173 , No. 20 Molecular Characterization of flgM , a Gene Encoding a Negative Regulator of Flagellin Synthesis in Salmonella typhimurium KAREN L. GILLEN AND KELLY T. HUGHES * Department of Microbiology SC42 , University of Washington , Seattle , Washington 98195 Received 4 June 1991/Accepted 7 August 1991 The expression of flagellin in Salmonella typhimurium is coupled to the assembly of complete flagella .
Mutations which disrupt this coupling define a gene , flgM , which represses the expression of the flagellin genes in strains with mutations in the basal body , switch , or hook flagellar gene ( K. L. Gillen and K. T. Hughes , J. Bacteriol .
Complementation studies demonstrated that theflgM gene is contained within a 600-bp cloned DNA fragment .
Sequence analysis revealed that this fragment carries a small open reading frame corresponding to a 97-amino-acid protein .
The FlgM protein observed in a T7-mediated expression system showed an apparent molecular mass of 9.5 kDa , similar to the predicted size of 10.6 kDa .
Upstream of the flgM coding region is a putative promoter sequence which shows strong homology to that thought to be recognized by the flagellin-specific sigma factor ( FliA ) .
Consistent with the use of this promoter in-vivo , promoter mapping by primer-extension demonstrated a transcriptional start site 11 bases downstream from the center of the putative -10 promoter element , which was dependent on functional FliA for full expression .
Motility and chemotaxis in peritrichously flagellated Sal - Methods ) , allowed expression of the flagellin genes in all flagellar mutant backgrounds studied except in those strains with mutations in the flhC , flhD , orfliA gene .
In this article we present a further characterization of the flgM gene .
By complementation assays and DNA sequence analysis with transposon TnlOOO insertions , we have determined that the flgM gene lies within a 600-bp SspI-BsmI cloned fragment of DNA .
FlgM activity was localized to an open reading frame corresponding to a 97-amino-acid protein , confirmed by the construction of a frameshifted flgM mutant .
Further evidence to support the identification of the reading frame came from primer-extension assays to locate the start of transcription and T7-mediated expression of the protein product of the flgM gene .
The significance of these results for FlgMmediated regulation of flagellin is discussed .
monella typhimurium require the expression of over 50 genes and subsequent ordered assembly of these gene products into about 7 to 10 complete flagellar structures ( for a review , see references 27 and 28 ) .
The flagellum is a complicated structure consisting of a filament , the external element composed of flagellin which is rotated for motility and chemotaxis ; the basal body , a group of membrane-bound rod and ring proteins of the flagellar motor ; and the hook , a flexible joint linking the filament and the basal body .
Additional associated components include the switch complex and chemotaxis proteins , which change the direction of filament rotation ( 20 , 45 , 46 ) ; three hook-associated proteins incorporated into the external structure ( 16 ) ; and proteins required for energy transduction ( 2 , 8 , 19 ) .
Expression of flagellar components is highly regulated ( 21 , 22 , 24 , 25 ) .
Cells defective for basal body , hook , or switch proteins do not transcribe either of the flagellin genes , fliC or fljB , alternately expressed by S. typhimurium ( 22 , 25 , 40 ) .
In addition , cells defective for either of two positive activator flhC flhD ( 23 , 38 ) , will proteins , encoded by the and genes not transcribe any flagellar genes ( 22 , 25 ) .
A regulatory classes has been dehierarchy composed of three main scribed by Kutsukake et al. for S. typhimurium ( 25 ) .
In this model , the genes at the top of the hierarchy or in the early class include theflhC andflhD genes .
The second or middle class includes those genes which encode components of the basal body , hook , and switch complex as well as the fliA gene .
The fliA gene encodes an alternate sigma factor ( 29 ) that directs the transcription of the flagellin genes , which are included in the third or late class of the hierarchy along with the genes for chemotaxis proteins .
We recently identified a negative regulatory locus which is evidently responsible for the coupling of flagellin expression to flagellar assembly by preventing expression of the flagellin genes when a component of the middle class of proteins is defective ( 11 ) .
Insertional inactivation of this locus , designated flgM ( previously designated flgR ; see Materials and MATERIALS AND METHODS Media .
( Difco ) supplemented with NaCl ( 5 g/liter ) was used as a rich-medium for growing strains , and Bacto-agar ( Difco ) was added to a final concentration of 1.5 % for solid medium .
LB ( 9 ) supplemented with E-salts ( 43 ) and 0.2 % glucose was used for growth of P22 phage .
MacConkey-lactose ( Difco ) and TTC-lactose plates were used as indicator media .
TTC-lactose agar ( 26 , 44 ) contained tryptone ( 10 g/liter ) , yeast extract ( 1 g/liter ) , NaCl ( 5 g/liter ) , lactose ( 10 g/liter ) , Bacto-agar ( 15 g/liter ) , and triphenyl tetrazolium chloride ( TTC ; 50 , jig/ml ) .
The same medium without TTC , lactose , or agar was used for growth of strains in primer-extension assays .
E-medium ( 43 ) was used as a minimal-medium and contained 0.2 % glucose ; thiamine ( 20 , ug/ml ) and to 18 amino-acids ( no methionine or cysteine ) at concentrations from 0.005 to 0.01 % were added for T7 agar ( 37 ) was used for complementaexperiments .
Motility tion assays of flagellar defects and contained tryptone ( 10 g/liter ) , NaCl ( 5 g/liter ) , and Bacto-agar ( 3 g/liter ) .
Antibiot-ics were added as appropriate to growth media to the following final concentrations : ampicillin , 100 , ug/ml ; tetracycline , 15 , ug/ml ; chloramphenicol , 12.5 , ug/ml ; and kana-mycin , 50 jig/ml .
X-gal ( 5-bromo-4-chloro-3-indolyl-13-D-ga-lactopyranoside ) was added when appropriate to a final concentration of 100 , g/ml .
Bacterial strains and plasmids .
The strains used in this study are listed in Table 1 .
S. typhimurium strains were derived from strain LT2 .
Plasmids constructed in the course of this work are derivatives of pBR322 , BlueScript ( Stratagene ) , or pTZ18R ( Pharmacia ) .
Plasmid pMH71 ( 17 ) was obtained from M. Carsiotis ( 4 ) .
It contains a 6.5-kb chromosomal insert from S. typhimurium and was the parent plasmid for subcloning the flgM gene ( Fig. 1 ) .
Plasmid pKG3 was derived from pMH71 by deleting a 1.4-kb ClaI-PvuII fragment .
In this and subsequent subcloning steps , DNA fragments were separated by agarose gel electrophoresis and gel purified by using GeneClean II ( Bio 101 ) .
The 3 ' recessed end of the ClaI site was filled in with T4 DNA polymerase ( Pharmacia ) at 15 °C ( 30 ) , and the free ends were ligated with T4 DNA ligase ( New England BioLabs ) .
Escherichia coli DH5a ( 13 ) was transformed and plated on nutrient agar containing ampicillin .
Other clones were obtained in a similar manner .
Plasmid pKG4 was derived from pKG3 by deleting the 2.4-kb BsmI fragment .
Subclone pKG5 was obtained by cutting a 2.2-kb HindIII fragment out of pKG3 and inserting it into pBR322 .
Plasmid pKG7 was obtained by deleting pKG5 from the SspI to the PvuII site .
Plasmid pKG8 was constructed by deleting pKG5 for the 0.5-kb BsmI fragment .
Subclone pKG11 ( not shown ) was obtained by insertion of the 0.6-kb SspI-BsmI fragment of pMH71 into the SmaI site of pBS .
Subclone pKG12 was derived from pKG11 by insertion of the 0.6-kb BamHI-KpnI fragment into pTZ18R .
Plasmid pKG13 ( not shown ) was derived from pKG12 by partial AseI digestion to obtain linearized fragments .
This was followed by filling in the 2-base 5 ' overhang with the Klenow fragment of DNA polymerase I ( New England BioLabs ) and subsequent religation and transformation .
This resulted in loss of the AseI restriction site and the inability of this clone to complement a chromosomal flgM mutation .
Nutrient broth 645 Complementation assays .
Plasmid pMH71 and its derivatives were checked for complementation of chromosomal flgM and flgA mutations .
In the presence of flagellar mutations , no expression of the fljB and fliC flagellin genes occurred ( 11 , 25 ) , as monitored by lac expression from MudJ ( 5 , 6 ) operon fusions to the flagellin genes .
In flgM mutant strains , the flagellin genes are expressed despite the presence of flagellar mutations ( 11 ) .
Complementation of flgM mutant strains was observed as restoration of repression of the flagellin genes ( Lac-phenotype [ red colonies on TTC-lactose medium ] ) .
Complementation of a chromosomalfigA mutation was checked by the strain 's ability to swarm on motility agar .
Genetic manipulations of S. typhimurium .
Transductions in S. typhimurium were carried out with generalized transducing phage P22 HTJOSIJ int-201 ( 31 ) .
Transductants were purified on green indicator plates ( 7 ) .
Plasmid DNA isolated from E. coli strains by a plasmid miniprep procedure ( 15 ) was introduced by electroporation into S. typhimurium with a Bio-Rad Gene Pulser equipped with a pulse controller per the manufacturer 's instructions .
y8 ) is a member of the Tn3 family of transposons , which replicate via a nonconservative or replicative mechanism of transposition ( 35 ) .
A stable intermediate of transposition , known as a cointegrate , i formed during the transposition process and consists of two copies of the transposon uniting the donor and recipient plasmids .
If F-mediated conjugation occurs before the cointegrate is resolved , both the F-factor and the recipient ( target ) plasmid are transferred to the recipient cells ( 12 ) .
Subsequent resolution results in a plasmid which contains a TnJOOO insertion .
TnJOOO insertions were obtained essentially as described by Strathmann et al. ( 39 ) .
Briefly , F-factor-containing E. coli DPWC carrying target plasmid pMH71 was used as the donor strain .
The donor was allowed to conjugate with the recipient E. coli strain JGM ( Kmr ) .
Portions ( 0.1 ml ) of overnight cultures were used to inoculate 2 ml of LB , and these cultures were incubated for 4 h at 37 °C on a roller drum ( about 30 rpm ) .
Cultures were diluted to 10-2 to 10-3 , and 0.1-ml portions were plated on nutrient agar plates containing kanamycin and ampicillin , which selects for recipient cells ( Kmi ) carrying the target plasmid ( Apr ) but against the donor cells ( Kms ) which contain that plasmid .
At least 50 colonies from each experiment were pooled , and the DNA was isolated by a plasmid miniprep procedure ( 15 ) .
Portions ( 1 , ul ) of DNA were electroporated into S. typhimurium MS1868 .
Transformants were recovered on nutrient agar plates containing ampicillin .
Colonies were pooled , and generalized transducing phage P22 was grown on the pooled cells .
The resulting phage lysate was used to transduce TH1983 to Apr on TTC-lactose indicator plates .
Plasmidcontaining colonies which complemented the chromosomal flgM mutation were Lac - , while those which did not complement it were Lac ' and harbored Tn1000 insertions in the plasmid-borne flgM gene .
DNA sequence analysis was performed by the dideoxy sequencing method of Sanger et al. ( 32 ) and commercial kits ( Sequenase ; USB ) according to the manufacturer 's instructions , with 35S-labeled ot-dATP or 32P-labeled ca-dATP ( New England Nuclear ) .
Double-stranded DNA was denatured with NaOH .
Primers GD1 and GD2 ( 39 ) to the ends of Tn1000 were used to sequence in both directions from the point of insertion .
Primers complementary to the multiple cloning site in BlueScript ( M13 -20 and KS ) were used to complete sequencing of both strands of the 0.6-kb SspI-BsmI clone ( pKG11 ) .
Overproduction of the FlgM protein .
BlueScript-or pTZ18R-derived plasmids containing the presumed flgM open reading frame adjacent to the T7 promoter were transformed into DH5a cells carrying plasmid pGP1-2 ( 41 ) .
pGPl-2 carries the gene for the T7 polymerase under the control of the temperature-sensitive XcI857 repressor .
Strains were grown in E-medium , and expression of the T7 polymerase gene was induced by growth at 42 °C with the subsequent addition of rifampin ( final concentration , 200 , ug/ml ) to prevent function of the cellular RNA polymerase , essentially as described before ( 41 ) .
After 1 h at 30 °C , [ 35S ] methionine/cysteine ( New England Nuclear ) was used to label proteins made from T7 RNA polymerase-induced transcripts for 5 min .
Extracts of these cultures were electrophoresed in a Hoeffer Mighty-Small gel apparatus with the tricine-sodium dodecyl sulfate ( SDS ) - polyacrylamide gel system described by Schagger and Von Jagow ( 34 ) with 16.5 % acrylamide .
To prevent cracking of this type of gel , the following drying conditions were used : the gel was placed on wet 3MM filter paper , covered with plastic wrap , and placed under vacuum for 10 min before the slow cycle ( Bio-Rad model 583 Gel Drier ) was used to a maximum temperature of 50 °C for 75 min .
RNA was isolated as described before TABLE 1 .
Strains used reference Relevant genotype Strain E. coli DPWC 39 supE42 recA A ( SstII-EcoRI ) Asrl : : TnJO ( Tcs ) F ' F-araD139 A ( ara-leu ) 7696 A ( lac ) X74 galU galK hsdR2 ( rK-mK ' ) mcrBI rpsL ( Str ) Tn5 seq-I ( Kanr ) endAI hsdRJ7 ( rK mK ' ) supE44 thi-1 recAI gyrA ( Nalr ) relAl A ( lacZYA-argF ) U169 [ 480d lac A1 ( lacZ ) M15 ] leuA414 ( Am ) suo hsSB ( r-m + ) FelsfliC5001 : : MudJ flgM5001 : : TnlOdCm AflgG-L ( fla-2157 ) fljB5001 : : MudJ flgM5001 : : TnlOdCm AflgG-L ( fla-2157 ) fljB5001 : : MudJ fliA2087 flgM5001 : : TnlOdCm fliCSOOI : : MudJ flgA2085 fljB50OO : : MudJ 39 JGM DH5a 13 S. typhimurium MS1868 M. Susskind 11 This study TH1077 TH1983 TH1984 This study TH1985 TH1986 This study This study FIG. 1 .
Complementation offlgM by pMH71 and its derivatives .
The open box indicates pBR322 sequence ; the shaded box indicates pTZ18R sequence .
The approximate location of the P-lactamase gene of pBR322 is indicated by Apr. .
Complementation of an flgM chromosomal mutation is indicated by + ( flgM + ) or - ( flgM ) and was monitored by expression offljB .
CHARACTERIZATION OF S. TYPHIMURIUM flgM VOL .
RNase inhibitor ( Boehringer Mannheim ) and DNase ( Bethesda Research Laboratories ) were added to the RNA in RNase-free water ( sterile water for irrigation ; Baxter Healthcare Corp. ) .
32p labeling of primers GD1 and GD2 was done with T4 polynucleotide kinase and [ .
y-32P ] ATP ( New En-gland Nuclear ) ( 1 ) .
Primer extension reactions were carried out ( 1 ) with Moloney murine leukemia virus reverse transcriptase ( Bethesda Research Laboratories ) and buffer supplied by the manufacturer at 42 °C for 30 min .
The work in this article characterizes the gene flgM , which was originally named flgR ( 11 ) .
This new nomenclature conforms to guidelines established for the flagellar genes of S. typhimurium and E. coli ( 18 ) .
Nucleotide sequence accession number .
The nucleotide sequence data shown in this article have been assigned GenBank accession number M74222 .
RESULTS Isolation of theflgM gene by complementation .
Repression of flagellin expression in flagellar-mutant backgrounds is alleviated when the flgM locus is insertionally inactivated or deleted ( 11 ) .
These mutations mapped the flgM locus to the flg region of the chromosome .
To clone the flgM locus , plasmid pMH71 ( 17 ) was obtained from M. Carsiotis .
This plasmid contains a 6.5-kb chromosomal insert which extends fromflgD throughflgA and about 4 kb beyondflgA ( Fig. 1 ) .
The ability to complement a chromosomal flgM defect in S. typhimurium TH1983 was used to identify clones carrying the flgM locus .
This strain is deleted for flagellar genes flgG,-H , - I,-J , - K , and-L and has a lacZ reporter gene transcriptionally fused to the fljB flagellin gene .
The presence of a transposon insertion in the flgM gene allows expression of the flagellin genes ( and hence lacZ ) despite the presence of flagellar defects .
Introduction of pMH71 into TH1983 resulted in colonies which were Lac - , indicating complementation of the chromosomal flgM mutation ( Fig. 1 ) .
Several derivatives of pMH71 were constructed in order to define the borders of theflgM locus .
The results shown in Fig. 1 demonstrate that in all cases , strains carrying plasmids which contain a 600-bp region of DNA between the SspI and BsmI sites restore an FlgM + phenotype .
Plasmids containing the 0.6-kb SspI-BsmI region in a strain which has no flagellar defects also cause reduced expression of an fliC : : MudJ lac transcriptional-fusion on lactose indicator plates ( data not shown ) .
Also , clones which are missing the fragment between the SspI and PvuII restriction sites no longer complement a chromosomalflgA mutation ( data not shown ) , demonstrating that the flgA gene lies adjacent to the flgM gene .
Obtaining TnlOOO insertions in theflgM gene .
As described in Materials and Methods , TnJ000 insertion mutations were generated in plasmid pMH71 .
These plasmids were transferred to the S. typhimurium test strain TH1983 ( flgM Aflg fljB-lac ) and screened for the loss of flgM-complementing activity .
Cells receiving a plasmid in which a Tn1000 insertion disrupted the flgM gene did not show complementation of the chromosomal flgM defect and remained Lac ' .
Nine independent insertions which gave an FlgM-phenotype were obtained and are shown in Fig. 2A .
Sequence data ( see below ) showed that all of the insertions mapped within the same 0.6-kb SspI-BsmI fragment shown by complementation to contain the flgM locus .
Once theflgM region had been defined , the DNA sequence was obtained by using primers complementary to the ends of Tn1000 .
This method gener ated about 900 bases of sequence , 600 bases of which included the region between the SspI and BsmI restriction sites .
This region is shown in Fig. 2B .
This sequence contains two consecutive open reading frames in an apparent operon , one which would encode a 97-amino-acid protein , and a second one which continues beyond the BsmI restriction site by at least 24 codons .
The second open reading frame is unlikely to be the flgM gene because of the complementation results obtained above .
There were no long open reading frames in the opposite direction .
The 97-amino-acid open reading frame is preceded by a putative ribosome-binding site ( 36 ) located 7 bases upstream of an ATG start codon ; a protein beginning at that methionine would have a predicted molecular mass of 10,556 Da .
Upstream of this region lies a sequence , 5 ' - TAAA-N15-GCCGATGA-3 ' , which is a close match to the published consensus for FliA-dependent promoter sequences ( 5 ' - TAAA-N15-GCCGATAA-3 ' [ 14 , 25 , 29 ] ) and may be the promoter for the putative flgM gene .
Mapping the start of transcription of the flgM gene .
If the presumed FliA-dependent promoter sequence described above were responsible for promoting transcription of the putative flgM gene , then transcripts beginning from that region would extend into a TnlOOO insert located downstream .
Primer extension with a primer complementary to the promoter-proximal end of the Tn1000 element can therefore be used to map the transcriptional start site by reverse transcriptase-mediated extension of a complementary DNA product back to the start of the mRNA .
RNA samples isolated from the following strains of S. typhimurium were used to determine the start of transcription : TH1983 , the test strain forflgM complementation ( flgM Aflg fljB-lac ) ; TH1984 , a fliA derivative of TH1983 ; and TH1985 , which is flgM fljB-lac ( Fla + ) .
These test strains carried either the control plasmid pMH71 ( flgM + ) or a Tnl000-containing derivative of pMH71 .
The particular TnJ000 insertion used was located 127 bases downstream of the putative promoter for the flgM gene , within the coding region of the gene .
The results of primer-extension analysis are shown in Fig. 3 and demonstrate a single transcriptional start site in the three strains which carry the TnJ000 insert plasmid .
No 127 40D A PesO pMH71 M flgDCB A B AATATTCTTATTAACCTATAATTGTGTAAAGAT -35 TTTGTCGCGGCTGCCGLTGILGATATTC1kCCATGATGGTAGCTGGCCGCTACAACGTAACCCTCGATGAGGATAAATAA -10 +1 ATG AGC ATT GAC CGT ACC TCA CCT TTG AAA CCC GTT AGC ACT GTC CAG ACG CGC GAA ACC met ser ile asp arg thr ser pro leu lys pro val ser thr val gln thr arg glu thr 34 113 1 173 AGC GAC ACG CCG GTA CAA AAA ACG CGT CAG GAA AAA ACG TCC GCC GCG ACG AGC GCC AGC 21 ser asp thr pro val gln lys thr arg gln glu lys thr ser ala ala thr ser ala ser 233 GTA ACG TTA AGC GAC GCG CAA GCG AAG CTC ATG CAG CCA GGC GTC AGC GAC ATT AAT ATG 41 val thr leu ser asp ala gln ala lys leu met gln pro gly val ser asp ile asn met 293 GAA CGC GTC GAA GCA TTA AAA ACG GCT ATC CGT AAC GGT GAG TTA AAA ATG GAT ACG GGA 61 glu arg val glu ala leu lys thr ala ile arg asn gly glu leu lys met asp thr gly 353 AAA ATA GCA GAC TCG CTC ATT CGC GAG GCG CAG AGC TAC TTA CAG AGT AAA TAA GCGTATG 81 lys ile ala asp ser leu ile arg glu ala gln ser tyr leu gln ser lys STOP 413 ACTCGTTTGTCAGAAATACTTGACCAGATGACCACCGTCCTGAATGACCTGAAGACGGTGATGGACGCCGAGCAACAA 491 CAGCTTTCCGTAGGCCAGATTAACGGCAGCCAGCTACAGCGTATTACAGAAGAAAAAAGCTCGTTGCTGGCGACGCTG 569 GATTATCTGGAACAACAGCGCCGTCTGGAGCAGAATGC FIG. 2 .
Location and sequence of theflgM gene .
( A ) Locations of Tn1000 inserts which resulted in an FlgM-phenotype .
These insertions were used to generate the nucleotide sequence shown in panel B .
The sequence shown is for the region between the SspI and BsmI restriction sites .
The -35 and -10 promoter regions are shown in boldface letters , the start of transcription is boxed , and the putative ribosome-binding site is underlined in boldface .
The location of the AseI restriction site is underlined .
Transcriptional mapping of theflgM promoter by primer-extension .
Lanes A , C , G , T , sequencing ladder .
Primer extensions are shown in lanes 1 to 6 .
Lanes 1 and 2 , TH1983 with pMH71/TnlO00 and with pMH71 , respectively ; lanes 3 and 4 , TH1984 ( TH1983 fliA ) with pMH71iTnlO00 and with pMH71 , respectively ; lanes 5 and 6 , TH1985 with pMH71ITnI000 and with pMH71 , respectively .
The arrow indicates the primer-extension products .
The base shown in boldface is the transcriptional start site -20.4 FIgM-Fl ~ ~ ~ -144.0 o -- ) P. 6.1 TFIG .
T7 RNA polymerase-mediated expression of the FlgM protein .
Proteins produced from pKG12 are shown in lane 1 , while those made from pKG13 are shown in lane 2 .
Controls pKG11 ( which contains the flgM gene in Bluescript in the opposite orientation from the T7 promoter ) , pTZ18R , and BlueScript are shown in lanes 3 , 4 , and 5 , respectively .
The FlgM and 3-lactamase ( Bla ) proteins are indicated .
T , truncated FlgM product .
Arrow , second protein made from constructs .
Positions of molecular mass markers are shown ( in kilodaltons ) .
primer-extension product was observed in any of the control strains which carry the wild-type plasmid .
The observed start site maps to an adenine nucleotide positioned 11 bases downstream of the center of the putative aFliA promoter -10 region ( boxed nucleotide in Fig. 2 ) .
This result supports the hypothesis that this is the promoter used for transcription of the flgM gene .
T7 RNA polymerase-mediated expression of the FIgM protein .
To verify that the 97-amino-acid open reading frame is expressed and is responsible for the complementation of a chromosomalflgM defect , in-vivo production of this protein was assayed .
Plasmid pKG12 contains the putative flgM + open reading frame in pTZ18R in the correct orientation for transcription from the inducible T7 promoter .
This plasmid and control plasmids were transformed into E. coli DH5a carrying pGP1-2 , which encodes the inducible T7 RNA polymerase .
Transcription from the T7 promoter was promoted by induction of T7 RNA polymerase synthesis .
Protein products were labeled in-vivo and subjected to SDS-polyacrylamide gel electrophoresis ( PAGE ) analysis .
35S-labeled protein products obtained from pKG12 are shown in lane 1 of Fig. 4 .
Two small proteins with apparent molecular masses of about 9.5 and 8.0 kDa appear in this lane .
We believe that the 9.5-kDa protein corresponds to the flgM gene product .
This conclusion is based on the results shown in lane 2 , which displays protein products obtained from pKG13 .
In plasmid pKG13 , an AseI site internal to the filled in , resulting in a 2-bp flgM gene was digested and frameshift .
The frameshift causes the addition of eight incorrect amino-acids after codon 58 of the open reading frame , followed by termination after 66 amino-acids ( 31 amino-acids early ) .
This construct no longer complemented a chromosomal flgM mutation .
This appears in lane 2 as a loss of the 9.5-kDa gene product and the appearance of a smaller protein product with an apparent molecular mass of 6.8 kDa , corresponding to the predicted molecular mass of the frame-shift product .
The 8.0-kDa protein product remains the same .
This protein may correspond to the open reading frame downstream from the flgM gene .
Proteins made from pKG11 ( lane 3 ) , which contains the SspI-BsmI fragment in the opposite orientation with respect to the T7 promoter in BlueScript , also appear in the BlueScript vector control lane ( lane 5 ) .
In pTZ18R , the bla gene is also in the correct orientation for transcription from the T7 promoter .
A band corresponding to about 30 kDa in lanes 1 and 2 is probably the P-lactamase protein , since it also appears in lane 4 , the pTZ18R vector control .
DISCUSSION When basal body , hook , or switch proteins are defective , no transcription occurs from the flagellin genes , an effect mediated by the flgM locus .
When the flgM locus is insertionally inactivated , the negative feedback regulation is uncoupled , and expression of the flagellin genes resumes in flagellar mutant strains ( 11 ) .
In this study we have determined the primary structure of the flgM gene .
Plasmids carrying the intact flgM gene were able to complement a chromosomal flgM mutation and restore a repressed condition of the flagellin structural genes in the presence of chromosomal flagellar defects , suggesting that flgM encodes a diffusible protein product .
We obtained nine independent Tn1000 insertions , in a 10-kb plasmid containing the flgM gene , which resulted in an FlgM-phenotype .
All of these insertions were located within a 320-bp region .
We have sequenced this region and have found an open reading frame which encodes a 97-amino-acid protein with a predicted molecular mass of 10.6 kDa .
In the T7-based expression system , the protein responsible for complementation of an flgM chromosomal defect was expressed and observed by SDS-PAGE analysis to have an apparent mo-lecular mass of 9.5 kDa .
Upon introduction of a frameshift mutation into the plasmid-borne clone of theflgM gene at an AseI site internal to the 97-amino-acid open reading frame , the plasmid no longer complemented an flgM chromosomal mutant and the 9.5-kDa protein band was lost .
The start of a second open reading frame lies just 5 bp downstream of the flgM stop codon .
A total of 90 codons of this open reading frame were determined in our DNA sequence analysis .
This open reading frame may be part of an operon that includes the flgM gene .
Further characterization of this open reading frame is needed to determine whether this putative gene has a role in the assembly or regulation of functional flagella .
The FlgM protein sequence was compared with known sequences in the GenBank 66 and EMBL 25 sequence data banks by using the FastDB sequence comparison software ( Intelligenetics , Inc. ) ( 3 ) .
The only significant homology obtained was to an open reading frame downstream of the gene for Yersinia enterocolitica invasin , the invA gene ( 47 ) , for which only a portion of the DNA sequence has been determined .
The F1gM protein has 57 % identity with 47 amino-acids from that open reading frame ( data not shown ) .
Upstream of the frame for the lies open reading flgM gene a sequence which matches the closely promoter sequence for the gene encoding the flagellin-specific alternate sigma factor FliA .
When the FliA sigma factor was removed by mutation , a low-level transcription offlgM was observed .
It is not clear why there was residual expression offlgM in the fliA mutant background .
One possibility is that the promoter forflgM is not completely dependent on a FliA-containing RNA polymerase for transcription .
Another explanation is that low-level expression is peculiar to the particular fliA point mutation that we used in our assays .
The mechanism of action of theflgM gene product remains to be determined .
The action of the FlgM protein theoretically requires two functions : repression of flagellin genes and recognition that a component of the flagellum is missing or defective .
Recently , fliA mutants insensitive toflgM regulation have been isolated ( 33 ) , and these results indicate that the FlgM protein acts to prevent FliA function or fliA expression .
This would suggest a regulatory circuit in which flgM , transcribed by a FliA-containing RNA polymerase negatively regulates FliA function in flagellar-mutant backgrounds .
Possible hypotheses for the mechanism of recognition of flagellar defects by the FlgM protein include sequestering of the protein product until it is needed ; modification , such as phosphorylation , of a constitutive protein product ; and regulated transcription of theflgM Our results gene .
indicate that the flgM gene is transcribed in both the presence and absence of flagellar defects .
However , since there was no wild-type FlgM present in the strains assayed , it may be that FlgM negatively regulates its own transcription in wild-type but not mutant backgrounds .
Also , high-copy-number plasmids containing theflgM ' gene in a wild-type strain carrying a lac fusion to thefliC gene cause a decrease in expression of the flagellin gene despite the absence of any flagellar defects .
This result suggests that overexpression of the flgM gene causes a superrepressor phenotype and that FlgM is limiting in wild-type cells .
In addition , some flagellar mutants become weakly motile when the flgM gene is inactivated ( 10 ) , suggesting that in some cases the cells are nonmotile due as much to the action of the FlgM gene product as to the particular mutation .
None of these results can solidly eliminate any of the hypotheses proposed .
Additional characterization of the flgM locus must be done in order fully to understand the function and mechanism of action of FlgM .
CHARACTERIZATION OF S. TYPHIMURIUM flgM VOL .
173 , 1991 6457 1 2 3 4 5 -290 Bla ¬ gM We thank Michael Strathmann for strains and-primers , Michael Carsiotis for pMH71 , Jon Visick for computer searches and helpful discussions , and Colin Manoil for critically reviewing the manu-script .
This work was supported by Public Health Service grant GM43149 from the National Institutes of Health .
K.T.H. is a recipient of a Junior Faculty Research Award from the American Cancer Society .
Ausubel , F. M. , R. Brent , R. Kingston , D. D. Moore , J. G. Seidman , J. A. Smith , and K. Struhl ( ed .
Current protocols in molecular biology .
John Wiley & Sons , Inc. , New York .
Blair , D. F. , and H. C. Berg .
The MotA protein of E. coli is a proton-conducting component of the flagellar motor .
Brutlag , D. L. , J.-P .
Dautricourt , S. Maulik , and J. Relph .
Improved sensitivity of biological sequence database searches .
Carsiotis , M. , B. A. D. Stocker , D. L. Weinstein , and A. D. O'Brien .
A Salmonella typhimurium virulence gene linked toflg .
Casadaban , M. J. , and S. N. Cohen .
Lactose genes fused to exogenous promoters in one step using Mu-lac bacteriophage : in-vivo probe for transcriptional control sequences .
Castilho , B. A. , P. Olfson , and M. J. Casadaban .
Plasmid insertion mutagenesis and lac gene fusion with mini-Mu bacteriophage transposons .
Chan , R. K. , D. Botstein , T. Watanabe , and Y. Ogata .
Specialized transduction of tetracycline resistance by phage P22 in Salmonella typhimurium .
Properties of a high frequency transducing lysate .
Chun , S. Y. , and J. S. Parkinson .
Bacterial motility : membrane topology of the Escherichia coli MotB protein .
Davis , R. W. , D. Botstein , and J. R. Roth .
Cold Spring Harbor Laboratory , Cold Spring Harbor , N.Y. 10 .
GiUen , K. L. , and K. T. Hughes .
Gillen , K. L. , and K. T. Hughes .
Negative regulatory loci coupling flagellin synthesis to flagellar assembly in Salmonella typhimurium .
Uses of the transposon yb in the analysis of cloned genes .
Studies on transformation of Escherichia coli with plasmids .
Helmann , J. D. , and M. J. Chamberlin .
DNA sequence analysis suggests that expression of flagellar and chemotaxis genes in Escherichia coli and Salmonella typhimurium is controlled by an alternative cu factor .
Holmes , D. S. , and M. Quigley .
A rapid boiling method for the preparation of bacterial plasmids .
Homma , M. , K. Kutsukake , T. Iino , and S. Yamaguchi .
Hook-associated proteins essential for flagellar filament formation in Salmonella typhimurium .
Homma , M. , K. Ohnishi , T. Iino , and R. M. Macnab .
Identification of flagellar hook and basal body gene protein products ( FlaFV , FlaFVI , FlaFVII , and FlaFVIII ) in Salmo-nella typhimurium .
lino , T. , Y. Komeda , K. Kutsukake , R. M. Macnab , P. Matsu-mura , J. S. Parkinson , M. I. Simon , and S. Yamaguchi .
New unified nomenclature for the flagellar genes of Escherichia coli and Salmonella typhimurium .
Khan , S. , M. Dapice , and T. S. Reese .
Effects of mot gene expression on the structure of the flagellar motor .
Kihara , M. , M. Homma , K. Kutsukake , and R. M. Macnab .
Flagellar switch of Salmonella typhimurium : gene sequences and deduced protein sequences .
Transcriptional control of flagellar genes in Escherichia coli K-12 .
Komeda , Y. , and T. Iino .
Regulation of expression of the flagellin gene ( hag ) in Eseherichia coli K-12 : analysis of hag-lac gene fusions .
Komeda , Y. , H. Suzuki , J. Ishidsu , and T. lino .
The role of cAMP in flagellation of Salmonella typhimurium .
Kutsukake , K. , T. lino , Y. Komeda , and S. Yamaguchi .
Functional homology offla genes between Salmonella typhimu-rium and Escherichia coli .
Kutsukake , K. , Y. Ohya , and T. Iino .
Transcriptional analysis of the flagellar regulon of Salmonella typhimurium .
Detection of fermentation variants with tetrazolium .
In F. C. Neidhardt , J. L. Ingraham , K. B. Low , B. Magasanik , M. Schaechter , and H. E. Umbarger ( ed .
) , Escherichia coli and Salmonella typhi-murium : cellular and molecular biology .
American Society for Microbiology , Washington , D.C. 28 .
Motility and chemotaxis , p. 733-759 .
In F. C. Neidhardt , J. L. Ingraham , K. B. Low , B. Magasanik , M. Schaechter , and H. E. Umbarger ( ed .
) , Escherichia coli and Salmonella typhimurium : cellular and molecular biology .
American Society for Microbiology , Washington , D.C. 29 .
Ohnishi , K. , K. Kutsukake , H. Suzuki , and T. lino .
Gene fliA encodes an alternate sigmna factor specific for flagellar operons in Salmonella typhimurium .
Sambrook , J. , E. F. Fritsch , and T. Maniatis .
Molecular cloning : a laboratory manual , 2nd ed .
Cold Spring Harbor Laboratory , Cold Spring Harbor , N.Y. 31 .
Sanderson , K. E. , and J. R. Roth .
Linkage map of Salmonella typhimurium , edition VI .
Sanger , F. , S. Nicklen , and A. R. Coulson .
DNA sequencing with chain terminating inhibitors .
Satia , J. , K. L. Gillen , and K. T. Hughes .
Schagger , H. , and G. Von Jagow .
Tricine-sodium dodecy sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa .
Tn3 and related transposable elements : site-specific recombination and transposition , p. 163-184 .
In D. E. Berg and M. M. Howe ( ed .
American Society for Microbiology , Washington , D.C. 36 .
Shine , J. , and L. Dalgarno .
The 3 ' - terminal sequence of Escherichia coli 16S ribosomal RNA : complementarity to nonsense triplets and ribosome binding sites .
Silverman , M. , and M. Simon .
Genetic analysis of flagellar mutants in Escherichia coli .
Silverman , M. , and M. Simon .
Characterization of Esch-erichia coli flagellar mutants that are insensitive to catabolite-repression .
Strathmann , M. , B. A. Hamilton , C. A. Mayeda , M. I. Simon , E. M. Meyerowitz , and M. J. Palazzolo .
Suzuki , H. , and T. lino .
Absence of messenger ribonucleic acid specific for flagellin in non-flagellate mutants of Salmo-nella .
Tabor , S. , and C. C. Richardson .
A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes .
Totten , P. A. , and S. Lory .
Characterization of the type a flagellin gene from Pseudomonas aeruginosa PAK .
Vogel , H. J. , and D. M. Bonner .
Acetylornithase of Escherichia coli : partial purification and some properties .
Winkelman , J. W. , and D. P. Clark .
Proton suicide : general method for direct selection of sugar transport-and fermentation-defective mutants .
Aizawa , M. Kihara , M. Isomura , C. J. Jones , and R. M. Macnab .
Genetic evidence for a switching and energy-transducing complex in the flagellar motor of Salmonella typhimurium .
Yamaguchi , S. , H. Fujita , A. Ishihara , S.-I .
Aizawa , and R. M. Macnab .
Subdivision of flagellar genes of Salmonella typhimurium into regions responsible for assembly , rotation , and switching .
Young , V. B. , V. L. Miller , S. Falkow , and G. K. Schoolnik .
Sequence , localization and function of the invasin protein of Yersinia enterocolitica .