169 , No. 9 metR Gene and quence of the Salmonella typhimurium the metR-metE Control Region Nucleotide S e LYNDA S. PLAMANN AND GEORGE V. STAUFFER * Department of Microbiology , University of Iowa , Iowa City , Iowa 52242 The nucelotide sequence of the Salmonella typhimurium metR gene and the metR-metE control region is presented .
The metR gene codes for a polypeptide of 276 amino-acids with a calculated Mr of 30,991 .
The metR gene product produced in a minicell system was found to migrate with an apparent Mr of 34,000 .
The transcription start sites for the metR and metE genes were determined by mung bean nuclease mapping .
The metR and metE genes are divergently transcribed , with only 25 base pairs separating the transcription start sites .
The overlapping nature of the metR and metE promoters suggests that there may be common regulatory signals for the two genes .
The last step in the synthesis of methionine in Escherichia coli and Salmonella typhimurium is the methylation of homocysteine ( for a review , see reference 10 ) .
This reaction is carried out by either of two transmethylase enzymes .
One is a vitamin-B12-independent enzyme , the metE gene product ; the other is a vitamin-B12-dependent enzyme , the metH gene product .
The methyl group for this reaction is donated by 5-methyltetrahydrofolate , which is produced by the metF gene product .
The metE , metH , and metF genes , as well as all other genes of the methionine pathway , are negatively regulated by the metJ gene product , with S-adeno-sylmethionine as the corepressor ( 14 ) .
In addition , the metE and metF genes are repressed by the metH gene product when cells are grown in a medium containing vitamin-B12 .
Recently we reported the existence of a third methionine regulatory gene , metR ( 17 ) .
The metR gene is closely linked to the metE gene on the E. coli and S. typhimurium chromosomes , and its product is required in trans for expression of the metE and metH genes .
In this paper we present the identification of the S. typhimurium metR gene product , the nucleotide sequence of the metR gene , and an analysis of the metR-metE control region .
MATERIALS AND METHODS Bacterial strains and plasmids .
The S. typhimurium wildtype strain JL781 and the metJ strain JB672 were used for preparing total cellular RNA .
The E. coli K-12 strain GS244 ( pheA905 thi AlacU169 araD129 rpsL AmetR : : Mu ) was used in all transformations and in the preparation of plasmid DNA .
E. coli K-12 strain GS200 is a minicell producer and was obtained from G. Zurawski .
Plasmid pGS47 contains the S. typhimurium metR and metE genes ( 12 ) , and plasmid pGS191 contains the S. typhimurium metR gene ( 17 ) .
The XhoI linker plasmids derived from pGS191 were constructed during this investigation .
Procedures for DNA manipulations were as described previously ( 5 ) .
The XhoI linker mutations in pGS191 were constructed by the method of Heffron et al. ( 3 ) with the modifications of Tatchell et al. ( 15 ) .
The minicell-producing strain GS200 was transformed with plasmid pGS191 and XhoI linker mutant derivatives of this plasmid .
Growth , purification , and labeling of minicells were as described previously ( 2 ) .
The 35S-labeled samples were fractionated on a sodium dodecyl sulfate-12.5 % polyacrylamide gel and examined by autoradi-ography ( 7 ) .
The DNA sequence was determined by the method of Maxam and Gilbert ( 6 ) .
Gel electro-phoresis was carried out by the method of Sanger and Coulson ( 11 ) .
Mung bean nuclease mapping .
The Si nuclease mapping procedure of Weaver and Weissman ( 18 ) was used , except that mung bean nuclease and mung bean buffer ( 30 mM sodium acetate [ pH 4.6 ] , 50 mM sodium chloride , 1 mM zinc chloride , 5 % glycerol ) were used in place of Si nuclease and Si buffer .
A 347-base-pair ( bp ) MluI-Sau3AI fragment that spans the metR and metE promoter regions was labeled at the 5 ' ends with [ y-32P ] ATP and T4 polynucleotide kinase ( 5 ) .
The labeled strands were separated and purified by gel electrophoresis ( 6 ) .
Aliquots of the single strands were hybridized to total cellular RNA isolated from either JL781 carrying pGS47 or from JB672 grown in Luria broth ( LB ) .
E. coli tRNA was used as a source of nonspecific RNA and served as a control .
The single-stranded tails of the RNA-DNA hybrids were digested with 30 to 200 U of mung bean nuclease , and the mung bean-resistant products were fractionated on a DNA sequencing gel next to a sequencing ladder of the original labeled strand .
Restriction enzymes , the large fragment of DNA polymerase I , bacterial alkaline phospha-tase , and XhoI linkers were purchased from Bethesda Research Laboratories , Inc. , Gaithersburg , Md. , or New En-gland BioLabs , Inc. , Beverly , Mass. .
T4 polynucleotide kinase and mung bean nuclease were obtained from Pharmacia , Inc. , Piscataway , N.J. Radionucleotides were from Amersham , Corp. , Arlington Heights , Ill. .
All other chemicals were reagent grade and were commercially available .
RESULTS Isolation of XhoI linker mutations .
Plasmid pGS191 , which contains the metR gene and about the proximal one-third of the metE gene of S. typhimurium ( 17 ) , was subjected to Xhol linker mutagenesis ( 3 , 15 ) .
XhoI derivatives of pGS191 ( pGS191XhoA , pGS191XhoB , pGS191XhoD , pGS19lXho3 , pGS19lXho5 , pGS19lXho6 , and pGS19lXho8 ) were constructed by randomly linearizing pGS191 with DNaseI in the presence of Mn2 , ligating a synthetic 8-bp linker containing the XhoI restriction enzyme site to each breakpoint , generating complementary ends by digestion with XhoI , and recircularizing the molecules with T4 DNA ligase .
The set of mutant plasmids was then used to transform the methionine-requiring metR mutant strain GS244 .
Transformants were selected on nutrient agar plus ampicillin and then tested for their ability to grow on glucose minimal plates ( containing phenylalanine , thiamine , and ampicillin ) with and without a methionine supplement .
Transformants that require methionine were assumed to have an XhoI linker inserted within the metR gene or its control region .
The linker mutations were mapped by digesting plasmid DNA with XhoI and a combination of other restriction enzymes .
A deletion often occurred at the site of the linker , and only plasmids with small deletions ( 50 bp or less ) were selected for further study .
Tatchell et al. ( 15 ) reported the occurrence of deletions at the sites of linker mutations as well .
All linker mutations that inactivate the metR gene were found to lie within a 1.3-kilobase ( kb ) MluI-HindIII fragment ( Fig. 1 ) .
The XhoI linker mutant derivatives of pGS191 were useful not only for the localization of the metR gene in pGS191 but also for the identification of the metR gene product and the isolation of DNA fragments for sequencing the metR gene .
Analysis of plasmid-encoded polypeptides .
To identify the metR gene product , we transformed the minicell-producing strain GS200 with plasmid pGS191 and derivatives of this plasmid that contain XhoI linker mutations at sites that inactivate the metR gene .
The 35S-labeled proteins synthesized by the transformed minicells were separated by electrophoresis on a sodium dodecyl sulfate-polyacrylamide gel and detected by autoradiography ( Fig. 2 ) .
A protein of Mr 34,000 was observed when plasmid pGS191 was used as template ( lanes a and e ) , but not when plasmids containing XhoI linker mutations at sites that inactivate the metR gene were used as templates ( lanes b , c , and d ) .
This suggests that the metR gene product is a polypeptide of Mr ca. 34,000 .
Truncated polypeptides were produced by pGS191XhoD and pGS19lXho5 , most probably owing to frameshift mutations created by the XhoI linker mutagenesis procedure .
The polypeptide produced by pGS19lXho8 is larger than the metR gene product , probably because the frameshift mutation in pGS19lXho8 is located near the end of the metR structural gene .
By comparing the sizes of the polypeptides produced by pGS19lXho8 , pGS191XhoD , and pGS191Xho5 with the approximate sites of the XhoI linker mutations , we were able to predict the direction of transcription of the metR gene ( Fig. 1 ) .
A physical map of the 2-kilobase SalI-HindIll fragment of pGS191 and the locations of the XhoI linker mutations within this fragment are shown in Fig. 1 .
The XhoI linker mutant derivatives of pGS191 provided convenient XhoI restriction sites for the isolation of fragmeent fo D ~ s ~ r ~ NA sequencing .
The pGS19lXho plasmids were cleaved with the restriction enzyme XhoI , labeled at the 5 ' or 3 ' end , and then cleaved with two restriction enzymes ( usually MluI and HindIll ) to generate two end-labeled fragments for DNA sequencing .
The DNA sequence of both strands of the metR gene and the metR-metE control region was determined and is shown in Fig. 3 .
Location of the transcription start sites for the metR and metE genes .
The studies involving the use of XhoI linker mutagenesis to localize the metR gene and identify the metR gene product indicated that the metR control region would probably be found on a 347-bp MluI-Sau3AI fragment .
In addition , DNA sequencing studies showed that an open reading frame extending toward the Sau3AI site initiates within this fragment .
Preliminary mung bean nuclease mapping experiments indicated that the transcription start site of the metE gene is located within this fragment as well .
A mung bean nuclease mapping procedure ( see Materials and Methods ) was used to map the transcription start sites of the metR and metE genes with the MluI-Sau3AI fragment as a hybridization probe .
The results of this experiment are shown in Fig. 4A and B ( metR and metE , respectively ) .
Each gene has two transcription start sites .
The start sites for metR are separated by 2 bases ; the start sites for metE are separated by 1 base .
The positions of the transcription start sites are the same whether the RNA for hybridization is isolated from a wild-type strain containing the multicopy metR-metE plasmid pGS47 ( lane 1 ) or a metJ mutant strain with no plasmid ( lane 2 ) .
The most likely transcription start sites for the metR and metE genes are shown in Fig. 3 .
The metR and metE genes are divergently transcribed , with only 25 bp separating the transcription start sites .
393 XhoB Sal Ill FIG. 1 .
Plasmid pGS191 and the locations of the XhoI linker mutations in pGS191 that inactivate the metR gene ( pGS19lXhoA , pGS19lXhoB , pGS19LXhoD , pGS19lXho5 , pGS19lXho6 , and pGS 191Xho8 ) .
Details of the constructions are given in Materials and Methods and in Results .
All linker mutations that inactivate the metR gene were found to be within a 1.3-kilobase MluI-HindIII fragment .
The location of the metE gene is also shown ( 12 ) .
Symbols : - k , directions of transcription for the metR and metE genes ; * , the truncated end of the metE gene ; , pBR322 vector .
The direction of transcription for the metR gene was determined by comparing the sizes of the polypeptides produced by pGS19lXho8 , pGS19LXhoD , and pGS19LXho5 ( Fig. 2 ) with the sites of the XhoI linker mutations .
A B C D E - 3 - , w op 34 ~ 28 a ¬ FIG. 2 .
Sodium dodecyl sulfate-polyacrylamide gel electropho-resis of proteins synthesized and labeled in a minicell system .
Templates : lanes a and e , pGS191 ; lane b , pGS19LXho8 ; lane c , pGS191XhoD ; lane d , pGS19lXho5 .
All plasmid derivatives of pGS191 contain XhoI linker mutations at sites that inactivate the metR gene .
The location of each linker mutation was determined by restriction endonuclease mapping and is shown in Fig. 1 .
The Mr 34,000 polypeptide is the metR gene product .
The Mr 28,000 that in all lanes is vector-encoded P-lactamase .
polypeptide appears The thin arrows indicate the polypeptides produced by the XhoI derivatives of pGS191 .
The DNA sequence and deduced amino-acid sequence of the S. typhimurium metR gene and the DNA sequence of the metR-metE control region .
The most likely -10 region , -35 region , Shine-Dalgarno sequence ( SD ) , and transcription initiation sites for the metR gene are indicated above the DNA sequence ; those for the metE gene are indicated below the DNA sequence .
Symbols : C , possible metJ operator region with partial homology to the tandemly repeating palindrome 5 ' - AGACGTCT-3 ' proposed by Belfaiza et al. ( 1 ) to be the metJ repressor-binding region ; * , region of dyad symmetry in the metE leader sequence .
Amino acid sequence and composition .
The DNA sequence presented in Fig. 3 has a major open reading frame extending from positions 42 to 869 .
This open reading frame codes for a 276-amino-acid polypeptide , the presumed metR gene product .
The AUG initiator codon is preceded by a good Shine-Dalgarno sequence ( 13 ) located near position 33 .
The amino-acid composition of the metR gene product , as deduced from the DNA sequence , is given in Table 1 .
The calculated molecular weight of the metR gene product is 30,991 , compared with 34,000 estimated from sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the metR gene product .
The codon usage for the metR gene is presented in Table 2 .
A comparison of the codon usage of the metR gene with the codon usage of strongly and moderately to weakly expressed genes in E. coli indicates that metR is a moderately to weakly expressed gene ( 4 ) 620-640-660 Leu Ile Tyr Pro Val Gln Arg Ser Arg Leu Asp Val Trp Arg His Phe Leu Gln Pro Ala Gly Ile Ser TTG ATT TAC CCG GTG CAG CGC AGC CGA CTG GAT GTC TGG CGA CAT TTC CTG CM CCG GCG GGT ATC AGT 680-700-720-740 Pro Leu Leu Lys Ser Val Asp Asn Thr Leu Leu Leu Ile Gln Met Val Ala Ala Arg Net Gly Ile Ala CCG CTG CTG MAA AGC GTG GAT MT ACG CTA CTG CTG ATT CAG ATG GTG GCG GCC AGA ATG GGT ATT GCC 760-780-800 Ala Leu Pro His Trp Val Vai Glu Ser Val Glu Arg Gln Gly Leu Val Val Thr Lys Thr Leu Gly Asp 0CC CTG CCG CAC TGG GTG GTG GM AGC GTT GAG CGC CAG GGT CTG GTG GTG ACC AM ACC CTT GGC GAT 820-840-860 Gly Leu Trp Ser Arg Leu Tyr Ala Ala Val Arg Asp Ala Thr Ser Val Arg Arg END 880 GGT CTG TGG AGC CGC CTG TAT GCC GCC GTG CGC GAC GCG ACC AGC GTC AGG CGG TGA CCGAGGCGTTTATTCGCTC 900-920-940-960 980 GACGCGGGATCACGCCTGCGATCATCTGCCGTTTGTGCGGAGCGCGGAGCGACCCATTTTCGATGCACCCACAGCGAAGCCAGGATCACAGCC FIG. 3 .
The DNA sequence and deduced amino-acid sequence of the S. typhimurium metR gene and the DNA sequence of the metR-metE control region .
The most likely -10 region , -35 region , Shine-Dalgarno sequence ( SD ) , and transcription initiation sites for the metR gene are indicated above the DNA sequence ; those for the metE gene are indicated below the DNA sequence .
Symbols : C , possible metJ operator region with partial homology to the tandemly repeating palindrome 5 ' - AGACGTCT-3 ' proposed by Belfaiza et al. ( 1 ) to be the metJ repressor-binding region ; * , region of dyad symmetry in the metE leader sequence .
DISCUSSION We have shown that the metR and metE genes are divergently transcribed , with only 25 bp separating the transcription start sites for the two genes .
The most likely -10 and -35 regions for the metR and metE genes are indicated in Fig. 3 .
The -35 region of the metR gene overlaps with one of the transcription start sites for the metE gene , and the -35 region of the metE gene overlaps with one of the transcription start sites for the metR gene .
This situation resembles that of the ilv Y and ilvC genes in E. coli ( 19 ) .
The promoters for these two genes overlap , and the gene for the positive activator ( ilv I ) is transcribed divergently from the gene it activates ( ilvC ) .
Although the mung bean mapping procedure is not strictly quantitative , it is interesting that the band intensities in lane 2 ( both A and B ) are greater than the band intensities in lane 1 .
Thus it appears that more metR and metE transcripts are produced in a metJ mutant ( no methionine repressor ) than in a wild-type strain containing multiple copies of metR and metE when the cells are grown in LB .
These results suggest that transcription of both genes is repressed by the metJ gene product .
Belfaiza et al. ( 1 ) proposed that the E. coli metJ repressor-binding region may be composed of tandemly repeating 8-bp palindromes which vary in their frequency of repetition and degree of homology to the consensus sequence 5 ' - AGAC GTCT-3 ' .
Urbanowski et al. ( 16 ) isolated mutations in the S. typhimurium metB control region which affect the regulation of metB by the metJ repressor .
These mutations were found to lie in a region that contains three imperfect tandem repeats of the above consensus sequence .
Tandem repeats of the 8-bp sequence were also found in the metR-metE control region ( Fig. 3 ) .
These three repeats span the transcription start sites of metE and the -35 region of metR .
Two of the repeats have five of eight bases in common with the consensus sequence ; one is identical .
Whether this repeated sequence is involved in metJ-mediated repression of metE ( and possibly metR ) is currently under investigation .
The S. typhimurium metE AUG initiator codon at position -208 ( Fig. 3 ) was confirmed by an amino-acid sequence analysis of the N terminus of the E. coli metE gene product ( H. Weissbach , personal communication ) .
Of the first 13 amino-acids of the E. coli metE polypeptide , 12 are identical to the amino-acid sequence of the S. typhimurium metE gene product deduced from the nucleotide sequence .
The results of the mung bean mapping experiment show that in-vivo transcription of metE initiates approximately 180 bases upstream of the AUG initiator codon .
This is in contrast to our previously published in-vitro-transcription results ( 12 ) .
These in-vitro studies indicated that transcription initiates near the metE AUG initiator codon at two sites separated by approximately 20 bases .
In addition , we showed that RNA polymerase protects two Hinfl sites in the region containin these in-vitro promoters from attack by Hinfl endonuclease .
Transcription from this region not detected in-vivo by was the mung bean mapping experiment .
It is not clear why the in-vitro-transcription results differ from the mung bean mapping results .
It is possible that transcription from the in-vivo promoter occurs only in the presence of the metR gene product , which was not present in the in-vitro-transcription studies .
Although our mung bean mapping results do not show transcription from the in-vitro promoters , it is possible that these promoters are used in-vivo under conditions that not tested .
The results of the in-vitro-transcription were experiments did indicate that is transcribed in a gene a direction opposite to that of the metE gene .
This in-vitro transcript was mapped to the region where metR transcription was found to initiate in-vivo .
The metE mRNA leader sequence contains a region of extensive dyad symmetry with its center between positions -109 and -110 ( Fig. 3 ) .
We are currently investigating the role that this symmetrical region may play in the regulation of metE expression .
gene How the metR product activates the metE and metH gene genes has not been determined ; however , there are many examples of positive activation in which the activator protein binds just upstream of or within the -35 region of a gene VOL .
169 , 1987 SALMONELLA TYPHIMURIUM metR GENE TABLE 1 .
Amino acid composition of the metR gene product B A Amino acid No .
of residuesa A 1 Ala. .
25 Arg ... 20 Asn ... 5 Asp ... 12 Cys ... 3 .
f.c 4n # AM # 114 - d ii .
s , 23 Gln W ip .
Pro ... 41 6 6 10 17 R A A Ai .
-1 PE T. O Ser ... 21 Thr ... 15 Trp ... 5 Tyr ... 3 Val ... 20 cA .
cA A T T T A ~ J ~ a The sequence is 276 amino-acids long ; Mr , 30,991 .
G 4U0 T40 FIG. 4 .
Locations of the 5 ' ends of metR and metE mRNA .
A 347-bp MluI-Sau3AI fragment carrying the control region for both the metR and metE genes was labeled at the 5 ' termini with 32p , the strands were separated , and each strand was hybridized to total cellular RNA isolated from JL781 carrying plasmid pGS47 ( lane 1 ) or JB672 ( lane 2 ) .
E. coli tRNA was used as a source of nonspecific RNA and served control ( not shown ) .
The single-stranded tails as a of the RNA-DNA hybrids were digested with mung bean nuclease , and the nuclease-resistant products were run on a DNA sequencing gel next to a sequencing ladder of the original labeled strand .
( A ) Location of the 3 ' ends of the protected metR DNA probe corresponding to the 5 ' termini of metR mRNA ; ( B ) location of the 3 ' ends of the protected metE DNA probe corresponding to the 5 ' termini of metE mRNA .
The activator molecule then makes contacts with RNA polymerase to facilitate transcription .
Although this is the most common mode of positive activation , the metR gene product may use an alternative mechanism .
For example , the metR gene product could act as a sigma factor or as an antiterminator of metE and metH transcription .
It is also possible that the rnetR gene product acts in a less direct manner by influencing the synthesis or degradation of a metabolite that is directly involved in metE and metH gene expression .
The overlapping nature of the metR and metE promoters suggests that there may be common regulatory signals for the two genes .
The metE gene is regulated in trans by the metJ and metH gene products ( 10 ) and by the metR gene product ( 17 ) .
If these regulatory proteins bind near the metE promoter region , they may affect the expression of the metR gene .
It is also possible that the overlapping metR and metE promoters compete for RNA polymerase , resulting in reciprocal regulation of the two genes .
It should be noted , however , that proteins may recognize overlapping DNA sequences but bind to different faces of the helix ( 8 ) .
Mutational analysis and in-vitro binding studies are necessary to understand the interactions that occur at the metR-metE control region .
of Amino Codon residues acid 4 Tyr 6 Tyr 1 End End His His Gln Gln Amino acid Phe Phe Leu Leu No .
of residues 2 1 0 TTT TAT TAC TAA TAG CAT CAC CAA CAG TTC TTA TTG CTT CTC CTA CTG 5 0 6 2 1 Leu Leu Leu Leu 2 10 13 1 31 8 4 0 Asn Asn Lys Lys Asp Asp Glu Glu Ile Ile ATT ATC ATA ATG GTT GTC GTA GTG AAT AAC AAA AAG GAT GAC GAA GAG 2 3 6 Ile Met Val Val Val Val 6 0 10 2 12 2 2 4 1 13 Cys Cys End Trp Ser TCT TCC TCA TCG TGT TGC 2 1 1 Ser Ser Ser Pro Pro Pro Pro 2 0 1 TGA TGG CGT CGC CGA CGG 3 5 ACKNOWLEDGMENT 5 Arg Arg Arg Arg CCT CCC CCA CCG 0 1 This investigation was supported by Public Health Service grant GM-26878 from the National Institute of General Medical Sciences .
Belfaiza , J. , C. Parsot , A. Martel , C. Bouthier de la Tour , D. Margarita , G. N. Cohen , and I. Saint-Girions .
Evolution in biosynthetic pathways : two enzymes catalyzing consecutive steps in methionine biosynthesis originate from a common ancestor and possess a similar regulatory region .
Garnant , M. K. , and G. V. Stauffer .
Construction and analysis of plasmids containing the Escherichia coli serB gene .
Heffron , F. , M. So , and B. J. McCarthy .
In vitro mutagenesis of a circular DNA molecule by using synthetic restriction sites .
Codon usage and tRNA content in unicellular and multicellular organisms .
Maniatis , T. , E. F. Fritsch , and J. Samubrook .
Molecular cloning : a laboratory manual .
Cold Spring Harbor Laboratory , Cold Spring Harbor , N.Y. 6 .
Maxam , A. M. , and W. Gilbert .
Sequencing end-labeled DNA with base-specific chemical cleavages .
Miozzari , G. F. , and C. Yanofsky .
Translation of the leader region of the Escherichia coli tryptophan operon .
genetic switch : gene control and phage X. Cell Press and Blackwell Scientific Publications , Palo Alto , Calif. 9 .
Raibaud , O. , and M. Schwartz .
Positive control of transcription initiation in bacteria .
Methionine biosynthesis and its regulation , p. 191-211 .
In K. M. Herrmann and R. L. Somerville ( ed .
) , Amino acids : biosynthesis and genetic regulation .
AddisonWesley Publishing Co. , Reading , Mass. 11 .
Sanger , F. , and A. R. Coulson .
The use of thin acrylamide gels for DNA sequencing .
Schulte , L. L. , L. T. Stauffer , and G. V. Stauffer .
Cloning and characterization of the Salmonella typhimurium metE gene .
Shine , J. , and L. Dalgarno .
Determinant of cistron speci ficity in bacterial ribosomes .
Shoeman , R. , B. Redfield , T. Coleman , R. C. Greene , A. A. Smith , N. Brot , and H. Weissbach .
Regulation of methionine biosynthesis in Escherichia coli : effect of metJ gene product and S-adenosylmethionine on the expression of the metF gene .
Tatchell , K. , K. A. Nasmyth , B. D. Hall , C. Astell , and M. Smith .
In vitro mutation analysis of the mating-type locus in yeast .
Urbanowski , M. L. , L. S. Plamann , and G. V. Stauffer .
Mutations affecting the regulation of the metB gene of Salmo-nella typhimurium LT2 .
Urbanowski , M. L. , L. T. Stauffer , L. S. Plamann , and G. V. Stauffer .
A new methionine locus , metR , that encodes a trans-acting protein required for activation of metE and metH in Escherichia coli and Salmonella typhimurium .
Weaver , R. F. , and C. Weissman .
Mapping of RNA by a modification of the Berk-Sharp procedure : the 5 ' termini of 15S P-globin mRNA precursor and mature 10S P-globin mRNA have identical map coordinates .
Wek , R. C. , and G. W. Hatfield .
Nucleotide sequence and in-vivo expression of the ilv Y and ilvC genes in Escherichia coli K12 .