for carAB in Regulation of Tandem Promoters Salmonella typhimurium Pyrimidine CHUNG-DAR LU ,1 MOGENS KILSTRUP ,2 JAN NEUHARD ,2 AND AHMED ABDELAL1 * Laboratory for Microbial and Biochemical Sciences , Georgia State University , Atlanta , Georgia 30303,1 and Institute of Biological Chemistry B , University of Copenhagen , Copenhagen , Denmark2 Received 20 April 1989/Accepted 12 July 1989 The carAB operon of Salmonella typhimurium encodes the two subunits of the enzyme carbamoylphosphate synthetase .
Transcription of the operon is initiated at tandem promoters that are subject to control by pyrimidines and arginine .
Pyrimidine regulation was examined by quantitative primer-extension experiments under conditions in which densitometric measurements of the transcripts were linear with the amount of RNA .
RNA was obtained from mutant strains that permit manipulations of pyrimidine nucleotide pools .
The data showed that a uridine nucleotide repressed the upstream promoter ( P1 ) , whereas arginine repressed the downstream promoter ( P2 ) .
Exogenous cytidine , which increased the intracellular CTP pool in certain mutant strains , did not affect either promoter .
However , CTP limitation resulted in derepression of the pyrimidinespecific promoter as well as the downstream arginine-specific promoter .
The effect of pyrimidines on P2 was confirmed in a carA : : lacZ-transcriptional-fusion in which the activity of the pyrimidine-specific promoter was abolished .
Primer extension experiments with an argR : : TnlO derivative showed that repression of P1 by uridine nucleotides did not require a functional arginine repressor and that repression of P2 by arginine did not interfere with elongation of transcripts initiated at the upstream P1 promoter .
Carbamoylphosphate synthetase ( CPSase ) in Salmonella typhimurium ( 1 ) and Escherichia coli ( 11 ) catalyzes the synthesis of carbamoylphosphate , a common precursor for arginine and pyrimidines ( Fig. 1 ) .
The two subunits of the enzyme are encoded by the carAB operon , the transcription of which is cumulatively repressed by arginine and pyrimi-dines ( 11 , 21 ) .
Recent studies ( 21 ) with S. typhimurium showed that transcription of the carAB operon is initiated at tandem promoters ( Fig. 2A ) .
As is the case with E. coli ( 5 , 7 , 11 , 30 ) , transcription from the upstream promoter ( P1 ) is subject to pyrimidine control , and transcription from the downstream promoter ( P2 ) is negatively controlled by arginine ( 21 ) .
The P2 region contains two 18-base-pair ( bp ) sequences homologous to the ARG box that characterizes operator sequences sensitive to the arginine repressor ( 11 ) .
The sequence of the P1 region does not show any features resembling the attenuators preceding the pyrBI ( 32 , 36 ) or pyrE ( 4 ) operon .
Both of these operons have been shown to be regulated through a UTP-sensitive attenuation control mechanism ( 4 , 10 , 32 , 36 ) .
In the case of pyrBI , recent studies ( 25 ) indicate that an additional mechanism , the nature of which is unknown , contributes to pyrimidine regulation of this operon .
Studies with pyrC ( 29 , 39 ) , pyrD of ( 22 ) , and pyrF ( 35 , 37 ) indicate that regulation expression of these genes does not involve attenuation control mecha-of and pyrE , the nisms .
Thus , with the exception pyrBI mechanisms that control expression of genes of pyrimidine biosynthesis are yet to be elucidated .
Studies with mutant strains of S. typhimurium that permit nucleotide ( 20 , 34 ) led manipulations of individual pools to the conclusion that expression of pyrB , pyrE , and pyrF is repressed by a uracil nucleotide different from UMP , whereas pyrC and pyrD expression is controlled primarily by a cytosine nucleotide other than CMP .
It has recently been and nucleotides reported ( 18 , 21 ) that both uracil cytosine control carAB expression in S. typhimurium .
The present article deals with the specific effects of cytidine and uridine nucleotides on expression of carAB .
We report quantitative primer-extension experiments in mutant strains that permit manipulations of pyrimidine nucleotide pools .
The results show that exogenous uridine negatively controls the activity of the upstream promoter ( P1 ) , whereas exogenous cytidine does not affect carAB expression .
Surprisingly , CTP limitation results in derepression not only of P1 but also of the downstream promoter ( P2 ) .
The downstream promoter was previously believed to be controlled only by arginine .
The effect of pyrimidines on P2 is supported by experiments with a carA : : lacZ-transcriptional-fusion in which the activity of P1 is abolished .
Primer extension experiments also showed that repression of the downstream promoter by arginine does not interfere with the elongation of transcripts initiated at the upstream promoter .
MATERIALS AND METHODS Strains .
All strains used were derivatives of Salmonella LT2 .
Strain AA57 ( argR : : TnJO ) was derived typhimurium KR62 provided by R. A. Kelln from ( proAB21 argR : : TnJO ) , ( 12 ) .
Strain KD1109 ( cdd4 ) was also obtained from R .
Strain JL1280 ( pyrGJ611 cdd-7 udp-2 glpT ) was obtained from J. L. Ingraham ( 3 ) .
The pyrG1611 mutation is leaky , and the CTP synthetase encoded by this allele is more labile than the wild-type enzyme .
Cells were suspended in 100 mM potassium ( pH 7.5 ) containing 0.5 mM EDTA , and cell phosphate extracts were prepared by sonic disruption or passage an Aminco French pressure cell .
CPSase activity through of into carwas assayed by incorporation [ ' 4C ] bicarbonate activities were bamoylphosphate ( 1 ) .
Enzyme computed from results obtained with reaction mixtures containing less than 100 of p.g protein ( reaction rates are not proportional to enzyme concentrations at higher protein levels ) .
Dihydro-orotase ( 39 ) , , B-galactosidase ( 27 ) , and r-lactamase ( 15 ) were assayed as described previously .
Cells were labeled for at least one generation of exponential-growth in the Trisbuffered medium of Irr and Gallant ( 16 ) containing 0.3 mM 32Pi with a specific activity of 33 Ci/mol .
Extraction of cells and thin-layer chromatographic separation of nucleoside triphosphates were done as described by Jensen et al. ( 19 ) .
The cultures were grown in minimal-medium ( 38 ) supplemented with 0.2 % glucose and arginine ( 100 , ug/ml ) , cytidine ( 1 mM ) , or uridine ( 1 mM ) where indicated .
A 10-ml sample of logarithmically growing culture ( OD6w , 0.5 ) was added to the RNA extraction buffer containing 10 % sodium dodecyl sulfate at 65 °C , and RNA was extracted quantitatively by the procedure described by Hagen and Young ( 13 ) .
In one experiment ( KD1109 ) , RNA was extracted by the procedure described by Aiba and co-workers ( 2 ) .
All solutions were made with 0.2 % dieth-ylpyrocarbonate-treated water .
The final RNA precipitate was dissolved in 100 pl of 10 mM Tris hydrochloride ( Tris-HCl ) ( pH 8.0 ) containing 1 mM EDTA .
The RNA concentration was determined by measuring the OD26 .
The quality of the RNA was monitored by electrophoresis on a 1 % agarose gel in sodium phosphate buffer ( pH 7.0 ) after denaturation of the RNA with glyoxal as described by Lehrach and co-workers ( 23 ) .
A synthetic oligonucleotide primer complementary to codons 8 to 13 of the carA gene was prepared with an Applied Biosystems model 381 DNA synthesizer .
The primer was applied to a 20 % polyacryl-amide gel and detected by UV shadowing as described by the manufacturer ( Applied Biosystems ) .
The purified primer was eluted from the gel with a C-18 cartridge ( Waters 543 Associates ) .
Purification of the oligonucleotide primer significantly improved the quality of primer-extension experiments .
The primer was labeled at the 5 ' end by phosphorylation with polynucleotide kinase and [ - y-32P ] ATP ( 6,000 Ci/mmol ; New England Nuclear Corp. ) .
The reaction mixture was extracted with phenol and chloroform , and the labeled primer was precipitated by adding 1/10 volume of 4 M ammonium acetate and 2 volumes of ethanol and incubating for 10 min in a dry ice-ethanol bath .
The primer was collected by centrifugation ( 4 °C ) , washed with 70 % ethanol , dried under vacuum , and dissolved in water .
The labeled primer ( 10 ng ) was mixed with RNA ( 10 to 50 pg ) in 0.02 M Tris-HCl , pH 8.0 , containing 0.1 M NaCl and 0.1 mM EDTA in a 1.5-ml microfuge tube ( final volume , 30 pI ) .
The reaction mixture was incubated at 85 °C for 5 min and then transferred to 55 °C for 3 h .
The reaction mix was cooled slowly to 37 °C in a covered water bath , followed by centrifugation at 12,000 x g for 5 s. Then , 30 [ l1 of 0.2 M Tris-HCl , pH 8.0 , containing 20 mM MgCl2 , 0.1 M KCl , 10 mM dithiothreitol , 1 mM each dATP , dCTP , dGTP , and dTTP , and 200 U of cloned Moloney murine leukemia virus reverse transcriptase ( Bethesda Research Laboratories ) was added .
The reaction mix was incubated at 37 °C for 1 h , and the reaction was terminated by heating at 65 °C for 5 min .
RNA was digested by the addition of 5 pRg of pancreatic RNase A and incubation at 37 °C for 10 min .
The sample was extracted with phenol and chloroform , and the products of primer-extension were precipitated by the addition of 0.1 volume of 4 M ammoni-and 2.5 volumes of ethanol and incubation in a mum acetate dry ice-ethanol bath for 10 min .
The primer-extension products were collected by centrifugation ( 4 °C ) at 12,000 x g for 15 min , washed once with 200 , ul of 70 % ethanol , and dried in vacuo .
The sample was dissolved in 7 , l of DNA-sequencing dye , and 3 , ul was applied to a 0.2-mm sequencing 8 % polyacrylamide gel with an LKB Macrophor electro-phoresis unit .
Following electrophoresis , the gel was soaked in 10 % acetic acid for 15 min and then dried at 80 °C for 1 h. Following exposure of an X-ray film for 15 h , the relative levels of transcripts were obtained by scanning the film with an LKB Ultrascan XL laser densitometer and using an LKB 2400 Gelscan XL software package .
Figure 3A shows a photograph of an autoradiograph obtained with different concentrations of RNA from JL1280 .
The downstream promoter is represented by three bands , as previously shown in primer-extension and Si experiments ( 21 ) .
The basis for the multiple bands of P2 observed under all physiological conditions in S. typhimurium ( 21 ) as well as E. coli ( 5 , 7 ) is not known .
The peak areas obtained by densitometric measurements of the autoradiograph for P1 and P2 were plotted as a function of RNA concentrations .
The resulting graph ( Fig. 3B ) shows the linear relationship between the densitometric measurements and the amount of RNA used in primer-extension experiments .
DNA sequencing was performed by the method of Sanger et al. ( 33 ) with recombinant M13 template and the same primer that was used for primer-extension .
UTP CTP * Tdk tndk UDP CDP t1cmk CMP t pif UMP OMP Cytidine  , , Urdinee Arginine Orotate A Argiunin LJCIDihyro Urail Orotate Cod Cytosine c-d Succinate IPYTc w Citruilline Carbamoyl Aspartate Carbamoylphosphate Pi4 + DP Glutamate t Omithine 2Mg A 2MgATP-i Glutamine H03 FIG. 1 .
Pathways of arginine and pyrimidine biosynthesis .
The genes encoding the enzymes involved are indicated : argI , ornithine carbamoyltransferase ; argG , argininosuccinate synthetase ; argH , argininosuccinase ; carAB , carbamoylphosphate synthetase ; cod , cytosine deaminase ; cdd , cytidine deaminase ; cmk , cytidine mono-phosphate kinase ; ndk , nucleoside diphosphate kinase ; pyrBI , aspartate carbamoyltransferase ; pyrC , dihydroorotase ; pyrD , dihydro-orotate oxidase ; pyrE , orotate phosphoribosyltransferase ; pyrF , orotidine 5 ' - phosphate decarboxylase ; pyrG , CTP synthetase ; pyrH , UMP kinase ; udk , uridine kinase ; udp , uridine phosphorylase ; upp , uracil phosphoribosyltransferase .
RESULTS Repression of P1 and P2 by uridine and arginine .
In wild-type S. typhimurium and E. coli , exogenous cytidine is rapidly and quantitatively converted to uridine by cytidine deaminase , encoded by cdd ( 3 , 28 ) ( Fig. 1 ) .
In contrast , cdd mutants convert exogenous cytidine effectively to CTP ( 20 , 34 ) .
In such cdd mutants , the addition of uracil to the growth medium increases the UTP pool and to a lesser extent th 2MgATP-i Glutamine H03 FIG. 1 .
Pathways of arginine and pyrimidine biosynthesis .
The genes encoding the enzymes involved are indicated : argI , ornithine carbamoyltransferase ; argG , argininosuccinate synthetase ; argH , argininosuccinase ; carAB , carbamoylphosphate synthetase ; cod , cytosine deaminase ; cdd , cytidine deaminase ; cmk , cytidine mono-phosphate kinase ; ndk , nucleoside diphosphate kinase ; pyrBI , aspartate carbamoyltransferase ; pyrC , dihydroorotase ; pyrD , dihydro-orotate oxidase ; pyrE , orotate phosphoribosyltransferase ; pyrF , orotidine 5 ' - phosphate decarboxylase ; pyrG , CTP synthetase ; pyrH , UMP kinase ; udk , uridine kinase ; udp , uridine phosphorylase ; upp , uracil phosphoribosyltransferase .
CTP pool , whereas the addition of cytidine increases the CTP pool about twofold without affecting the UTP pool significantly ( 20 , 34 ) .
Strain KD1109 was grown in the absence and presence of uridine , cytidine , or arginine , and quantitative primer-extension experiments were carried out as described under Materials and Methods .
The results ( Table 1 ) show that exogenous uridine and exogenous arginine significantly repressed P1 and P2 , respectively .
In contrast , exogenous cytidine had no significant effect on either P1 or P2 expression .
Dihydro-orotase , assayed in the same cultures , was repressed by exogenous cytidine .
Dihydroorotase has been shown previously to be primarily controlled by a cytidine nucleotide ( 20 , 34 ) and can thus serve as an index of the intracellular CTP pool in the cultures used for primer-extension and CPSase assay .
Figure 4 shows the results of another experiment with KD1109 in which the X-ray film was exposed for 72 h rather than the 15 h required for the densitometric measurements .
The photograph clearly shows that exogenous cytidine did not repress P1 activity .
The absence of repression by exogenous cytidine in strain KD1109 ( cdd4 ) was reproducible .
Similar results were obtained in primer-extension experiments with strains KP1968 ( cdd-2 ) and JL1278 ( cdd-7 ) .
Comparison of CPSase and dihydroorotase levels between LT2 and KD1109 ( Table 1 ) showed higher levels for these enzymes in KD1109 .
A higher level of omithine carbamoyltransferase in KD1109 relative to LT2 was also noted in an earlier report ( 20 ) .
The basis for the differences in the levels of the three enzymes between KD1109 and LT2 is not known .
This variation in enzyme levels does not affect the conclusion about the lack of repression by exogenous cytidine , since this observation applies to a number of cdd derivatives regardless of the CPSase levels in cultures grown in glucose minimal-medium .
Both P1 and P2 are derepressed upon cyde limitation .
The effect of cytidine limitation was examined in strain JL1280 , which harbors a bradytrophic mutation in pyrG ( CTP synthetase ) as well as a cdd mutation ( Fig. 1 ) .
When this strain was grown in the absence of exogenous cytidine , the CTP pool was reduced and the UTP pool was elevated ( Table 2 ) .
The results of primer-extension experiments are shown in Table 1 and Fig. 5 ( the X-ray film was exposed for 15 h for densitometric measurements and 72 h for photography ) .
Under conditions of cytidine limitation , in which derepressed synthesis of CPSase and dihydroorotase was observed , both P1 and P2 were derepressed , despite the elevated UTP pool ( Table 1 ) .
Addition of exogenous uridine did not affect the low CTP pool but increased the UTP pool even further ( Table 2 ) .
This growth-condition , which resulted in repressed CPSase levels but high levels of dihydro-orotase , caused repression of P1 and a slight lowering of the elevated P2 level ( Table 1 ) .
These results were reproducible and establish that P2 is also controlled by pyrimidines .
Consistent with this conclusion , cytidine starvation decreased arginine repression of P2 ( Table 1 ) .
Pyridmidine control of P1 is maint ined i an arR background .
The results of primer-extension experiments with strain AA57 ( argR : : TnlO ) are shown in Table 1 .
These results show that repression of P1 by pyrimidines does not require a functional argR product .
Transcriptional fusion experiments confirm the effect o LU ET AL. .
A CARATTTGACCATTTGGTCCACTTTTTATCATGCCAGCCAGTTTTTTGCGAACTCAAGGAA GCGCMSGCGTTTTCTATCGTAACTTIGTTGATCTTTTTGCCTCTTAAACAGAATAACTTCC -35 P1 TTATAATGTGCAAAATAACATAAAAAACACCCTCTTTATGTTGACTTTTATCCGGCTTAAC -1 P1i -35 P2 TTCR6IITGCCGCCGTTTGCCAGOAATCCACGGGTAACCAAATTTGCATTGCTTC * TACTG -1 P2 * .
S.D. ACTGROTGSATTABTATGCCTAAAGTGAGTGAATATTCTCTiIIII6GTGTT TTG ATT arg-box arg-box fNET Ile B dJVO ucs SW `` p1 c I pmml Hinl Fp 6TTGACT b a PUKUJ -- Al , -- b i. L-i-L GTTAAC pMK52 ATC 6ACT l I S bp FIG. 2 .
( A ) Nucleotide sequence of the carAB control region of S. typhimurium ( 21 ) .
The -10 and -35 regions for the pyrimidine-specific promoter ( P1 ) and the arginine-specific promoter ( P2 ) are overlined and labeled .
Asterisks indicate the transcriptional initiation sites corresponding to the tandem promoters .
The operator sites for the arginine repressor are underlined and labeled arg-box .
The Shine-Dalgarno sequence is overlined and labeled S.D. ( B ) Structure of carA : : lacZ operon fusion plasmids .
The expression vector pMM1 ( 21 ) contains the multiple cloning sites ( MCS ) of pUC8 followed by a 96-bp leader with translational stops in all three reading frames .
Translation of the lacZ gene is initiated at the lacZ ribosome-binding site .
Open bars , lacZ structural gene ; shaded bars , carA structural gene ; open boxes , operator sites ; solid boxes , promoter -35 and -10 regions ; open arrows , mRNA start points ; thin arrows , repeated sequences .
Relationship between the amount of RNA used in primer-extension experiments and the peak areas obtained from densitometric measurements .
The RNA used was obtained from strain JL1280 grown in glucose minimal-medium at 37 °C .
( A ) Products of primer-extension with different amounts of RNA .
Lane 1 , 48 , ug ; lane 2 , 36 , ug ; lane 3 , 24 , ug ; lane 4 , 12 , ug .
The dideoxy ladder shown to the right of the autoradiogram was generated with the same primer used for extension .
( B ) Peak areas obtained from densitometric measurements of the autoradiogram plotted as a function of RNA concentration .
The values indicated for P2 represent the sum of the peak areas for the three bands associated with this promoter .
We described earlier ( 21 ) the construction of carA : : lacZ operon fusions on a low-copy-number plasmid .
Figure 2B shows the structure of two carA : : lacZ-fusions used in this work .
pMK50 contains a chromosomal fragment carrying the two promoters , the upstream region , and the first 340 bp of the structural gene encoding the small subunit .
pMK52 carries a deletion of all sequences upstream of the P1 promoter , and the -35 region of P1 is changed from TTGACT to TCGACT , resulting in abolishment of P1 activity ( 21 ) .
The plasmid used is temperature sensitive for replication .
Accordingly , expression of carA was studied by measuring the P-galactosidase levels in strain JL1280 at 30 °C , at which the low copy number is maintained .
The results with pMK50 ( Table 3 ) show that under conditions of cytidine limitation , transcription of carAB was significantly regulated with cytidine or uridine .
In the case of pMK52 , transcription from P2 was significantly regulated by cytidine and somewhat less by uridine .
As expected , arginine resulted in strong repression of P2 activity in pMK52 .
However , fully repressed levels of P2 were only obtained in the presence of both arginine and cytidine .
The data in Table 3 also indicate that P1 was significantly more sensitive than P2 to the presence of both cytidine and uridine .
Thus , in the case of pMK50 with arginine ( i.e. , P1 ) , addition of cytidine reduced the specific activity by 3.6-fold ( 7,650 versus 2,120 U ) , whereas cytidine plus uridine reduced it 10-fold ( 7,650 versus 748 U ) .
In contrast , with pMK52 ( i.e. , P2 ) , cytidine reduced expression 2.5-fold ( 1,930 versus 782 U ) , and cytidine plus uridine reduced it only slightly more , i.e. , 2.7-fold .
Comparison of transcript and CPSase levels .
Examination of the data presented in Table 1 shows reasonable correspondence within each experiment between CPSase levels and the sum of P1 and P2 transcripts .
These results indicate that the translational efficiencies of P1 and P2 mRNA do not differ significantly in S. typhimurium .
fw -- r -- a-u a. 3 U pi 0 4 3 ii U U ' U go P2I .
40 w `` ae la A 3 DISCUSSION This article reports primer-extension experiments with cd 2 derivatives of S. typhimurium that are blocked in the conversion of exogenous cytidine to uridine ( cdd ; Fig. 1 ) .
In such strains , exogenous cytidine specifically increases the CTP pool without affecting the UTP pool , whereas exogenous uridine increases the UTP pool and to a lesser extent the CTP pool ( 20 , 34 ) .
The results obtained with KD1109 ( Table 1 ) establish that exogenous uridine and exogenous arginine repress P1 and P2 , respectively .
However , exogenous cytidine , which swells the intracellular CTP pool , has no effect on transcriptional initiation of carAB in the cdd derivative .
Dihydroorotase , which has been shown to be controlled by a cytosine nucleotide ( 20 , 34 ) , was repressed in the same cultures under these conditions ( Table 1 ) .
The primer-extension data with strain JL1280 ( pyrG cdd ) not only revealed that CTP limitation results in derepression of P1 but also of P2 ( Table 1 ) .
The effect of pyrimidines on the activity of the two promoters was confirmed with the transcriptional-fusions pMK50 and pMK52 , of which pMK52 lacks P1 activity ( Fig. 2B and Table 3 ) .
The effect of pyrimidines on P2 is surprising , since this promoter overlaps the two ARG boxes for carAB ( Fig. 2A ) .
The two ARG boxes are similar to the operator modules for the arginine regulon ( 11 ) , and a recent report by Charlier et al. ( 7 ) has shown that the purified arginine repressor ( 24 ) protects the ARG boxes of the E. coli carAB operon against DNase I h-cents 4 a ) 0 20 40 RNA ( , gg ) The nucleotide sequence of argR from S. typhimurium was recently determined ( C. Lu and A. Abdelal , manuscript in preparation ) .
The deduced amino-acid sequence for the arginine repressor from S. typhimurium exhibits 95 % homolglucose minimal-medium ; lane 2 , 1 mM cytidine ; lane 3 , 1 mM uridine ; lane 4 , 100 p.g of arginine per ml .
The X-ray film was ogy with its counterpart from E. coli ( 24 ) .
The interactions of the two repressors with the carAB control regions are thus expected to be very similar .
No equivalent data on the effect of pyrimidine limitation on the arginine-specific promoter reported here for S. typhi-murium are available for E. coli .
However , Charlier et al. ( 7 ) reported Si nuclease mapping experiments in E. coli which indicate that the simultaneous presence of pyrimidines and arginine represses P2 more efficiently than arginine alone .
These authors also concluded from experiments with carA : : lacZ-fusions that this intensification of arginine repression by pyrimidines of P2 expression does not occur when P1 is inactive ( 7 ) .
These results contrast with the data reported here ( Table 3 ) that indicate the presence of pyrimidine control of P2 in a carA : : lacZ fusion in which P1 is inactive .
In fact , the results with this fusion also show intensification of arginine repression of P2 by pyrimidines .
The differences between the results reported here and those reported for E. coli may reflect the use of a high-copy-number vector in the studies reported by Charlier et al. ( 7 ) .
We recently reported primer-extension experiments with S. typhimurium ( 21 ) , which indicate the absence of pyrimidine control of transcriptional initiation under high-copy conditions .
Similarly , uracil repression was also reported to be absent in a high-copy-number carA : : lacZ-transcriptional-fusion in E. coli by Bouvier et al. ( 5 ) .
The escape from pyrimidine control suggests the involvement of a titratable regulatory element in pyrimidine control of carAB .
In such a case , the pyrimidine effect on P2 could reflect protein-protein interactions be ¬ 00 TABLE 2 .
Nucleoside triphosphate pools for strain JL1280 ' Addition Pool size ( nmol/mg [ dry wt ] of cells ) to medium ATP GTP CTP UTP None 8.9 4.2 0.4 8.3 Cytidine 5.1 2.4 2.3 1.5 Uridine 6.6 2.5 0.4 11.8 '' Strain JL1280 ( pyrG cdd ) was grown at 37 °C in low-phosphate mbinimal medium ( 16 ) with glucose as the carbon source .
Cytidine or uridine was added at 1 mM as indicated tween the arginine repressor and a putative pyrimidine-regulatory protein .
One candidate for pyrimidine-regula-a tory protein is the product of the use gene ( 6 ) .
A mutation in this gene results in temperature-dependent sensitivity to uracil ( 6 ) , an effect shown to be exerted at P1 of the carAB operon ( 21 ) .
The results presented in Table 1 clearly show that repression of P2 by arginine does not interfere with elongation of transcripts initiated at P1 , 69 nucleotides upstream of P2 .
These results contrast with those obtained with lac ( 14 ) and a Cells were grown in AB medium ( 9 ) at 30 ` C .
The following additions were made as indicated : Arg , arginine at 100 pLg/ml ; CR , 1 mM cytidine ; UR , 1 mM uridine .
b Values were normalized relative to P-lactamase encoded by the plasmids .
Protein was determined by the method of Lowry et al. ( 26 ) .
Numbers in parentheses indicate percentage of activity with no addition .
aroP ( 8 ) , in which a repressor bound at a downstream site from the transcription initiation site was effective in preventing elongation by RNA polymerase .
Finally , it should be pointed out that nucleotide sequences resembling the consensus PUR box ( 31 ) are located in the carAB region ; one ( AAGCGCAAGCGTTTTCTA ) is found approximately 100 bp upstream of P1 , and the other is located 660 bp into the coding region of carA ( L. M. Meng and M. Kilstrup , personal communication ) .
The PUR box characterizes operator sequences for certain genes of purine biosynthesis that are regulated by the product of purR ( 31 ) .
The significance of the finding that sequences resembling the PUR box are present in the carAB operon is not clear .
Purines have been previously shown to affect expression of the pyr genes in S. typhimurium ( 17 , 18 ) ; however , their exact role in carAB regulation is not known .
Regulation of levels of P1 and P2 transcripts and CPSase Transcript levelb % of total Addition ( s ) to medium `` i1 t ( rPa1nscriPp2t ) s + Sp act ( nmollmin per mg of protein ) CPSase Dihydroorotase Strain Expt no .
( relevant genotype ) None 1.8 0.5 5.1 50 1 LT2Z ( wild type ) 2 KD1109 ( cdd ) None CR UR Arg 1.5 1.4 0.3 1.3 1.1 1.1 1.1 0.3 100 96 54 61 10.0 ( 100 ) 8.9 ( 89 ) 5.2 ( 52 ) 7.7 ( 77 ) 100 38 48 100 3 JL1280 ( pyrG cdd ) None CR 4.4 1.5 0.9 4.4 1.6 0.9 1.3 0.7 100 41 37 85 18.9 ( 100 ) 8.0 ( 42 ) 7.0 ( 37 ) 18.2 ( 96 ) 210-23-180-220 UR Arg AA57 ( argR : : TnJO ) Arg 1.8 3.24 100 10.8 ( 100 ) 37 Arg , UR 0.4 3.20 71 8.7 ( 81 ) 17 4 a Cultures were grown at 37 °C in glucose minimal-medium ( 38 ) with the indicated additions : Arg , 100 p.g of arginine per ml ; CR , 1 mM cytidine ; UR , 1 mM uridine .
b Transcript levels represent peak areas obtained by densitometric measurements of autoradiograms from primer-extension experiments .
c Numbers in parentheses represent percent CPSase activity , with the level in the absence of pyrimidines taken as 100o .
CPSase assays were done in duplicates that varied within 2 % .
However , it is less accurate to compare CPSase levels between different experiments because of the difficulty in making precise determination of the specific radioactivity of preparations of [ 14C ] bicarbonate .
Dihydroorotase assays were also done in duplicates that varied less than 7 % .
Nucleoside triphosphate pools for strain JL1280 ' FIG. 4 .
Primer extension experiments with strain KD1109 ( cdd ) .
ed 25 containg of RNA .
Lane 1 , No additions to exposed for 72 h .
A C G T 1 2 3 4 3 ~ ~ d ~ ~ P ~ i A dm - ¬ as - a * s o .
a We are grateful to Barbara Baumstark for careful review of the manuscript .
This work was supported in part by a research grant from the National Science Foundation ( PCM-8315759 ) to Ahmed Abdelal , a grant from the Danish Natural Science Foundation to Jan Neuhard , and a grant from the Danish Center for Microbiology to Mogens Kilstrup .
Abdelal , A. , and J. L. Ingraham .
Carbamoylphosphate synthetase from Salmonella typhimurium .
Regulation , subunit composition , and function of the subunits .
Aiba , H. , S. Adhya , and B. De Crombrugghe .
Evidence for two functional gal promoters in intact Escherichia coli cell .
Beck , C. F. , and J. L. Ingraham .
Location on the chromosome of Salmonella typhimurium genes governing py-rimidine metabolism .
Bonekamp , F. , K. Clemmesen , 0 .
Karlstrom , and K. F. Jensen .
Mechanism of UTP-modulated attenuation at the pyrE gene of Escherichia coli : an example of operon polarity control through the coupling of translation to transcription .
Bouvier , J. , J. C. Patte , and P. Stragier .
Multiple regulatory signals in the control region of the Escherichia coli carAB operon .
Bussey , L. B. , and J. L. Ingraham .
A regulatory gene ( use ) affecting the expression of pyrA and certain other pyrimidine genes .
Charlier , D. , G. Weyens , M. Roovers , J. Piette , C. Bocquet , A. Pierard , and N. Glansdorff .
Molecular interactions in the control region of the carAB operon encoding Escherichia coli carbamoylphosphate synthetase .
Chye , M.-L. , and J. Pittard .
Transcription control of the aroP gene in Escherichia coli K-12 : analysis of operator mutants .
Clark , D. J. , and D. Maaloe .
DNA replication and the division cycle in Escherichia coli .
Clemmesen , K. , F. Bonekamp , 0 .
Karlstrom , and K. F. Jensen .
Role of translation in the UTP-modulated attenuation at the pyrBI operon of Escherichia coli .
Cunin , R. , N. Glandsdorff , A. Pierard , and V. Stalon .
Arginine biosynthesis and metabolism in bacteria .
Gardner , M. M. , D. 0 .
Hennig , and R. A. Kelln .
Control of arg gene expression in Salmonella typhimurium by the arginine repressor from Escherichia coli K-12 .
Hagen , F. S. , and E. T. Young .
Effect of RNase III on efficiency of translation of bacteriophage T7 lysozyme mRNA 14 .
Herrin , G. I. , and G. N. Bennett .
Role of DNA regions flanking the tryptophan promoter of Escherichia coli .
Insertion of lac operator fragments .
Cloning and characterization of the prs gene encoding phosphoribosylpyrophosphate synthetase of Escherichia coli .
Irr , J. , and J. Gallant .
The control of ribonucleic acid synthesis in Escherichia coli .
Stringent control of energy metabolism .
Apparent involvement of purines in the control of expression of Salmonella typhimurium pyr genes : analysis of a leaky quaB mutant resistant to pyrimidine analogs .
Regulation of Salmonella typhimurium pyr gene expression : effect of changing both purine and pyrimidine nucleotide pools .
Jensen , K. F. , U. Houlberg , and P. Nygaard .
Thin-layer chromatographic methods to isolate 32P-labeled 5-phosphoribo-syl-1-pyrophosphate ( PRPP ) : determination of cellular PRPP pools and assay of PRPP synthetase activity .
Kelln , R. A. , J. J. Kinahan , K. F. Foltermann , and G. A. O'Donovan .
Pyrimidine biosynthetic enzymes of Salmo-nella typhimurium , repressed specifically by growth in the presence of cytidine .
Kilstrup , M. , C. Lu , A. Abdelal , and J. Neuhard .
Nucle-otide sequence of the carA gene and regulation of the carAB operon in Salmonella typhimurium .
Larsen , J. N. , and K. F. Jensen .
Nucleotide sequence of the pyrD gene of Escherichia coli and characterization of the flavoprotein dihydroorotate dehydrogenase .
Lehrach , H. , D. Diamond , J. M. Wozney , and H. Biedtker .
RNA molecular weight determination by gel electrophoresis under denaturing conditions : a critical reexamination .
Lim , D. , J. D. Oppenheim , T. Echhardt , and W. K. Maas .
Nucleotide sequence of the argR gene of Escherichia coli K12 and isolation of its product , the arginine repressor .
Liu , C. , and C. L. Turnbough .
Multiple control mechanisms for pyrimidine-mediated regulation of pyrBI operon expression in Escherichia coli K-12 .
H. , N. J. Rosebrough , A. L. Farr , and R. J. Randall .
Protein measurement with the Folin phenol reagent .
Experiments in molecular genetics .
Cold Spring Harbor Laboratory , Cold Spring Harbor , N.Y. 28 .
Neuhard , J. , and J. L. Ingraham .
Mutants of Salmonella typhimurium requiring cytidine for growth .
Neuhard , J. , E. Stauning , and R. A. Kelgn .
Cloning and structural characterization of the Salmonella typhimurium pyrC gene encoding dihydroorotase .
Piette , J. , J. Nyunoya , C. Lusty , R. Cunin , G. Weyens , M. Crabeel , D. Charlier , N. Glandsdorff , and A. Pierard .
DNA sequence of the carA gene and the control region of carAB .
Tandem promoters respectively controlled by arginine and the pyrimidines regulate the synthesis of carbamoylphosphate synthetase in Escherichia coli K-12 .
Rolfes , R. J. , and H. Zalkin .
Escherichia coli gene purR encoding a repressor protein for purine nucleotide synthesis .
Cloning , nucleotide sequence , and interaction with the purF operator .
Roof , W. D. , K. F. Feltermann , and J. R. Wild .
The organization and regulation of the pyrBI operon in E. coli includes a p-independent attenuator sequence .
Sanger , F. , S. Nicklen , and A. R. Coulson .
DNA sequencing with chain-terminating inhibitors .
Schwartz , M. , and J. Neuhard .
Control of expression of the pyr genes in Salmonella typhimurium : effects of variations in uridine and cytidine nucleotide pools .
Theisen , M. , R. A. Kelln , and J. Neuhard .
Cloning and characterization of the pyrF operon of Salmonella typhimurium .
Turnbough , C. L. , K. L. Hicks , and J. P. Donahue .
Attenuation control of pyrBI expression in Escherichia coli K-12 .
Turnbough , C. L. , K. H. Kerr , W. R. Funderburg , J. P. Donahue , and F. E. Powell .
Nucleotide sequence and characterization of the pyrF operon of Escherichia coli K-12 .
Vogel , H. J. , and D. M. Bonner .
Acethylornithinase of Escherichia coli : partial purification and some properties .
Wilson , H. R. , P. T. Chan , and C. L. Turnbough , Jr. 1987 .
Nucleotide sequence and expression of the pyrC gene of Esch-erichia coli K-12 .