171 , No. 1 Molecular Characterization of the cysJIH Promoters of Salmonella typhimurium and Escherichia coli : Regulation by cysB Protein and N-Acetyl-L-Serine JACEK OSTROWSKI AND NICHOLAS M. KREDICH * Laboratories of the Howard Hughes Medical Institute at Duke University and Departments of Medicine and Biochemistry , Duke University Medical Center , Durham , North Carolina 27710 Received 6 July 1988/Accepted 30 September 1988 The cysJIH promoter regions from Salmonella typhimurium LT7 and Escherichia coli B were cloned and sequenced .
Primer extension analyses showed that the major in-vivo transcription initiation site in S. typhimurium is located 171 nucleotides upstream of the cysJ start codon .
Minor start sites were found 8 and 9 nucleotides downstream of the major site .
In vivo transcription initiation in E. coli was found to occur at a single site 66 nucleotides upstream of the cysJ start codon .
Primer extension studies also indicated that chromosomal cysJIH transcription is stimulated by sulfur limitation and repressed by growth on L-cystine .
Paradoxically , in strains carrying plasmids containing the S. typhimurium cysJIH region , the highest levels of primer-extension products were found with RNA from cells grown on L-cystine , even though levels of the proteins encoded by cysJ and cysl were normally repressed .
In vitro transcription runoff studies with DNA template from the S. typhimurium cysJIH promoter region showed synthesis of a product originating at the major in-vivo start site , which was dependent on the presence of purified cysB protein and either O-acetyl-L-serine or N-acetyl-L-serine .
N-Acetyl-L-serine was 10-to 30-fold more active than O-acetyl-L-serine as an in-vitro inducer of cysJIH transcription .
Synthesis of L-cysteine by Salmonella typhimurium and Escherichia coli involves cellular uptake and reduction of sulfate to sulfide , the synthesis of O-acetyl-L-serine from L-serine and acetyl coenzyme A by serine transacetylase , and the reaction of O-acetyl-L-serine with sulfide in a reaction catalyzed by O-acetylserine ( thiol ) - lyase ( reviewed in reference 20 ) .
Except for serine transacetylase , these bio-synthetic activities are regulated at the gene level as a system of positive control termed the cysteine regulon , wherein gene expression requires sulfur limitation and the cysB regulatory protein ( 17 , 19 ) , a tetramer of identical 36-kilodalton subunits ( 27 , 35 ) .
Serine transacetylase is controlled through feedback inhibition by L-cysteine ( 21 , 22 ) .
In addition to acting as an L-cysteine precursor , 0-acetyl-L-serine is considered an internal inducer of the cysteine regulon because cysE strains ( lacking serine trans-acetylase ) can not be derepressed by sulfur limitation unless provided with an external source of 0-acetyl-L-serine ( 18 , 19 ) .
Known genes of the cysteine regulon are widely scattered on the chromosome in five different clusters ( 2 , 40 ) .
The cysJIH region consists of contiguous genes specifying the flavoprotein ( cysJ ) and hemoprotein ( cysI ) components of NADPH-sulfite reductase ( 42 , 44 ) and for 3 ' - phosphoadeno-sine 5 ' - phosphosulfate sulfotransferase ( cysH ) ( 11 ) .
Regulation of cysJIH is at the level of transcription ( 12 ) , and genetic studies indicate that these three genes constitute a single transcriptional unit with the order promoter-cysJ-cysl-cysH ( 9 , 24 , 34 ) .
We have cloned and sequenced the cysJIH regions from S. typhimurium ( J. Ostrowski and N. M. Kredich , Abstr .
1987 , H183 , p. 170 ) and E. coli ( J. Y. Wu , J. Ostrowski and N. M. Kredich , manuscript in preparation ) and have identified the open reading frames coding for all three genes .
We report here in-vivo and in-vitro studies that characterize the cysJIH promoter and show that its activity is dependent on cysB protein and either O-acetyl-L-serine or its derivative N-acetyl-L-serine .
MATERIALS AND METHODS Bacterial strains and media .
The S. typhimurium and E. coli strains used in these studies are described in Table 1 .
Medium E with 0.5 % glucose ( 45 ) was used as minimal-medium and was supplemented with-amino-acids at 40 mg/liter and with uracil or thiamine hydrochloride at 4 mg/liter when appropriate for the growth of auxotrophs .
An equimolar amount of MgCl2 was substituted for MgSO4 , and either 0.5 mM reduced glutathione , 1.0 mM Na2SO4 , 0.5 mM L-cysteine sulfinic acid , or 0.5 mM L-cystine was added as the sulfur source .
Medium was adjusted to pH 6.8 with HCI before autoclaving in experiments testing in-vivo effects of 0-acetyl-L-serine and N-acetyl-L-serine ( 19 ) .
Rich medium consisted of LB for plasmid transformations and YT for phage M13 transformations ( 28 ) .
Solid medium contained 1.5 % agar .
When required , ampicillin was used at 25 mg/liter .
Plasmids are shown in Fig. 1 .
pGBK5 and pJYW2 were isolated by selecting for Cys + transformants of the E. coli cysI EC1124 .
pGBK5 was isolated by G. Jagura-Burdzy and contains cysI from S. typhimurium LT7 hisG70 on a 13.0-kilobase ( kb ) SalI fragment inserted in pBR322 .
pGBK5 was transferred by bacteriophage P22HT-mediated transduction ( 30 ) into the S. typhimurium cysJ266 , cysI68 , and cysJIH383 and gave a Cys + phenotype with each , indicating that this plasmid contains the entire cysJIH region from S. typhimurium LT7 .
pJYW2 was isolated by Jer Yuarn Wu and contains cysI from E. coli B on a 9.5-kb fragment obtained from a partial Sau3A digest and inserted in the BamHI site of pBR322 .
Comparison of the DNA sequences of pGBK5 and pJYW2 indicated that pJYW2 also carries the entire cysJIH region from E. coli B ( Wu et al. , in preparation ; also , see below ) .
pRSM15 is a pBR322 derivative that contains cysJIH on a 7.8-kb fragment from wild-type S. typhimurium LT2 ( 30 ) , which also was the product of a partial Sau3A digest .
TK2167 is a AcysB strain of S. typhimurium LT2 known to carry a spontaneous mutation in or near the cysJIH promoter ( cys2332 ) that causes constitutive expression of NADPH-sulfite reductase in the absence of cysB protein ( 34 ) .
It was derived from DW363 by selection for the ability to grow on L-cysteine sulfinic acid , a convenient precursor of sulfite , as a sulfur source .
TK2192 was obtained in the same way from DW365 , another AcysB strain of S. typhimurium LT2 , and also carries a mutation in or near the cysJIH promoter ( cys2335 ) .
The cysJIH regions from these strains were cloned in pBR322 by a shotgun approach by transforming E. coli cysB NK1 and selecting for growth on L-cysteine sulfinic acid .
Recombinant plasmids carrying cysB + were not obtained , because both TK2167 and TK2192 are AcysB .
The cysJIH region from TK2167 was obtained as a 7.9-kb EcoRI-SalI insert in a plasmid designated pJOK7 ( Fig. 1 ) .
pJOH10 contains cysJIH from TK2192 as a 7.8-kb fragment obtained from a Sau3A partial digest , which was inserted into the BamHI site of pBR322 ( Fig. 1 ) .
DNA sequencing was performed by the method of Sanger et al. ( 41 ) by using the Klenow fragment of E. coli DNA polymerase ( Pharmacia , Inc. ) , [ o-35S ] dATP ( 4 ) purchased from the Du Pont Co. , and field-strength gradient , 6 % polyacrylamide electrophoresis gels containing 7 M urea ( 33 ) and maintained at 55 °C with thermostatic plates .
Overlapping fragments of single-stranded DNA templates were generated from M13 phage derivatives ( 46 ) by the method of Dale et al. ( 8 ) .
Both DNA strands were completely sequenced for the cysJIH promoter regions from pGBK5 and pJYW2 ( strategies not shown ) .
The cysJIH promoter regions in pJOK7 and pJOH10 were sequenced in only one direction .
pRSM15 was not sequenced at all .
Analyses of in-vivo transcripts .
Total cellular RNA was prepared by the method of Aiba et al. ( 1 ) from bacteria grown on minimal-medium containing either reduced gluta-thione , sulfate , or L-cystine as a sulfur source .
For primer-extension experiments , 25 , ug of total RNA and 0.1 pmol of 13 5 ' - [ 32P ] - labeled synthetic oligodeoxynucleotide were dissolved in 30 RI of 40 mM sodium-PIPES [ piperazine-N , N ' - bis ( 2-ethanesulfonic-acid ) ] , pH 6.7 , containing 1 mM Na2-EDTA-0.2 % sodium dodecyl sulfate-0.4 M NaCl and hybridized by incubating at 37 °C for 16 h ( 23 ) .
After the addition of 0.5 ml of water , 0.2 ml of 4 M ammonium acetate , and 0.5 ml of isopropanol , the mixture was incubated for 10 min at 23 °C .
The precipitated RNA-oligodeoxynucleotide hybrid was collected by centrifugation and dissolved in 50 p.l of 50 mM Tris hydrochloride , pH 8.3 , containing 75 mM KCI , 6 mM MgCl2 , 10 mM dithiothreitol , and each of the four deoxynucleoside triphosphates at 0.5 mM .
Primer extension was initiated by the addition of 6 U of avian myeloblastosis virus reverse transcriptase ( U. S. Biochemical Corp. ) in a 1-pIl volume and carried out for 2 h at 41 °C .
Phenol-extracted and ethanol-precipitated radiolabeled DNA was then analyzed in sequencing gels .
Si nuclease protection experiments were performed as described earlier ( 30 ) .
In vitro runoff transcription assays .
The templates used in transcription runoff assays were derived from M13 phage derivatives , in which sequences downstream from the S. typhimurium LT7 cysJIH promoter were deleted and replaced by a ( C ) n GAATTC sequence at the EcoRI cloning site of M13mpl9 ( 8 ) .
Fragments were subcloned in pUC19 and then purified from that vector by standard procedures ( 25 ) .
The 20-pul preincubation mixture contained 40 mM Tris hydrochloride at a pH ranging between 7.4 and 8.0 , 0.1 M KCl , 10 mM MgCl2 , 1 mM dithiothreitol , 0.1 mM ATP , 100 p.g of nuclease-free bovine serum albumin per ml , 2 nM purified template DNA , 50 p , g ( approximately 110 nM ) of nuclease-free E. coli RNA polymerase holoenzyme per ml ( Pharmacia ) , and various amounts of purified cysB protein , O-acetyl-L-serine , and N-acetyl-L-serine .
After incubation for 2 to 8 min at 37 °C to allow formation of initiation complexes , transcription was initiated by the addition of 2 pI of a solution containing 0.5 mg sodium heparin per ml , 10 p.M [ a-32P ] CTP ( 800 Ci/mmol ; Du Pont Co. ) , and 2 mM each of ATP , GTP , and UTP ( 37 ) .
After another 5 min at 37 °C , the reaction was terminated by adding 0.2 ml of 10 mM Na2-EDTA containing 50 p.g of yeast tRNA per ml .
Phenol extracted and ethanol-precipitated radiolabel was then analyzed in sequencing gels .
General methods were those described by Maniatis et al. ( 25 ) .
DNA ligase ( Boehringer Mannheim Biochemicals ) and restriction enzymes ( Bethesda Research Laboratories , Inc. ) were used according to the instructions of the suppliers .
Oligodeoxynucleotides were prepared on an Applied Biosystems model 380A automated DNA synthesizer and purified on cartridges from the same company ( 26 ) .
They were radiolabeled at the 5 ' terminus by dissolving 200 pmol in 30 , ul of 0.1 M Tris hydrochloride , pH 9.0 , containing an equimolar amount of [ - y-32P ] ATP ( 3,000 Ci/mmol ; Du Pont Co. ) , 5 mM MgCl2 , 5 mM dithiothreitol , and 7 U of polynucleotide kinase ( Promega Biotec ) .
After incubation at 37 °C for 30 min , DNA was recovered by phenol extraction and ethanol precipitation and dissolved in sterile water at a concentration of 1 pmol/lil .
Preparation and analysis of O-acetyl-L-serine and N-acetyl-L-serine .
O-Acetyl-L-serine ( 39 ) and N-acetyl-L-serine ( 31 ) were prepared as described earlier and analyzed by highperformance liquid chromatography with isocratic elution of a Partisil-10 SCX column ( 0.46 by 25 cm ; Whatman , Inc. ) with 0.02 M ammonium phosphate , pH 2.3 , at a flow rate of 1.5 ml/min .
The ehlate was monitored with a model 450 variable wavelength detector ( Waters Associates , Inc. ) at 216 nm for N-acetyl-L-serine ( 8216 = 755 M-1 cm-1 ) and O-acetyl-L-serine ( 8216 = 65 M-1 cm-1 ) which were cluted at 3.1 and 7.7 ml , respectively .
This method is not very sensitive for O-acetyl-L-serine , but 1 nmol of N-acetyl-L-serine in a volume of 0.1 ml or less was easily detected .
Conversion of O-acetyl-L-serine to N-acetyl-L-serine was measured in a continuous spectrophotometric assay by monitoring the increase in A216 in a Shimadzu UV-260 recording spectrophotometer equipped with electronic temperature control .
Our methods for the purification of S. typhimurium cysB protein ( 27 ) , preparation of bacterial extracts ( 19 ) , and assays for O-acetylserine ( thiol ) - lyase ( 3 ) , NADPH-sulfite reductase and NADPH-cytochrome c reductase ( 43 ) have been described .
Protein was determined b the dye ligand method ( 5 ) by using bovine serum albumin as a standard .
DNA sequence comparisons used the programs Compare and DotPlot from the Sequence Analysis Software Package of the Genetics Computer Group , University of Wisconsin ( 10 ) .
Bacterial strains Genotype Origin or reference Species and strain E. colia B JA199 NK1 EC1124 Wild type ATCC 11303 J. Carbon AtrpES leu-6 thi hsdR hsdM + AtrpE5 leu-6 thi hsdR hsdM + cysB AtrpE5 leu-6 thi hsdR hsdM + cysI 16 From JA199 by A. Wiater S. typhimuriumb LT2 Wild type 29 9 cysB403 cysB403 cysJ266 cysJ266 cysI68 A ( cysI68 ) cysJIH383 A ( cysJIH383 ) hisG70 hisG70 DW18 cysE2 DW363 leu-500 pyrFl46 A ( topA cysB1763 ) DW365 leu-500 pyrF146 A ( topA cysB1765 ) TK2167 leu-500 pyrF146 A ( topA cysB1763 ) cys2332 TK2192 leu-500 pyrFJ46 A ( topA cysB1765 ) cys2335 a E. coli strains are all K-12 derivatives except wild-type E. coli B. b S. typhimurium strains are all LT2 derivatives except hisG70 , which is an LT7 strain .
c Selected for growth on L-cysteine sulfinic acid as a sulfur source .
9 9 14 19 7 7 34c Spontaneous from DW365C R K S R H H pJOK7 lIL p ( cys2332 ) p p I K K H HtB I I I I p P R S3/B RL 1 pJOH1O ( cys2335 ) R K R S K K S R H H I I I L a pGBK5 ¬ ( wild type LT7 ) R P p K H R H R K pRSM15 e I l I S3/B ( wild type LT2 ) P P S3/B R IP IcysJIcYsII 0 4 2 8 6 10 12 14 16 18 kb P S3/8 H P B B P R pJYW2 ( wild type E. coll B ) I I I II I I I R P B S FIG. 1 .
Restriction endonuclease maps of plasmids used in this study .
All are pBR322 derivatives , and cloned fragments of chromosomal DNA are shown as boldface lines .
pGBK5 contains the wild-type cysJIH region from S. typhimurium LT7 hisG70 on a 13.0-kb Sall fragment .
pRSM15 contains the cysJIH region from wild-type S. typhimurium LT2 on a 7.8-kb fragment obtained from a partial Sau3A digest .
The cysJIH regions in pJOH10 and pJOK7 are from S. typhimurium LT2 derivatives : pJOH10 contains the cys2335 allele from TK2192 on a 7.8-kb fragment obtained from a partial Sau3A digest , and pJOK7 contains the cys2332 allele from TK2167 on a 7.9-kb EcoRI-SaII fragment .
pJYW2 contains wild-type cysJIH from E. coli B on a 9.5-kb fragment obtained from a partial Sau3A digest .
The plasmids are aligned with respect to the positions of the promoter and individual genes of the cysJIH cluster , which are shown above the scale .
Abbreviations : B , BamHI ; H , HindIII ; K , KpnI ; P , PstI ; R , EcoRI ; S , Sall .
Fragments obtained from partial Sau3A digests were inserted into the BamHI site of pBR322 .
Resultant sites that are resistant to BamHI are designated S3/B .
* +200 * ( S. typh ) CCGGCTCCACTGACTGGGTTGCTTCCGCTTA ... ( E.coli ) CAGGTCCCACCTTCCGCGTTGCTTCCGTTGA ... +80 * +100 FIG. 2 .
DNA sequences of the wild-type cysJIH promoter regions of S. typhimurium LT7 and E. coli B. Identical nucleotides are indicated by a hyphen between the two sequences .
The sequences were aligned for maximum identity by including a single-nucleotide gap in the S. typhimurium sequence and a 106-nucleotide gap in the E. coli sequence .
An additional 316 nucleotides upstream of those shown were sequenced for E. coli B but are not included here .
Nucleotide positions are numbered relative to in-vivo major transcription start sites ( * and 9 ) that were determined by primer-extension studies .
Two minor transcription start sites at positions +9 and +10 were found for S. typhimurium ( * W ) .
The cysJ coding region begins at position +172 for S. typhimurium and at position +67 for E. coli .
The KpnI site at the beginning of the S. typhimurium sequence is labeled as a point of reference for comparison with Fig. 1 .
Regions corresponding to -10 and -35 promoter elements are double underlined .
RESULTS Comparison of cysJIH promoter sequences from wild-type S. typhimurium LT7 coli B .
The S. typhimurium LT7 and E. sequence obtained from pGBK5 included 389 nucleotides upstream of the cysJ start codon , which was identified by amino-terminal analysis of purified NADPH-sulfite reductase flavoprotein ( Ostrowski and Kredich , Abstr .
From pJYW2 we sequenced 600 nucleotides upstream of the E. coli B cysJ start codon .
The entire 389 nucleotides from S. typhimurium and the corresponding region from E. coli were aligned for maximum identity by including a 1-nucleotide gap in the S. typhimurium sequence and a 106-nucleotide gap in that of E. coli .
Each is numbered in Fig. 2 with respect to its major transcription initiation start site ( see below ) .
The overall identity between the two is 57 % for the first 257 nucleotides of the S. typhimurium sequence and 100 % for the last 27 nucleotides .
In vivo transcription start sites .
Sites of in-vivo cysJ transcription initiation were determined by primer-extension analyses with three different 5 ' -32 P-labeled oligodeoxynucleotides .
Primer A is a 30-mer complementary to the S. typhimurium sequence extending from +43 to +72 ( Fig. 2 ) .
Primer B is a 29-mer complementary to the S. typhimurium sequence extending from position + 134 to + 162 .
Primer C is a 30-mer complementary to an E. coli sequence within the cysJ coding region extending from position +76 to +105 ( Fig. 2 ) .
These primers were selected to be specific for either the S. typhimurium or E. coli sequence .
Extension of primer A with RNA template from wild-type S. typhimurium LT2 gave a major product of 72 nucleotides and minor products of 63 and 64 nucleotides ( Fig. 3 , lane 1 ) .
These size estimates were confirmed with the tuse of primer B , which gave a 162-nucleotide major product and a product of about 153 nucleotides , which was not resolved into two components ( Fig. 3 ) .
These findings suggest the presence of multiple in-vivo transcription initiation sites in the cysJIH promoter region of S. typhimurium .
The major site is at the C residue located 171 nucleotides upstream of the cysJ start codon and is designated position + 1 in Fig. 2 .
Two minor sites may exist at the G and A residues located 8 and 9 nucleotides downstream from the major site .
S1 nucleas protection experiments ( results not shown ) confirmed these results by showing two different protected RNA species , one of the length expected from the major initiation site defined by primer-extension analyses and the other 7 to 10 nucleo-tides shorter .
An alternative explanation of these data is that the two shorter transcripts may have been derived from the longer one by RNA processing .
Si nuclease protection experiments failed to detect transcripts that might have originated from positions +134 to +171 , which would not have been detected by our primer-extension experiments .
With RNA template from the E. coli K-12 derivative EC1124 ( pRSM15 ) , extension of the E. coli B-specific primer C gave a 105-nucleotide product ( Fig. 3 ) , which we assume was directed by mRNA from the cysJIH region of E. coli K-12 .
If the cysJIH promoter region of E. coli K-12 is identical to that of E. coli B , these results indicate the presence of an initiation start site at the T residue located 66 nucleotides upstream of the cysJ start codon and designated position +1 in Fig. 3 .
There was no evidence of a second transcription initiation start site in E. coli .
The -10 element of the major cysJIH promoter in both sequences is represented by TAACCT and begins at -12 for S. typhimurium and at -11 for E. coli .
These two promoters also share the sequence TTTAAT in the -35 region , which is separated from the -10 element by 18 nucleotides , only 6 of which are identical ( Fig. 2 ) .
The sequence TATCCT beginning at position -6 may serve as the -10 element of the postulated minor cysJIH promoter for S. typhimurium .
In vivo regulation of cysJIH promoter activity .
In wild-type S. typhimurium LT2 carrying no plasmid , the highest levels of major and minor primer-extension products were found with RNA from bacteria that were sulfur-limited by growth on glutathione as a sole sulfur source ( Fig. 3 ) .
RNA from sulfate-grown cells gave lesser amounts of these products , and RNA from cells repressed for the cysteine regulon by growth on L-cystine gave no detectable products .
These findings confirm those of Fimmel and Loughlin ( 12 ) for E. coli and are consistent with the notion that regulation of the cysteine regulon occurs at the level of transcription .
The results obtained with EC1124 carrying wild-type S. typhimu-rium cysJIH on either pGBK5 ( from strain LT7 ) or pRSM15 were different and showed the ( from strain LT2 ) quite highest primer-extension product levels with RNA from cells grown on L-Cystine ( these results are discussed below ) .
Additional minor extension products of 89 and 92 nucleo-tides were noted with EC1124 ( pRSM15 ) and were found in highest amounts in L-cystine-grown cells ( Fig. 3 ) .
Very small amounts of products of the same length were also detected with template-RNA from sulfur-limited cultures of plasmidfree wild-type S. typhimurium LT2 and with EC1124 ( pGBK5 ) .
We do not know whether these products are artifacts of the primer-extension reaction , mRNA degradation products , or products of another minor in-vivo promoter with start sites at positions +73 and +76 .
Levels of the E. coli-specific primer-extension product in sulfur-limited and sulfur-replete EC1124 ( pRSM15 ) did not vary as dramatically as in S. typhimurium LT2 but were still significantly lower in cells grown on L-cystine ( Fig. 3 ) .
Characterization of the cysJIH promoter regions of cys2335 and cys2332 .
Extension of primer B with RNA template from EC1124 carrying cys2335 on pJOH10 gave not only the products expected from expression of the wild-type S. typhimurium promoters but also a new major product of 76 nucleotides and two additional minor products of 74 and 77 nucleotides ( Fig. 3 ) .
The DNA sequence of the cysJIH promoter region from pJOH1O was found to be identical t that of wild-type LT7 between positions -218 and +171 except for a C -- A substitution at position +74 ( Fig. 4 ) .
This change can not be due to a difference between strains LT2 and LT7 , because it was not present in the other LT2 derivative , pJOK7 ( see below ) .
This mutation changes a TCACGT sequence to TAACGT , which has the highly conserved TA -- T residues of the -10 element of a promoter .
Upstream and separated from this sequence by 17 nucleotides is the nearly consensus -35 promoter sequence TTGACT ( 15 ) .
The results of our primer-extension experiments indicate that the C -- A mutation in cys2335 has created a new promoter , which initiates transcription primarily at the T residue at position +87 and with much less efficiency from sites 1 nucleotide upstream and 2 nucleotides downstream .
It is of interest that , as was seen with EC1124 ( pGBK5 ) and EC1124 ( pRSM15 ) , the highest levels of extension products from both the wild-type promoters and the mutant promoter were obtained with RNA from cells grown on L-cystine .
Primer extension experiments gave no product with RNA template from EC1124 carrying cys2332 on pJOK7 except for a small amount of material of about 133 nucleotides observed with primer B ( Fig. 3 ) .
Of the 680 nucleotides that were sequenced upstream of the cysJ start codon of cys2332 , the first 505 were found to differ completely from any portion of the promoter regions of wild-type LT7 and the cys2335 allele of pJOH10 ( Fig. 4 ) .
The last 175 nucleotides were identical to those of wild-type LT7 and differed from cys2335 only at the position of the cys2335 mutation .
These findings indicate that cys2332 is either a large deletion or some other type of rearrangement extending upstream from wild-type position -5 .
The restriction map of the pGBK5 insert ( wild type ) shows a cluster of EcoRI , KpnI , and PstI sites at about 0.5 kb that are found 4.3 kb closer to cysJIH in the pJOK7 insert ( Fig. 1 ) .
Therefore , we believe that cys2332 is a deletion , which has eliminated most of the wild-type promoter sequences and fused cysJIH to an upstream promoter that does not require cysB protein for activity .
Our inability to detect a primer-extension product with RNA from EC1124 ( pJOK7 ) suggests this promoter is a kilobase or more upstream of our primer .
Si nuclease protection studies with RNA from EC1124 ( pJOK7 ) showed the presence of a small amount of protected fragment , which was approximately the size of that obtained with RNA from EC1124 ( pGBK5 ) ( data not shown ) .
This is the result expected from a cys2332 transcript originating upstream of the wild-type initiation site , because such an mRNA would anneal to a DNA probe as far upstream as position -4 and give a protected fragment only 4 nucleotides longer than that obtained with a wild-type transcript .
In vitro transcription initiation at the S. typhimurium cysJIH promoter ( s ) was characterized in a transcription runoff assay , with two different duplex-DNA-fragments used as templates .
Each began at the KpnI site at position -218 and extended downstream into cysJ to either position +215 or position +271 relative to the major in-vivo transcription initiation site ( Fig. 2 ) .
As a result of the method used to obtain these templates ( see Materials and Methods ) , the shorter ended in a ( C ) 12 GAATT-5 ' segment not present in the cysJ sequence , and the longer had a ( C ) 16 GAATT-5 ' segment , giving totals of 232 and 292 nucleotides , respectively , expected for runoff products originating from the major in-vivo initiation site .
These two templates gave the expected runoff products of either 232 or 292 nucleotides , which were dependent on the addition of both purified cysB protein and acetyl-L-serine .
With the shorter template and 3 mM O-acetyl-L-serine , synthesis of the 232 nucleotide product was directly proportional to cysB protein concentration over a range of 0.5 to 10 , ug/ml ( Fig. 5 , lanes 3 through 8 ) .
Higher concentrations of cysB protein gave no further increase in runoff product , as determined from visual inspection of gel autoradiographs ( data not shown ) .
Since O-acetyl-L-serine is considered the coinducer of the cysteine regulon , we were surprised to fin that N-acetyl-L-serine was an effective substitute for 0-acetyl-L-serine in the generation of this in-vitro-transcription fragment ( Fig. 5 , lanes 11 through 16 ) .
No appreciable product was noted with cysB protein at 10 , ug/ml in the absence of acetyl-L-serine or with 3 mM L-serine ( Fig. 5 , lanes 9 and 10 ) .
Small amounts of several shorter transcripts that were also dependent on cysB protein and acetyl-L-serine were noted , but comparison of gels from experiments using the two templates indicated that these products were due to premature transcription termination ( data not shown ) .
There was no evidence in these in-vitro experiments for transcription initiation at positions +9 and +10 , suggesting that the products found in primer-extension analyses ( Fig. 3 ) and in Si nuclease protection experiments may represent proc-essed derivatives of the transcript originating at position + 1 .
Our finding that N-acetyl-L-serine was active in stimulating in-vitro cysJIH transcription raised the possibility that conversion of O-acetyl-L-serine to N-acetyl-L-serine might be responsible for the observed effects of 0-acetyl-L-serine .
This reaction is known to occur spontaneously by means of an intramolecular 0-to-N acetyl shift with a first-order rate constant of 0.98 % per min at pH 7.5 and 29 °C ( 13 ) .
This constant is directly proportional to the concentration of nonprotonated amino group , viz. , NH2 , and therefore is larger at higher pHs .
The reverse reaction , viz. , formation of O-acetyl-L-serine from N-acetyl-L-serine , does not occur to any significant extent except in strong acid ( 32 ) .
To minimize conversion of O-acetyl-L-serine to N-acetyl-L-serine , we used a preincubation time of 2 min at pH 7.4 in all experiments reported here .
These conditions gave approximately the same amount of cysB protein-dependent transcription as the 8 min at pH 8.0 called for in our model protocol ( 37 ) .
As a further measure , freshly prepared stock solutions of 0.1 M O-acetyl-L-serine were kept on ice for no more than 2 h before use .
At this low-temperature and pH of 5.1 , conversion to N-acetyl-L-serine was found to be negligible ( < 0.001 % / min at 1 °C ) .
At a constant cysB protein concentration of 10 , ug/ml , transcription initiation at the cysJIH promoter occurred with N-acetyl-L-serine concentrations as low as 0.05 mM but was only slight until 0.3 mM ( Fig. 6 ) .
O-Acetyl-L-serine was far less effective and required concentrations of 1 to 3 mM fo significant stimulation .
The amount of product found at 3 mM O-acetyl-L-serine was equivalent to that formed at between 0.1 and 0.3 mM N-acetyl-L-serine in the same experiment .
If O-acetyl-L-serine itself were totally inactive , this effect would require an N-acetyl-L-serine contaminant of 3 to 10 % and more likely between 5 and 8 % .
Analysis of our O-acetyl-L-serine preparation by high-performance liquid chromatography showed an N-acetyl-L-serine content of < 0.2 % at zero time .
When incubated at 37 °C in the runoff assay preincubation buffer ( 40 mM Tris hydrochloride , 0.1 M KCl , 10 mM MgCl2 ) at pH 7.4 , O-acetyl-L-serine was converted to N-acetyl-L-serine at a rate of 0.31 % / min .
cysB protein at 10 , ug/ml had no appreciable effect on this rate .
From these values we estimate that the N-acetyl-L-serine concentration of reaction mixtures preincubated with 0-acetyl-L-serine at 37 °C for 2 min at pH 7.4 would be less than 1 % of the initial 0-acetyl-L-serine concentration .
Since an N-acetyl-L-serine contaminant of 5 to 8 % would be required to account for the observed effects , it follows that O-acetyl - * -120 * -100 * -80 * -60 ( S. typh ) GAAAATTTA-ATAATTATCAATCAATTATAAAATCGATTTTGGCGTTAATAACGATAACTAAAACAGGTTAGTTCATTTGG ( E. coli ) CTAAATTCATTTGTTTTTCATTAGGTTGGTTAATCTATTTTGTTGTTAAAGACTATTGCTAAAACAGGTTAGTCGATTTGG * -120 * -100 * -80 * -60 +1 * -40 * -20 * 4 44 +20 ( S. typh ) TTATTTGTTATTTCCAACCCTTCTTTAATTGTTATTCCTCTCACCGTTAACCTTATCCTCAGTTTGGGATTTATCGCTT ( E. Coi ) TTATTAGTTATCGCTATCCCGTCTTTAATCCACACCGTTTGCCCCGTTAACCTTACCTTCTCTTCTGTTTTATGGGCGC * -40 * -20 * + +20 +1 * +40 * +60 * +80 * +100 ( S. typh ) ATACATTTCATCTTTCAAGCCGCATCTGTGTTGACTGCGTTTACTCACCCCAGTCACGTATTTATGTACGCTCCTGGGGC ( E.coli ) TGACAGGGCGCAGAAACA ... * +120 * +140 * +160 * cysJ -- > ( S. typh ) GCGATCAGCTTACGGCGAACTTGAATGATTTTGTGTATAGATCCGCTTTGCTTACTGGAACATAACGACGC ATGACGACA ( E.coli ) ... .
GCTTTGCTTACTGGAACATAACGACGC ATGACGACA +40 * +60 CYSJ -- > * +200 * ( S. typh ) CCGGCTCCACTGACTGGGTTGCTTCCGCTTA ... ( E.coli ) CAGGTCCCACCTTCCGCGTTGCTTCCGTTGA ... +80 * +100 FIG. 2 .
DNA sequences of the wild-type cysJIH promoter regions of S. typhimurium LT7 and E. coli B. Identical nucleotides are indicated by a hyphen between the two sequences .
The sequences were aligned for maximum identity by including a single-nucleotide gap in the S. typhimurium sequence and a 106-nucleotide gap in the E. coli sequence .
An additional 316 nucleotides upstream of those shown were sequenced for E. coli B but are not included here .
Nucleotide positions are numbered relative to in-vivo major transcription start sites ( * and 9 ) that were determined by primer-extension studies .
Two minor transcription start sites at positions +9 and +10 were found for S. typhimurium ( * W ) .
The cysJ coding region begins at position +172 for S. typhimurium and at position +67 for E. coli .
The KpnI site at the beginning of the S. typhimurium sequence is labeled as a point of reference for comparison with Fig. 1 .
Regions corresponding to -10 and -35 promoter elements are double underlined .
i ` i. : `` 1hU : , f M I I ; x - s : jlX .
; I , i. U 5 4-1 66 22 -- 1 3 a E. .
* * * 9 4 r 8 WU * 4-8 ~ a * 7 9 - v * 3 3 * 4-6 9 * 0 6 2 2 .
Primer extension analyses of in vi Votranscription initiation for cysJIH .
RNA was isolated from ea grown on either reduced glutathione ( g ) , sulfatte ( s ) , orL-cystine ( c ) as a sulfur source and used as template f Dr primer-extension .
Identical amounts of primer and total RNA were used for each reaction .
Product sizes were estimated by comparison with G-reaction lanes ( M ) from a DNA sequencing reaction by using M13mpl8 as a template .
The values given aire corrected for the assumption that the 5 ' -32 P-phosphorylated primer-extension products migrate further by 1 nucleotide than the nonphosphorylated DNA products .
The first lane shows extensioin products of 72 , 64 , RNA from glutathiand 63 nucleotides , which were obtained with S. typhimurium LT2 annealed primer A , a 30-mer one-grown to complementary the S. typhimurium to sequen +43 and +72 ( Fig. 2 ) .
For the 15 lanes after lane M , RNA was annealed to primer B , a 29-mer complementary to the S. typhimu-rium sequence between positions + 134 and + -162 .
Extension products of 162 and 153 ( presumably a doublet ) nuicleotides were found with each strain except EC1124 ( pJOK7 ) .
RNA from EC1124 ( pJOH10 ) also gave products of 74 , 76 , and 777 nucleotides .
Minor products of 89 and 92 nucleotides were foiund with RNA from EC1124 ( pRSM15 ) and were faintly visiblie with RNA from rium LT2 grown on EC1124 ( pGBK5 ) and wild-type S. typhimui glutathione .
The three lanes preceding the fin from EC1124 ( pRSM15 ) annealed to the E. coi i-specific primerC , a 30-mer complementary to the E. coli sequenIce between positions +76 and +105 ( Fig. 2 ) .
The 105-nucleotide product represents a transcript originating from the E. coli c-vsJIH promoter of EC1124 ( pRSM15 ) .
Wild type S. typhimurium vs cys2335 ( pJOH10 ) * +40 * +60 * +80 * +100 ACATTTCATCTTTCAAGCCGCATCTGTGTTGACTGCGTTTACTCACCCCAGTCACGTATTTATGTACGCTCCTGGGGC ... V. ... TTGACT < -- 17 nt -- > TAACGTATTTATGTACGCTCC .
( -35 ) ( -10 ) * ( wild type LT7 ) ( cys2335 ) Wild type S. typhimurium vs cys2332 ( pJOK7 ) * -40 * -20 * 4 44 +20 TTATTTCCAACCCTTCTTTAATTGTTATTCCTCTCACCGTTAACCTTATCCTCAGTTTGGGATTTATCGCTTA ... ( wild type LT7 ) ( pJOK7 ) ... tcgtaaagagatcaaaggccaggcgtaatcctgctttacctctTCCTCAGTTTGGGATTTATCGCTTA .
A ( 4.2 kb deletion ) FIG. 4 .
Comparison of promoter regions from wild-type S. typhimurium LT7 and the LT2 derivatives cys2335 and cys2332 .
Only the relevant portions of sequences are shown .
The 389 nucleotides upstream of the cysJ start codon in cys2335 were identical to the wild-type LT7 sequence except for a C-to-A transversion shown at position +75 ( V ) , which creates a -10 promoter element 17 nucleotides downstream from a nearly consensus -35 sequence .
The major initiation start site of this mutant promoter was determined by primer-extension studies and is marked at position +87 ( * ) .
Minor initiation sites were noted at +86 and +89 ( not shown ) .
A total of 680 nucleotides upstream to the cysJ start codon were sequenced for the cys2332 allele of pJOK7 .
Similarity to the wild-type LT7 promoter region was not observed until position -4 , after which the next 175 nucleotides were identical .
Lowercase letters indicate nonidentical sequences of cys2332 ( except for random matches ) .
Major ( 9 ) and minor ( t W ) transcription start sites of the wild-type sequence are marked as in Fig. 2 .
136 3 mM N-Acetylserine 3 mM O-Acetylserinne 1 2 3 4 5 6 7 B 9 1CD 11 12 13 14 15 1i l I * ~ a m I. - M 40 ¬ .1 '' 4-2 % t IM FIG. 5 .
Dependence of cysJIH promoter activity on purified cysB protein in an in-vitro-transcription runoff assay .
Initiation complexes between DNA template and RNA polymerase holoenzyme were allowed to form for 2 min at pH 7.4 before addition of sodium heparin and nucleoside triphosphates .
Transcription runoff products were then analyzed on polyacrylamide sequencing gels , and product sizes were estimated by comparison with a G-reaction lane from a DNA sequencing reaction with M13mpl8 used as a template ( lanes 1 and 17 ) .
Values are corrected for the assumption that the transcription products migrate faster by 1 nucleotide than the nonphosphorylated DNA products in the standard .
The DNA template used in this experiment contained 232 nucleotides downstream of ( and including ) the major transcription start site for the S. typhimurium cysJIH promoter .
Reaction mixtures contained no cysB protein and no acetyl-L-serine ( lane 2 ) ; 3.0 mM O-acetyl-L-serine and cysB protein at 0 , 0.5 , 1 , 2 , 5 , and 10 , .
ug/ml ( lanes 3 to 8 , respectively ) ; no acetyl-L-serine and 10 , ug of cysB protein per ml ( lane 9 ) ; 3 mM L-serine and 10 , ug of cysB protein per ml ( lane 10 ) ; and 3.0 mM N-acetyl-L-serine and cysB protein at 0 , 0.5 , 1 , 2 , 5 , and 10 jig/ml ( lanes 11 to 16 ) .
Production of a 232-nucleotide transcript was clearly dependent on the concentration of cysB protein and on the presence of either O-acetyl-L-serine or N-acetyl-L-serine .
N-Acetylseri ne ( mM ) .05.1.3.5 1 3 O-AcetyIseri ne ( mM ) .1.3.5 1 3 L-serine itself has some activity as an in-vitro activator of cysJIH transcription .
Conclusive evidence on this point will require a more quantitative type of transcription initiation assay .
In vivo induction of the cysteine regulon by N-acetyl-L-serine .
Previous studies had shown that cysE strains of E. coli ( 18 ) and S. typhimurium ( 19 ) could not be derepressed for activities of the cysteine regulon unless provided with an exogenous source of O-acetyl-L-serine .
Because of our finding that N-acetyl-L-serine was more effective than O-acetyl-L-serine in stimulating in-vitro-transcription initiation at the S. typhimurium cysJIH promoter , we decided to measure the in-vivo effects of N-acetyl-L-serine .
Sulfur-limited cultures of S. typhimurium DW18 ( cysE2 ) were treated with various concentrations of either O-acetyl-L-serine or N-acetyl-L-serine , and extracts were assayed for NADPH-cytochrome c reductase , a sensitive indicator of cysJ flavoprotein activity ; for NADPH-sulfite reductase holoenzyme activity , which depends on both cysJ and cysI expression ; and for O-acetylserine ( thiol ) - lyase , a measure of cysK expression .
The results showed that the cysteine regulon can be induced in-vivo by N-acetyl-L-serine but required much higher concentrations than are necessary with O-acetyl-L-serine ( Table 2 ) .
With O-acetyl-L-serine , enzyme activities reached half-maximal values at concentrations of 0.01 to 0.03 mM and peaked at about 0.1 mM .
In contrast to our in-vitro comparisons of these two compounds , 10-fold higher concentrations of N-acetyl-L-serine were required to achieve similar levels of induction in-vivo .
Since we did not measure transport rates or steady-state cellular levels of these two compounds , the significance of these in-vivo differences can not be assessed .
M M 4 0 1 1 1 1 @ 09a.,1-232 I i I A .
II I 1 4 A I I il 2 * 2036 DISCUSSION FIG. 6 .
Relative effects of N-acetyl-L-serine and O-acetyl-L-serine in stimulating cysB protein-dependent in-vitro-transcription from the S. typhimurium cysJIH promoter .
The DNA template and general conditions were the same as those described in Materials and Methods and in the legend to Fig. 5 .
Initiation complexes were allowed to form for 2 min at pH 7.4 to minimize conversion of O-acetyl-L-serine to N-acetyl-L-serine .
The G-reaction lane from a DNA sequencing reaction with M13mpl8 used template as a was used as a standard ( M ) .
All reaction mixtures contained 10 , ug of cysB protein per ml and either N-acetyl-L-serine or O-acetyl-L-serine at the concentrations indicated .
With 3 mM O-acetyl-L-serine , the amount of specific product at 232 nucleotides was slightly less than that obtained with 0.3 mM N-acetyl-L-serine .
Our primer-extension analyses have defined the in-vivo transcriptional start sites and promoter regions for the cys-JIH operons of S. typhimurium and E. coli .
The deviation of the -35 region of the cysJIH promoter from the consensus the promoters sequence ( 15 ) has also been observed for cysK of S. typhimurium and E. coli , which are also dependent on cysB for expression ( 6 ) , and appears to be a general characteristic of positively regulated promoters ( 38 ) .
Presumably , cysB protein interacts with nearby DNA sequences or with RNA polymerase or both to facilitate transcription initiation at what is otherwise an inefficient promoter .
The DNA sequences of the cys2332 and cys2335 alleles indicate that the ability of AcysB strains carrying these mutations to express cysJIH is due to the creation of new cysB-indepen-dent promoters either through a point mutation in cys2335 or by fusion to another promoter in cys2332 .
Comparison of the promoter regions of cysJIH from S. typhimurium and E. coli with those of cysK showed a number of identities for the four sequences including TA -- CT in the -10 region , CTT in the -35 region , and 12 of 39 nucleotides immediately upstream of the -35 regions ( Fig. 7 ) .
The last are of particular interest because preliminary studies in this laboratory indicate that the 39 to 41 nucleotides immediately upstream of the -35 region of the S. typhimurium cysK promoter are required for positive control by cysB protein ( R. Monroe and N. M. Kredich , Abstr .
Sequences separating the -10 and -35 regions are quite different from one another and consist of 18 nucleo-tides for the cysJIH promoters and only 16 nucleotides in the cysK promoters The semiquantitative results of our primer-extension analyses with RNA from wild-type S. typhimurium carrying no plasmid confirmed previous studies on the effects of different sulfur sources on cysJIH expression ( 11 , 19 , 36 ) .
The very high levels of extension product with RNA from plasmidcarrying strains grown on L-cystine were unexpected , however , and prompted us to measure enzyme levels in plasmidcarrying strains .
EC1124 carrying either pRSM15 , pJOH10 , or pJOK7 was grown on minimal-medium with different sulfur sources under conditions identical to those used to prepare RNA for primer-extension studies .
Extracts were assayed for NADPH-cytochrome c reductase and NADPH-sulfite reductase to evaluate cysJ and cysJI expression and for O-acetylserine ( thiol ) - lyase to estimate cysK expression as a control .
As might be expected from a copy-number effect , the absolute level of cytochrome c reductase was approximately 30-fold higher in L-cystine-grown EC1124 ( pRSM15 ) than in a plasmid-free cysJIH + strain .
However , in contrast to the results expected from primer-extension experiments , this high level of enzyme activity increased another 10-to 20-fold during-growth on glutathione or sulfate .
As expected , O-acetylserine ( thiol ) - lyase levels were the lowest in L-cystine-grown cells .
Similar results were obtained with EC1124 ( pJOH10 ) and EC1124 ( pJOK7 ) , in which the lowest levels of all three enzymes were also found in L-cystine-grown cells ( data not shown ) .
Thus , even though growth on L-cystine gave the highest transcript levels in cysJIH plasmid strains , this sulfur source gave the lowest levels of the enzymes encoded by cysJ and cysI .
We do not understand this effect of L-cystine on transcript levels , but our results suggest that it may occur only for cysJIH carried on a plasmid .
For instance , in EC1124 ( pRSM15 ) , in which the E. coli cysJIH region is on the chromosome and the S. typhimurium genes are on a plasmid , extension of an E. coli primer gave the largest amounts of product with RNA from glutathione-and sulfate-grown cells , while extension of the same preparations with an S. typhi-murium primer gave the largest amounts of product with RNA from L-cystine-grown cells ( Fig. 3 ) .
Therefore , in EC1124 ( pRSM15 ) , levels of cysJ transcript were `` appropriate '' for the sulfur source for the chromosomal gene and inappropriate for the plasmid gene .
Furthermore , in EC1124 ( pJOH10 ) , growth on L-cystine gave the highest levels of transcript originating from the cysB-independent promoter created by the point mutation in cys2335 , which was also carried on a plasmid ( Fig. 3 ) .
It has yet to be determined why the very high transcript levels found in L-cystine-grown plasmid strains are not accompanied by correspondingly high levels of enzyme activity .
Our in-vitro-transcription studies using templates containing the S. typhimurium cysJIH promoter establish a role for cysB in regulating transcription from this promoter and provide a direct demonstration of biochemical activity for purified cysB protein .
Although these experiments did not define an exact mechanism of action for cysB protein , they are consistent with the notion that this regulatory element acts at the level of transcription initiation .
As predicted from in-vivo studies , in-vitro-transcription from the cysJIH requires only cysB protein but also coinpromoter not a ducer , which has been thought to be O-acetyl-L-serine ( 17 , 19 ) .
Our transcription runoff assays , however , show that N-acetyl-L-serine is far more effective than O-acetyl-L-serine as a coinducer .
It is not clear whether the major regulatory effect of O-acetyl-L-serine is due to a low level of intrinsic activity as a coinducer or is mediated through its conversion to N-acetyl-L-serine .
The greater in-vivo activity of externally supplied O-acetyl-L-serine coinducer as a may be due rapid cellular uptake , followed perhaps by to more conversion to N-acetyl-L-serine .
By analogy with other regulatory systems , the most likely role for coinducer would be to bind to cysB protein , thereby effecting a change in conformation necessary for stimulating transcription initiation at cys promoters .
In support of this model is the fact that certain cysB point mutations causing single-amino-acid changes ( T. E. Colyer , J. Ostrowski , R. S. Monroe , and N. M. Kredich , Abstr .
1988 , H154 , p. 170 ) obviate the requirement for coinducer and result in the constitutive expression of cys genes , even in a cysE background and regardless of the sulfur source used for growth ( 19 ) .
A previously unsuccessful effort to demonstrate binding of O-acetyl-L-serine to purified cysB protein ( 27 ) is now understandable in light of our finding that this compound has only weak activity as a coinducer in transcription runoff assays with the cysJIH promoter .
If these in-vitro experiments are any indication , it also be difficult demonstrate binding of N-acetyl-L-may to serine to cysB protein by direct means .
The limited solubility of cysB protein limits the sensitivity of binding studies to a Kd of 1 x i0-4 M or less , and only a very weak effect on in-vitro-transcription initiation was noted at that concentration of N-acetyl-L-serine .
Preliminary studies from this laboratory suggest that it may be possible to quantify binding of N-acetyl-L-serine to cysB protein indirectly by measuring effects on binding of cysB protein to DNA .
Induction of the cysteine regulon in DW18 ( cysE2 ) by O-acetyl-L-serine and N-acetyl-L-serinea Concn ( mM ) of added : Activityb of : O-Acetylserine ( thiol ) - lyase ( U/mg ) Cytochrome c Sulfite reductase reductase ( mU/mg ) ( mU/mg ) O-Acetyl-L-serine N-Acetyl-L-serine 0 0 55 < 1 3.1 0.01 0 75 5 7.2 0.03 0 255 41 15.1 0.1 0 400 67 17.8 0.3 0 405 74 16.5 1 0 360 47 16.5 3 0 355 61 16.2 0 0.1 155 30 11.2 0 0.3 280 49 16.6 0 1 325 53 18.5 0 3 475 82 22.9 a S. typhimurium DW18 ( cysE2 ) was grown with vigorous shaking at 37 ' C in minimal-medium adjusted to pH 6.8 containing 0.5 % glucose and 1 mM reduced glutathione ( 19 ) .
Either O-acetyl-L-serine or N-acetyl-L-serine was added when cultures reached about 2 x 108 cells per ml , and bacteria were harvested by centrifugation at densities of 4 x 109 to 6 x 109 cells per ml .
Enzyme assays were performed on crude extracts .
b For both reductases , 1 U of activity catalyzes the oxidation of 1 , umol of NADPH per min .
Sulfite reductase was assayed with hydroxylamine as an electron-acceptor ( 43 ) .
One unit of O-acetylserine ( thiol ) - lyase activity catalyzes the formation of 1 Fmol of cysteine per min .
-35 -10 StWhCPlq AACAGGTTAGTTCATTTGGTTATTTGTTATTTCCAACCCTTCTTTAATTGTTATTCCTCTCACCGTTAACCTTATCCTC E.COl cysN AACAGGTTAGTCGATTTGGTTATTAGTTATCGCTATCCCGTCTTTAATCCACACCGTTTGCCCCGTTAACC TTACCTT & tWhc8K ACCATTATTTCCCATCAGCATATAGATATGCGAAATCCTTACTTCCC CATATCTGGCTGGAAGG -- TATGC T GGGAAG F.COU4 , K GTCATTATTTCCCTTCTGTATATAGATATGCTAAATCCTTACTTCCGCATATTCTCTGAGCGGG -- TATGCTACCTGTTG ( ce .
Comparison of the cysJIH and cysK promoter regions of S. typhimurium and E. coli .
Sequences are aligned with respect to -35 and-10 regions ( double underline ) and have been adjusted by including two blank spaces ( hyphens ) just before the-10 regions of the cysK promoters .
The last nucleotide of each sequence is the major transcription start site .
The cysK data are from the work of Byrne et al. ( 6 ) .
Residues that are identical in all four sequences are shown on the bottom line This work was supported by Public Health Service research grant DK-12828 from the National Institutes of Health .
We thank Humphrey Kendall for his excellent technical assistance .
Aiba , H. , S. Adhya , and B. de Crombrugghe .
Evidence for two functional gal promoters in intact Escherichia coli cells .
Linkage map of Escherichia coli K-12 , edition 7 .
Becker , M. A. , N. M. Kredich , and G. M. Tomkins .
The purification and characterization of O-acetylserine sulfhydrylase A from Salmonella typhimurium .
Biggin , M. D. , T. J. Gibson , and G. F. Hong .
Buffer gradient gels and 3 `` S label as an aid to rapid DNA sequence determination .
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding .
Byrne , C. R. , R. S. Monroe , K. A. Ward , N. M. Kredich .
DNA sequences of the cysK regions of Salmonella typhimurium and Escherichia coli and linkage of the cysK regions to ptsH .
Cheney , R. W. , Jr. , and N. M. Kredich .
tFine-structure genetic map of the cysB locus in Salmonella typhimurium .
Dale , R. M. K. , B. A. McClure , and J. P. Houchins .
A rapid single-stranded cloning strategy for producing a sequential series of overlapping mitochondrial 18S rDNA .
Demerec , M. , D. H. Gillespie , and K. Mizobuchi .
Genetic structure of the cysC region of the Salmonella genome .
Devereux , J. , P. Haeberli , and 0 .
A comprehensive set of sequence analysis programs for the VAX .
Dreyfuss , J. , and K. J. Monty .
The biochemical characmutants of Salmonella terization of cysteine-requiring typhimu-rium .
Fimmel , A. L. , and R. E. Loughlin .
Isolation of a Xdcys transducing bacteriophage and its use in determining the regulation of cysteine messenger ribonucleic acid synthesis in Esch-erichia coli K-12 .
Flavin , M. , and C. Slaughter .
Synthesis of the succinic ester of homoserine , a new intermediate in the bacterial synthesis of methionine .
Hartman , P. E. , Z. Hartman , R. C. Stahl , and B. N. Ames .
Classification and mapping of spontaneous and induced muta-16:1-tions in the histidine operon of Salmonella .
Hawley , D. K. , and W. R. McClure .
Compilation and analysis of Escherichia coli promoter DNA sequences .
Jagura-Burdzy , G. , and N. M. Kredich .
Cloning and physical mapping of the cysB region of Salmonella typhimu-rium .
Positive control of sulfate reduction in Escherichia coli : the nature of the pleiotropic cysteineless mutants of E. coli K12 .
C. , J. Wheldrake , and C. A. Pasternak .
The control of sulphate reduction in Escherichia coli by O-acetyl-L-serine .
Regulation of L-cysteine biosynthesis in Salmonella typhimurium .
I. Effects of growth on varying sulfur sources and O-acetyl-L-serine on gene expression .
Biosynthesis of cysteine , p. 419-428 .
In F. C. Neidhardt , J. L. Ingraham , K. B. Low , B. Magasanik , M. Schaechter , and H. E. Umbarger ( ed .
) , Escherichia coli and Salmonella typhimurium : cellular and molecular biology .
American Society for Microbiology , Washington , D.C. 21 .
Kredich , N. M. , M. A. Becker , and G. M. Tomkins .
Purification and characterization of cysteine synthetase , a bifunctional protein complex , from Salmonella typhimurium .
Kredich , N. M. , and G. M. Tomkins .
The enzymatic synthesis of L-cysteine in Escherichia coli and Salmonella typhimurium .
Lillie , J. W. , M. Green , and M. R. Green .
An adenovirus Ela protein region required for transformation and transcriptional repression .
Polarity of the cysJIH operon of Salmo-nella typhimurium .
Maniatis , T. , E. F. Fritsch , and J. Sambrook .
Molecular cloning : a laboratory manual , p. 1-545 .
Cold Spring Harbor Laboratory , Cold Spring Harbor , N.Y. 26 .
McBride , L. J. , C. McCollum , S. Davidson , J. W. Efcavitch , A. Andrus , and S. J. Lombardi .
A new , reliable cartridge for the rapid purification of synthetic DNA .
Miller , B. E. , and N. M. Kredich .
Purification of the cysB protein from Salmonella typhimurium .
Experiments in molecular genetics , p. 431-433 .
Cold Spring Harbor Laboratory , Cold Spring Harbor , N.Y. 29 .
Mizobuchi , K. , M. Demerec , and D. H. Gillespie .
Cysteine mutants of Salmonella typhimurium .
Monroe , R. S. , and N. M. Kredich .
Isolation of Salmonella typhimurium cys genes by transduction using a library of recombinant plasmids packaged in phage P22HT capsids .
Isolation of acetylseryltyrosine from the chymotryptic digests of proteins of five strains of tobacco mosaic virus .
Reaction of anhydrous formic acid with proteins .
Olsson , A. , T. Moks , M. Uhlen , and A. B. Gaal .
Uniformly spaced banding pattern in DNA sequencing gels by use of field-strength gradient .
Ostrowski , J. , and D. Hulanicka .
Constitutive mutation of cysJIH operon in a cysB deletion strain of Salmonella typhimu-rium .
Ostrowski , J. , G. Jagura-Burdzy , and N. M. Kredich .
DNA sequences of the cysB regions of Salmonella typhimurium and Escherichia coli .
Pasternak , C. A. , R. J. Ellis , M. C. Jones-Mortimer , and C. E. Crichton .
The control of sulfate reduction in bacteria .
Raibaud , O. , and E. Richet .
Maltotriose is the inducer of the maltose regulon of Escherichia coli .
Raibaud , O. , and M. Schwartz .
Positive control of transcription initiation in bacteria .
Sakami , W. , and G. Toennies .
The investigation of amino-acid reactions by methods of non-aqueous titrimetry .
Sanderson , K. E. , and J. R. Roth .
Linkage map of Salmonella typhimurium , edition VI .
Sanger , F. , S. Nicklen , and A. R. Coulson .
DNA sequencing with chain-terminating inhibitors .
Siegel , L. M. , and P. S. Davis .
Reduced nicotinamide adenine dinucleotide phosphate-sulfite reductase of Enterobac-IV .
coli hemoflavoprotein : subunit ture and dissociation into hemoprotein and flavoprotein components .
Siegel , L. M. , P. S. Davis , and H. Kandn .
Reduced nicotinamide adenine dinucleotide phosphate-sulfite reductase of Enterobacteria .
The Escherichia coli hemoflavoprotein : catalytic parameters and the sequence of electron flow .
Seigel , L. M. , H. Kamin , D. C. Rueger , R. P. Presswood , and Q. H. Gibson .
An iron-free sulfite reductase flavoprotein from mutants of Salmonella typhimurium , p. 523-553 .
In H. Kamin ( ed .
University Park Press , Baltimore .
Vogel , H. J. , and D. M. Bonner .
Acetylornithinase of Escherichia coli : partial purification and some properties .
Yanisch-Perron , C. , J. Viera , and J. Messing .
Improved M13 phage cloning vectors and host strains : nucleotide sequences of the M13mpl8 and pUC19 vectors .