Regulation of the Salmonella typhimurium aroF gene in Escherichia colit The Salmonella typhimurium aroF gene , encoding the tyrosine-sensitive 3-deoxy-D-arabino-heptulosonate 7-phosphate ( DAHP ) synthase , was localized to a chromosomal PstI fragment by Southern blotting with an Escherichia coli aroF probe .
This fragment was cloned by screening a plasmid library for complementation of an E. coli aroF mutant .
The nucleotide sequence of S. typhimurium aroF was determined and compared with its E. coli homolog .
The nucleotide sequences are 85.1 % identical , and the corresponding amino-acid sequences are 96.1 % identical .
The E. coli genes encoding the three DAHP synthase isoenzymes are evolutionarily more distant from one another than are the homologous aroF genes of E. coli and S. typhimurium .
The S. typhimurium aroF regulatory region contains three imperfect palindromes , two upstream of the promoter and one overlapping the promoter , that are nearly identical to operators aroFol , aroFo2 , and TyrR box 1 of E. coli .
The aroFol and aroFo2 sequences of the two organisms are each separated by three turns of the DNA helix with no sequence similarity .
The 5 ' ends of the aroF transcripts for both organisms contain untranslated regions with potential stem-loop structures .
Translational fusions of the aroF regulatory regions to lacZ were constructed and then introduced in single copy into the E. coli chromosome .
fi-Galactosidase assays for tyrR-mediated regulation of aroF-lacZ expression revealed that the E. coli TyrR repressor apparently recognizes the operators of both organisms with about equal efficiency .
In bacteria and plants , aromatic amino-acid biosynthesis proceeds by the common aromatic or shikimate pathway , which delivers chorismate to the terminal pathways to generate phenylalanine , tyrosine , and tryptophan ( 18 , 32 ) .
In Escherichia coli , carbon flow through the shikimate pathway is controlled by modulation of the first enzyme , the 3-deoxy-D-arabino-heptulosonate 7-phosphate ( DAHP ) synthase ( EC 4.1.2.15 ) ( 31 ) .
This enzyme catalyzes the condensation of phosphoenolpyruvate and erythrose 4-phosphate to DAHP ( 41 ) .
In ` E. coli and Salmonella typhimurium there are three DAHP synthase isoenzymes that can be distinguished by their regulatory properties .
The tyrosine - , phenylalanine - , and tryptophan-sensitive isoenzymes are encoded by the unlinked genes aroF , aroG , and aroH , respectively ( 11 , 32 ) .
The nucleotide sequences of the E. coli aroF , aroG , and aroH genes have been determined ( 9 , 33 , 38 ) .
Expression of aroF and aroG is repressed by the tyrR gene product , the Tyr repressor , complexed to tyrosine or phenylalanine , respectively .
Regulatory mutants with lesions linked to aroF isolated ( 7 , 12 ) .
Nucleotide sequence analysis localized were the lesions to three operator boxes , designated aroFol and ( 7 ) .
These boxes are 20-aroFo2 ( 12 ) and TyrR box 1 base-pair ( bp ) imperfect palindromes ; aroFol and aroFo2 of similar sequences , located upstream of the aroF are promoter , and are separated by three turns of the DNA helix overlaps the promoter and shows some ( 12 ) .
The TyrR box 1 sequence similarity with aroFol and aroFo2 ( 10 ) .
The regulatory region of aroG features only one operator box , which is similar to aroFol and aroFo2 ( 12 ) .
phenyl-In wild-type E. coli grown in minimal media , the alanine-sensitive DAHP synthase contributes 80 % and the tyrosine-sensitive DAHP synthase contributes 20 % of the t Paper no. 12209 of the Purdue University Agricultural Experiment Station .
However , the aroF promoter scores much higher than the aroG promoter on a scale of relative promoter strength ( 12 , 15 ) , a fact that may only be reflected in tyrR strains .
Thus , repressor binding to the aroG operator may be less efficient than to the aroF operator .
In wild-type S. typhimurium grown in minimal media , the phenylalanine - ` sensitive DAHP synthase may also be the major isoenzyme ( 20 ) , although the tyrosine-sensitive isoenzyme has been reported to predominate under these conditions ( 22 ) .
A comparison of the nucleotide sequences for the aroF genes of E. coli and S. typhimurium was expected to offer some insight into an explanation for the potentially different expression levels .
This report describes the cloning and characterization of aroF from S. typhimurium , the construction of E. coli and S. typhimurium aroF-lacZ translational fusions , and studies on the regulation of S. typhimu-rium aroF in E. coli .
MATERIALS AND METHODS Bacteria , plasmids , and bacteriophages .
Bacteria , plasmids , and bacteriophages used in this study are listed in Table 1 .
E. coli GKM41 hsdR4 ) was derived from ( aroF in two P1 on NK5161 JM105 ( 47 ) steps by using phage grown ( tyrA : : TnJO ) ( 23 ) and YS482 ( aroF ) , respectively .
Strain YS482 , isolated by R. L. Somerville , is a one-step UV-induced mutant of wild-type strain W1485 .
Strain YS482 DAHP synthase .
Strain GKM41 lacks tyrosine-sensitive grows on minimal salts medium , but not on such medium supplemented with phenylalanine and tryptophan .
Strain SP564 , a CSH63 derivative obtained by transduction with phage P1 grown on PLK 1336 , has a TnJO insertion near tyrR but is Tetr and TyrR + .
Strain SP564-1 , an SP564 derivative from which the TnJO has been excised by the method of Bochner et al. ( 4 ) , is Tets and TyrR - .
Bacteria were grown in either Luria broth , 2 x YT ( 29 ) , or minimal salts medium supplemented with vitamin-B1 and biotin ( 45 ) .
Cells were plated on nutrient agar or M9 agar supplemented with vitamin-B1 and biotin ( 29 ) and , where indicated , with 20 , ug of amino-acids per ml , 50 , ug of ampicillin per ml , 20 , ug of kanamycin per ml , and 15 , ug of tetracycline per ml .
M13 phages were plated in Luria broth top agar containing 40 , ug of 5-bromo-4-chloro-3-indolyl-p-D-galactopyranoside ( XGal ) per ml and 28 , ug of isopropyl-j-D-thiogalactopyrano-side ( IPTG ) per ml .
A phages were plated in tryptone top agar on minimal plates supplemented with 40 , g of X-Gal per ml .
Phosphoenolpyruvate ( 5 ) and erythrose 4-phosphate ( 39 ) were synthesized and assayed as described previously .
Kanamycin , chloramphenicol , tetracycline , tyrosine , phenylalanine , and tryptophan were from Sigma Chemical Co. ; nutrient agar was from Difco Laboratories ; agarose and IPTG were from Bethesda Research Laboratories , Inc. ; X-Gal , dideoxynucleotides , and 7-deaza-dGTP were from Boehringer Mannheim Biochemicals ; [ a-32P ] dCTP was from ICN Radiochemicals or Amersham Corp. ; low-melting-point agarose was from FMC Corp. , Marine Colloids Div. ; redistilled phenol and 0.2-mm wedge-shaped sequencing gel spacers were from International Biochemical , Inc. ; deoxynucleotides were from Pharmacia , Inc. ; acrylamide , hydroxylapatite-HTP , and protein molecular weight markers were frotn Bio-Rad Laboratories ; and form-amide and propanediol were from Eastman Kodak Co. .
Oligonucleotides were synthesized by the Purdue Laboratory for Macromolecular Structure .
Restriction enzymes and T4 DNA ligase were from Bethesda Research Laboratories or New England BioLabs , Inc. ; restriction enzyme and ligase buffers and exonuclease III were from Bethesda Research Laboratories ; Klenow fragment of DNA polymerase I was from Boehr-inger Mannheim Biochemicals ` or New England BioLabs ; Klenow sequencing kit , T4 polynucleotide kinase , and mung bean nuclease were from New England BioLabs ; Sequenase ( T7 DNA polymerase ) and Sequenase sequencing kit were from U.S. Biochemicals Corp. .
DAHP synthase was assayed as described previously ( 37 ) .
Chromosomal DNA was isolated by the method of Saito and Miura ( 34 ) ; agarose gel electropho-resis , ligations , plasmid and phage miniscreens , electroelutions , and transformations were as described previously ( 1 ) .
DNA probes were labeled by nick translation with [ a-32P ] dCTP .
Genome blotting to dried agarose gels ( 44 ) was performed under optimal hybridization conditions ( 2 , 27 ) .
S. typhimurium DNA , digested with restriction endonuclease PstI and size fractionated , was ligated into pKGW ( 24 ) .
The resulting recombinant plasmids were grown in E. coli D1210 on M9 medium containing kanamycin and IPTG .
Amplification and preparation by the method of Birnboim ( 3 ) yielded the recombinant plasmid pGM59 .
Site-directed mutagenesis with an Amersham kit was performed by the method of Sayers et al. ( 36 ) .
Mutants were screened by SmaI digestion , and the mutations were confirmed by nucleotide sequence analysis .
For nucleotide sequence analysis by the dideoxy method ( 35 ) , pGM59 fragments were cloned into phages M13mpl8 and M13mpl9 .
One subclone was generated by ligating the 900-bp BssHII fragment previously filled in with DNA polymerase I ( Klenow fragment ) ( 1 ) into the SmaI site of M13mpl8 .
The resulting clone had the same orientation as lacZ .
This recombinant was used for exonuclease III digestion ( 16 ) .
Both replicative-form and single-stranded phages were prepared , and the extent of the deletions was determined by agarose gel electrophoresis and DNA sequencing .
Two plasmids with deletions of 150 and 350 bp were used to complete the nucleotide sequence analysis of the BssHII fragment .
The aroF regulatory regions of E. coli and S. typhimurium were subcloned into pMLB1034 .
The resulting recombinant plasmids were used to transform E coli MC4100 , yielding Lac ' derivativo : s that served as hosts to prepare lysates of XRZ5 ( 14 ) by ttL method of Silhavy et al. ( 40 ) .
Recombinant phages carrying functional lacZ genes were identified as blue plaques on X-Gal-agar .
Six lysogens from each XRZ5 derivative carrying aroF-lacZ-fusions were purified and shown to be single lysogens ( 40 ) .
The 1-galactosidase activities in extracts of the lysogens were measured and are given in Miller units ( 29 ) .
Purification of S. typhimurium tyrosine-sensitive DAHP synthase .
E. coli GKM41 carrying plasmid pGM59 was grown to late log phase in minimal salts medium containing ampicillin .
The cells were harvested by centrifugation and resuspended in 50 mM potassium phosphate ( pH 6.5 ) containing 2 % propanediol and 2 mM phosphoenolpyruvate ( buffer A ) .
The cells were disrupted in an Aminco French pressure cell at 20,000 lb/in2 ; cell debris was removed by centrifugation for 60 min at 25,000 x g .
The supernatant was treated with 0.1 volume of 2 % protamine sulfate , and the precipitate was removed by centrifugation for 75 min at 30,000 x g .
The supernatant was applied to a BioGel hydroxylapatite-HTP column equilibrated with buffer A. Protein was eluted from the column with a 500-ml linear gradient of 0.05 to 0.5 M potassium phosphate containing 2 % propanediol and 2 mM phosphoenolpyruvate .
Protein was quantitated by the procedure of Lowry et al. .
( 26 ) ; gel electrophoresis was performed on a sodium dodecyl sulfate-10 % polyacrylamide gel by the method of Laemmli ( 25 ) ; the proteins in the gel were detected by silver staining ( 46 ) .
Amino acid sequencing was carried out on an Applied Biosystems model 470A gas-phase sequenator with a model 120A analyzer ( 17 ) .
S. typhimurium LT2 chromosomal DNA was digested separately with five restriction endonucleases .
The digestion products were subjected to agarose gel electrophoresis .
The dried gel was probed with E. coli DNA encoding tyrosine-sensitive DAHP synthase .
Plasmid pCG201 ( 38 ) carries the E. coli aroF gene ( Fig. 1 ) totally contained within two DdeI fragments of 714 and 796 bp .
The autoradiogram of a gel probed with the 796-bp DdeI fragment is shown in Fig. 2A .
The 714-bp DdeI probe gave an identical pattern .
PstI digestion yielded a 5.5-kilobase ( kb ) fragment that hybridized with both the 796-and 714-bp DdeI probes and was predicted to contain the entire aroF gene of S. typhimurium .
PstI-digested S. typhimurium LT2 DNA was subjected to gel electrophor - ` sis with low-melting-point agarose .
Fractions containing DNA fragments of different sizes were isolated by phenol extraction of gel slices melted at 65 °C .
A sample of each fraction was subjected to agarose gel electrophoresis and probed as before with the 796-bp DdeI fragment ( Fig. 2B ) .
DNA of fraction 3 was used in the cloning experiments .
Cloning of S. typhimurium aroF .
The positive selection vector pKGW ( 24 ) was chosen to clone S. typhimurium aroF .
This plasmid carries the gene encoding the restriction endonuclease EcoRI under the control of the lacUVS promoter ( Fig. 1 ) .
This high-copy-number plasmid is lethal to wild-type cells , but can be propagated in lacIq cells grown in the absence of inducer .
Upon induction of the lacUVS promoter with IPTG , overproduction of EcoRI becomes lethal to the host cells , unless the coding sequence of EcoRI is interrupted .
The PstI or BglII sites within the EcoRI coding sequence are suitable cloning sites .
Size-fractionated PstI-digested S. typhimurium DNA was cloned in plasmid pKGW .
Transformants of E. coli D1210 ( lacTq ) were selected in the presence of IPTG and kanamy-cin .
A library of recombinants was generated , amplified , and screened by transformation of the aroF strain GKM41 .
Selection was made for growth on minimal salts medium supplemented with phenylalanine and tryptophan .
An aroFcontaining plasmid designated pGM59 ( Fig. 1 ) was isolated and shown to contain aroF by hybridization and DAHP synthase assay of cell extracts from plasmid-bearing strains .
Nucleotide sequence analysis of S. typhimurium aroF .
The 5.5-kb PstI insert of plasmid pGM59 was subjected to restriction analysis ( Fig. 1 ) .
By hybridization analysis , aroF was localized within the 5.5-kb PstI fragment to a 2-kb EcoRV-HincII fragment .
Figure 3 shows the strategy that TTATTGCAAACCCAGGGAAATCCGCAGCOCCCGAACTAT GC A T GC G C CT T L L Q T Q O N P1J C0 V I L R O C Aa P N Y 242 T O T G A G C G T AGCCCGGCAGATOTCGCTCAGTGTGAAAAAGAGATGGACAGGCGGOACTAC1TCCTTCGCTGATG I K N 0 S P A D V A Q C Z Z Q A L R P 8 L N 264 C C O C GTAGATGCAGTCATOGTAACTCCAATAAAGATTATGCCCGCCAGCCAGCCOTTGCcGAATCTGTG 0 T T T C A V D C S H N S N K D Y R R Q P A V A Z S V 286 T A C C C C C GTTGCGCAGATTAAAGATGGCAATCGTTCAATCATTIGCTTAATGATTGAAAGTAATATTCATGAG K S 0 N 1 T TC G V A Q I D G N R I I L I 8 N I H 1 308 C T G A T A C T A A C C GGTAACCAGTCTTCCGAACAGCCGCGCAGCGAAATGAAGTATGGCOTTCCGTCACCGATGCTTCT S S S K 0 S G N Q E Q P R Z M Y V V T D A C 330 A T C G C G C A 0 A ATTAGCTGGGAGATGACCGATGCCCTGTTACGTGAAATTCAT ^ AAC WccCACCGa : Gq I S W E N T D A L L R 2 I H t D G Q LA 352 CT G T GZCGCGTCGCATAA V R V A 356 A FIG. 4 .
Nucleotide sequence of the S. typhimurium aroF ( GenBank no .
M31302 ) and amino-acid sequence of the encoded tyrosinesensitive DAHP synthase ( middle two lines ) .
The sequence variations to the E. coli aroF coding region ( upper line ) and the E. coli DAHP synthase ( lower line ) are also shown .
was used to obtain the nucleotide sequence of the 2-kb EcoRV-HincII fragment .
The nucleotide sequence reveals a 1,068-bp open reading frame that is similar in sequence to aroF of E. coli ( Fig. 4 ) .
Purification of S. typhimurium tyrosine-sensitive DAHP synthase and amino-acid sequence analysis .
The tyrosinesensitive DAHP synthase was purified from extracts of E. coli GKM41 ( aroF ) carrying the S. typhimurium aroF-plasmid pGM59 .
A two-step procedure yielded enzyme of near electrophoretic homogeneity ( Fig. 5 ) .
The protein was subjected to N-terminal amino-acid sequence analysis .
The N-terminal 14 amino-acid-residues are identical to those predicted from the nucleotide sequence of the 1,068-bp open reading frame .
Thus , we have cloned and sequenced the coding region of the S. typhimurium aroF gene .
Regulation of S. typhimurium aroF in E. coli .
To initiate a functional analysis of the S. typhimurium aroF regulatory region , we constructed two very similar lacZ-fusions to the homologous regions of the E. coli and the S. typhimurium aroF genes ; the fusions contain identical coding regions .
Site-directed mutagenesis was used to generate two SmaI sites covering codons 4 and 5 of the two genes ( Fig. 6 ) .
Two M13 constructs served as templates for the mutagenesis : M13GME contains the 674-bp EcoRV-NdeI E. coli fragment ( Fig. 1 ) that encompasses 334 bp upstream of the E. coli aroF transcription start .
M13GMS contains the 434-bp EcoRV-SmaI S. typhimurium fragment ( Fig. 1 ) that covers 313 bp upstream of the predicted S. typhimurium aroF transcription start .
Both fragments were inserted into the SmaI site of M13mpl8 .
After mutagenesis , new SmaI sites were detected by restriction analysis and confirmed by nucleotide sequence analysis .
The EcoRI-SmaI fragment that contains 18 bp of the M13 polylinker 5 ' to the new E. coli EcoRV-SmaI fragment of 397 bp and the EcoRI-SmaI fragment that contains the same polylinker fragment 5 ' to the new S. typhimurium EcoRV-SmaI fragment of 376 bp were subcloned into the EcoRI and SmaI sites of the polylinker of plasmid pMLB1034 , which carries a promoterless lacZ gene , yielding aroF-lacZ translational fusions .
In the two recombinant pMLB1034 derivatives , codons 4 of the E. coli and the S. typhimurium aroF were fused to codon 6 of lacZ .
The inserts of the recombinant plasmids were confirmed by restriction and nucleotide sequence analyses .
Phage XRZ5 was used to place the aroF-lacZ-fusions in single copy at the X att site on the E. coli chromosome ( 14 ) .
3-Galactosidase activities in the resulting lysogens grown on media with and without tyrosine were determined ( Table 2 ) .
Cells of tyrR + strains grown in minimal-salts tyrosine me-dium show very similar , low enzyme values , indicating that the E. coli Tyr repressor can regulate the expression of both the E. coli and the S. typhimurium aroF gene .
Since the aroF genes differ markedly for the nucleotide sequence in the three helix turns that separate aroFol and aroFc2 ( 12 ) , our results also suggest that the sequence in this region is not critical for repressor function .
Under conditions of derepression , P-galactosidase activity from the S. typhimurium aroF-lacZ fusion is about twice as high as the activity in the corresponding strain carrying the E. coli fusion ( Table 2 ) .
DISCUSSION S. typhimurium chromosomal DNA contains a 5.5-kb PstI fragment that strongly hybridizes with E. coli aroF probes .
The 5.5-kb PstI fragment was cloned into the positive selection vector pKGW .
The recombinant plasmid pGM59 complements the E. coli aroF mutant strain GKM41 .
A restriction map of the 5.5-kb insert of pGM59 was obtained , and the position of aroF on a 2-kb fragment within the insert was determined by hybridization analysis .
The nucleotide sequence of this 2-kb fragment contains a 1,068-bp open reading frame with extensive sequence similarity to the E. coli aroF gene ( 38 ) .
The two DNA sequences are 85.1 % identical .
Several other genes have been sequenced from both S. typhimurium and E. coli , most notably the genes of the trp operon ( 8 , 19 , 30 , 48 ) .
The trp operon genes showed between 75 and 84 % sequence identity .
The degree of relatedness of the two aroF genes is within the range at the upper end of the identity scale , perhaps reflecting the highly evolved role of DAHP synthase as a control enzyme for the common aromatic amino-acid bio-synthetic pathway ( 31 ) .
The 85.1 % identity between the two aroF genes contrasts with about 50 % identity between E. coli aroF and the other two E. coli genes encoding DAHP synthases ( 9 , 33 , 38 ) .
The three E. coli genes aroF , aroG , and aroH are evolutionarily more distant than the homologous S. typhimurium and E. coli aroF genes , suggesting that the three DAHP synthase isoenzymes existed before the genera Escherichia and Sal-monella diverged .
The S. typhimurium aroF gene encodes a protein of 356 amino-acid-residues .
S. typhimurium tyrosine-sensitive DAHP synthase was purified , and the amino-acid sequence predicted by the nucleotide sequence was confirmed through N-terminal sequence analysis .
The amino-acid sequences of the tyrosine-sensitive DAHP synthase from S. typhimurium and E. coli are 96.1 % identical ( Fig. 4 ) .
There are only 14 amino-acid-residue differences between the two proteins .
Eleven of these differences are localized to three small regions of the protein , residues-32 to 43 , 125 to 132 , and 345 to 353 .
Within these regions the sequence similarity is only 55.6 , 66.3 , and 66.7 % , respectively .
Apparently , none of these differences have a marked influence on the kinetic or stability properties of the enzyme .
The apparent Vmax values for both enzymes are very similar , and both enzymes are subject to rapid inactivation when cells approach the stationary-phase of growth ( G. K. Muday and K. M. Herrmann , unpublished data ) , a phenomenon previously described for the E. coli enzyme ( 43 ) .
The codon usage of the two aroF genes is relatively close to the overall codon usage of E. coli , as well as to each other .
It is , however , quite interesting that in both aroF genes rare codons are used for the aromatic-amino-acids tyrosine and phenylalanine .
In E. coli , 40 % of all tyrosine codons are TAT ; for the aroF genes , five of seven E. coli and six of seven S. typhimurium codons are TAT .
Likewise in E. coli , 37 % of all phenylalanine codons are TTT ; for the aroF genes of both organisms , seven of seven codons are TTT .
Also , several other rare codons are used slightly more frequently in the S. typhimurium gene , for example , TTA and TTG fo leucine , ATA for isoleucine , and CGA and CGG for arginine .
A more quantitative analysis showed a correlation of optimal codon usage to cellular levels of the protein products ( 21 ) .
When this analysis is applied to the two aroF genes , the frequencies are 0.61 and 0.64 for S. typhimurium and E. coli , respectively .
The E. coli aroF value is close to 0.63 , 0.65 , and 0.66 for the E. coli trpA , trpD , and trpE genes , respectively .
The frequencies of optimal codon usage for S. typhi-murium trpA , trpB , and trpD are all 0.63 , slightly lower than the E. coli trp gene values , just as the S. typhimurium aroF gene has a lower value than the E. coli aroF gene .
This result is in good agreement with a few other examples ( 13 ) that show higher frequencies of optimal codon usage in E. coli , suggestive of a slightly tighter codon preference .
The regulatory regions of the two aroF genes were also compared .
For the E. coli gene , the start of transcription has been determined ( 12 ) , a strong promoter has been identified ( 12 ) , and three operator boxes have been defined by mutational analysis ( 7 , 12 ) .
The aroF regulatory region of S. typhimurium shows a high degree of sequence identity to the corresponding E. coli sequences of defined regulatory function , but very little similarity in the sequences outside the defined regions ( Fig. 7 ) .
In all E. coli aroF operator mutations identified thus far , the changes are in nucleotides that are identical for both wild-type organisms ( Fig. 7 ) .
The S. typhimurium promoter was assigned on the basis of its similarity in sequence and location to the E. coli promoter .
The promoters are very similar and very strong , with McClure algorithm scores of 68.6 and 69.2 for the S. typhimu-rium and the E. coli promoter , respectively ( 15 ) .
Three operator boxes were identified within the S. typhi-murium regulatory region , based on their similarity to the E. coli boxes .
The sequence and location of the boxes and the distance between them are very similar for both genes ( Fig. 7 ) .
The distance between aroFol and aroFo2 corresponds to three turns of the helix .
Although the distance between these operator boxes is preserved , the nucleotide sequence in the region between the boxes shows much less similarity , indicating that the distance , if not the sequences , between the boxes may be important for proper operator recognition by the tyrR product .
The high degree of similarity between the regulatory regions of the two aroF genes suggests that the levels of transcription and translation of these two genes should be very similar .
To compare the control features for both aroF genes , we fused their regulatory regions to lacZ and measured the P-galactosidase levels in strains carrying the translational fusions in single copy .
Under derepression conditions , expression of the S. typhimurium promoter is about twice that of the E. coli promoter .
This difference could account in part for the higher levels of the tyrosine-sensitive DAHP synthase reported for wild-type S. typhimurium ( 22 ) .
Under repression conditions , the enzyme values were about the same .
These results indicate that the E. coli Tyr repressor recognizes both E. coli and S. typhimurium aroF operators with about equal efficiency .
Since the sequences that separate aroFol and aroFo2 in the two organisms show no similarity , one may assume that the sequences within these three turns of the DNA helix can not be part of the recognition signal for repressor binding .
A preliminary study with a multicopy plasmid system suggested that the distance between E. coli aroFol and aroFo2 is also not critical for repressor recognition ( 6 ) .
However , the separation of the two operator boxes by three turns of a helix for both organisms suggests an important role for this portion of the regulatory region .
The regulatory region of the E. coli aroL gene , which is also controlled by the tyrosine repressor , also has three operator boxes , arranged in the same way as the aroF boxes ( 10 ) .
The distance between the two upstream aroL boxes is again three turns of the helix , yet the nucleo-tide sequence of the spacer shows no similarity to the corresponding aroF E. coli or S. typhimurium sequences .
A new potential regulatory region is also seen when the E. coli and S. typhimurium aroF gene sequences are compared .
In the untranslated portion of the transcript for both regulatory regions , a palindromic sequence is found with a potential for stem-loop formation .
The regulatory significance of these palindromes will be addressed through site-directed mutagenesis .
We thank R. L. Somerville and H. Zalkin for bacterial strains and plasmids , M. A. Hermodson for help with the amino-acid sequence analysis , and R. L. Somerville and B. L. Wanner for critical reading of the manuscript .
G.K.M. was supported by David Ross grant 6901264 .
Ausubel , F. M. , R. Brent , R. E. Kingston , D. D. Moore , J. G. Siedman , J. A. Smith , K. Struhl .
Current protocols in molecular biology .
Greene Publishing Associates and John Wiley & Sons , Inc. , New York , N.Y 2 .
Beltz , G. A. , K. A. Jacobs , T. H. Eickbush , P. T. Cherbas , and F. C. Kafatos .
Isolation of multigene families and determination of homologies by filter hybridization methods .
A rapid alkaline extraction method for the isolation of plasmid DNA .
Bochner , B. R. , H. C. Huang , G. L. Schieven , and B. N. Ames .
Positive selection for loss of tetracycline resistance .
Clark , V. M. , and A. J. Kirby .
An improved synthesis of phosphoenolpyruvate .
Repression of the aroF promoter by the Tyr repressor in Escherichia coli K-12 : role of the upstream operator site .
Cobbett , C. S. , and M. L. Delbridge .
Regulatory mutants of the aroF-tyrA operon of Escherichia coli K-12 .
Crawford , I. P. , B. P. Nichols , and C. Yanofsky .
Nucleo-tide sequence of the trpB gene in Escherichia coli and Salmo-nella typhimurium .
Davies , W. D. , and B. E. Davidson .
The nucleotide sequence of aroG , the gene for 3-deoxy-D-arabino-heptu-losonate 7-phosphate synthetase ( phe ) in Escherichia coli K-12 .
DeFeyter , R. C. , B. E. Davidson , and J. Pittard .
Nucleo-tide sequence of the transcription unit containing the aroL and aroM genes from Escherichia coli K-12 .
Doy , C. H. , and K. D. Brown .
Control of aromatic biosynthesis : the multiplicity of 7-phospho-2-oxo-3-deoxy D-arabino-heptonate D-erythrose-4-phosphate-lyase ( pyruvate-pho phorylating ) in Escherichia coli W. Biochim .
Garner , C. C. , and K. M. Herrmann .
Operator mutations of the Escherichia coli aroF gene .
Gouy , M. , and C. Gautier .
Codon usage in bacteria : correlation with gene expressivity .
Grove , C. L. , and R. P. Gunsalus .
Regulation of the aroH operon of Escherichia coli by the tryptophan repressor .
Hawley , D. K. , and W. R. McClure .
Compilation and analysis of Escherichia coli promoter DNA sequences .
Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing .
Hermodson , M. A. , L. H. Ericsson , K. Titani , H. Neurath , and K. A. Walsh .
Application of sequenator analyses to the study of proteins .
The common aromatic biosynthetic pathway , p. 301-322 .
In K. M. Herrmann and R. L. Somerville ( ed .
) , Amino acids : biosynthesis and genetic regulation .
Addi-son-Wesley Publishing Co. , Reading , Mass. 19 .
Horowitz , H. , J. van Arsdell , and T. Platt .
Nucleotide sequence of the trpD and trpC genes of Salmonella typhimu-rium .
Hu , C.-Y. , and D. B. Sprinson .
Properties of tyrosine-inhibitable 3-deoxy-D-arabino-heptulosonic acid-7-phosphate synthase from Salmonella .
Ikemura , T. , and H. Ozeki .
Codon usage and transfer RNA contents : organism-specific codon choice patterns in reference to the isoacceptor contents .
Cold Spring Harbor Symp .
Jensen , R. A. , D. S. Nasser , and E. W. Nester .
Comparative control of a branchpoint enzyme in microorganisms .
Kleckner , N. , J. Roth , and D. Botstein .
Genetic engineering in-vivo using translocatable drug-resistance elements .
Kuhn , I. , F. H. Stephenson , H. W. Boyer , and P. J. Greene .
Positive selection vectors utilizing lethality of the EcoRI endonuclease .
Cleavage of structural proteins during the assembly of the head of bacteriophage T4 .
H. , N. J. Rosebrough , A. L. Farr , and R. J. Randall .
Protein measurements with the Folin phenol reagent .
Maniatis , T. , E. F. Fritsch , and J. Sambrook .
Molecular cloning : a laboratory manual .
Cold Spring Harbor Laboratory , Cold Spring Harbor , N.Y. 28 .
New M13 vectors for cloning .
Experiments in molecular genetics .
Cold Spring Harbor Laboratory , Cold Spring Harbor , N.Y. 30 .
Nichols , B. P. , and C. Yanofsky .
Nucleotide sequence of trpA of Salmonella typhimurium and Escherichia coli : an evolutionary comparison .
Ogino , T. , C. Garner , J. L. Markley , and K. M. Herrmann .
Biosynthesis of aromatic compounds : 13C NMR spectros-copy of whole Escherichia coli cells .
Biosynthesis of the aromatic-amino-acids , p. 368-394 .
In F. C. Neidhardt , J. L. Ingraham , K. B. Low , B. Magasanik , M. Schaechter , and H. E. Umbarger ( ed .
) , Esche-richia coli and Salmonella typhimurium : cellular and molecular biology .
American Society for Microbiology , Washington , D.C. 33 .
Ray , J. M. , C. Yanofsky , and R. Bauerle .
Mutational analysis of the catalytic and feedback sites of the tryptophan-sensitive 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase of Escherichia coli .
Saito , H. , and K. I. Miura .
Preparation of transforming deoxyribonucleic acid by phenol treatment .
Sanger , F. , S. Nicklen , and A. R. Coulson .
DNA sequencing with chain-terminating inhibitors .
Sayers , J. R. , W. Schmidt , and F. Eckstein .
5 ' -3 ` Exonucleases in phosphothionate-based oligonucleotide-di-rected mutagenesis .
Schoner , R. , and K. M. Herrmann .
Purification , properties and kinetics of the tyrosine-sensitive isoenzyme from Esche-richia coli .
Shultz , J. , M. A. Hermodson , C. C. Garner , and K. M. Herr-mann .
The nucleotide sequence of the aroF gene of Escherichia coli and the amino-acid sequence of the encoded protein , the tyrosine-sensitive 3-deoxy-D-arabino-heptuloso-nate 7-phosphate synthase .
Sieben , A. S. , A. S. Perlin , and F. J. Simpson .
An improved preparative method for D-erythrose-4-phosphate .
Silhavy , T. J. , M. L. Berman , and L. W. Enquist .
Experiments with gene fusions .
Cold Spring Harbor Laboratory , Cold Spring Harbor , N.Y. 41 .
Srinivasan , P. R. , and D. B. Sprinson .
2-Keto-3-deoxy-D-arabo-heptonic acid 7-phosphate synthetase .
Tribe , D. E. , H. Camakaris , and J. Pittard .
Constitutive and repressible enzymes of the common pathway of aromatic biosynthesis in Escherichia coli K-12 : regulation of enzyme synthesis at different growth-rates .
Tribe , D. E. , and J. Pittard .
Hyperproduction of tryptophan by Escherichia coli : Genetic manipulation of the pathways leading to tryptophan formation .
Tsao , S. G. S. , C. F. Brunk , and R. E. Pearlman .
Hybridization of nucleic acids directly in agarose gels .
Vogel , H. J. , and D. M. Bonner .
Acetylornithinase o Escherichia coli : partial purification and some properties .
Wray , W. , R. Boulikas , V. P. Wray , and R. Hancock .
Silver staining of proteins in polyacrylamide gels .
Yanisch-Perron , C. , J. Vieira , and J. Messing .
Improved M13 phage cloning vectors and host strains : nucleotide sequences of the M13mpl8 and pUC19 vectors .
Yanofsky , C. , and M. vanCleemput .
Nucleotide sequence of trpE of Salmonella typhimurium and its homology with the corresponding sequence of Escherichia coli .