173 , No. 11 Cloning an The Salmonella typhimurium pepT gene encodes an ami-notripeptidase that is produced at higher levels in cells grown anaerobically than in cells grown aerobically ( 32 ) .
The anaerobic expression of pepT and other Salmonella genes ( 13 , 32 ) requires the product of oxrA , the Salmonella equivalent of the Escherichia colifnr gene ( 11 , 32 ) .
The product of fnr is a positive regulator of a family of genes that includes nitrate reductase , fumarate reductase , and nitrite reductase ( 14 , 22 , 27 ) .
Most genes regulated byfnr encode components of anaerobic respiratory pathways ( 29 ) .
Peptidase T has no obvious function in growth under anaerobic respiratory conditions , and the significance of fnr-dependent regulation of pepT is obscure .
As part of an effort to understand the mechanism and physiological significance of the anaerobic regulation of pepT , we have cloned the pepT gene and determined its nucleotide sequence .
d Nucleotide Sequence of the Anaerobically pepT Gene of Salmonella typhimurium CHARLES G. MILLER , t * JUDY L. MILLER , t AND DEEPSARAN A. BAGGA Department of Molecular Biology and Microbiology , School of Medicine , Case Western Reserve University , Cleveland , Ohio 44106 Received 11 February 1991/Accepted 28 March 1991 Regulated The anaerobically regulated pepT gene of Salmonella typhimurium has been cloned in pBR328 .
Strains carrying the pepT plasmid , pJG17 , overproduce peptidase T by approximately 70-fold .
The nucleotide sequence of a 2.5-kb region including pepT has been determined .
The sequence codes for a protein of 44,855 Da , consistent with a molecular weight of -46,000 for peptidase T ( as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and gel filtration ) .
The N-terminal amino-acid sequence of peptidase T purified from a pJG17-containing strain matches that predicted by the nucleotide sequence .
A plasmid carrying an anaerobically regulated pepT : : lacZ-transcriptional-fusion contains only 165 bp 5 ' to the start of translation .
This region contains a sequence highly homologous to that identified in Escherichia coli as the site of action of the FNR protein , a positive regulator of anaerobic gene expression .
A region of the deduced amino-acid sequence of peptidase T is similar to segments of Pseudomonas carboxypeptidase G2 , the E. coli peptidase encoded by the iap gene , and E. coli peptidase D. MATERIALS AND METHODS Bacterial strains and plasmids , media , and growth-conditions .
The bacterial strains and plasmids used in this work are listed in Table 1 .
Media and growth-conditions have been described elsewhere ( 32 ) .
Standard methods ( 16 ) were used for preparation of chromosomal and plasmid DNA , restriction enzyme digestion , ligation , and agarose gel electrophoresis .
P22 transduction ( 4 ) was used to move plasmids between Salmonella strains ( 25 ) .
DNA sequencing was carried out by the dideoxy method ( 26 ) with phage T7 DNA polymerase ( Sequenase ; U.S. Biochemicals ) .
Most of the sequence was obtained by using single-stranded templates obtained from subclones into M13mp18 or M13mpl9 ( 18 , 35 ) .
Both strands were completely sequenced .
Sequence analysis was carried t Present address : Department of Microbiology , University of Illinois at Urbana-Champaign , 131 Burrill Hall , 407 South Goodwin , Urbana , IL 61801 .
out with the Bionet resource and the University of Wisconsin Genetics Computer Group programs ( 5 ) .
3-Galactosidase activity was determined as described by Miller ( 19 ) .
Peptidase T was assayed , using Met-Gly-Gly as the substrate and high-performance liquid chromatography of reaction mixtures derivatized with trinitrobenzenesulfonyl chloride ( 33 ) .
Purification of peptidase T. Peptidase T was purified from S. typhimurium TN2322 grown without shaking to stationary-phase in minimal glucose medium supplemented with Casamino Acids ( 0.1 % ) and ampicillin ( 100 The RgIml ) .
harvested cells ( 26.4 g ) were suspended in buffer ( 0.01 M Tris-HCl , pH 7.5 ) and disrupted by sonication .
After centrifugation for 1 h at 27,000 x g , the supernatant was diluted to 68 ml with buffer and then 10 ml of protamine sulfate solution ( 2 % ) was added with stirring at 4 °C over 1 h. Centrifugation at 12,000 x g for 10 min produced a pellet containing the peptidase T activity .
This pellet was suspended in 140 ml of buffer , and the resulting suspension was centrifuged for 1 h at 27,000 x g .
The supernatant was retained and , after dialysis overnight in buffer , applied to a Whatman DE-52 column ( 140-ml volume ) equilibrated with buffer .
This column was eluted with a NaCl gradient ( O to 0.4 M in buffer ) , and peptidase T was eluted at -0.3 M salt .
The pooled fractions containing peptidase T ( 209 ml ) were concentrated to 6 ml ( Amicon YM10 membrane ) and applied to an Ultrogel AcA54 ( LKB ) column ( 475-ml total volume , equilibrated with 0.05 M Tris-HCl [ pH 7.5 ] ) .
Peptidase T eluted from this column at a position suggesting a molecular mass of -47 kDa .
The pooled active fractions ( 25 ml ) were concentrated ( Amicon CentripreplO ) and exchanged into 0.02 M Tris-HCl ( pH 7.5 ) with a Pharmacia PD10 column .
This material was chromatographed on a Pharmacia MonoQ HR5/5 column equilibrated with 0.02 M Tris-HCl ( pH 7.5 ) buffer and eluted with a 23-ml NaCl gradient ( O to 0.4 M ) .
Peptidase T eluted at -0.25 M salt .
The active fractions were pooled , concentrated to 150 RI ( Amicon CentripreplO ) , and chromatographed on a Superose-12 column ( Pharmacia ) equilibrated with 0.05 M Tris-HCl ( pH 7.5 ) .
Peptidase T eluted as a symmetrical peak and was concentrated to 0.92 mg/ml and frozen at -70 °C .
Sodium dodecyl sulfate-poly-acrylamide gel electrophoresis ( SDS-PAGE ) of the purified material showed only one band ( molecular mass , 46 kDa ) when the gel was stained with Coomassie blue .
The purification yielded 12 % recovery and a 145-fold increase in specific activity .
This represents a purification factor of 860 relative to the level of activity found in extracts of cells grown under inducing conditions from strains carrying a single copy of pepT .
The amino-acid sequence of the N-terminal region of the protein was determined by using an Applied Biosystems model 477A protein sequencer .
Nucleotide sequence accession number .
GenBank has assigned the accession number M62725 to the S. typhimurium pepT sequence .
355 RESULTS AND DISCUSSION Cloning of pepT .
For cloning of the wild-type pepT gene , fragments ( 6.5 to 10 kb ) from a Sau3A partial digest of chromosomal DNA from strain TN1246 ( a pepT + strain carrying mutations in several other peptidase genes [ 31 ] ) were ligated into the BamHI site of pBR328 , and the resulting plasmids were transformed into E. coli LE392 ( 16 ) with selection for ampicillin resistance .
Plasmid DNA was prepared from a pool ( -4,000 colonies ) of these transformants and used to transform S. typhimurium TN2540 , again with selection for ampicillin resistance .
Approximately 20,000 transformants were pooled , and a P22 transducing lysate was prepared on this population .
To identify plasmids carrying pep genes , this lysate was used to transduce the multiply peptidase-deficient strain TN2183 , with selection for both chloramphenicol resistance and growth on Met-Gly-Gly as the Met source .
To verify that Met-Gly-Gly utilization was plasmid encoded , colonies from these transduction plates were purified and transducing lysates were prepared and used to transduce TN2183 to chloramphenicol resistance .
These transductants were checked for inheritance of the unselected Met-Gly-Gly utilization phenotype .
Transductants from these crosses were tested for utilization of '' Cultures were grown in LB on a rotating wheel ( aerobic ) or standing in a filled screw-cap tube ( anaerobic ) .
peptides other than Met-Gly-Gly .
Several strains with a utilization pattern that suggested they contained plasmids producing peptidase T were identified , and one of these plasmids ( pJG17 , originally carried by strain TN2322 ) was characterized in detail .
A crude extract of TN2322 was electrophoresed in a nondenaturing polyacrylamide gel , and the gel was stained for peptidase activity ( 15 ) , using Leu-Gly-Gly and Met-Gly-Gly as substrates .
The gel showed two bands of activity , as observed previously with strains that overproduce peptidase T as a result of chromosomal mutations ( 31 , 32 ) .
These bands had no activity toward the dipeptide Leu-Gly .
These results strongly suggested that pJG17 codes for peptidase T .
The pJG17 plasmid was transduced into a polA strain ( 34 ) with selection for chloramphenicol resistance .
Since pBR328 can not be maintained as a plasmid in a polA strain ( 12 ) , these transductants contain plasmids inserted into the chromosome by homologous recombination between the Salmonella DNA in the plasmid and the corresponding chromosomal region ( 7 ) .
One of these transductants was purified and used as a recipient in a transduction cross with a strain carrying a mini-TnJO insertion ( zcf-3233 : : TnlO.l16M7 ) that is linked to pepT ( 13 ) .
Tetracycline-resistant transductants from this cross were tested for loss of chloramphenicol resistance conferred by the plasmid .
Thirty percent ( 28 of 88 ) of the tetracycline-resistant transductants were chloramphenicol sensitive .
As a control for spontaneous loss of the inserted plasmid , the same transduction was carried out by using as the donor a strain carrying zad-3131 : : TnJOAJ6AJ7 , an insertion unlinked to pepT .
Only 2 of 88 tetracycline-resistant transductants were chloramphenicol sensitive .
These results indicate that the plasmid is integrated into the chromosome near pepT and must therefore carry an insert with homology to the pepT region .
The levels of peptidase T in extracts of TN2322 ( pJG17 ) made from both aerobically and anaerobically grown cells were determined by using Met-Gly-Gly as TABLE 1 .
Bacterial strains and plasmids TABLE 2 .
, B-Galactosidase levels '' Strain or plasmid Description 1-Galactosidase level ( U ) Strain Ratio ( plasmid ) ( anaerobic/aerobic ) Strains TN1246 Aerobic 50 860 Anaerobic 440 6,100 leuBCD485 pepBI I pepN90 pepAJ6 AsupQ302 ( proAB pepD ) leuBCD485 leuBCD485 metA15 pepN90 pepA16 pepBJl pepPI pepQl pep77 : : Mudl ( X ) leuBCD485 pep T7 : : MudJ leuBCD485 metAl5 pepN90 pepA16 pepBRI pepPI pepQl pepT7 : : Mudl ( X ) pJG17 metE551 metA22 ilv-452 trpB2 hisC527 ( Am ) ga1E496 xyl404 rpsL120 flaA66 hsdL6 hsdSA29 TN2262 ( no plasmid ) TN2262 ( pJG38 ) 8.8 7.1 TN1379 TN2183 TN2262 TN2322 TN2540 ( DB4926 ) Plasmids pJG17 7.1-kb insert containing pepT in BamHl site of pBR328 15-kb insert containing pepT7 : : MudJ in BamHI site of pBR322 pJG38 pJG1 7 Bm-I 1 $ b sv V AE EB V E I I I I P EB I I I pJG38 S E B I I lacZ MAdJ FIG. 1 .
Restriction of pJG17 and pJG38 .
Thick lines indi-maps cate vector DNA ( pBR328 for pJG17 and pBR322 for pJG38 ) ; thin lines indicate inserted DNA .
Abbreviations : A , AvaI ; B , BgIlI ; Bm , BamHI ; E , EcoRI ; P , PstI ; S , Sall ; V , EcoRV .
The specific activities ( in units per milligram [ 33 ] ) for TN1246 were 0.04 ( aerobic ) and 0.54 ( anaerobic ) .
TN2322 ( pJG17 ) showed specific activities of 9.3 ( aerobic ) and 39 ( anaerobic ) U/ml .
These data show that the strain carrying pJG17 overproduces peptidase T and that peptidase T activity is anaerobically inducible in this strain .
Taken together , these results show that pJG17 carries pepT and the sites necessary for its regulated expression .
Cloning of a pepT : : lacZ fusion .
In addition to the wild-type pepT gene , a pepT : : lacZ-transcriptional-fusion , constructed by replacement ( 9 ) of the Mudl insertion described previously ( 32 ) with MudJ ( MudI1734 [ 3 ] ) , was cloned .
Fragment A E E A V FIG. 2 .
Nucleotide sequence of region of pJG17 containing pepT .
The underlined G at nucleotide 283 indicates the start of the insert in pJG38 .
A potential promoter site for the aerobic expression of pepT at nucleotides 298 to 303 ( -35 ) and 320 to 325 ( -10 ) is underlined .
The sequence proposed to be the site of FNR action ( Fig. 3 ) at nucleotides 364 to 391 is underlined .
The proposed -10 region for this promoter at nucleotides 407 to 412 is indicated .
A potential ribosome binding site is labeled S.D. .
The MudJ element of pJG38 is inserted between nucleotides 1308 and 1309 .
In addition to the inverted repeat present at the proposed FNR interaction site , the pepT promoter region contains an inverted repeat at nucleotides-285 to 291 and 298 to 303 and three appearances of the sequence AAAGTGA ( nucleotides 339 to 345 , 368 to 374 , and 423 to 429 ) .
The N-terminal amino-acid sequence determined from purified peptidase T is underlined .
2350-2370-2390 AACCTGGGATAAT CSTGGC ~ GCAGCAGCGCATATTGcTTA 2410-2430-2450 TAC&GCTATAGTCGAGGCCTCGCTAAAGTAGGCC ~ ATCACA 2470-2490-2510 AACGCTTTATGCGCGAATTCGGCGAAATGACGGTT-GACRGCAATAATCTTGCTGGCTTTT 2530 2550 ATGCCAQGGGCCATCTTATAAGGAAGOGAAA Consensus A-A-TTGAT -- A-ATCAAT -- -14 -21 bp - '' -10 '' 2EPT AAAAGTGACCTGACGCATATT -15 bp-AAThAT ( 14 to 19 kb ) from a Sau3A partial digest of TN2262 were ligated into the BamHI site of pBR322 , and the resulting plasmids were transformed into E. coli LE392 ( 16 ) with selection for kanamycin resistance ( encoded by the MudJ element ) .
Plasmid DNA from 22 of these transformants was used to transform Salmonella strain DB4926 on nutrient agar-kanamycin-5-bromo-4-chloro-3-indolyl -,3-D-galactopy-ranoside ( X-Gal ) plates .
The 11 blue colonies were saved , and P22 transducing lysates were prepared on each .
P22 lysates from 11 of these strains were used to transduce TN1379 to kanamycin resistance on MacConkey lactose plates .
Ten of these strains yielded red transductants .
These transductants were tested for anaerobic induction of p-ga-lactosidase by determining the levels of activity in station-ary-phase and exponential-phase cells ( 32 ) .
Four strains clearly contained plasmids that conferred elevated station-ary-phase levels of , B-galactosidase , and one of these ( containing plasmid pJG38 ) was characterized further .
The data in Table 2 suggest that this strain carries all of the pepT-linked sites necessary for anaerobic regulation .
Restriction analysis of pJG38 ( Fig. 1 ) showed that this plasmid carries an insert of approximately 16 kb and locates the position and orientation of the MudJ insertion .
The restriction map of pJG17 ( Fig. 1 ) shows that the insert in this plasmid is approximately 7.1 kb long , and comparison with pJG38 indicates the location of pepT in pJG17 .
Nucleotide sequence of pepT .
The nucleotide sequence of a segment of pJG17 that includes pepT is shown in Fig. 2 .
An open reading frame encodes a protein with a molecular mass of 44,855 Da .
This is consistent with the molecular masses determined by SDS-PAGE ( 46 kDa ) and gel filtration ( 47 kDa ) .
The N-terminal sequence of this open reading frame agrees with that determined for purified peptidase T .
A potential ribosome binding site ( GAGG ) is located 8 bases 5 ' to the translation start codon .
The chromosomal DNA in pJG38 begins at position 283 of the sequence shown in Fig. 2 and includes only 165 bp 5 ' to the start of translation .
Since production of,-galactosidase from pJG38 is anaerobically regulated , this 165-bp region must contain the sites necessary for this regulation .
A site of imperfect dyad symmetry with significant similarity ( Fig. 3 ) to the proposed FNR consensus recognition sequence ( 28 ) is located 15 bp upstream from a potential -10 sequence for sigma-70 promoters .
This spacing is consistent with those observed for the FNR-dependent promoters discussed by Eiglmeier et al. ( 6 ) .
In addition to its presence in the proposed FNR site ( nucleotides 368 to 374 ) , the sequence AAAGTGA is present at two additional sites ( nucleotides 339 to 345 and 423 to 429 ) in this region .
The significance of this , if any , is unknown .
As indicated in Fig. 2 , another potential promoter site which might be responsible for the basal ( aerobic ) expression of pepT is located upstream from the proposed FNR site .
Two regions of imperfect inverted repeat , also of unknown significance , are located 5 ' to the proposed FNR site ( nucleotides-285 to 303 and 305 to 331 ) .
A sequence potentially forming a mRNA stem-loop structure ( nucleotides 1703 to 1732 ) followed by a run of T 's that might function as a transcription terminator ( 24 ) is located downstream from the translation stop codon .
A search of the GenBank and EMBL sequence data bases using the FASTA program ( 23 ) turned up a potentially significant amino-acid sequence similarity ( 27.5 % sequence identity in a 211-amino-acid overlap ) between a region of PepT and a region of carboxypeptidase G2 from a Pseudo-monas strain ( 20 ) ( Fig. 4 ) .
The gene encoding this enzyme was also determined to be the most closely related to pepT in a FASTA search of the nucleotide sequence data banks .
Although the amino-acid sequence identity is low , the fact that both proteins are bacterial metallopeptidases prompted further analysis .
A subsequence of highest similarity ( 17 identities in 41 amino-acids as aligned by the Bestfit program ) was identified and used in a second search of the data banks .
This search revealed a similar region in a third bacterial This locus the the E. peptidase , product of coli iap gene .
encodes an enzyme ( presumably an aminopeptidase ) that is responsible for generating electrophoretically detectable variants of alkaline phosphatase ( 10 ) .
A comparison of this sequence with the sequence of E. coli pepD ( 8 ) also turned up a region of similarity .
These proteins have similar functions ( peptide bond hydrolysis ) , they are of roughly similar size ( 38 to 53 kDa ) , and the subsequence of high similarity is located in approximately the same position in each sequence ( it begins between 110 and 137 amino-acids from the N terminus ) .
Peptidase T , carboxypeptidase G2 , and peptidase D are known to be metallopeptidases , and it is possible that a common sequence motif represents a metal-binding region of the protein .
The specificities of these enzymes are quite different , so it is likely that the sequence has nothing to do with substrate recognition .
The amino-acid sequence was also compared to the sequences of several other peptidases from E. coli or S. typhimurium by using Genalign .
No significant similarities were found between the sequence of pepT and those of E. coli pepN ( 1 , 17 ) , pepA ( 30 ) , and pepP ( 36 ) , E. coli ( 2 ) and S. typhimurium ( 21 ) pepM , S. typhimurium dcp ( 7a ) , and S. typhimurium opdA ( formerly optA ) ( 3a ) .
Comparison of the proposed pepT FNR site with the most recent E. coli consensus sequence ( 28 ) .
Bases underlined in the pepT sequence match the consensus .
Other slightly different consensus sequences have been proposed ( e.g. , in reference 6 ) .
The proposed FNR site is located 15 to 21 bp upstream from the -10 region of most of the FNR-dependent promoters ( 6 ) .
A reasonable -10 site 15 bp downstream from the FNR site of pepT is indicated .
lap aIpOIA & GLGVUEIaAERLDIrTPTE .
Ga Cpg2 PGIA IAVITULYGVRDY QIwVLFRDEGSFGS PepD .
ame ... S V.LDE * LZVLLTKTUZ DGA FIG. 4 .
Amino acid sequence similarities .
The sequences shown are from lap ( amino-acids 137 to 182 ) , an E. coli peptidase involved in the generation of N-terminal sequence variants of alkaline phosphatase ( 10 ) ; peptidase T ( PepT ; amino-acids 134 to 179 ) ; carboxypeptidase G2 ( Cpg2 ; amino-acids 136 to 179 ) , a Pseudomonas enzyme that removes glutamate residues from folic acid and its derivatives and analogs ( 20 ) ; and peptidase D ( PepD ; amino-acids 110 to 152 ) , an E. coli dipeptidase ( 8 ) This work was supported by a grant ( AI10333 ) from the National Institute for Allergy and Infectious Diseases .
We acknowledge the contributions of Jane Glazebrook , John Denker , Mary Jane Lombardo , and Randa Quale .
Bally , M. , M. Foglino , M. Bruschi , M. Murgier , and A. Lazdunski .
Nucleotide sequence of the promoter and amino-terminal encoding region of the Escherichia coli pepN gene .
Ben-Bassat , A. , K. Bauer , S.-Y .
Chang , K. Myambo , A. Boosman , and S. Chang .
Processing of the initiation methionine from proteins : properties of the Escherichia coli methionine aminopeptidase and its gene structure .
Castilho , B. A. , P. Olfson , and M. J. Casadaban .
Plasmid insertion mutagenesis and lac gene fusion with mini-Mu bacteriophage transposons .
Conlin , C. Unpublished data .
Davis , R. , D. Botstein , and J. R. Roth .
Cold Spring Harbor Laboratory , Cold Spring Harbor , N.Y. 5 .
Devereux , J. , P. Haeberli , and 0 .
A comprehensive set of sequence analysis programs for the VAX .
Eiglmeier , K. , N. Honore , S. luchi , E. C. C. Lin , and S. T. Cole .
Molecular genetic analysis of FNR-dependent promoters .
Gutterson , N. I. , and D. E. Koshland .
Replacement and amplification of bacterial genes with sequences altered in-vitro .
Hamilton , S. Unpublished data .
Henrich , B. , U. Monnerjahn , and R. Plapp .
Peptidase D gene ( pepD ) of Escherichia coli K-12 : nucleotide sequence , transcript mapping , and comparison with other peptidase genes .
Hughes , K. T. , and J. R. Roth .
Transitory cis complementation : a method for providing transposition functions to defective transposons .
Ishino , Y. , H. Shinagawa , K. Makino , M. Amemura , and A. Nakata .
Nucleotide sequence of the iap gene , responsible for alkaline phosphatase isozyme conversion in Escherichia coli , and identification of the gene product .
Jamieson , D. J. , and C. H. Higgins .
Anaerobic and leucine-dependent expression of a peptide transport gene in Salmonella typhimurium .
Kingsbury , D. T. , and D. R. Helinski .
DNA polymerase as a requirement for the maintenance of the bacterial plasmid colicinogenic factor El .
Kukral , A. M. , K. L. Strauch , R. A. Maurer , and C. G. Miller .
Genetic analysis in Salmonella typhimurium with a small collection of randomly spaced insertions of transposon TnOAM16117 .
Lambden , P. R. , and J. R. Guest .
Mutants of Escherichia coli K-12 unable to use fumarate as an anaerobic electron-acceptor .
Lewis , W. H. P. , and H. Harris .
Human red cell peptidases .
Maniatis , T. , E. F. Fritsch , and J. Sambrook .
Molecular cloning : a laboratory manual .
Cold Spring Harbor Laboratory , 17 .
McCaman , M. T. , and J. D. Gabe .
The nucleotide sequence of the pepN gene and its over-expression in Escherichia coli .
New M13 vectors for cloning .
Experiments in molecular genetics .
Cold Spring Harbor Laboratory , Cold Spring Harbor , N.Y. 20 .
Minton , N. P. , T. Atkinson , C. J. Bruton , and R. F. Sherwood .
The complete nucleotide sequence of the Pseudomonas gene coding for carboxypeptidase G2 .
Movva , N. R. , D. Semon , C. Meyer , E. Kawashima , P. Wingfield , J. Miller , and C. G. Miller .
Cloning and nucleotide sequence of the Salmonella typhimurium pepM gene .
Newman , B. M. , and J. A. Cole .
The chromosomal location and pleiotropic effects of mutations of the nirA + gene of Escherichia coli K-12 : the essential role of nirA + in nitrite reduction and in other anaerobic redox reactions .
Pearson , W. R. , and D. J. Lipman .
Improved tools for biological sequence comparison .
Transcription termination and the regulation of gene expression .
Sanderson , K. E. , and J. R. Roth .
Linkage map of Salmonella typhimurium , edition VI .
S. Sanger , F. , Nicklen , and A. R. Coulson .
DNA sequencing with chain-terminating inhibitors .
Shaw , D. J. , and J. R. Guest .
Amplification and product identification of the fnr gene of Escherichia coli .
Spiro , S. , and J. R. Guest .
FNR and its role in oxygenregulated gene expression in Escherichia coli .
Nitrate respiration in relation to facultative metabolism in enterobacteria .
Stirling , C. J. , S. D. Colloms , J. F. Collins , G. Szatmari , and D. J. Sheratt .
xerB , an Escherichia coli gene required for plasmid ColEl site-specific recombination , is identical to pepA , encoding aminopeptidase A , a protein with substantial similarity to bovine lens leucine aminopeptidase .
Strauch , K. L. , T. H. Carter , and C. G. Miller .
Overproduction of Salmonella typhimurium peptidase T. J. Bacteriol .
Strauch , K. L. , J. B. Lenk , B. L. Gamble , and C. G. Miller .
Oxygen regulation in Salmonella typhimurium .
Strauch , K. L. , and C. G. Miller .
Isolation and characterization of Salmonella typhimurium mutants lacking a tripeptid-ase ( peptidase T ) .
Whitfield , H. , and G. Levine .
Isolation and characterization of a mutant of Salmonella typhimurium deficient in a major deoxyribonucleic acid polymerase activity .
Yanisch-Perron , C. , J. Vieira , and J. Messing .
Improved M13 phage cloning vectors and host strains : nucleotide sequences of the M13mpl8 and pUC19 vectors .
Yoshimoto , T. , H. Tone , T. Honda , K. Osatomi , R. Kobayashi , and D. Tsuru .
Sequencing and high expression of ami-nopeptidase P gene from Escherichia coli HB101 .