DNA Sequences of the cysK Regions of Salmonella typhimurium and Escherichia coli and Linkage of the cysK Regions to ptsH CAROLYN R. BYRNE , ' ROBIN S. MONROE ,2 KEVIN A. WARD , ' AND NICHOLAS M. KREDICH2 * Division of Animal Production , Commonwealth Scientific and Industrial Research Organisation , Blacktown , New South Wales 2148 , Australia , ' and Laboratories of the Howard Hughes Medical Institute at Duke University and Departments of Medicine and Biochemistry , Duke University Medical Center , Durham , North Carolina 277102 Nucleotide sequences of the cysK regions of SalmoneUa typhimurium and Escherichia coli have been determined .
A total of 3,812 and 2,595 nucleotides were sequenced from S. typhimurium and E. coli , respectively .
Open reading frames of 323 codons were found in both species and were identified as those of cysK by comparison of deduced amino-acid sequences with amino-and carboxyl-terminal amino-acid analyses of the S. typhimurium cysK gene product O-acetylserine ( thiol ) - lyase A .
The two cysK DNA sequences were 85 % identical , and the deduced amino-acid sequences were 96 % identical .
The major transcription initiation sites for cysK were found to be virtually identical in the two organisms , by using primer-extension and Si nuclease protection techniques .
The -35 region corresponding to the major transcription start site was TTCCCC in S. typhimurium and TTCCGC in E. coli .
The deviation of these sequences from the consensus sequence TTGACA may reflect the fact that cysK is subject to positive control and requires the cysB regulatory protein for expression .
Sequences downstream of cysK were found to include ptsH and a portion of ptsl , thus establishing the exact relationship of cysK with these two genes .
A 290-codon open reading frame , which may represent the cysZ gene , was identified upstream of cysK .
Salmonella typhimurium and Escherichia coli synthesize L-cysteine from O-acetyl-L-serine and sulfide in a reaction catalyzed by O-acetylserine ( thiol ) - lyase ( formerly designated O-acetylserine sulfhydrylase [ 4 , 24 ] ) .
Two such enzymes , termed A and B , are found in S. typhimurium ( 5 ) and are coded for by cysK and cysM , respectively ( 18 , 19 ) .
Both cysK and cysM are closely linked to cysA and to the crr ptsI ptsH cluster located at 49 min on the S. typhimurium chromosome ( 41 ) and at 52 min on the E. coli chromosome ( 3 ) .
Native O-acetylserine ( thiol ) - lyase A has a molecular of pyridoxal phos-weight of 68,000 , contains 2 molecules phate and is composed of two identical 34-kilodalton subunits ( 4 , 6 ) .
The large excess of the A isozyme over the B indicates that , under these isozyme during aerobic-growth for the majority of Lconditions , the former accounts cysteine synthesis from O-acetyl-L-serine and sulfide ( 18 , 23 ) .
Unlike the A isozyme , O-acetylserine ( thiol ) - lyase B also catalyzes the formation of S-sulfocysteine from 0-acetyl-L-serine and thiosulfate ( 30 , 31 ) and is required for efficient cysteine biosynthesis during anaerobic-growth ( 12 ) .
Both enzymes are presumed to exist in E. coli as well , even though only cysK and its product have been demonstrated in this species ( 6 , 13 ) .
Genes for the enzymes of cysteine biosynthesis are scat-regulated tered widely on the bacterial chromosome and are termed the cysteine regulon .
by a system of positive control combination Derepression of the cysteine regulon requires a and coinducer of sulfur starvation , the L-cysteine precursor protein encoded by the cysB 0-acetyl-L-serine , and the molecular regulatory gene ( 21-23 ) .
The elucidation of the positive regulation mechanisms involved in this system of the promoter regions of cys requires the characterization of under cysB control .
In this combined effort from our genes laboratories , we report the nucleotide sequences of two identification cysK from S. typhimurium and E. coli and the of the promoter regions for these genes .
Our sequences also show the exact relationship of cysK to adjacent genes , since the sequences overlap ptsH and portions of ptsl on the one side and show an open reading frame on the other , which may be that of cysZ , a gene required for sulfate transport in E. coli ( 35 ) .
MATERIALS AND METHODS Bacterial strains and media .
The S. typhimurium LT2 were the wild type and DW378 , which is strains used trpCJ09 cysK1772 cysM1770 and Cys-owing to the lack of both 0-acetylserine sulfhydrylases ( 18 ) .
DW378 carrying a cysK + plasmid is Cys + and was used to carry pRSM28 ( see E. coli K-12 strain C600 is F-thi-J thr-J leuB6 below ) .
The Minimal medium E ( 45 ) was used for tonA21 supE44 A - ( 2 ) .
the growth of S. typhimurium ; E. coli C600 was grown on the minimal-medium of Davis and Mingioli ( 10 ) as modified by Pasternak ( 37 ) , with the pH adjusted to 6.5 .
Both media were prepared with MgCl2 in place of MgSO4 and were supplemented with 0.5 % glucose and either 1.0 mM Na2SO4 , 0.5 mM L-cystine , or 0.5 mM L-djenkolic acid as a sulfur source .
Amino acids at 40 mg/liter and thiamine hydrochloride at 4 mg/liter were included where appropriate for the growth of auxotrophs .
Rich media consisted of LB for plasmid transformations and YT for bacteriophage M13 transformations and phage production ( 28 ) .
Solid media contained 1.5 % agar .
When required , ampicillin was used at 25 mg/liter .
Plasmids and DNA sequencing .
pBR322 derivatives carrying the cysK genes of E. coli and S. typhimurium are shown in Fig. 1 .
Plasmid pAB101 was constructed by Boronat et al. ( 6 ) and contains a 4.32-kilobase ( kb ) BamHI-HindIII insert from the E. coli chromosome that includes cysK , ptsH , and a portion of ptsI .
The cysK gene was shown by these authors to contain a HindIlI site , with about 90 % of the gene situated on the 1.62-kb BamHI-HindIII fragment ( Fig. 1 ) .
A total of 2,595 nucleotides were sequenced from this insert beginning at the BamHI site on one side of cysK and extending to a PvuII site on the other side of cysK .
Plasmid pRSM28 contains a 4.65-kb S. typhimurium chromosomal fragment which was obtained from a partial Sau3A digest and inserted at the BamHI site of pBR322 ( 29 ) .
pRSM28 also carries cysK , ptsH , and ptsI and has a HindIII site within the cysK gene ( 17 ) .
We sequenced 4,087 nucleo-tides of pRSM28 beginning at the pBR322 Sall site and extending to the first EcoRI site of the insert , for a total of 3,812 nucleotides of S. typhimurium DNA .
DNA sequencing was done by the dideoxy-chain termination method ( 42 ) with either [ a-35S ] dATP purchased from the Du Pont Co. for the S. typhimurium analyses or [ a-32P ] dATP obtained from BRESA ( Adelaide , Australia ) for the E. coli studies .
Single-stranded templates were generated from de-rivatives of M13 phage ( 26 ) .
For the E. coli sequence , restriction endonuclease fragments were subcloned into the multiple cloning site ; for the S. typhimurium sequence , overlapping fragments were generated by the method of Dale et al. ( 9 ) .
Both DNA strands were sequenced , and for approximately 90 % of the sequence , a minimum of two different templates were used ( strategies not shown ) .
RNA was prepared by the method of Aiba et al. ( 1 ) from bacteria grown on minimal-medium containing either L-cystine , sulfate , or L-djenkolic acid as the sole sulfur source .
The methods of Hudson and Davidson ( 16 ) were used to generate single-stranded DNA probes that were radiolabeled internally with either 35S or 32P and to analyze the 5 ' end of cysK mRNA by either S1 nuclease protection or the technique of primer-extension .
O-Acetylserine ( thiol ) - lyase A was purified from S. typhimurium by the method of Becker et al. ( 4 ) .
An amino-terminal analysis was performed with an Applied Biosystems model 470A gas-phase protein sequencer ( 20 ) , as described previously ( 27 ) .
Carboxyl-terminal analysis was performed by digestion of 0.8 mg of O-acetylserine ( thiol ) - lyase A with 1.6 jig of carboxypeptidase A ( Sigma Chemical Co. ) at 37 °C in 0.2 ml of 0.01 M N-tris ( hydroxymethyl ) methyl-2-aminoethane-sulfonic acid ( pH 7.5 ) -0.5 M NaCl .
At 5-to 10-min intervals , 0.04-ml portions were removed , deproteinized , and analyzed for free amino-acids as described elsewhere ( 27 ) .
Recombinant DNA methods were those of Maniatis et al. ( 25 ) , with enzymes purchased from Be-thesda Research Laboratories , Inc. , New England BioLabs , Inc. , BRESA-Australia , Boehringer-Mannheim Biochemicals , and Pharmacia .
Analysis of peptide hydrophilicity was performed as described elsewhere ( 15 ) .
315 EcoRl Hindl EcoKl bamH/SouJA EcoRI ECORI KpnI 0b .6 0.58 kb Pv .0 bpABlOJ 0.97 kb ~ KpnI Hindl 1.62 kb 5 u k 6 RS 4 k RESULTS Open frames of 323 codons were found reading beginning at position 1255 for the S. typhimurium sequence and at position 777 for that of E. coli ( Fig. 2 ) .
Both were preceded by the Shine-Dalgarno sequence AAGGA ( 43 , 44 ) and included HindIII sites known from previous studies to lie within the cysK coding regions ( 6 , 17 ) .
The DNA sequence identity for these open reading frames was 85 % , with 127 of the 143 differences occurring in codon position 3 .
Of a total of 132 nonidentical codons , all but 13 were synonymous , giving deduced amino-acid sequences that were 96 % identical .
As expected , many of the amino-acid differences were conservative .
Amino acid sequence analyses of purified S. typhimurium O-acetylserine ( thiol ) - lyase A established that these open reading frames represent the cysK coding region .
The amino-terminal sequence was found to be H2N-Ser-Lys-Ile - ?
- Thr-Pro-Leu-Val - , for which the identity of residues 4 and 13 could not be determined with certainty .
The 15 residues that were identified correspond exactly to those deduced from the S. typhimurium DNA sequence ( Fig. 2 ) , assuming the removal of the initiator Met residue by posttranslational processing .
A carboxylterminal amino-acid sequence of-Leu-Gln-Gln-CO2H was found , which also corresponds to the deduced sequence .
In addition , previously published amino-acid compositions and subunit molecular weights of purified O-acetylserine ( thiol ) - lyase A from S. typhimurium ( 4 ) and E. coli ( 6 ) are very close to those expected from the DNA sequences .
Overlapping single-stranded DNA probes spanning a region from 217 nucleotides 3 ' to the translation start codon to 432 nucleotides 5 ' to the start codon were isolated from the E. coli cysK gene and tested for the ability to prime reverse transcriptase-directed DNA synthesis with E. coli mRNA as template .
Only one probe , which was derived from the region 217 to 28 nucleotides 3 ' to the ATG start site , was active in primer-extension experiments .
Estimation of the size of the major extension product ( Fig. 3A ) permitted the assignment of the transcription start site to the G residue 32 nucleotides upstream of the translation start site ( Fig. 2 ) .
Sizing gels also showed minor primer-extension products consistent with transcription start sites 2 and 35 nucleotides upstream of the major start site .
The S. typhimurium cysK transcription start site was mapped by S1 nuclease protection .
S. typhimurium mRNA was annealed to a radiolabeled single-stranded cysK DNA probe extending 203 nucleotides upstream from a site 26 nucleotides 3 ' to the translation start site .
DNA fragments of 60 + 4 and 130 ± 2 nucleotides were protected from Si nuclease digestion ( Fig. 3B ) , indicating the existence of two transcription initiation sites .
Our best estimate is that the major site is 33 nucleotides upstream of the translation start site while the other is an additional 70 nucleotides upstream and is different from the minor site found for the E. coli cysK gene ( Fig. 2 ) .
The 32 nucleotides preceding the initiation codon were identical in the two cysK genes .
In both sequences , TATGCT preceded the major transcription start site by 8 nucleotides in E. coli and by 6 nucleotides in S. typhimurium and was a logical choice for the -10 element of the cysK promoter .
The -35 region consisted of the TTCCGC sequence in E. coli and the nearly identical TTCCCC sequenc in S. typhimurium .
Each region was separated from the -10 region by 16 nucleotides , 9 of which were nonidentical .
Regulation of cysK transcription .
O-Acetylserine ( thiol ) - lyase A and the other activities of the cysteine regulon are repressed by growth on L-cystine and maximally derepressed by growth on a limiting sulfur source ( 21-23 ) .
To determine whether these effects on O-acetylserine ( thiol ) - lyase A are mediated at the level of transcription , we performed primer-extension analyses ( for E. coli ) and S1 nuclease protection experiments ( for S. typhimurium ) with RNA isolated from cells grown on minimal-medium containing either L-cystine or the limiting sulfur source L-djenkolic acid .
Using strains lacking plasmids to evaluate the expression of chromosomal genes , we found for both E. coli and S. typhimurium that levels of cysK mRNA originating from the major promoter were very high in sulfur-limited cells and almost undetectable in bacteria grown on L-cystine ( Fig. 3A and B , lanes 1 and 2 ) .
Interestingly , this inhibitory effect of L-cystine was relatively small in E. coli cysK + ( pAB101 ) ( Fig. 3A , lane 5 ) , whereas expression from the major promoter was normally repressed in L-cystine-grown S. typhi-murium cysK + ( pRSM28 ) ( Fig. 3B , lane 4 ) .
In E. coli , expression from the minor transcription start site located 35 nucleotides upstream from the major start site was unaffected by the sulfur source used for growth and was very low in the strain carrying pAB101 .
Expression from the minor upstream promoter in S. typhimurium was also unaffected by growth on different sulfur sources but appeared to be severa times greater in the strain carrying pRSM28 than in the plasmid-free strain ( Fig. 3B , lanes 3 and 4 versus lanes 1 and 2 ) .
These findings are consistent with the results of Boronat et al. ( 6 ) , who noted the incomplete repression of O-acetyl-serine ( thiol ) - lyase A activity by L-cystine in strains carrying pAB101 , and with similar results obtained from analyses of S. typhimurium strains carrying pRSM28 ( data not shown ) .
It is interesting that in E. coli this cysK plasmid effect is due to a lack of repression at the major cysK promoter , while in S. typhimurium , most of the unregulated cysK expression appears to originate from a minor upstream promoter .
Sequences upstream of cysK .
The DNA sequence upstream of the S. typhimurium cysK gene contains a 290-codon open reading frame beginning at nucleotide position 219 ( Fig. 2 ) .
The potential Shine-Dalgarno sequence TAAAGATG is complementary to the 3 ' terminus of 16S rRNA at six of eight positions ( 43 ) and is separated from the ATG codon at position 219 by seven nucleotides .
No other in-frame ATG , GTG , or TTG codon in the open reading frame was preceded by less than 12 nucleotides by sequences characteristic of a ribosome-binding site .
The shorter E. coli sequence began with an open reading frame that was very similar to the final 192 codons of the S. typhimurium sequence .
The deduced amino-acid sequences over this region differed at only 17 positions , suggesting that these open reading frames code for homologous peptides .
There were 163 nucleotides separating this open reading frame from cysK in S. typhimurium and 183 nucleotides in E. coli .
Sequences downstream of cysK .
Open reading frames representing the entire ptsH gene and part of ptsI were found downstream from cysK in both species ( Fig. 2 ) .
In S. typhimurium , ptsH was identified as an open reading frame of 85 codons beginning at nucleotide 2610 , which gave a deduced amino-acid sequence identical to that determined for the S. typhimurium ptsH gene product , the phosphocarrier protein HPr ( 38 , 46 ) .
The corresponding E. coli DNA sequence agreed with that reported by De Reuse et al. ( 11 ) and by Saffen et al. ( D. W. Saffen , K. A. Presper , T. L. Doering , and S. Roseman , J. Biol .
Chem. , in press ) and was 95 % identical to that of S. typhimurium .
All 12 nonidentical codons were synonymous , giving the same deduced amino-acid sequence for HPr in both species .
For both E. coli and S. typhimurium , the coding portions of cysK and ptsH were separated by 383 nucleotides , which contained sequences resembling a rho-independent terminator ( 40 ) beginning at 29 nucleotides after the cysK terminator codon ( Fig. 2 ) .
The sequence identity for this intergenic region was 87 % , with only two differences occurring in the 83 nucleotides immediately preceding ptsH .
ptsH and ptsI were separated by 48 nucleotides in S. typhimurium and by 44 nucleotides in E. coli .
The open reading frame representing the S. typhimurium ptsI gene began at nucleotide 2916 and extended for a total of 299 codons until interrupted at the EcoRI site at the end of our sequence ( Fig. 2 ) .
Saffen et al. ( in press ) have sequenced the entire ptsI gene of E. coli and found that it has a total of 575 codons .
A comparison of the first 299 amino-acids for the two deduced sequences revealed only 13 differences , giving an amino-acid identity of 96 % ( data not shown ) .
Our E. coli sequence included only the first 54 codons of ptsI and was nucleotides upstream of the translation start site , respectively .
The lower elements of the ladder effect could be eliminated by using less Si nuclease , and the higher elements were much less pronounced with larger amounts of S1 nuclease ( results not shown ) identical to that determined by Saffen et al. ( in press ) .
There were only 8 nucleotide differences in the 162-nucleotide region common to both sequences ( Fig. 2 ) , and only 1 difference gives a nonsynonymous codon .
k 1.7 kb 4.36 kb p M28 Hindi S Sol BornHl BomHl/Sou3A FIG. 1 .
Plasmids carrying cysK from E. coli and S. typhimurium .
Symbols : , pBR322 portions ; m1 , portions of the inserts that were sequenced .
pAB101 contains a 4.32-kb insert from E. coli K-12 , which has a HindIll site that lies within cysK ( 6 ) .
pRSM28 contains 4.65 kb-insert from S. typhimurium ( 29 ) , and it , has a too , a HindIlI site in cysK ( 17 ) .
Sau3A * * * * * 60 * * * * * 120 ( S.t. ) GAkTCGTTCTT ACGGCTGGTlhCMTGTACC AGTAA AGCG ; ATTATGGAT GCGCCAACATGATTATATCACTGCACTCTaTTATATTCCGTTCAC * * * * * 180 * * * * * 240 SDBa .
) CG T G T G DA ( E. c. ) CGCTGGTTCGCCTGAATCGCATCGG * * * * * * 1480 * * * * * 1540 krgGlyValLeuLysProGlyValGluLeuValGluercoThrAsnGlyAsnThrGlyllelaLsuAlaTyrValAlalaAlaA , ArgGlyTyrLyJLeuThrLeuThrettProGluThr ( S.t. ) GTGGTCT TACC ( E. c. ) GC GG CG CGT AAC Ser * * * * * 1600 * * * * 1660 MetSerIleGluArgArgLysLeuLeuLysAlaLeuGlykl & AsnLeuValLeuThrGluGlyAlaLysGl ~ yM * tLysGlyAlaIleGlnLysAlaGluGluIleVaLAUaSerAspPro ( S.t. ) T ; AGCATTG AACCCAGCTAC TTCGE TGTGC ( E. c. ) TGAGTATTG A CGT G G Asn * * * * * 1720 * * * * * 1780 GlnLysTyrLeuLeuleuGlnGlnPheSerA8nProAlaAsnProGluIleHi8GluLysThrThrGlyProGluIleTrpGluAspThrAspGlyGlnValAspvalPhoIleSerGly ( S.t. ) AAAAT TG TCAGCAG ( E. c. ) AGAAATACCTGCTG CTGCAAAATCGC : TCGCAACCTGAAATTCACCGAACACCGGTCCCGGGTATCGATCGACGGC GTGTGTATTATTGAClTaGGCG Glu * * * * * 1840 * * * * * 1900 ValGlyThrGlyGlyThrLeuThrGlyValThrArgTyrI leLysGlyThrLysGlyLysThrAspLeuIleThrValAlaValGluProThrAspS , erProVa , lIleAlaGlnAlaLau ( S.t. ) T CGCC CGC ( E.c. ) TT AC CGGTACG CTCTACATTAAGn.CTCTTATCTCTGTCG CAGACCGTTCTCCAG Trp Pro Ser FIG. 2 .
Nucleotide sequences of the cysK regions of S. typhimurium and E. coli .
The S. typhimurium sequence begins at the BamHI-Sau3A site located 275 nucleotides from the pBR322 Sall site in pRSM28 and ends at an EcoRI site .
A HindIII site is present at position 2120 .
The E. coli sequence begins at the BamHI site in pAB101 and ends at a PvuIl site .
The two sequences have been aligned to maximize identity , and only the S. typhimurium sequence is numbered .
Complete deduced amino-acid sequences are given for S. typhimurium ; only differences are shown for E. coli .
An unidentified open reading frame of 290 codons begins at nucleotide 219 of the S. typhimurium sequence .
The open reading frame coding for cysK begins at nucleotide 1255 and ends at nucleotide 2226 .
Shine-Dalgarno ( SD ) sequences for both are indicated .
The major transcription initiation site for cysK is at nucleotide 1222 for S. typhimurium and at nucleotide 1224 for E. coli ( vertical arrows ) .
The -10 and -35 regions for this promoter are shown in bold type and are underlined .
Open reading frames for ptsH and ptsl begin at positions 2610 and 2916 , respectively .
A region of dyad symmetry that may represent a rho-independent transcription terminator ( ... ) is shown following the cysK coding region .
lTTC ... I ) ACGTGATATTGGSW ; CGCC ~ ~ ~ ~ ~ ~ TGCTGCGCAACATCCT * * * * * 1960 * * * * * 2020 ( S.typh AlaGlyGluGluIleLysProGlyProHisLysloeGlnGlyIledlyAlaGlyPheIleProGlyAsrSuAmUpIALySLOuIlepLysValValGlyIloThrAsnnGluGluAla ( E.coli Ala Val Iie * * * * * 2080 * * * U * ( S.typhk ) G A ; A l iSCeTWSTeTCrThrAlaArgArgLeuMbtGluGluGluValPhoLuklaGlylleSerSorGlyAlaAlValAlaAladaXuLy `` LuG ] lnGluAapGluSerPh * ThrAaiLyanIle Ai 2140 ( E. coli TCTCT A GlyIle * * * * * 2200 * Cy - > I * ValValIleLAuProSerSerG1byG1uArgTyrLeuSerThrAaLeuphA1aAgpLeupheThrGuLyaGluLsuG1nGlnTer ( S. typh ( E. coli * * 2260 * * * * * * * * * * 2320 AI = 2380 ( S.typh I ) > = ( E. coli MTT m C AA ' A TA T A l a * * a a * * 2440 * * * 2500 ( S.typh ( E. coli * * 2560 * * * * pt - > 2620 M & tPh * GlnGln ASGC 6 % T C T * * * ( S.typh ( E. ooli .
) = C T7TTAAAACTGCOC * a * * * 2680 * * * * * 2740 GluValThrIleThrAlaProAaGyLouHiz8ThrArgProAlAlaA1GlnphgValLyaGluAlaLyaGlyPheThrSerGluIleThrvalThrSorA & nGlyLysSerAlaSorAla ( S.typh ( E. coli .
A ) AAGTACTACGCT = TCGRACGGTCAA * * * * * 2800 * * * * * 2860 LyaSerLeuPheLyaLeuGlnThrIouGlyLeuThrGlnGlyThrValValThrIloSerAlaGluGlyGluAspGluGlnLYaAlavalGluHisLeLuValLysLAuMthtl GluLau ( S.typhl ( E. ooliI * a * * * 2980 GluTer MatIleSerGlyIlleLuAlaSerProGlyIleAlaPheGlyLysalaLeuLeuLouLyaGluAap ( S.typh CGAGTAAGTTTTCOGGTTC ( E. coli .
M os ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ O. ... ... FIG. 3 .
Analyses of in-vivo transcription initiation for cysK .
( A ) The E. coli gene was analyzed by primer-extension with a probe derived by the method of Hudson and Davidson ( 16 ) from the M13 phage derivative that was used as a template in the sequencing reaction shown in lanes A , G , C , and T .
The probe has the same nonphosphorylated 5 ' end as the fragments in the sequencing lanes ; the 3 ' end of the probe the was product of an MboII digest and corresponds to the base complementary to nucleotide 1283 in Fig. 2 .
Thus , the sequencing lanes show the strand that is complementary to that presented in Fig. 2 .
Primer extension was carried out after the probe was annealed to RNA isolated from strain C600 grown on L-djenkolic acid ( lane 1 ) or L-cystine ( lane 2 ) , strain C600 grown on L-djenkolic acid but lacking revese transcriptase ( lane 3 ) , and C600 ( pAB101 ) grown on L-djenkolic acid ( lane 4 ) or L-cystine ( lane 5 ) .
Identical amounts of RNA and primer were used in each reaction .
P , Position of the primer itself .
The positions of the major extension product and minor product indicated by large and small a are arrows , respectively , and correspond to transcription sites located 32 and 67 nucleotides upstream of the translation start site , respectively .
It is not known whether the minor product located two nucleotides upstream from the major product and those at several downstream positions represent additional start sites or are artifacts of the primer-extension reaction .
( B ) The S. typhimurium gene was analyzed by S1 nuclease protection with a probe annealed to RNA isolated from wild-type LT2 grown on L-djenkolic acid ( lane 1 ) or L-cystine ( lane 2 ) and wild-type LT2 ( pRSM28 ) grown on L-djenkolic adic ( lane 3 ) or L-cystine ( lane 4 ) .
Identical of probe and amounts RNA were used in each reaction .
Lane G is a sequencing lane from an unrelated template and was used as a size reference , taking into account the fact that the 5 ' termini of sequencing fragments are nonphosphorylated .
The large and small arrows indicate the positions of major and minor protected fragments , respectively , which correspond to transcription initiation sites located 33 and 103 +3 hydrophilic ¬ +2 ¬ +1 DISCUSSION 0 Genetic mapping data and analyses of cloned genes give the order cysA gsr ptsI ptsH cysK cysZ dsd in E. coli ( 6 , 7 ) and cysA cysM crr ptsI ptsH cysk dsd in S. typhimurium ( 17 , 32 ) , where the crr of S. typhimurium is equivalent to the gsr of E. coli .
Comparison of deduced amino-acid sequences with those obtained from our analyses of purified O-acetyl-serine ( thiol ) - lyase A established with certainty the identity of the S. typhimurium and E. coli cysK genes in our DNA sequences .
ptsH and ptsI were also readily identified through comparison with DNA and protein sequences from other laboratories ( 11 , 46 , 47 ; Saffen et al. , in press ) , thus allowing us to establish the exact relationship between cysK , ptsH , and ptsl .
Our deduced amino-acid sequence for the first 299 residues of S. typhimurium ptsl was similar to that deduced for E. coli ptsl ( Saffen et al. , in press ) but differed at positions 3 and 8 from the amino-terminal analysis reported for purified S. typhimurium enzyme I ( 47 ) .
For both positions , the peptide analysis gives an arginine , but the DNA sequence specifies a serine .
Since our DNA sequencing gels clearly showed TCA and TCC codons and since the E. coli deduced sequence also shows serines at these positions , we believe the S. typhimu-rium deduced sequence is correct .
A comparison of the DNA sequence preceding the S. typhimurium crr gene reported by Nelson et al. ( 32 ) with that of ptsl from E. coli ( Saffen et al. , in press ) indicates that the former includes the carboxyl-terminal 54 codons of the S. typhimurium ptsI gene , which were separated from the initiation codon of crr by 40 nucleotides ( data not shown ; 32 ; Saffen et al. , in press ) .
The S. typhimurium sequence of Nelson et al. ( 32 ) was obtained from an EcoRI-EcoRV fragment , which was separated from the ptsl end of our sequence by a small EcoRI-EcoRI fragment ( see pRSM28 in Fig. 1 and reference 18 ) .
If one assumes that the E. coli and S. typhimurium ptsl coding regions have the same length , i.e. , 575 codons , it follows that the EcoRI-EcoRI fragment in pRSM28 , estimated by gel electrophoresis to be approximately 0.65 kb in length , must consist of 666 nucleotides that specify ptsl codons 300 to 521 .
Parra et al. ( 36 ) have studied a class of E. coli mutants that no longer utilize glucose in preference to lactose but are distinct from gsr mutants .
They have proposed that mutations giving this phenotype define a locus termed iex , which is situated between ptsH and cysZ ( 7 ) .
An examination of restriction endonuclease maps of cloned portions of this region ( see lambda phage isolate 109 in reference 7 ) indicates that iex must lie between ptsH and the BamHI site that marks the beginning of our E. coli DNA sequence .
The absence of an open reading frame of any significant length in the 383 nucleotides separating cysK and ptsH eliminates this region as a possible location for iex .
Furthermore , the long open reading frame upstream of cysK in the S. typhimurium sequence can not be iex , because it lacked an amino-terminal portion in the E. coli sequence .
It seems likely , therefore , that iex is in fact an allele of ptsH , as originally suggested by Britton et al. ( 7 ) .
We have previously shown ( 17 ) that S. typhimurium SB3751 ( 8 ) carries a deletion beginning in the middle of ptsl and extending 4.0 kb past cysK to a point somewhere ~ ~ ~ ~ ~ I 0 100-150-200-250 AMINO ACID RESIDUE FIG. 4 .
Hydrophobicity analysis ( 15 ) of the peptide deduced from the open reading frame upstream of S. typhimurium cysK .
The averaging length was 10 residues .
Three or four very hydrophobic regions are readily apparent .
between the BglI site now known to be at position 125 of our DNA sequence and the HincII site at position 440 .
It follows that the unidentified open reading frame upstream of cysK must not be essential in S. typhimurium , since most or all of it is deleted in SB3751 ; yet this strain has no nutritional requirement other than those expected from the ptsHI genotype .
SB3751 and all other cysK cysM + strains are Cys + owing to the presence of an O-acetylserine ( thiol ) - lyase isozyme encoded by cysM ( 18 , 19 ) .
One possibility is that this open reading frame represents cysZ , a gene required for sulfate transport in-E .
coli but possibly not in S. typhimu-rium , since it has never been identified in the latter despite genetic studies on a large number of sulfate permease auxotrophs ( 33 ) .
This hypothesis is consistent with the data of Britton et al. ( 7 ) , which indicate that cysZ lies within 1.5 kb of cysK in E. coli .
A hydrophobicity analysis of the peptide deduced from this open reading frame is interesting in that it shows three or four very hydrophobic regions , suggesting that the peptide might be a membrane constituent ( Fig. 4 ) .
If this unidentified open reading frame is cysZ , it can not be required for sulfate transport in S. typhimurium under the usual laboratory conditions of growth ( i.e. , 0.8 to 1 mM sulfate ) , because strain SB3751 grows normally on sulfate .
Positive control of O-acetylserine ( thiol ) - lyase A activity and of other elements of the cysteine regulon requires a regulatory protein encoded by cysB and the internal inducer O-acetyl-L-serine ( 21-23 ) .
A likely mechanism is that a complex of cysB protein and O-acetyl-L-serine interacts at or near the cysK promoter to facilitate transcription initiation .
Since the cysB proteins from S. typhimurium and E. coli are virtually identical ( 34 ) , a comparison of the two cysK promoter regions should provide some information regarding sequences ipnportant for regulation .
The conserved -35 sequences TTCCCC and TTCCGC are of interest because of their deviation from the consensus sequence TTGACA ( 14 ) .
This result is in accord with the findings of Raibaud and Schwartz ( 39 ) , who surveyed 31 positively controlled promoters in E. coli and related bacteria and found that most differ significantly from the typical constitutive promoter , particularly in the -35 region .
Additional studies will be required to determine whether the cysB protein specifically recognizes this portion of the promoter or whether it inter acts with the promoter indirectly by binding to a nearby sequence .
The relative insensitivity of cysK transcript levels to repression in E. coli ( pAB101 ) is puzzling but consistent with the findings of Boronat et al. ( 6 ) , who noted that O-acetyl-serine ( thiol ) - lyase activity is repressed 25-fold by A Lcystine in a plasmid-free strain but only 2-fold in a strain carrying pAB101 .
One possible explanation for this effect is that the high repressed level in the plasmid-carrying strain is actually normal for the copy number and that the derepressed level is abnormally low because of a relative lack of cysB regulatory protein .
Instances of this type of activator titration have been reviewed by Raibaud and Schwartz ( 39 ) .
Such a phenomenon is unlikely to account , however , for the insensitivity to repression of O-acetylserine ( thiol ) - lyase A activity in S. typhimurium ( pRSM28 ) .
In this case , levels of cysK transcripts originating from the primary promoter are decreased by growth on L-cystine , and high levels of cysK transcript originate from a secondary promoter that is more active on the plasmid than in the chromosome .
Both instances illustrate some of the problems that can be encountered in studies of the regulation of expression of cloned genes ( 39 ) and emphasize the need for cautious interpretation from studies .
of results obtained such -1 -2 - hydrophobic I I 3k 5 A portion of this work was supported by Public Health Service grant DK12828 and by a Cell and Molecular Biology training grant , GM07184 , both from the National Institutes of Health .
We thank Barney Miller and Richard Randall for the amino-acid sequence analyses , Gina Moreta for technical assistance , and Jacek Ostrowski , Cheryl Hunt , and Richard Loughlin for their many useful suggestions .
Aiba , H. , S. Adhya , and B. de Crombrugghe .
Evidence for two functional gal promoters in intact Escherichia coli cells .
Segregation of new lysogenic types during-growth of a doubly lysogenic strain derived from Esch-erichia coli K12 .
Linkage map of Escherichia coli K-12 , edition 7 .
Becker , M. A. , N. M. Kredich , and G. M. Tomkins .
The purification and characterization of O-acetylserine sulfhydrylase A from Salmonella typhimurium .
Becker , M. A. , and G. M. Tomkins .
Pleiotropy in a cysteine requiring mutant of Salmonella typhimurium resulting from altered protein-protein interactions .
Boronat , A. , P. Britton , M. C. Jones-Mortimer , H. L. Kornberg , L. G. Lee , D. Murfitt , and F. Parra .
Location on the Escherichia coli genome of a gene specifying O-acetylserine ( thiol ) - lyase .
Britton , P. , A. Boronat , D. A. Hartley , M. C. Jones-Mortimer , H. L. Kornberg , and F. Parra .
Phosphotransferase-medi-ated regulation of carbohydrate utilization in Escherichia coli K12 : location of the gsr ( tgs ) and iex ( crr ) genes by specialized transduction .
Cordaro , J. C. , and S. Roseman .
Deletion mapping of the genes coding for HPr and enzyme I of the phosphoenolypruvate : sugar phosphotransferase system in Salmonella typhimu-rium .
Dale , R. M. K. , B. A. McClure , and J. P. Houchins .
A rapid single-stranded cloning strategy for producing a sequential series of overlapping clones for use in DNA sequencing : application to sequencing the corn mitochondrial 18S rDNA .
Davis , B. D. , and E. S. Mingioli .
Mutants of Escherichia coli requiring methionine or vitamin-B12 .
De Reuse , H. , A. Roy , and A. Danchin .
Analysis of the ptsH-ptsI-crr region in Escherichia coli K-12 : nucleotide sequence of the ptsH gene .
Filutowicz , M. , A. and D. Waiter , Hulanicka .
Delayed inducibility of sulfite reductase in cysM mutants of S. typhimu-rium under anaerobic conditions .
Fimmel , A. L. , and R. E. Loughlin .
Isolation and characterization of cysK mutants of Escherichia coli K12 .
Hawley , D. K. , and W. R. McClure .
Compilation and analysis of Escherichia coli promoter DNA sequences .
Hopp , T. P. , and K. R. Woods .
Prediction of protein antigenic-determinants from amino-acid sequences .
Hudson , G. S. , and B. E. Davidson .
Nucleotide sequence and transcription of the phenylalanine and tyrosine operons of Escherichia coli K12 .
Hulanicka , M. D. , C. Garrett , G. Jagura-Burdzy , and N. M. Kredich .
Cloning and characterization of the cysAMK region of Salmonella typhimurium .
Hulanicka , M. D. , S. G. Hallquist , N. M. Kredich , and T. Mojica-A .
Regulation of O-acetylserine sulfhydrylase B by L-cysteine in Salmonella typhimurium .
Hulanicka , M. D. , N. M. Kredich , and D. M. Treiman .
The structural gene for O-acetylserine sulfhydrylase A in Salmonella typhimurium .
Identity with the trzA locus .
Hunkapiller , M. W. , R. M. Hewick , W. J. Dreyer , and L. E. Hood .
High-sensitivity sequencing with a gas-phase sequenator .
Positive control of sulfate reduction in Escherichia coli : the nature of the pleiotropic cysteineless mutants of E. coli K12 .
Jones-Mortimer , M. C. , J. R. Wheldrake , and C. A. Pasternak .
The control of sulphate reduction in Escherichia coli by O-acetyl-L-serine .
Regulation of L-cysteine biosynthesis in Salmonella typhimurium : effects of growth on varying sulfur sources and O-acetyl-L-serine on gene expression .
Kredich , N. M. , and G. M. Tomkins .
The enzymatic synthesis of L-cysteine in Escherichia coli and Salmonella typhimurium .
Maniatis , T. , E. F. Fritsch , and J. Sambrook .
Molecular cloning : a laboratory manual , p. 1-545 .
Cold Spring Harbor Laboratory , Cold Spring Harbor , N.Y. 26 .
New M13 vectors for cloning .
Miller , B. E. , and N. M. Kredich .
Purification of the cysB protein from Salmonella typhimurium .
Experiments in molecular genetics , p. 431-433 .
Cold Spring Harbor Laboratory , Cold Spring Harbor , N.Y. 29 .
Monroe , R. S. , and N. M. Kredich .
Isolation of Salmonella typhimurium cys genes by transduction with a library of recombinant plasmids packaged in bacteriophage P22HT capsids .
Nakamura , T. , H. lwahashi , and Y. Eguchi .
Enzymatic proof for the identity of the S-sulfocysteine synthase and cysteine synthase B of Salmonella typhimurium .
Nakamura , T. , Y. Kon , H. Iwahashi , and Y. Eguchi .
Evidence that thiosulfate assimilation by Salmonella typhimu-rium is catalyzed by cysteine synthase B. J. Bacteriol .
Nelson , S. O. , A. R. J. Schuitema , R. Benne , L. H. T. van der Ploeg , J. S. PlJter , F. Aan , and P. W. Postma .
Molecular cloning , sequencing , and expression of the crr gene : the struc 33 .
Ohta , N. , P. R. Galsworthy , and A. B. Pardee .
Genetics of sulfate transport by Salmonella typhimurium .
Ostrowski , J. , G. Jagura-Burdzy , and N. M. Kredich .
DNA sequences of the cysB regions of Salmonella typhimurium and Escherichia coli .
Parra , F. , P. Britton , C. Castle , M. C. Jones-Mortimer , and H. L. Kornberg .
Two separate genes involved in sulphate transport in Escherichia coli K12 .
Parra , F. , M. C. Jones-Mortimer , and H. L. Kornberg .
Phosphotransferase-mediated regulation of carbohydrate utili-zation in Escherichia coli K-12 : the nature of the iex ( crr ) and gsr ( tgs ) mutations .
Sulfate activation and its control in Escherichia coli and Bacillus subtilis .
Powers , D. A. , and S. Roseman .
The primary structure of S. typhimurium HPr , a phosphocarrier protein of the phosphoe-nolpyruvate : glycose phosphotransferase system : a correction .
Raibaud , O. , and M. Schwartz .
Positive control of transcription initiation in bacteria .
Rosenberg , M. , and D. Court .
Regulatory sequences involved in the promotion and termination of RNA transcrip ¬ 41 .
Sanderson , K. E. , and J. R. Roth .
Linkage map of Salmonella typhimurium , edition VI .
Sanger , F. , S. Nicklen , and A. R. Coulson .
DNA sequencing with chain-terminating inhibitors .
Shine , J. , and L. Dalgarno .
The 3 ' - terminal sequence of Escherichia coli 16S ribosomal RNA : complementarity to nonsense triplets and ribosomal binding sites .
Stromo , G. D. , T. D. Schneider , and L. M. Gold .
Characterization of translational initiation sites in E. coli .
Vogel , H. J. , and D. M. Bonner .
Acetylornithinase of Escherichia coli : partial purification and some properties .
Weigel , N. , D. A. Powers , and S. Roseman .
Sugar transport by the bacterial phosphotransferase system : primary structure and active site of a general phosphocarrier protein ( HPr ) from Salmonella typhimurium .
Weigel , N. , E. B. Waygood , M. A. Kukuruzinska , A. Nakazawa , and S. Roseman .
Sugar transport by the bacterial phosphotransferase system : isolation and characterization of enzyme I from Salmonella typhimurium .