171 , No. 11 Mutational Analysis of the Histidine Operon Promoter of Salmonella typhimurium RICHARD F. SHAND , ' t PAUL H. BLUM ,1 t DONALD L. HOLZSCHU ,1 § MICKEY S. URDEA ,2 AND STANLEY W. ARTZl * Department of Microbiology , University of California , Davis , California 95616,1 and Chiron Corporation , Emeryville , California 946082 We isolated a colection of 67 independent , spontaneous Salmonella typhimwium his operon promoter mutants with decreased his expression .
The mutants were isolated by selecting for to the toxic lactose analog o-nitrophenyl-o-D-thiogalactoside in a his-lac fusion strain .
The colection iuded bae pair substitutions , small insertions , a deltion , and one large insertion identified as IS30 ( IS121 ) , which is resident on the Mu dl cts ( Ap ' lac ) phage used to construct the his-lac fusion .
Of the 37 mutations that were sequenced , 14 were unique .
Six of the 14 were isolated more than once , with the IS30 insertion occurring 16 times .
The mutations were located throughout the his promoter region , with two in the conserved -35 hexamer sequence , four in the conserved -10 hexamer sequence ( Pribnow box ) , seven in the spacer between the -10 aad -35 hexamer sequences , and the IS30 insertions just upstream of the -35 hexamer sequence .
Four of the five substitution mutations changed a consensus base pai recognized by Eu7 RNA polymerase in the -10 or -35 hexamer .
Decreased his expression caused by the 14 different his promoter mutations was measured in-vivo .
Relative to the wild-type promoter , the mutations reswlted in as little as a 4-fold decrease to as much as a 357-fold decrease in his expression , with the largest decreases resulting from changes in the most highly conserved features of Eo70 promoters .
The histidine-biosynthetic operon of Salmonella typhimu-rium and Escherichia coli is physically organized into eight structural genes preceded by a promoter-regulatory region ( reviewed in references 2 , 5 , and 33 ) .
The his structural genes of S. typhimurium have been extraordinarily well characterized by mutant analysis ( 16 ) , and the complete DNA sequence of the E. coli his operon has been determined .
Similarly , the his attenuation mechanism has been extensively characterized genetically and is well understood .
In contrast , the his promoter is presently defined by a DNA sequence and the location of a transcription startpoint .
There has not been an extensive genetic analysis relating the DNA sequence to RNA polymerase-promoter interaction and regulation of transcription initiation .
The histidine operon is under positive control of the `` alarmone '' guanosine-5 ' - diphosphate 3 ' - diphosphate ( ppGpp ) ( reviewed in references 2 , 8 , and 33 ) .
The molecular mechanism ( s ) involved in ppGpp regulation remains elusive , although the his promoter has been implicated as the target site of the regulation ( 26 ) .
Changes in ppGpp levels are positively correlated with changes in his expression in-vitro : his expression is stimulated 10-to 20-fold by physiological concentrations ( 50 to 100 puM ) of ppGpp ( 26 , 31 ) .
Positive correlations between ppGpp levels and his expression over a 20-to 60-fold range are found in-vivo under conditions of mild amino-acid starvation ( 29 , 31 ) .
In addition , positive correlations have also been shown in-vivo by using mutants with altered ppGpp levels ( 28 , 34 ) .
t Present address : Department of Biochemistry/Biophysics , University of California , San Francisco , CA 94143 .
t Present address : Department of Microbiology and Immunology , Stanford University , Stanford , CA 94305 .
§ Present address : Exploratory Sciences Division , Eastman Kodak Co. , Rochester , NY 14650 .
A large collection of his promoter mutations would be useful to ( i ) determine whether his expression is controlled by one or more than one promoter , ( ii ) characterize the his promoter with respect to sigma factor utilization , and ( iii ) identify additional sequences involved in ppGpp regulation ( 26 ) .
In our genetic characterization of the his promoter , we decided to select mutations that decrease his expression , since some of these mutations might concomitantly reduce the positive effect correlated with ppGpp .
The o-nitrophenyl-3-D-thiogalactoside ( TONPG ) selection used by Hopkins ( 18 ) to isolate mutants with reduced lac operon expression in E. coli was adapted for use in a his-lac fusion strain of S. typhimurium .
TONPG selection has been used successfully in E. coli to isolate promoter mutations in both the lac operon ( 18 ) and the tyrT gene ( 4 ) .
In this article , we report the isolation , DNA sequence determination , and effects on his expression of spontaneous his operon promoter mutations .
MATERIALS AND METHODS Bacterial strains , phage , media , and reagents .
The S. typhimurium strains used in this work are listed in Table 1 .
Generalized transduction with bacteriophage P22 HT105/int -201 was carried out as described before ( 11 ) .
Complex media were ( i ) nutrient broth ( NB ; Difco Laboratories ) , containing 0.5 % ( wt/vol ) NaCl , and ( ii ) supplemented NB , containing 0.4 % ( wt/vol ) glucose , 1 x VB salts ( 11 ) , and 0.75 mM L-serine ( SNB medium ) ( 29 ) .
TONPG selection plates were N-C-medium ( 1 ) supplemented with 0.4 % ( wt/vol ) sodium citrate .
2H20 , 10 mM NH4Cl , 0.26 mM L-histidine , 0.36 mM uracil , and 1 mM TONPG .
TONPG was prepared as a 100 mM stock solution in dimethyl sulfoxide , and 0.2 ml was spread onto the surface of the plate to give a concentration of -1 mM .
The TONPG was allowed to diffuse into the agar at room temperature for several hours before use .
633 AZ68 onor G p Ga G D C B ( 1 ) I12 ( 2 I W AZ1413a Wild-type LT2Z B. Ames Ahis-203 B. Ames zga-607 : : TnlO relAl B. Ames dhuAI AhisGa1242 Laboratory collection pyrCIS02 ' 1 ( hisHAF-lac ) 29 AhisGa1242 AhisGal242 4 ) ( hisGD-lac ) 29 Isogenic with AZ1460 but 29 zga-607 : : TnlO relAl a Mu dl cts ( Apr lac ) fusions were isolated and immobilized as described before ( 6 ) .
The point of insertion of the Mu dl phage in strain AZ1413 was localized to the hisH , hisA , or hisF gene and in strains AZ1460 and AZ1472 to the hisG or hisD gene .
The immobilization procedure renders the strain heat resistant , so that growth experiments can be done at 37 °C .
onor G p Ga G D C B ( 1 ) I12 ( 2 I W ( 5 ) AZ1460a AZ1472a A3 G D C B H A F ( IE ) Recipient 11 1I I ( TA816 ) A203 Lo , Select His + , purify smooth colonies B Indicator media were green indicator plates ( 11 ) and Mac-Conkey-lactose plates ( Difco ) .
Ampicillin ( 50 p , g/ml ) was added to MacConkey-lactose plates , and 10 , ug of tetracycline per ml was present in NB plates .
Top agar was 0.6 % ( wt/vol ) Bacto agar ( Difco ) containing 0.5 % ( wt/vol ) NaCl .
Solid media contained 1.5 % ( wt/vol ) Bacto agar .
Selection for spontaneous TONPG-resistant mutants in a his-lac fusion strain .
The selection method makes use of selection for TONPG resistance due to decreased lacY expression ( 18 ) in a his-lac fusion strain ( AZ1413 ) .
The principle of the selection method is described in Results .
Application of TONPG selection for use in S. typhimurium required modification of the selection medium described for E. coli ( 18 ) .
Five different carbon sources ( glucose , glycerol , citrate , acetate , and succinate ) were tried in combination with two different mineral salt formulas , N-C-salts ( 1 ) and VB salts ( 11 ) .
The selection was most effective with N-C-citrate medium ( supplemented with histidine , uracil , and 10 mM NH4Cl ) , and spontaneous TONPG-resistant mutants occurred at a frequency of -10 ' .
The optimal TONPG concentration was about 1 mM .
The selection worked equally well at 30 and 37 °C .
Selection for independent , spontaneous TONPG-resistant mutants was ensured by using cultures of strain AZ1413 grown from individual colonies .
The overnight NB cultures were washed once and resuspended in an equal volume of 0.85 % NaCl ; 0.1 ml was spread onto TONPG selection plates , which were sealed with Parafilm ( to prevent dessication ) and incubated at 30 °C for 3 days .
Identification of potential his operon promoter mutants among TONPG resistance mutants .
There are several classes of mutations that will decrease expression of lacY fused to his and confer TONPG resistance .
These include ( corresponding numbered mutations shown in Fig. 1A ) ( 1 ) his promoter mutations that decrease his-lac expression ; ( 2 ) polar mutations in his structural genes promoter proximal to the his-lac fusion ; ( 3 ) mutations in lacZ that are polar on lacY ; ( 4 ) lacY mutations ; and ( 5 ) mutations in unlinked genes ( gene X ) that potentially reduce his operon expression .
The , B-galactosidase indicator X-gal ( 5-bromo-4-chloro-3-indolyl - , - D-galactoside ) has been used to distinguish among several classes of TONPG-resistant mutants , including partial loss-of-function ( `` leaky '' ) promoter mutations , which result in pale blue colonies in the presence of the dye ( 4 , 18 ) .
We found this to be an unreliable test for leaky his promoter mutants , however , probably because the majority of pale blue isolates were the result of his polar mutations .
To identify clones containing leaky his promoter mutations efficiently , we used a rapid genetic screening method .
TONPG-resistant colonies were pooled on each selection plate by suspension in 1 ml of 0.85 % ( wt/vol ) NaCl with the aid of a glass spreader .
Then , 50 , ul of each cell suspension was inoculated individually into 5 ml of NB and incubated at 370C with shaking to stationary-phase .
Bacteriophage P22 lysates were made on these cultures and used as the donor in the genetic cross shown in Fig. 1A .
Selection was for prototrophic growth of the histidine auxotrophic recipient strain TA816 on minimal-medium containing 2 % glucose .
Strain TA816 carries the Ahis-203 deletion , which removes the his promoter regulatory region .
All His + transductants must receive the his promoter and the AhisGal242 attenuator mutation of the donor .
The AhisGal242 mutation by itself results in a characteristic wrinkled colony morphology owing to constitutive overproduction of the hisH and hisF gene products in a His ' prototrophic background ( 23 ) .
Inheritance of a his promoter-down mutation suppresses the effect of the AhisGa1242 deletion , and transductants appear smooth or grainy .
Smooth or grainy transductants must carry mutations lying under Ahis-203 , eliminating the other TONPG-resistant classes described above .
To ensure isolation of independent his promoter mutants , only one smooth and/or one grainy mutant was saved from each TONPG pool and purified by single-colony isolation on green indicator plates .
Phage P22 lysates were made on the purified transductants and backcrossed to strain TA816 to confirm the smooth-colony phenotype ( Fig. 1B ) .
Ability t confer the smooth-colony phenotype in the backcross occurred for more than 95 % of the isolates .
Sixty-seven putative his promoter mutations were isolated in this fashion and characterized further by analog sensitivity and by DNA sequence analysis .
Characterization of putative his promoter mutants by using analogs that inhibit histidine biosynthesis .
Isolates containing putative his promoter mutations challenged with the were compounds 3-amino-1,2,4-triazole ( AMT ) and 2-thiazoleala-nine ( TA ) by the top agar overlay method .
Mutants were grown in VB salts plus glucose ( 0.4 % , wt/vol ) to stationary-phase , and 100 , ul was mixed with 2.5 ml of 45 °C top agar , poured onto a VB plus glucose plate ( for TA ) or a VB plus glucose plate supplemented with 10 p.g of thiamine per ml and 50 jig of adenosine per ml ( for AMT ) , and allowed to harden .
Fifteen microliters of 3 M AMT or 20 p.l of 50 mM TA added to 6-mm filter disks that had been was paper of the Diameters of of placed on the surface agar .
zones growth inhibition were measured after 24 h of incubation at 37 °C .
Fusion of Mu dl cts ( Apr lac ) to his promoter mutations for measuring his-lac expression .
Prototrophic his + strains carrying his ' promoter mutations resulting from the cross shown in Fig. 1A were transduced to ampicillin resistance on MacConkey-lactose plates containing ampicillin with a phage P22 lysate made on strain AZ1460 .
Strain AZ1460 carries the wild-type his promoter , AhisGa ] 242 , and an immobilized Mu dl cts ( Apr lac ) insertion in the hisG or hisD gene [ 4 ( hisGD-lac ) ; Table 1 ] .
Transductants that inherited the his promoter-regulatory region of the donor appeared as dark red colonies .
White or pink transductants retained the promoter mutation of the recipient .
Promoter mutations that conferred only a slight decrease in his expression gave transductants that were indistinguishable ( dark red ) from transductants that inherited the wild-type promoter of the donor .
Recombinants carrying these promoter mutations fused to lac were identified by patching several ampicillin-resistant transductants on TONPG selection plates .
The desired recombinants gave distinctly better growth than the TONPG-sensitive control strain AZ1413 in the presence of TONPG after 3 days at 30 °C .
Strains were grown in 2 ml of SNB medium at 37 °C overnight and then subcultured to give an OD650 of 0.01 in 25 ml of the same medium .
P-Galactosidase specific activities were determined as differential rates of enzyme synthesis from differential rate plots by using five samples ( 1 ml ) taken at about 10-min intervals during-growth between an OD650 of 0.05 and an OD650 of 0.2 .
3-Galactosi-dase assays were performed as described before ( 21 ) , with the modifications described by Shand et al. ( 29 ) .
Cloning and DNA sequence analysis of his promoter mutations .
Cloning of the his promoter mutants onto M13mp his phages has been described before ( 3 , 7 ) .
Phage M13mp his DNA was prepared for sequencing by the method of Messing ( 20 ) .
DNA sequencing was done by the dideoxy method ( 20 ) with an oligonucleotide primer complementary to the sequence from + 34 to +53 ( relative to the startpoint of transcription ) .
G p Ga G D C B ( 1 ) I12 ( 2 I W ( 5 ) A3 G D C B H A F ( IE ) Recipient 11 1I I ( TA816 ) A203 Lo , Select His + , purify smooth colonies B Gp Ga G D C B H A F ( IE ) ( 1 Donor ( 1 ) Al 2421 g , ~ G ~ I ~ ~ D I C I B I H A F ( IE ) Recipient 4 I ' I ( TA816 ) A203 GD11BH F Select HIs + , soore oolony morphology FIG. 1 .
Genetic screening method used to identify his promoter mutants among TONPG-resistant mutants .
See Materials and Methods for a description of the crosses .
`` X , '' Hypothetical unlinked gene that regulates the his promoter ( indicated by arrow ) ; x , potential TONPG resistance mutations ( see text ) .
Double-headed arrows on sequences indicate extent of DNA that must recombine to result in a His ' phenotype .
Wild type 3352a , 3354a , 3355C , 3356a , 33589 , 3359a , 3360a , 3363a , 3364 , 3365a , 3366a , 3373 , 3375 , 3377 , 3378a , 3379a , 3380a , 3382a , 3383a , 3355C , 3387a , 18 others 3362f , 3381 ' , 3369 ' , 3372h , 3374f , 3357f , 3370f , 3376d , 3385f , 8 others 3351k , 3353k , 3361b , 3367n , 3371 , 3381 ' , 3361b , 4 others Moderate Strong RESULTS Isolation of TONPG-resistant S. typhimurium mutants .
The rationale of the TONPG selection for his operon promoter mutants of S. typhimurium is identical to that described by Hopkins ( 18 ) in the selection for lac operon mutants with reduced levels of expression in E. coli .
Briefly , TONPG is a a Cultures were grown and tested for TA sensitivity as described in were isolated as Materials and Methods .
Prototrophic derivatives of mutants shown in the cross in Fig. 1A .
Strain AZ68 was used as the hisGp + control and was insensitive to TA ( zone of inhibition , < 6 mm [ the diameter of the filter paper disk ] ) .
Mutants were categorized as weakly sensitive ( 6-to 17-mm zone of inhibition ) , moderately sensitive ( 18 to 25 mm ) , or strongly sensitive ( 26 to 40 mm ) .
The three mutant categories were also distinguished by the degree of turbidity within the zones of inhibition .
In general , weakly sensitive mutants gave turbid zones , moderately sensitive mutants gave less turbid zones , and strongly sensitive mutants gave clear zones .
Results are shown for the 37 mutants that were subsequently analyzed by DNA sequencing .
The superscript indicated with each allele number corresponds to the sequence change shown in Fig. 2 .
Also indicated in the table are the number of other mutants in each category that were tested for TA sensitivity but not subjected to DNA sequence analysis .
lactose analog that is transported by the lactose permease , the product of the lac Y gene .
When lac + E. coli is grown on a poor carbon source under inducing conditions in the presence of the analog , the cells accumulate sufficient TONPG to inhibit growth .
One class of TONPG-resistant mutants that overcomes this growth inhibition has decreased levels of lacY permease as a result of mutations in the lac operon promoter .
The S. typhimurium strain ( AZ1413 ) used in our selection contains an immobilized Mu dl cts ( Apr lac ) insertion ( 6 ) , with the lac structural genes transcriptionally fused to the his promoter-regulatory region ( Table 1 , Fig. 1 ) .
Strain AZ1413 also carries the AhisGa1242 mutation , which deletes the his operon attenuator , thus preventing the isolation of TONPG-resistant mutations affecting the attenuation mechanism .
In addition , the AhisGa1242 mutation results in sufficiently high levels of fused lac Y expression to cause sensitivity to TONPG ; hisGa + - lac fusion strains are resistant to TONPG .
By using a modification of the E. coli TONPG selection , followed by a genetic screening method to localize mutations within the promoter-regulatory region ( see Materials and Methods ) , we obtained 67 putative his promoter mutants .
These mutants were characterized further by analog testing , DNA sequence analysis , and quantitation of effects on his promoter activity .
Characterization of TONPG-resistant mutants with analogs that inhibit histidine biosynthesis .
To estimate qualitatively the range of decreased his expression in the collection of TONPG-resistant mutants and to facilitate DNA sequencing of a wide variety of mutant types , the mutants were categorized by their sensitivity to the analogs TA and AMT ( 32 ) .
TA acts as a feedback inhibitor of ATP phosphoribosyltransferase ( product of hisG ; EC 2.4.2.17 ) ; hypersensitivity to the analog may result from decreased levels of this enzyme .
AMT inhibits imidazoleglycerol phosphate dehydratase ( product of hisB ; EC 4.2.1.19 ) ; AMT hypersensitivity may result from decreased levels of this enzyme .
The results for TA sensitivity are shown in Table 2 ( AMT sensitivities are not shown but resulted in a similar classification ) .
The mutants were classified into three groups based on th a Wild-type his promoter expression was determined by using his-lac fusion strain AZ1472 ( Table 1 ) .
Strains used to determine expression from mutant his promoters are isogenic to AZ1472 except for the his promoter mutation .
Letters in parentheses correspond to lettering of mutations in Fig. 2 .
b Numbering is relative to the start point of transcription ( Fig. 2 ) .
Locations of the base pair substitutions and of the single-base-pair deletion are designated by a single number .
Locations of insertions are designated with two numbers which represent the positions of the 2 base pairs flanking the insertion .
c Compiled from Table 2 .
In cases of multiple isolates of the same mutation , his expression was usually determined for more than one of the isolates .
In these cases , there was generally close agreement .
d Cultures were grown in SNB medium , and his expression was determined 3-galactosidase by measurements of activity encoded by the lacZ gene , which was transcriptionally fused to the hisGp promoter ( see Materials and Methods ) .
The location of the fusion joint eliminated any contribution of internal his operon promoters .
Specific activities ( A420 units per minute per OD650 unit , times 1,000 ) were determined from differential rate plots as described before ( see Materials and Methods ) ( 29 ) .
degree of growth inhibition .
The largest group ( 39 mutants ) was weakly sensitive to TA inhibition , and the other two groups were moderately sensitive ( 17 mutants ) or strongly sensitive ( 11 mutants ) .
Generally , mutants that were strongly sensitive to analog inhibition proved to have the largest decreases in his expression in-vivo , while weakly and moderately sensitive mutants had smaller decreases in his expression ( compare Tables 2 and 3 ) .
The categorization of mutants into groups by analog sensitivities was used as a guide in selecting those mutants to be analyzed by DNA sequencing .
The greatest number of mutants sequenced were chosen from the weakly sensitive group , because these leakier mutants should be easier to study with respect to his promoter-regulatory alterations ( e.g. , involving the ppGpp regulatory mechanism ) .
DNA sequence analysis of his promoter mutations .
Of the 67 TONPG-resistant mutants found to have mutations lying under the Ahis-203 mutation ( Fig. 1 ) and characterized by analog sensitivity as having decreased his expression , 42 were subjected to DNA sequencing .
Of these 42 mutants , 37 ( 88 % ) were found to have sequence changes within or near the his promoter .
The remaining five mutants did not have sequence changes within or near the his promoter ( or in the his leader-attenuator region ) and have not been studied further .
Of 21 mutations sequenced from the weakly TA-sensitive five different group , only changes were found ( Table 2 ; see below ) .
In addition , five different changes were found among the nine mutations sequenced from the moderately TA-sensitive group , and four different changes were found among the seven mutations sequenced from the most strongly TA-sensitive group .
Figure 2 shows the 14 different changes found among the 37 mutations sequenced .
These include five different , single-base-pair substitution mutations ( four transitions and one transversion ) , one single-base-pair deletion mutation , and eight different insertion mutations .
Six of the 14 different promoter mutations were isolated independently more than once ( Tables 2 and 3 ) , suggesting that the method is beginning to approach target saturation .
Each of the base pair substitution mutations and the single-base-pair deletion mutation altered either the region near -10 or the region near -35 relative to the start point of transcription .
The three substitutions near -10 ( hisGp3353 , hisGp3367 , and hisGp3381 ) altered either the first or last highly conserved T residues of the consensus -10 hexamer sequence ( Pribnow box ) recognized by the EJ70 form of RNA polymerase .
The single-base-pair deletion ( AhisGp3377 ) at position -10 or -11 also resulted in a decrease in homology to the consensus -10 hexamer sequence .
The base pair substitution at position -35 ( hisGp3361 ) changed a highly conserved residue of the consensus -35 hexamer sequence recognized by the Eu70 form of RNA polymerase .
In contrast , the hisGp3355 mutation at position -34 was a substitution of one nonconserved base pair for another , consistent with a hierarchy among nonconsensus base pairs at the -35 hexamer sequence .
The wild-type his promoter has a spacing of 18 base pairs between the -10 and the -35 hexamer sequences .
Seven of the eight insertion mutations increased this spacing .
Five of the seven spacer mutations were single-base-pair insertions ( hisGp3358 , hisGp3370 , hisGp3371 , hisGp3372 , and hisGp3376 ) .
The other two spacer mutations were duplications of adjacent sequences : hisGp3369 was a 4-base-pair duplication of positions -14 through -11 , and hisGp3373 was an 11-base-pair duplication of positions -30 through -20 .
All seven of the spacer insertion mutations occurred in runs of A. T base pairs .
The last of the 14 different changes of the his promoter occurred 16 times among the 37 independently isolated mutants subjected to DNA sequence analysis .
Each of the 16 occurrences of this mutation ( represented by hisGp3378 in Fig. 2 ) was due to a large insertion located with its endpoints between positions -39 and -38 , immediately upstream of the -35 hexamer sequence of the his promoter .
The identification of this insertion mutation as insertion sequence element IS30 is considered in the Discussion .
his expression of his promoter mutants in-vivo .
A summary of the effect of each different promoter mutation on his expression in-vivo is shown in Table 3 .
The strains ( his-lac derivatives ) were grown in a complex , nutrient-rich-medium ( SNB medium ) , and his expression was measured as a function of , B-galactosidase specific activity .
Comparison is made with the otherwise isogenic hisGp + strain AZ1472 ( Table 1 ) .
The data for the promoter mutants are ordered from strongest to weakest defect in his expression .
his expression was decreased as much as 357-fold to as little as 4-fold among the mutants .
Base pair substitution mutations of consensus positions in the -10 hexamer ( hisGp3353 , hisGp3367 , and hisGp3381 ) and in the -35 hexamer ( hisGp3361 ) resulted in drastic reductions in his expression ( from 71-fold to 357-fold ) .
In contrast , the substitution of the nonconsensus C at position -34 in the -35 hexamer with a nonconsensus T ( hisGp3355 ) reduced his expression only about fourfold .
Similarly , deletion of the G residue in the -10 hexamer at position -10 or -11 ( AhisGp3377 ) caused about a fourfold decrease .
Four of the five single-base-pair insertions within the 18-base-pair spacer region ( hisGp3358 , hisGp3370 , hisGp3371 , and hisGp3372 ) strongly reduced his expression ( 96-fold to 179-fold ) .
In contrast , the remaining single-base-pair spacer insertion ( hisGp3376 ) reduced his expression about fourfold .
Insertions in the spacer created by 4 - ( hisGp3369 ) or 11 - ( hisGp3373 ) base-pair duplications reduced his expression 40-fold and 9-fold , respectively .
Finally , the large insertion mutation ( hisGp3378 ) between positions -38 and -39 , upstream of the -35 hexamer sequence , reduced his expression about sevenfold .
DISCUSSION A consensus eubacterial Eu70 promoter sequence has been derived by analyzing the homologies among a large variety of wild-type promoters ( 15 , 17 , 22 ) .
The consensus Ea & 70 sequence comprises three major components : a sequence ( TATAAT ) centered around position -10 with respect to the transcription start site ( +1 ) ; a sequence ( TTGACA ) centered around position -35 ; and a spacer region between the -10 and -35 hexamer sequences , with an optimal length of 17 base pairs .
By inspection , the wild-type sequence upstream of the start point of transcription of the his operon ( 13 , 14 ) resembles the consensus Ea70 sequence .
The his sequence contains three out of six matches to consensus base pairs in both the -10 and -35 hexamers , with a suboptimal 18-base-pair separation between the hexamers .
According to quantitative predictions , this sequence would be a promoter of moderate intrinsic strength compared with other well-characterized Eu70 promoters ( 22 ) ( see below ) .
The mutation analysis provides unequivocal evidence that the his promoter sequence identified by inspection is an Eu70 promoter .
All of the base pair substitution mutations altered positions in either the -10 or -35 hexamer ; four out of five of these mutations changed consensus base pairs to nonconsensus base pairs and reduced his expression .
Similarly , his expression was reduced by a single-base-pair deletion in the -10 hexamer sequence .
We have previously shown ( 26 ) that two mutations that improve the match to consensus of the -10 hexamer increase intrinsic his promoter strength .
All of the mutations that increased the spacing between the -10 and -35 hexamers reduced his expression .
The mutation analysis also strongly supports the conclusion that the his operon is expressed from a single major promoter in the regulatory region upstream of the his structural genes .
Since several promoter mutations caused defects in his expression greater than 100-fold , a secondary promoter in the his regulatory region could contribute less than 1 % to his expression under the complex , nutrient-rich conditions used .
We can not exclude the possibility that a secondary promoter would be unmasked by some other , unknown growth-condition .
Although an overview of the effects caused by hisGp mutations established the wild-type sequence as an Ea70 promoter , several of the mutations resulted in unexpected quantitative alterations in his promoter activity .
In several cases , these interesting effects can be systematically analyzed based on mathematical predictions that relate Eu70 promoter function to promoter sequence .
Mulligan et al. ( 22 ) have devised an algorithm for computing homology scores for Eu70 promoters based on DNA sequence alone and have applied the homology scores , with significant reliability , to predict the relative intrinsic strengths of different promoters .
The magnitude of the homology score for a given promoter is based on the homology to consensus of the -10 and -35 hexamers , the sequence of proximal regions flanking the hexamers , and the spacing between the hexamers .
For 112 known promoters included in the analysis , the homology scores varied from 31.4 for the weakest promoter to 79.9 for the strongest promoter .
We calculated the homology score of the wild-type S. typhimurium his promoter to be 58.6 , which places this promoter near the middle of the homology score distribution .
The single-base-pair deletion in the -10 hexamer sequence ( AhisGp3377 ; Fig. 2 ) resulted in one of the smallest defects in his expression ( Table 3 ) .
A simple interpretation of the effect of this deletion is that the wild-type -10 hexamer sequence ( TAGGTT ) is changed to a new sequence ( TAGTTA ) ( alternative c in Fig. 3 ) .
This interpretation , however , results in one of the lowest calculated homolog Wild type 3352a , 3354a , 3355C , 3356a , 33589 , 3359a , 3360a , 3363a , 3364 , 3365a , 3366a , 3373 , 3375 , 3377 , 3378a , 3379a , 3380a , 3382a , 3383a , 3355C , 3387a , 18 others 3362f , 3381 ' , 3369 ' , 3372h , 3374f , 3357f , 3370f , 3376d , 3385f , 8 others 3351k , 3353k , 3361b , 3367n , 3371 , 3381 ' , 3361b , 4 others Moderate Strong TABLE 3 .
his expression of hisGp mutants in-vivo StrSaitnan hohis c i allelea LLoGatpon ' b AZ1472 hisGp + AZ5317 3353 ( k ) -13 AZ5160 3361 ( b ) -35 AZ5341 3381 ( 1 ) -13 AZ5308 3370 ( f ) -22 , -23 AZ1060 3358 ( g ) -22 , -23 AZ1022 3372 ( h ) -22 , -23 AZ1021 3371 ( i ) -14 , -15 AZ1007 3367 ( n ) -8 AZ5314 ( j ) 3369 -14 , -15 AZ1823 3373 ( e ) -30 , -31 AZ5337 3378 ( a ) -38 , -39 AZ1057 3355 ( c ) -34 AZ1034 3376 ( d ) -31 , -32 AZ1036 3377 ( m ) -10 or -11 P-Galactosidase actd De ( cfroleda ) se sp 2,500 7 357 11 227 14 179 14 179 14 179 24 104 26 96 35 71 63 40 278 9 352 7 556 5 600 4 625 4 isolatesc No .
of 2 2 2 5 1 1 1 1 1 1 16 2 1 1 -35 .4 18bpspacer -10 -40 -30 -20 10 AAAAAGCGCTTGCTTTAAGGCGTAAAAGTGGTGG +1 GGTAT N ) O ( ) ( D SUBSTITUTIONS 3367 3361 3355 3353 3381 DELETION , < ^ ~ 33 ~ 3 ~ 7 ~ 7 TGAATCTACA ( IS30 ) 3378 ( IS30 ) T TTAG 0D T A C 0 ( E ) T ( D .
3369 3358 3372 3370 3376 3371 INSERTIONS AA GCG A A T G A A J 3373 FIG. 2 .
The wild-type his promoter sequence is shown above the mutations .
The -35 and -10 hexamer sequences are indicated .
Numbering of the sequence is relative to the start point of transcription ( +1 ) of the wild-type promoter .
Numbers under the mutations are allele designations , and the circled letters correspond to lettering of mutations in Tables 2 and 3 .
bp , Base pairs GGTTAAAAGGTAT ... hisGpa33s FIG. 3 .
Alternative -10 hexamers of the mutant promoters AhisGp3377 and hisGp3369 .
The wild-type his promoter -10 hexamer and the start point of transcription ( +1 ) are underlined .
The alternative -10 hexamers from the mutants are boxed and designated a , b , and c , with spacer lengths of 16 , 17 , and 18 base pairs , respectively .
The two mutants share the same promoter sequence upstream of the A residue marked with an arrow .
scores ( 46.7 ) among all of the mutants , including several with much larger defects in his expression .
Figure 3 shows two additional -10 hexamer sequences that could result from AhisGp3377 .
Alternative b changes the wild-type 18-base-pair spacing between the -10 and -35 hexamers to the optimal 17 base pairs , but results in a homology score of only 43.7 .
Alternative a changes the spacing to 16 base pairs but results in a homology score of 55.6 , which is much closer to the wild-type score of 58.6 .
Alternative a , therefore , is most likely to be recognized by Ea70 RNA polymerase and provides a reasonable explanation for the relatively small defect caused by AhisGp3377 .
The 4-base-pair insertion mutation ( hisGp3369 ; Fig. 2 ) increased the spacing between the wild-type -10 and -35 hexamer sequences from 18 base pairs to 22 base pairs but caused a smaller defect in his expression than several of the single-base-pair insertion and spacer mutations ( Table 3 ) .
In addition , no active wild-type or mutant Eu70 promoter with spacing greater than 21 base pairs has been identified ( 15 , 17 ) .
The effect of the hisGp3369 mutation must therefore have a different basis than a simple spacer defect .
Interestingly , hisGp3369 generated the identical alternative -10 hexamer sequences as AhisGp3377 ( Fig. 3 ) and retained the same sequence and spacing upstream of the alternative -10 hexamers ( Fig. 2 ) .
It is most likely that alternative a is recognized by Eu70 RNA polymerase for the hisGp3369 promoter as was deduced for the AhisGp3377 promoter .
The 10-fold difference in his expression between the AhisGp3377 and hisGp3369 promoters ( Table 3 ) must therefore be the consequence of variation in the sequence downstream of the -10 hexamers .
We have previously shown in-vitro that certain mutations in this region of the his promoter sequence can affect expression and ppGpp regulation ( 26 ) .
The 11-base-pair insertion/spacer mutation ( hisGp3373 ; Fig. 2 ) also caused a much smaller defect in his expression than several of the single-base-pair insertion/spacer mutations ( Table 3 ) .
Using the Mulligan et al. algorithm ( 22 ) , we searched for alternative -10 and -35 hexamer sequences that would be generated by hisGp3373 .
The sequence giving the best homology score ( 53.8 ) retained the hisGp + -35 hexamer and introduced a new -10 hexamer sequence ( TAAAAG ; positions -24 through -19 in Fig. 2 ) with a spacing of 18 base pairs between the hexamers .
An interesting alternative to the utilization of -10 hexamer a new is that the hisGp3373 mutation sequence permits the hisGp + -10 and -35 hexamers to be utilized with an integral-turn loop in the spacer region .
The -10 and -35 hexamers would then be positioned on approximately the same face of the DNA surface as is required for productive interaction with Eur70 RNA polymerase ( 30 ) .
These alternatives may be resolved by footprinting analysis with Eu70 RNA polymer-ase combined with determination of the transcription start point of the hisGp3373 promoter .
The five single-base-pair insertion mutations in the spacer region between the -10 and -35 hexamer sequences ( Fig. 2 ) are predicted to have similar effects on his promoter function .
Each of the mutations results in a 34.5 ° rotation in the orientation of the contacts made by Eu70 RNA polymerase in recognizing the -10 and -35 hexamer sequences ( 30 ) .
Surprisingly , while four of the mutations ( hisGp3358 , hisGp3370 , hisGp3371 , and hisGp3372 ) caused large defects in his expression ( 96-to 179-fold ; Table 3 ) , the fifth mutation ( hisGp3376 ) had a small effect ( 4-fold ) .
Interestingly , three of the five single-base-pair insertion/spacer mutations ( hisGp3358 , hisGp3371 , and hisGp3376 ) expanded homopolymeric dA-dT tracts to 4 or 5 base pairs , while the other two mutations ( hisGp3370 and hisGp3372 ) disrupted a 4-base-pair dA-dT tract .
Such tracts have been shown to be the site of sequence-induced DNA bending ( 19 , 35 ) .
To account for the data , we propose that DNA bending may contribute to the effects of the insertion/spacer mutations on his expression .
Conformational changes in DNA ( e.g. , DNA bending ) have not been analyzed quantitatively by mathe ¬ TATAAT consensus +1 hi ... TGGlrTAAAGGTAT ... cI ... ATG T AT ... hsG3377 a A -35 -10 IS30 5 ' TGTAGATTCA ATTGGTCAAC GCAACAGTTA TGTGAAAACA 3 ' ACATCTAAGT TMCCTGTTG CGTTGTCAAT ACACTTTTGT hisGD3378 3 ' ACATCTMGT TAACCTGTTG CGTTGTCAAT ACACTTTTGT 10 20 30 40 SD hisGD3378 3 ' ACCCCMCGC CTCCAAAAAA CTTACTCTGC TUG ... 50 60 70 B IS30 5 ' TGGGGTTGCG GAGGlTTlTT GAATGAGACG MC ... 3 ' ACCCCAACGC CTCCAAAMA CTTACTCTGC TTG ... Phage P1 TCATMGTGCCAT TGT ... IS30 .
ACA AT CTCCTTTCTTA * 000 * 0 0S ... .
S ACA CGUCITAAGG * 000 0 00 0 s 0 NR1-Basel GCGAAATGCCAGC TGT .
ACA GC GTCGAArTGCG FIG. 4 .
( A ) Alignment of the DNA sequence of the left end of E. coli insertion element IS30 ( 10 ) and insertion mutation hisGp3378 .
Both strands of the IS30 sequence are shown above the single strand we sequenced for hisGp3378 .
The -35 and -10 hexamers of a putative IS30 promoter , a Shine-Dalgarno ( SD ) sequence , and an ATG translation start codon ( as proposed in reference 10 ) are underlined .
In the hisGp3378 mutant , IS30 is oriented with its left endpoint adjacent to the his -35 hexamer sequence so that the putative IS30 promoter would be transcribed in a divergent manner ( see Fig. 2 for the proper orientation ) .
There is no direct evidence that the IS30 promoter is utilized , but if it is , it might interfere with transcription of the his promoter .
( B ) Sequence homologies among the known IS30 integration sites .
The phage P1 and R plasmid NR1-Basel integration sites were previously determined ( 9 ) , and their homologies are indicated by double horizontal lines .
Homologies between the his integration site and the other two sites are indicated by solid circles .
The two nucleotides duplicated during IS30 integration are shown separated from the rest of the sequence ( AT in the case of phage P1 and GC for NR1-Basel ) .
Since we sequenced only one insertion junction , we can not verify the duplication for hisGp3378 .
The -35 hexamer of the his promoter is underlined matical models of RNA polymerase-promoter interaction ( 22 ) .
The large insertion upstream of the -35 hexamer sequence ( hisGp3378 ; Fig. 2 ) reduced his expression sevenfold ( Table 3 ) .
The sequence upstream of the -35 hexamer in Eu70 promoters is somewhat conserved and has been predicted to contribute to promoter strength ( 22 ) .
Mutations in this region of other Ea '' promoters have been shown to decrease promoter activity ( 25 , 27 ) .
The frequent occurrence of the large insertion mutation was unexpected , since spontaneous insertion mutations are rare in S. typhimurium ( 12 ) .
We extended the sequence of the inserted DNA to 73 nucleotides upstream of the point of insertion and searched the GenBank data set of DNA sequences for The sequence matched perfectly homologies .
the left end of E. coli insertion element IS30 ( Fig. 4A ) ( 10 ) .
It has been reported ( 12 ) that IS30 may be identical to IS121 , which is resident in the Mu dl cts ( Apr lac ) phage ( Fig. 1 ) ( 24 ) .
Since the parent strain used in our TONPG selection carries the Mu dl cts ( Apr lac ) genome , we assume that this was the source of the large insertion mutations .
IS30 has a pronounced specificity for the target site at which it inserts , but only two integration sequences have been reported , one in phage P1 and one in the R plasmid NR1-Basel ( 9 ) .
Figure 4B compares the two previously determined integration sites with the site upstream of the his promoter .
Although there are obvious similarities among the three integration sites , more target sequences are needed to clarify the question of specificity of IS30 integration .
hisGD3378 3 ' ACCCCMCGC CTCCAAAAAA CTTACTCTGC TUG ... 50 60 70 We thank Rick Moershell and Dan Riggs for helpful discussions and Lisa Couper for expert technical assistance .
This work was supported by Public Health Service grant GM27307 from the National Institutes of Health and grant DMB8608058 from the National Science Foundation .
Alper , M. D. , and B. N. Ames .
Transport of antibiotics and metabolic analogs by systems under cyclic AMP control : positive selection of Salmonella typhimurium cya and crp mutants .
Artz , S. W. , and D. Holzschu .
Histidine biosynthesis and its regulation , p. 379-404 .
In K. M. Herrmann and R. L. Som-erville ( ed .
) , Amino acids : biosynthesis and genetic regulation .
Addison-Wesley Publishing Co. , New York .
Artz , S. , D. Holzschu , P. Blum , and R. Shand .
Use of M13mp phages to study gene regulation , structure and function : cloning and recombinational analysis of genes of the Salmonella typhimurium histidine operon .
Berman , M. L. , and J. Beckwith .
Use of gene fusions to isolate promoter mutants in the transfer RNA gene tyrT of Escherichia coli .
Blasi , F. , and C. B. Bruni .
Regulation of the histidine operon : translation-controlled transcription termination ( a mechanism common to several biosynthetic operons ) .
Blum , P. , L. Blaha , and S. Artz .
Reversion and immobilization of phage Mudl cts ( Apr lac ) insertion mutations in Salmonella typhimurium .
Blum , P. , D. Holzschu , H.-S .
Kwan , D. Riggs , and S. Artz .
Gene replacement and retrieval using recombinant M13mp phages .
Cashel , M. , and K. Rudd .
In F. C. Neidhardt , J. L. Ingraham , K. B. Low , B. Magasanik , M. Schaechter , and H. E. Umbarger ( ed .
) , Esche-richia coli and Salmonella typhimurium : cellular and molecular biology .
American Society for Microbiology , Washington , D.C. 9 .
Caspers , P. , B. Dalrymple , S. Iida , and W. Arber .
IS30 , a new insertion sequence of Escherichia coli K12 .
Dalrymple , B. , P. Caspers , and W. Arber .
Nucleotide sequence of the prokaryotic mobile genetic element IS30 .
Davis , R. W. , D. Botstein , and J. R. Roth ( ed .
Advanced bacterial genetics , p. 78 , 201-202 .
Cold Spring Harbor Laboratory , Cold Spring Harbor , N.Y. 12 .
Locations of native insertion sequence elements , p. 982-989 .
In F. C. Neidhardt ( ed .
) , Escherichia coli and Salmonella typhimurium : cellular and molecular biology .
American Society for Microbiology , Washington , D.C. 13 .
Freedman , R. , and P. Schimmel .
In vitro transcription of the histidine operon .
Frunzio , R. , C. B. Bruni , and F. Blasi .
In vivo and in-vitro detection of the leader RNA of the histidine operon of Esche-richia coli K-12 .
Harley , C. B. , and R. P. Reynolds .
Analysis of E. coli promoter sequences .
Hartman , P. E. , Z. Hartman , R. C. Stahl , and B. N. Ames .
Classification and mapping of spontaneous and induced mutations in the histidine operon of Salmonella .
Hawley , D. , and W. R. McClure .
Compilation and analysis of Escherichia coli promoter DNA Nucleic Acids sequences .
A new class of promoter mutations in the lactose operon of Escherichia coli .
Wu , and D. M. Crothers .
DNA bending at adenine thymine tracts .
` New M13 vectors for cloning .
Experiments in molecular genetics , p. 352-355 .
Cold Spring Harbor Laboratory , Cold Spring Harbor , N.Y. 22 .
Mulligan , M. E. , D. K. Hawley , R. E. Entriken , and W. R. McClure .
Escherichia coli promoter sequences predict in-vitro RNA polymerase selectivity .
Murray , M. L. , and P. E. Hartman .
Overproduction of hisH and hisF gene products leads to inhibition of cell division in Salmonella .
O'Connor , M. B. , and M. H. Malamy .
A new insertion sequence , IS121 , is found on the Mu dlI ( Ap lac ) bacteriophage and the Escherichia coli K-12 chromosome .
Reznikoff , W. S. , D. A. Siegele , D. W. Cowing , and C. A. Gross .
The regulation of transcription initiation in bacteria .
Riggs , D. L. , R. D. Mueller , H.-S .
Kwan , and S. W. Artz .
Promoter domain mediates guanosine tetraphosphate activation of the histidine operon .
Rosen , E. D. , J. L. Hartley , K. Matz , B. P. Nichols , K. M. Young , J. E. Donelson , and G. N. Gussin .
DNA sequence analysis of prm-mutations of coliphage lambda .
Rudd , K. E. , B. R. Bochner , M. Cashel , and J. R. Roth .
Mutations in the spoT gene of Salmonella typhimurium : effects on his gene expression .
Shand , R. F. , P. H. Blum , R. D. Mueller , D. L. Riggs , and S. W. Artz .
Correlation between histidine operon expression and ppGpp levels during amino-acid downshift in stringent and relaxed strains of Salmonella typhimurium .
Siebenlist , U. , R. Simpson , and W. Gilbert .
E. coli RNA polymerase interacts homologously with two different promoters .
Stephens , J. C. , S. W. Artz , and B. N. Ames .
Guanosine 5 ' - diphosphate 3 ' - diphosphate ( ppGpp ) : positive effector for histidine operon transcription and general signal for amino-acid deficiency .
Straus , D. S. , and J. H. Wyche .
Histidine regulation in Salmonella typhimurium .
Procedure for the selection of mutants unable to derepress the histidine operon .
Biosynthesis of histidine , p. 395-411 .
In F. C. Neidhardt , J. L. Ingraham , K. B. Low , B. Magasanik , M. Schaechter , and H. E. Umbarger ( ed .
) , Escherichia coli and Salmonella typhimurium : cellular and molecular biology .
Winkler , M. E. , R. V. Zawodny , and P. E. Hartman .
Mutation spoT of Escherichia coli increases expression of the histidine operon deleted for the attenuator .
Wu , H.-M. , and D. M. Crothers .
The locus of sequence-directed and protein-induced DNA bending .