAAACTGCTACGACTTGCTCGTGCTT MetSerAlaGluHisValLeuThrMetLeuAsnGluHisGlu FIG. 3 .
Nucleotide sequence of a segment of the glnA gene encoding the N-terminal amino-acids of glutamine synthetase .
The sequence was determined from fragments isolated from BgII and EcoRI digests of pJB8 DNA and corresponds to a segment located between nucleotides at about 700 and 820 on the restriction map ( Fig. 1 ) .
The inferred amino-acid sequence for the first 14 amino-acids is indicated .
The amino-acids which are underlined represent those which have been previously identified ( 13 ) .
The positions of the HaeIII and BgIII restriction endonuclease sites are indicated for reference J. BACTERIOL .
1925 AluI 1975 5 ' GAAGAAGATGACCGCGTGCGTATGACCCCGCACCCGGTAGAGTTTGAGCTGTACTACAGCGTTTAATCGTATATTAAA CTTCTTCTACTGGCGCACGCATACTGGGGCGTGGGCCATCTCAAACTCGACATGATGTCGCAAATTAGCATATAATTT GluGluAspAspArgValArgMetThrProHisProValGluPheGluLeuTyrTyrSerVail C-Terminus 2000-2025-2050 * AATCCGACAAATTTCGCGTTGCTGCAAGGCAGCAACTGAGCACATCCCAGGAGCATAGATAGCGATGTGACTGGGGTAAG TTAGGCTGTTTAAAGCGCAACGACGTTCCGTCGTT ... .
TGACCCCATTC 2075-2100-2125 t l I CGAAGGCAGCCAACaCAGCAGCAGCG ... .
GCTTCCGTCGGTTGCGTCGTCGTCGCACTTCCGCAGTCCTCAAAAACTCAACGGCACCTTTGAAAGTCGGGTAGGGTTCT 2150 2175 AluI II I ... ... ACGCGCTTTTTAGTGITAAAAAGCTATAATGCACTAAAATGGTGCAAC ACCCGAAAAAAGAGGTGGTTGTTAGACTAGAGTGCGCGAAAAATCACCA1TTTTCGATATTACGTGATTTTACCACGTTG Pribnow heptamer 2225-2250-2275 9 , 1 CTTTTCCAGGAGACTGCCGAATGGCAAGCGGCATACAGCCCGATGCTGGGCAGATCCTCAATTCGTTAATCAACAGC ' 3 GAAAAGGTCCTCTGACGGCTTACCGTTCGCCGTATGTCGGGCTACGACCCGTCTAGGAGTTAAGCAATTAGTTGTCG FIG. 4 .
Nucleotide sequence corresponding to the carboxy terminus of the glnA gene .
The sequence was determined from fragments isolated from PvuI , Sall , and AluI digests of pJB8 DNA .
The dots represent portions of the particular strand which were not sequenced .
The inferred amino-acid sequence for the carboxy terminus is shown .
The 14 amino-acids which are underlined are those found at the carboxy terminus of the glutamine synthetase protein ( 13 ; R. Heinrikson , personal communication ) .
The locations of the Pribnow heptamer as well as a possible ribosome binding site ( GGAG ) and a possible translation initiation codon ( ATG ) are indicated .
The AluI restriction sites and nucleotide numbers are shown relative to their position on the restriction map in Fig. 1 .
The corrected enzyme levels shown in Table 1 verify that the fusion in pJB16 ( containing the HinclI fragment located between nucleotides 300 and 1,200 ) contains control sequences which correspond to the glnA promoter .
P-Lactamase activity was measured to determine relative plasmid copy number .
After correcting for the lowered gene dose in glucose-proline cultures of the pJB16 transformants , regulation of the hybrid 3-galactosidase was identical to that of glutamine synthetase .
The results in Table 1 also indicate that the response of the control sequence in the pJB15 fusion ( containing the SmaI-Sall fragment located between nucleotides 1,730 and 2,300 ) is quite different from that of the pJB16 fusion .
The activity of hybrid , B-galactosidase per copy of pJB15 was similar in glucose-proline and glu-cose-NH4 ' cultures , although slightly elevated in the latter .
Studies by Magasanik 's group ( 5 , 22 ) , MacNeil et al. ( 16 ) , and Gutterman et al. ( 9 ) hav demonstrated that the order of the genes in the glnA region of E. coli is gInA-g1nL-glnG and that they comprise a single transcriptional unit controlled by the glnA promoter .
The results of Gutterman et al. ( 9 ) and Pahel et al. ( 22 ) , which describe the regulation of glnL and gInG , indicate that these genes are regulated by a second promoter located at glnL .
We propose that the ginA-distal control region contained in the pJB15 fusion is analogous to the proposed gene glnL promoter of E. coli .
Thus , we show that the 2.3-kb pJB8 insert which encodes S. typhimurium glutamine synthetase contains a promoter distinct from that which regulates g1nA .
Unlike glnL , we find no ideal Pribnow heptamer within the sequence immediately preceding the gInA coding region ( Fig. 3 ) npr is one contained within the sequence which extends 165 nucleotides upstream from the BgiII restriction site ( unpublished data ) .
Our sequence data also suggest that additional ginA-distal control regions exist .
A sequence ( CAGCCAACGCAGCAGCAG ) which is located 101 nucleotides beyond the carboxy terminus of glnA could encode four glutamines if translated ( Fig. 4 ) .
Pahel et al. ( 22 ) address the possibility that continuation of transcription distal to gInA may be regulated .
If this intercistronic region is also involved in regulating ginL and ginG , it differs from previously described intercistronic regulation elements ( 10 ) because it precedes an apparent transcription initiation site at the Pribnow heptamer .
We are characterizing this intercistronic region further to determine whether it is involved in novel molecular a mechanism which serves to better coordinate expression of the nitrogen regulatory genes gInL and ginG with the synthesis of glutamine synthe-tase .
B ApR A ApR 4H3 H2 Sm Pv 2/Sa m H2H-X % 2.9 / / I ' I \ I R / / Av J Av L ¬ 6 .
o 0.0 5.2 pJB8 / I A / ~ I pJB14 Z 8.1 .
Plasmids containing gln-lac gene fusions .
Segments of the insert DNA from pJB8 were cloned into plasmid vector pMC1403 ( 3 ) .
pJB8 DNA ( represented by the linear map ) digested with HinclI was ligated with pMC1403 DNA that had been digested with SmaI as described in the text .
Two classes of fusions represented by clones pJB14 and pJB16 were isolated .
Restriction mapping verified the position and orientation of the pJB8 HincII fragments which had been fused to lacZ .
A portion of the insert in pJB14 was removed after digestion with SmaI and ligation to generate pJB15 .
The first 200 nucleotides of the insert in pJB15 correspond to an inversion of the SmaI-HincII fragment from the pJB8 insert ( between nucleotides 100 and 300 on the restriction map , Fig. 1 ) , which is followed by a 600-nucleotide segment from pJB8 containing the carboxy-terminal portion of glnA and the adjacent , downstream region .
The insert in pJB16 corresponds to a 900-base pair HincIl fragment , a portion of which encodes the amino-terminal amino-acids of glutamine synthetase .
Solid lines represent pJB8 DNA .
Open lines correspond to pMC1403 DNA .
Hatch marks denote pMC1403 DNA derived from the lac genes ( 3 ) .
Relevant restriction sites are indicated and have the following designations : Av , AvaI ; Bg , BglII ; H2 , HincII ; H3 , HindIII ; Pv , PvuI ; Sa , Sall ; Sm , SmaI .
Kilobase coordinates for relevant sites and the location of the Apr ( ampicillin resistance ) determinant gene of the plasmids are shown .
Covarrubias , F. Bolivar , and F. Bastarrachea for discussions of their work with the ginA gene of E. coli , M. D. Marks for his in DNA sequencing , and P. T. Gilham sharing expertise for help in computer analysis of the sequences and use of laboratory space .
This work was supported by Public Health Service grant GM25251 from the National Institute of General Medical Sciences , by grant PCM20882 from the National Science Foundation , a Research Career Development award GM00449 from the National Institute of General Medical Sciences to J.E.B. , and by grant GM19395 from the National Institute of General Medical Sciences to P.T.G. LITERATURE CITED 1 .
Bolivar , F. , R. L. Rodriguez , M. C. Betlach , and H. W. Boyer .
Construction and characterization of new cloning vehicles .
I. Ampicillin-resistant derivatives of plasmid pMB9 .
Effect of methionine sulfoximine and methionine-sulfone on glutamate synthesis in Klebsi-ella aerogenes .
Casadaban , M. J. , J. Chou , and S. N. Cohen .
In vitro gene fusions that join an enzymatically active 3-galactosidase segment to amino-terminal fragments of exogenous proteins : Escherichia coli plasmid vectors for the detection and cloning of translational initiation signals .
Chacoas , G. , and J. H. Van de Sande .
5 ' 32p labelling of RNA and DNA restriction fragments .
Cben , Y.-M. , K. Backman , and B. Ma nik .
Characterization of a gene , glnL , the product of which is involved in the regulation of nitrogen utilization in Esche-richia coli .
Citri , N. , and M. R. Poflock .
The biochemistry and function of P-lactamase ( penicillinase ) .
Dautry-Varsat , A. , G. N. Cohen , and E. R. Stadtman .
Some properties of Escherichia coli glutamine synthetase after limited proteolysis by subtilisin .
Davis , R. N. , D. Botsteln , and J. R. Roth .
Advanced bacterial genetics , p. 116-127 .
Cold Spring Harbor LaboCold Harbor , N.Y. ratory , Spring 9 .
Gutterman , S. K. , G. Roberts , and B. Tyler .
Polarity in the ginA operon : suppression of the Reg-phenotype by rho mutants .
Higgins , C. F. , G. F.-L Ames , W. M. Barnes , J. M. Clment , and M. Holbung .
A novel intercistronic regulatory element of prqkaryotic operons .
Ish-Horowlcz , D. , and J. F. Burke .
Rapid and efficient cosmid cloning .
Kodurl , R. K. , D. M. Bedwell , and J. E. Brenchley .
Characterization of a HindIll-generated DNA fragment carrying the glutamine synthetase gene of Salmonella typhimurium .
Kustu , S. , D. Burten , E. Garcia , L. McCarter , and N. McFarland .
Nitrogen control in Salmonella : regulation by the gInR and glnF gene products .
Lei , M. , U. Aebi , E. G. Heldner , and D. Eisenberg .
Limited proteolysis of glutamine synthetase is inhibited by glutamate and by feedback inhibitors .
H. , N. J. Rosebrough , A. L. Farr , and R. J. Randall .
Protein measurement with the Folin phenol reagent .
MacNeil , T. , D. MacNeil , and B. Tyler .
Fine-structure deletion map and complementation analysis of the glnA-glnL-glnG region in Escherichia coli .
Maxam , A. M. , and W. Gilbert .
Sequencing endlabelled DNA with base-specific chemical cleavages .
McFarlad , N. , L. McCarter , S. Artz , and S. Kusta .
Nitrogen regulatory locus `` glnR '' of enteric bacteria is composed of cistrons ntrB and ntrC : identification of their proton products .
Experiments in molecular genetics , p. 48 .
Cold Spring Harbor Laboratory , Cold Spriing Harbor , N.Y. 20 .
Nordstrom , K. , L. Ingam , and A. Lundback .
Mutations in R factors of Escherichia coli causing an increased number of R-factor copies per chromosome .
O'Callghan , C. E , , A. Morris , S. Kirby , and A. E. Shingler .
Novel method for detection of 3-lactamase by using a chromogenic cephalosporin substrate .
Pahel , G. , D. M. Rothstdn , and B. Magasanlik .
Complex glnA-glnL-glnG operon of Escherichia coli .
Pahel , G. , and B. Tyler .
A new ginA-linked regulatory gene for glutamine synthetase in Escherichia coli .
PrIval , M. J. , and B. Ma nlk .
Resistance to catabolite-repression of histidase and proline oxidase during nitrogen-limited growth of Klebsiella aerogenes .
Rezalkoff , W. S. , and B. B. Jones .
Tryptophan-transducing bacteriophages : in-vitro studies with restriction endonucleases HindII and III and Escherichia coli ribonucleic acid polymerase .
Rigby , P. N. J. , M. Dkckmann , C. Rhodes , and P. Berg .
Labelling deoxyribonucleic acid to high specific activity in-vitro by nick translating with DNA polymerase I. J. Mol .
Rosenberg , M. , and D. Court .
Regulatory sequences involved in the promotion and termination of RNA transcription .
Rosenfeld , S. A. , and J. E. Brenchley .
Regulation of nitrogen utilization in hisT mutants of Salmonella typhi-murium .
Shine , J. , and L. Dalgarno .
The 3 ' - terminal sequences of Escherichia coli 16s ribosomal RNA : complementarity to nonsense triplets and ribosome binding sites .
D. , and S. N. Cohen .
3 ' - Endlabelling of DNA with [ a-32p ] cordycepin-5 ' - triphosphate .
UblIn , B. E. , and K. Nordstrom .
R plasmid gene dosage effects in Escherichia coli K-12 : copy mutants of the R plasmid Rl drd-19 .
Uhlin , B. E. , and K. Nordstrom .
A runaway-replica-tion mutant of plasmid Rl drd-19 : temperature dependent loss of copy number control .