JouRNAL OF BACrERIOLOGY , May 1992 , p. 2754-2762-0021-9193 / 9V/092754 -09 $ 02.00 / 0 Copyright C 1992 , American Society for Microbiology Vol .
174 , No. 9 Structure and Function of the uhp Genes for the Sugar Phosphate Transport System in Escherichia coli and Salmonella typhimurium MICHAEL D. ISLAND , BEI-YANG WEI , AND ROBERT J. KADNER * Department of Microbiology , School of Medicine , and Molecular Biology Institute , University of Vrginia , Charlottesville , Virginia 22908 Received 17 October 1991/Accepted 18 February 1992 Expression of the Escherichia coli sugar phosphate transport system , encoded by the uhpT gene , is regulated by external glucose 6-phosphate through the action of three linked regulatory genes , uhpABC .
The nucleotide sequence of the uhp region cloned from Sabnonella typhimurium was determined .
The deduced Uhp polypeptide sequences from the two organisms are highly related .
Comparison with the corrected sequence from E. coli revealed that the four uhp genes are closely spaced , with minimal intergenic distances , and that uhpC is nearly identical in length to uhpT , both of which have substantial sequence relatedness along their entire lengths .
To facilitate analysis of uhp gene function , we isolated insertions of a kanamycin resistance ( Km ) cassette throughout the uhp region .
In-frame deletions that removed almost the entire coding region of individual or multiple uhp genes were generated by use of restriction sites at the ends of the Km cassette .
The phenotypes of the Km insertions and the in-frame deletions confirmed that all three regulatory genes are required for Uhp function .
Whereas the deletion of uhpA completely abolished the expression of a uhpT-lacZ reporter gene , the deletion ofuhpB or uhpC resulted in a partially elevated basal level of expression that was not further inducible .
These results indicated that UhpB and perhaps UhpC play both positive and negative roles in the control of uhpT transcription. , Translational fusions of the uhpBCT genes to topological reporter gene phoA were generated by making use of restriction sites provided by the Km cassette or with transposon TnphoA .
The alkaline phosphatase activities of the resultant hybrid proteins were consistent with models predicting that UhpC and UhpT have identical transmembrane topologies , with 10 to 12 transmembrane segments , and that UhpB has 4 to 8 amino-terminal transmembrane segments that anchor the polar carboxyl-terminal half of the protein to the cytoplasmic side of the inner membrane .
Cells of Escherichia coli possess an inducible active transport system which is required for growth-on-glucose 6-phosphate ( Glu6P ) , fructose 6-phosphate ( Fru6P ) , and several other phosphorylated-sugars and related compounds ( 4 , 7 , 21 ) .
This transport system , encoded by the uhpT gene , consists of a single polypeptide-chain of 463 amino-acids .
It carries out an electroneutral exchange process that couples the accumulation of sugar phosphates to the downhill release of Pi ( 1 , 26 ) .
The glycerol 3-phosphate transporter , GlpT , is similar to UhpT in both amino-acid sequence and overall transport mechanism ( 1 , 8 ) .
The production of UhpT is induced specifically by extracellular Glu6P but not by intracellular Glu6P formed during the metabolism of glucose or other carbon sources ( 5 , 33 ) .
The induction of uhpT transcription is regulated by the uhpABC genes , located immediately upstream of uhpT at 82.1 min on the E. coli genetic map .
Previous studies have shown that all three uhp regulatory genes are required for uhpT expression and support a model for uhp regulation in which the membrane-localized UhpB and UhpC proteins the of external Glu6P and convert the respond to presence protein form able activate uhpT transcription UhpA to a to ( 30 , 31 ) .
Analysis of the deduced amino-acid sequences of UhpA and UhpB showed that they regions with homology possess respectively , of to the receiver and transmitter modules , 31 ) .
Members of two-component regulatory systems ( 14 , these families of regulatory proteins are widespread in bacteria and mediate variety of environmental responses to a signals by means of protein phosphorylation and phosphate transfer to the receiver protein , which functions in many cases as a transcriptional activator ( 28 ) .
A previous study concluded that UhpC was about 20 kDa in size and homologous to the middle third of UhpT ( 30 ) .
The homology between UhpC and UhpT suggested that UhpC could act as a receptor for Glu6P in the signaling process .
Consistent with this hypothesis , the Uhp-phenotype conferred by transposon mutations in uhpC could be overcome by additional mutations linked to the uhp region ( 13 , 30 ) .
The expression of uhpT in these UhpC-independent variants was trans-dominant and constitutive .
Subsequently , several errors were found in the published sequence of uhp ; the corrected sequence is reported here and was corroborated by the cloning and sequencing of the uhp region from Salmonella typhimunium .
The uhp regions from E. coli and S. typhimuinum are highly related , and the are with minimal four uhp genes closely spaced , intergenic in to and intervals .
UhpC is almost identical length UhpT , these proteins share considerable sequence relatedness and have similar hydropathic distributions , suggesting very similar topological dispositions in the cytoplasmic membrane .
To define more the role of the uhp regulatory precisely we isolated insertions of a genes , kanamycin resistance ( Km ) cassette in numerous sites within the locus .
The loca-uhp tions and phenotypes of these insertion mutations support the new frame assignments for uhpC and are open reading consistent with those of the other three genes .
In addition , in-frame deletions were generated by use of the unique restriction sites introduced by the Km insertions and allowed the determination of the null phenotypes resulting from the loss of a regulatory gene independently or in combination .
275 This work This approach was not complicated by the polar effects that transposon insertions often have on genes distal to their site of insertion .
We show that whereas uhpA was absolutely required for the transcription of a uhpT-lacZ reporter gene when all genes were present in single copies , the absence of uhpB or uhpC resulted in an elevated basal level of expression .
Induction by Glu6P , however , was blocked by the loss of any of these regulatory genes .
These results indicate that UhpB and possibly UhpC play both positive and negative roles in the control of uhpT transcription .
The new restriction sites associated with the Km insertions also allowed the construction of fusions of the uhp genes to the topological reporter , PhoA , encoding the mature portion of periplasmic alkaline phosphatase ( 16 ) .
Analysis of the enzymatic activity expressed by fusions of different lengths provided extended support for the previous topological map of UhpT ( 15 ) and showed that the topology of UhpC is likely to be identical to that of UhpT .
Finally , the properties of the UhpB-PhoA fusions were consistent with the presence of multiple transmembrane segments in the nonpolar amino-terminal half of UhpB and with the location of the carboxyl-terminal half in the cytoplasm .
MATERIALS AND METHODS Plasmids , phages , and bacterial strains .
The strains used in this work are described in Table 1 .
Plasmid constructions and were with E. coli manipulations XL-1 Blue performed La Calif. ) .
( Stratagene , Jolla , Plasmid pMI29 was constructed by cloning the 6.0-kb EcoRI-BamHI from fragment the entire pRK10 ( 30 ) , into containing uhp region , Bluescript plasmid pKS + ( Stratagene ) from which several restriction sites in the polylinker region had been removed .
Plasmid contains the E. pRS415 : PTRsaI coli uhpT promoter region ( nucleotides 3472 to 3848 ) fused to lacZ in pRS415 ( 17 , 25 ) .
The uhpT-lacZ operon fusion from this plasmid was transferred to phage XRZ5 ( 22 ) , a gift from R. Zagursky , by recombination to form XRZ5-Prlac ( 17 ) .
An analogous construct , XRZ5-Prlac [ Km ] , conferring kanamycin resistance , was prepared by cloning a Km cassette into the unique PstI site of the 1-lactamase gene in pRS415 : PTRsaI and then transferring the fusion to XRZ5 as described above .
Lysogens containing XRZ5-PTlac [ Km ] in strain RK6894 or XRZ5-PTIac in strain MC4100 were selected by making use of the antibiotic resistance of the phage ( 24 ) .
To obtain Uhp + revertants , we plated 3 x 108 to 5 x 108 cells from overnight cultures of three independent isolates of strains carrying each chromosomal uhp : : Km insertion or a deletion of uhpBC on minimal plates with Fru6P as the carbon source .
The rich-medium was L broth ; the minimal-medium was medium A with required supplements ( 19 ) .
Routine recombinant DNA procedures were performed by use of standard methods or conditions specified by the product 's manufacturer .
Rapid plasmi preparations were made by a modification of the alkaline lysis method ( 2 ) , in which an ammonium acetate precipitation step replaced the phenol-chloroform extraction .
Dou-ble-stranded DNA sequencing was performed on rapid plasmid preparations with the Pharmacia T7 sequencing kit .
Oligonucleotide sequencing primers were purchased from Synthecell Corp. ( Rockville , Md. ) .
Generation of Km cassette insertions .
Partial digestions with restriction enzymes were performed in the presence of ethidium bromide ( 60 , ug/ml ) to favor the recovery of DNA molecules cut at a single site .
The full-length linear fragments were isolated by agarose gel electrophoresis and ligated with the 1.4-kb Km determinant .
This Km cassette was obtained by digestion of pUC-4K ( Pharmacia , Piscataway , N.J. ) with HinclI for ligation into pMI29 fragments with blunt ends , with BamHI for the Sau3A-treated plasmid , or with AccI for the HpaII-digested plasmid .
The ligation mixtures were introduced by transformation into strain XL-1 Blue , and transformants resistant to ampicillin and kanamy-cin were selected .
The oligonucleotides used as sequencing primers ( 5 ' - CAGAGATJTGAGACACAAC and 5 ' - CGCT GACTTGACGGGACGGC ) hybridize to opposite strands of the Km cassette , just inside the 200-bp inverted repeat segments at the ends of the cassette .
Transfer of mutations to the chromosome .
Plasmids containing uhp : : Km insertions were digested with BamHI , and the full-length , linear DNA molecules were introduced into strain JC7623 by transformation as described by Winans et al. ( 32 ) .
The cassette was transferred at a low frequency to the chromosome by homologous recombination events in the flanking uhp regions .
Plasmid pMI29 and derivatives carrying uhp deletions were transferred to strain RK9338 ( pol4 uhpT-lacZ ) by transformation and selection for the antibiotic resistance of the plasmid .
In this strain , the plasmid can not replicate autonomously ( 11 ) , and ampicillin-resistant transformants in which the plasmid was integrated into the chromosome at a low frequency were isolated .
Assays of Uhp function and regulation .
Uhp function was screened by growth on 0.2 % Fru6P as carbon source , relative to growth-on-glucose at the same concentration .
P-Galactosidase activities were determined on cultures grown to an optical density at 590 nm ( OD50 ) of ca. 0.1 with or without 0.34 mM Glu6P as inducer and treated with 0.01 % sodium dodecyl sulfate ( SDS ) - chloroform ( 1:1 ) in polypro-pylene microtiter plates .
The rate of hydrolysis of 3 mM o-nitrophenyl-3-D-galactopyranoside was determined from the change in the A415 and normalized for culture density ( at 590 nm ) .
Assays were performed with polystyrene microtiter plates and read with a spectrophotometric plate reader as described below .
Each reported activity , mOD415-0 X minute - ' x OD59 culture - ' , is the average of at least three determinations on three independent isolates of each strain .
Cloning of S. typhimuium DNA .
S. typhimurium genomic DNA was extracted from strain ST422 as previously described ( 24 ) , partially digested with EcoRI , ligated into the EcoRI site of Xgtll , and packaged in-vitro with Gigapack II Plus extracts ( Stratagene ) in accordance with the manufacturer 's instructions .
The library was amplified by passage through E. coli Y1090r-and used to infect E. coli RK9332 ( AuhpA ) and RK9337 ( AuhpT ) .
X transducing phages were recovered from Uhp ' transductants by induction of liquid cultures at 42 °C for 15 min and incubation at 37 °C for 2 h. Nucleotide sequence determination .
Nucleotide sequencing was performed by the method of Sorge and Blinderman ( 27 ) with the ExoMeth sequencing kit from Stratagene .
Cesium chloride-purified plasmid DNA was digested with pairs of restriction enzymes to generate 3 ' and 5 ' overhangs at one end of the region to be sequenced .
For pKB24 , KpnI and SailI were used to determine the sequence in one direction and PstI and EcoRI were used for the opposite direction .
For pKB23 , KInI-XhoI and SstI-BamHI were used .
The resulting linear DNA fragments were treated with exonuclease III for various times , and portions of the reaction mixture at each time were subjected to the dideoxy sequencing protocol with 5-methyl-dCTP .
The reaction mixtures were digested with RsaI prior to running of the sequencing gel to establish fixed endpoints for reading the sequence .
Construction of uhp-phoA fusions .
Fusions of the phoA gene to regions of uhp were constructed in-vitro by use of the PstI sites at the ends of the Km insertions and cassettes containing the phoA gene bounded by polylinker sequences .
TwophoA cassettes were used to allow fusion to PstI sites in either of two translational reading frames .
One cassette was derived from plasmid pSWFII ( 6 ) by cleavage with PstI and partial digestion with XbaI .
This cassette was cloned into PstI-XbaI-cut pMI29 : : Km plasmids to replace the Km cassette and distal uhp sequences with phoA fused in-frame to uhp at positions corresponding to amino-acid-residues B-182 , B-250 , B-411 , C-91 , C-361 , C-404 , T-157 , T-189 , T-217 , T-221 , and T-366 .
The second cassette was constructed by subcloning the SmaI-Sacl , phoA-containing fragment of pSWFII into pKS + cut with SmaI-SacI , which displaces the phoA coding frame by 1 base relative to the PstI site .
The PstI-XbaI fragment from this construct ( pKS-phoA ) was used as described above to form fusions at uhp positions corresponding to amino-acid-residues B-87 , B-151 , B-240 , B-345 , C-224 , C-241 , T-249 , T-332 , and T-427 .
Additional fusions were obtained by in-vivo transposition of TnphoA into an expression vector in which uhpBC was inserted downstream of the lac promoter , with amino-acid 11 of LacZ fused to residue 189 of UhpA via the pUC8 polylinker .
This plasmid was constructed by cloning the 2.8-kb PstI-NsiI fragment ( nucleotides 666 to 3531 ) of uhp from plasmid pMI29 : : Km [ A189 ] into vector pMLB1113 cut at the PstI site of its polylinker by partial digestion .
Plasmid pMLB1113 is a pBR322 derivative containing the lacIq and lacZ genes , with the pUC8 polylinker inserted at codon 11 of lacZ , and was provided by Michael Berman .
Products with the fragment in the proper orientation were identified by restriction mapping , and the plasmid was introduced into strain CC118 .
Transposition of TnphoA into the plasmid was selected after introduction of F ' TnphoA as described by Manoil and Beckwith ( 16 ) , with some modifications .
Light and dark blue colonies on LB plates containing 300 p , g each of ampicillin and kanamycin per ml and 40 pug of 5-bromo-4-chloro-3-indolyl phosphate per ml were purified , and plasmid DNA was prepared .
For plasmids carrying a TnphoA insert , the sequence at the fusion junction was determined with a primer ( 5 ' - CGCCCIGAGCAGCCCGG ) which anneals within the phoA gene .
There were many fusions to the 5-lactamase gene , and no low-activity fusions occurred in uhp .
High-activity fusions in uhp were transferred to plasmid pMI29 for comparison with in-vitro-generated fusions .
The PstI-XbaI fragment containing the phoA gene from pKS-phoA was cloned into plasmid pMI29 : : Km [ A189J , replacing the Km cassette and 3 ' uhp sequences with phoA .
The PstI-SphI uhp-phoA ' fragment of this construct was replaced with the PstI-SphI uhp-phoA ' fragment of each TnphoA fusion to generate plasmids with the same structure as the in-vitro-generated fusions .
The only differences between these constructs and the fusions constructed in-vitro were fou amino-acids inserted at UhpA residue 189 .
There were also differences in the linker region precedingphoA in constructs made with pSWFII , pKS-phoA , or TnphoA .
Assays of alkaline phosphatase and,-lactamase activities .
Alkaline phosphatase activity was measured by a modification of the procedure of Michaelis et al. ( 18 ) .
Isolates of strain CC118 carrying different uhp-phoA fusion plasmids were grown overnight in LB broth supplemented with 40 , g of ampicillin per ml , diluted 1:100 in the same medium , and grown at 37 °C to an OD59 of ca. 0.2 .
Two 1.5-ml portions of each culture were sedimented and suspended in 0.15 ml of 2 M Tris-HCl ( pH 8.0 ) for the alkaline phosphatase assay or 0.1 M Tris-HCl ( pH 7.4 ) for the , B-lactamase assay .
The turbidity of a 1:10 dilution of each sample was measured , and 0.1 ml of the remaining material was lysed with 0.02 ml of 0.1 % SDS-chloroform ( 1:1 ) in polypropylene microtiter plates .
The enzymatic reaction was started by adding 0.05 ml of cell lysate to 0.05 ml of reaction mixture in wells of polystyrene microtiter plates .
Changes in the absorbance were measured over 10 min at 37 °C with a THERMOma microplate reader ( Molecular Devices , Menlo Park , Calif. ) .
For the alkaline phosphatase assay , the reaction mixture contained 2 M Tris ( pH 8.0 ) and 4 mg of Sigma 104 phosphatase substrate ( p-nitrophenyl-phosphate ) per ml and the increase in the OD405590 was measured .
For the 3-lac-tamase assay , the reaction mixture contained 0.1 M Tris ( pH 7.4 ) and 4.0 x 10 - ' M pyridine-2-azo-p-dimethylalanine cephalosporin ( PADAC ; Calbiochem , San Diego , Calif. ) and the decrease in the OD5906s50 was measured ( 12 ) .
Both alkaline phosphatase and , B-lactamase activities were corrected for cell density , and the expression of , B-lactamase was used to correct alkaline phosphatase activity for slight differences in plasmid copy number .
Nucleotide sequence accession numbers .
The GenBank accession numbers for the E. coli and S. typhimurium uhp sequences are M89479 and M89480 , respectively .
Pv H PV Ss t : BoRS s la Bo sX Sa BcRB Bo Bass I ll * - F P I I I I I I I I R1V 11 I I a I I II OBa1gL I I I Ri I astp Eo : Be RB RB lU % kdn * o aino ads 97 .
912 % Uh dicon 5.0 81.6 90.1 80.3 865 % Us auwns cnodnn 55.7 Su FIG. 1 .
Structure and comparison of the uhp regions in E. coli and S. typhimunum .
Restriction maps of the E. coli ( Ec ) and S. typhimunium ( St ) uhp regions are presented on the upper line .
Cleavage sites are abbreviated as follows : Bc , BclI ; R5 , EcoRV ; Pv , PvuI ; Ba , BalI ; Ss , SstII ; Hp , HpaI ; Cl , ClaI ; Ml , MluI ; H , HindIII ; Bg , BglIl ; Sa , Sall .
There were no sites for BamHI , EcoRI , KpnI , NcoI , PstI , SstI , SmaI , orXhol .
The location and the direction of the uhp open reading frames are presented on the middle line , and a summary of the percent identity in nucleotide and amino-acid sequences is presented on the lower line .
RESULTS Sequence of the S. typhimurium uhp region .
The S. typhi-murium uhp genes were cloned from a library of EcoRIgenerated DNA fragments in Xgtll by selection for growth on Fru6P of transductants of E. coli AuhpA ( RK9332 ) and AuhpT ( RK9337 ) strains .
One recombinant phage able to complement transposon insertion mutations in all four E. coli uhp genes was obtained .
This phage carried an insert of a 6.3-kb EcoRI fragment , which was cloned into the EcoRI site of pKS + to yield plasmid pKB18 , which complemented uhpA and uhpT mutations .
Plasmid pKB18 was cut by ClaI into two fragments .
The 2.6-kb fragment was cloned into the ClaI site of pKS + to yield pKB23 , which carried part of uhpC and all of uhpT .
The other fragment , of 6.6 kb , was ligated to a circular form , yielding pKB24 , which had a 3.7-kb insert carrying uhpA , uhpB , and part of uhpC .
The nucleotide sequence of the 5,465-bp region was determined by the ExoMeth procedure of Sorge and Blinderman ( 27 ) for the generation of nested deletions from the ends of the insert .
An average of 5.6 gel readings were obtained for each sequence character .
The restriction map for the S. typhimunium uhp locus differed considerably from that for the E. coli uhp locus , although some sites were common to both ( Fig. 1 ) .
The nucleotide sequences from the two organisms exhibited 81.5 % overall identity and were readily aligned ( Fig. 2 ) .
Four uhp open reading frames were present in the S. typhimurium sequence .
The uhpA and uhpT genes were identical in size and encoded polypeptides having greater than 94 % amino-acid sequence identity with their E. coli homologs .
However , the uhpB and uhpC coding regions were different in size and deduced polypeptide sequence from the published E. coli sequence ( 9 ) .
Correction of the E. coli uhp sequence .
During this work , several errors in the published E. coli uhp sequence were discovered in regions of gel compression .
The changes that must be made in the published sequence ( 9 ) are deletion of a G at position 1762 , insertion of a C at position 1823 , change of CG to GC at position 2123 , and insertion of a G at positions 2134 , 2167 , 2722 , and 3271 .
These changes were corroborated by comparison with the location , length , and coding capacity of the open reading frames in the S. typhi-murium sequence .
Comparison of the uhp regions .
The corrections in the nucleotide sequence of the uhp region changed the deduced sequence of the uhpB and uhpC gene products and markedly reduced the length of the intergenic spaces .
Several salient features of uhp gene organization are summarized here .
An open reading frame precedes the uhpA coding region in S. typhimurium and ends at the same position as the ilvN gene in E. coli ( residues 24 to 26 in Fig. 2 ) , although the deduced sequence is different .
These coding regions in both organisms are followed by a typical rho-independent terminator structure which is highly conserved and appears to overlap the uhpABC promoter .
The amino-acid sequence of UhpA is strongly conserved , with only five conservative substitutions among 196 codons ( nucleotides 101 to 692 ) .
The termination codon of uhpA overlaps the initiation codon of uhpB in the sequence TGATG in E. coli and the sequence TAATG in S 865 % Us auwns cnodnn 55.7 Su FIG. 1 .
Structure and comparison of the uhp regions in E. coli and S. typhimunum .
Restriction maps of the E. coli ( Ec ) and S. typhimunium ( St ) uhp regions are presented on the upper line .
Cleavage sites are abbreviated as follows : Bc , BclI ; R5 , EcoRV ; Pv , PvuI ; Ba , BalI ; Ss , SstII ; Hp , HpaI ; Cl , ClaI ; Ml , MluI ; H , HindIII ; Bg , BglIl ; Sa , Sall .
There were no sites for BamHI , EcoRI , KpnI , NcoI , PstI , SstI , SmaI , orXhol .
The location and the direction of the uhp open reading frames are presented on the middle line , and a summary of the percent identity in nucleotide and amino-acid sequences is presented on the lower line .
A A L D A AA I 0 C I C L H A H V A V H E E I R R R K TCCOCC 0OCOCOCTOGATATCOOCOG CTTOGTOTATTOCTGATO0TATOCOOTAAOA.OAOCAAACC COCCOCOCTIACCCCGCTOTGTATCT 5028 I I E K K I Q V N I Ag 9 cents T AGAPA&TCOAOC TArT ~ OCTA OTOC TGTACOTTTTOCCCO0CTAOCAO-TTTTT w , 5106 L T V TFTTATTOTATCA ~ TG0AOAATCCCACATO ~ CGCOTTAGTTTTAOCCOTO = TTATOCCTTOCOOTTOTCAGACA4GACATccoOcaTcTOOCGTAAAOAATAGACAAOcaTAATA ^ ATCACATCCTGACAG 5186 5263 typhimurium .
The uhpB coding region extends for 500 codons ( nucleotides 691 to 2193 ) .
The UhpB amino-acid sequences are 91 % identical in the two organisms .
The similarity of UhpA and UhpB to receiver and transmitter modules of sensory transduction pathways has been described ( 14 , 28 , 31 ) , and the correction of two short regions in the published sequence at the carboxyl-terminal end of UhpB resulted in an increased match to other members of the protein kinase family .
The uhpB coding sequence is followed by a 9-bp intergenic region before the start of the 442-codon uhpC coding sequence ( nucleotides 2203 to 3531 ) .
The E. coli uhpC gene begins with two tandem AUG codons , whereas in S. typhi-murium the first of these codons is AUA .
On the basis of the distance to the Shine-Dalgamo sequence , we suspect that both genes start at the conserved AUG codon at nucleotide 2203 .
UhpC of S. typhimunum is longer than UhpC of E. coli owing to the insertion of three amino-acids just before the last residue .
There is 90 % amino-acid sequence identity for UhpC from the two organisms .
The termination codon of uhpC overlaps part of the promoter region of uhpT .
There is an intergenic segment of about 150 bp before the start of the uhpT coding region of 463 amino-acids ( nucleotides 3671 to 5063 ) .
The UhpT protein sequences are very strongly conserved , with 94.8 % identity .
UhpT and UhpC are related along their entire lengths , with 30.7 % identical amino-acids .
About 11 % of the residues are identical in all members of the family of membrane proteins , which includes UhpC and UhpT in both organisms , glycerol 3-phosphate transporter GlpT of E. coli ( 8 ) , and phosphoglycerate transporter PgtP of S. typhimunum ( 10 ) .
The degree of amino-acid identity shared by UhpC and UhpT is about the same as that among transporters UhpT , GlpT , and PgtP , between 27.8 and 33.3 % .
There were no large stretches of amino-acid sequence in which UhpC differed from the transport proteins , which might represent a signalling domain .
Generation of insertion mutations in uhp .
Insertions of a Km cassette in the uhp region were made to provide a set of precisely localized mutations and to allow the generation of in-frame deletions and phoA fusions .
The 1.4-kb Km cassette was ligated to compatible ends on the linear form of plasmid pMI29 generated by digestion with limiting concentrations of AluI , HaeIII , HpaII , RsaI , Sau3A , or ThaI .
Restriction enzyme analysis and nucleotide sequencing across both junctions identified the sites of insertion and verified the presence of a single Km cassette in a full-length uhp + plasmid .
Several insertions contained short deletions on one side of the cassette as a result of cleavage at multiple , closely spaced sites on pMI29 and were not studied further .
The Uhp phenotypes conferred by 46 Km cassette insertions in uhp were determined following transfer to the chromosome and replacement of the chromosomal uhp + allele ( Fig. 3 ) .
Two insertions just upstream of the uhp coding region retained Uhp function , as shown by growth on Fru6P as a carbon source .
One Uhp + insertion was less than 100 bp upstream of the start of the uhpA reading frame and 30 bp from its putative -35 region .
As expected from previous studies with transposon insertions , almost all of the Km insertions in the corrected uhp reading frames eliminated Uhp function .
The only uhp : : Km insertion that retained a Uhp + phenotype lay after amino-acid 437 in UhpC , three codons from the end of that protein , indicating that the extreme carboxyl terminus of UhpC is not essential for its function .
Frequency of Uhp + revertants .
The ability of the uhp : : Km insertion mutants to yield Uhp + offspring was determined .
Strains with insertions in uhpA or uhpT did not give rise to Uhp + progeny .
The small colonies that arose on prolonged incubation yielded small colonies when restreaked on Fru6P medium .
All of the mutants with insertions in uhpB or uhpC yielded Uhp + progeny at frequencies of ca. 10i per cell plated .
All of these revertants retained the Km phenotype conferred by the original insertion mutation .
Thus , it appears that the requirement for either uhpB or uhpC can be bypassed by second-site mutations , whereas the requirement for uhpA and uhpT can not .
Regulatory phenotypes of null mutations .
To test the effect of the loss of each uhp gene on the regulation of uhapT expression , we prepared null mutations in each uhp gene as in-frame deletions that removed most of the coding region without perturbing the reading frame .
These deletions were prepared by use of the PstI sites in the polylinker flanking each Km cassette .
Digestion of pMI29 : : Km plasmids with PstI and HindIII or with PstI and BamHI and exchange and ligation of the appropriate DNA fragnents resulted in removal of the Km determinant and the desired portion of uhp .
Each deletion was transferred to the chromosomal uhp locus , and its effect on uhapT expression was determined from the level of , B-galactosidase encoded by a uhpT-lacZ fusion carried on a XRZ5 prophage .
The wild-type induction ratio exhibited by this reporter system was at least 500 ( Fig. 3 ) .
The deletion of uhpA between amino-acids 15 and 189 resulted in complete loss of uhpT-lacZ expression , as did longer deletions extending from early in uhpA to the distal ends of uhpB , uhpC , or u/pT .
The levels of,-galactosidase were as low as those in uninduced cells .
Thus , uhpA is absolutely required for uhpT transcription , regardless of whether the other uhp genes are present or absent .
The in-frame deletion that removed most of u/pB conferred an elevated basal level of u/pT expression , about 1 to 3 % the induced wild-type level .
This expression was not changed by the presence of Glu6P .
The same behavior was exhibited by strains with deletions of u/pBC and uhpBCT .
The deletion of uhpC also resulted in an increased basal level of u/pT-lacZ expression that was not induced by the addition of Glu6P , although the increase in expression was smaller than that in the u/pB deletion .
These results showed that UhpB and UhpC are required for the response to an inducer and that they also appear to act in a negative manner .
The deletion of u/pT had no apparent effect on the expression or regulation of the uhpT-lacZ reporter gene , confirming the previous conclusion that significant transport of Glu6P into the cell is not needed for the induction of u/pT expression ( 23 ) .
Topology deduced from Uhp-PhoA fusions .
Translational fusions of u/pBCT to the mature portion of phoA were generated with the restriction sites introduced on some of the Km cassettes .
Additional fusions were made with TnphoA .
The alkaline phosphatase activities of strain CC118 carrying uhp-phoA constructs in plasmid pMI29 were measured relative to the 1-lactamase levels to control for plasmid copy number .
As the extent of the uhp sequence from all three genes was increased , there was a periodic alternation between fusions with substantial enzymatic activity and those with very low levels of enzymatic activity .
These results are expected for fusions with proteins that span the cytoplasmic membrane multiple times .
It is expected that high enzymatic activity will be displayed by fusions whose junction allows the PhoA moiety to be exported to the periplasmic space .
Fusions that retain the PhoA moiety in the cytoplasm will show low enzymatic activity , as a result of the instability of the phosphatase domain , cleavage by proteases , or an inability to form disulfide bonds or to acquire the metal-ions necessary for stability or activity ( 3 , 15 , 18 ) .
The enzymatic activities of the 12 UhpB-PhoA , 7 UhpC-PhoA , and 9 UhpT-PhoA hybrids constructed in this study correlated with transmembrane topological models based o hydropathy distributions and deductions from charge distributions of extramembranous loops ( 29 ) ( Fig. 4 ) .
Figure 4 includes the results for 12 previously described UhpT-PhoA fusions ( 15 ) .
In almost all cases , the observed enzymatic activities fit the predicted model , although other possible topologies are not excluded .
The few exceptions are discussed below .
The deduced topologies of UhpC and UhpT are identical .
UhpB is predicted to have 6 to 10 transmembrane segments which anchor the polar carboxyl-terminal half in the cytoplasm .
H L N F L K A P ^ N COOTACOCOOTGAOCOTCTCGTTOCCCCAOCTACTTAOAOOTAOCTCTTTTT r A.AA ^ COCACOCOTOTCAOCt ; TTTCTCTACCTCAACQCTATOTCTAGTTTQATGATGTTOCCOTTTCTCGAACCOCCTaCCO 0 P 0 A P L I T D HN E V D A R Y R Y W RR N I L I T I W ACOCCOCTCTACOA TAOCOGOTTACCOOTACCTACT OOOcOCTATCCT GATCACCATTTO & TTATTACCCACCATOCTCGCTATCTOCTACCATCTGG H V I L LOaYA ^ L F V F T R K SF N AAAP Elx LA 4OXIL T 4709 2150 4766 2230 4968 2310 4948 2390 RHOlDX LATL F TYavNKFV OV L YI SD OOOCAOC4ATATCOOCCTCTTOQCSAOCTOTTTATCACCTTITITCCOCATCTTAC CCGTAOCGATATCOOCCTOTTAOCOACCCTGTTTTACATTACCTATOOCOTOTCGAAOTTTOTCTCCOOCATTOTCAOCO 2470 R N A RR Y r H G I a L x A T A V V xI L F O F N T ATCTAOTcCATTTOCTOCTAT0AT0TATOAATCTTOOCTTCTOO C ATCOCTC I N FA 0 V N P V c L W A L W A L N A F F 0 o A R L L TcOCTTCTTCTCTOCTATOcocTOAACOCCTrTTTCCAO * OOTTTOATOOC TTO OCT TCOCTATOIOCOTTTOCCOTOCTCOOTOCOTCTOTT V V w 2550 2630 275 FIG. 2 .
Sequence of the uhp region .
Aligned nucleotide sequences for the uhp regions from E. coli and S. typhimunum are presented .
The amino-acid sequences predicted for S. typhimurium are indicated above in single-letter code ; the amino-acids for E. coli are shown below only when they differ from those for S. typhimurium .
Putative Shine-Dalgarno sequence residues are indicated by dots ; termination codons are indicated by @ ; gaps inserted to maintain maximal alignment are indicated by dashes .
t W. IAAA - GIu6P + GIu6P 3 1480 AA A AA 3 ) A15-A189 1 0.6 AlS-B48 F-0.5 0.6 A15-C437 1-0.5 0.7 AIS-T427 H 0.8 0.8 B60-B489 1-33 25 9BO-C437 a 54 40 665-T427 I-1 29 37 C41-C047 7.9 6 C41-T427-1 9.3 11 Ti-T427-1 1.4 1530 FIG. 3 .
Km cassette insertions and deletions in the E. coli uhp region .
Arrowheads indicate the positions of Km cassette insertions , determined by nucleotide sequencing .
The location of the insertion conferring a Uhp + phenotype is indicated by the filled arrowhead .
The sequences remaining in the in-frame deletions are indicated below .
Each deletion was derived by combining fragments of appropriate cassette insertions generated by cleavage at HindIII and BamHI sites outside the uhp region and at the PstI sites at the boundary of each insertion .
The designation given to each in-frame deletion indicates the amino-acids removed by that deletion : A , UhpA ; B , UhpB ; C , UhpC ; T , UhpT .
Deletions were transferred to the chromosome of strain RK9338 ( XRZ5-P .
lac [ Km ] ) , and 3-galactosidase activity expressed from the uhpT-lacZ reporter was measured after growth in the absence or presence of Glu6P .
Each value is the mean of at least three determinations for three separate isolates and is given as mOD415 590 x minute - ' x OD590 culture - ' l 1 l ) ¬ 1 ISLAND ET AL. .
A. UhpB-PhoA B. Uhp-PoA 0 .
Topological models based on the location and activity of uhp-phoA gene fusions .
Two-dimensional topological models are presented for UhpB ( A ) , UhpC ( B ) , and UhpT ( C ) .
The shaded columns represent putative transmembrane segments , with the amino-acid-residues beginning and ending each segment indicated at each end .
Heavy lines portray the cytoplasmic and periplasmic loops or termini of the polypeptides , oriented with the periplasmic space at the top .
Thin lines connect the position of each fusion junction to a box which gives the last Uhp amino-acid before the fusion junction ( upper number ) and the alkaline phosphatase/13-lactamase activity ratio relative to those of other fusions in the same gene ( lower number ) .
Shaded boxes in UhpT-PhoA ( C ) are previously reported fusions ( 15 ) .
DISCUSSION Cassette insertions in the E. coli uhp region helped define the boundaries and requirements for the genes in this locus .
The phenotypes conferred by these precisely mapped insertions indicated that our previous reading frame assignment for uhpC was incorrect , as indicated by the Uhp-phenotype of five insertions in sequences previously thought to be outside uhpC ( 9 ) .
The structure of the uhp locus has been clarified by correction of several errors in the published sequence and by an independent determination of the homologous region from S. typhimurium .
Correction of the E. coli sequence revealed a higher-than-usual degree of relatedness between the S. typhimurium and E. coli uhp operons .
The four uhp genes are arranged with minimal intergenic spacing , raising the possibility that translation of the uhpABC transcripts is coupled .
The only uhp : : Km insertion that was Uhp + was located three codons from the C terminus of UhpC .
A further indication that the carboxyl terminus of UhpC is not critical to its function is the fact that this is the site of three additional amino-acids in the S. typhimunum sequence .
For UhpA or UhpB , insertions 7 or 11 codons , respectively , from the carboxyl terminus resulted in loss of function .
We had previously identified UhpC as a 20-kDa polypeptide expressed from a plasmid in which a DNA fragment encoding the distal portion of uhpB and intact uhpC was transcribed from a phage T7 late promoter ( 30 ) .
This poly-peptide is instead likely to be the 168-amino-acid polypeptide encoded by the fusion of ilvN to the end of uhpB .
The detection of UhpC is complicated by its low level of expression and its mobility on gel electrophoresis as a diffuse band with a size similar to that of UhpT .
Previous studies used transposon insertions , deletions , and overproduction of uhp gene products to address the role of individual uhp genes in sugar phosphate transport and its regulation ( 30 , 31 ) .
These studies were limited by the imprecise localization of transposon insertion sites and deletion boundaries , by the polar effect that insertions can have on downstream genes , and by the difficulty in constructing strains which express pertinent gene products at normal levels .
The in-vitro-generated cassette insertions allowed the construction of in-frame deletions that had known endpoints and that removed the uhp genes individually or in combinations .
These plasmid constructs were returned to the E. coli chromosome to generate strains expressing the remaining uhp gene products from their native promoter at a normal gene dosage .
Using a uhpT-lacZ reporter to provide a more sensitive assay of gene expression than the measurement of transport activity , we obtained new information about the effect that the absence of one or more uhp gene products had on expression from the uhpT promoter .
As expected , all three uhp regulatory genes were required for the proper regulation of the uhpT gene ( 30 ) .
However , the loss of the uhpB and uhpC gene products resulted in a moderate increase in the basal expression of uhpT over the very low levels in uninduced cells .
Thus , UhpB and UhpC might act in both positive and negative manners .
One hypothesis is that , in the absence of induction , UhpB functions to maintain UhpA in an inactive state and thereby contributes to the extremely low basal level of expression in the Uhp system .
Sequence homology suggests that UhpB may be a histidine-protein kinase and , in the presence of Glu6P , may phosphorylate and activate UhpA .
In the absence of induction , it may act as a protein phosphatase to maintain UhpA in its unphosphorylated , inactive state .
Such a system would reduce the effects of so-called `` cross-talk '' between Uhp and other two-component regulatory kinases .
The deletion of uhpC caused an increase in uhpT-lac expression similar to but smaller thsan that caused by the deletion of uhpB .
Perhaps UhpC enhances UhpB phosphatase activity by the formation of a UhpBC complex .
Although no direct evidence for an interaction between UhpB and UhpC has been presented , such an interaction may be critical to proper Uhp regulation .
If UhpC contains the Glu6P-binding site relevant for regulation , transduction of the signal to UhpB through a protein-protein interaction is a probable mechanism .
An unexpected result was the finding that both UhpB and UhpC could be bypassed by suppressor mutations , whereas we previously only had evidence that the UhpC function could be bypassed ( 13 , 31 ) .
The Km insertions also allowed the generation of translational fusions with topological reporter PhoA .
We had previously described the use of transposon TnphoA for the isolation of uhpT-phoA fusions ( 15 ) .
This approach was of limited value with the weakly expressed uhp regulatory genes because the level of PhoA activity in fusions to internal domains was so low that these fusions could not be reliably identified .
In contrast , making uhp-phoA fusions at defined sites-and in the proper reading frame allowed the application of this approach to these poorly expressed genes .
Maintenance of the proper reading frame from the site of Km insertion required the use of severalphoA cassettes , and we constructed fusions in two of the three possible frames .
As was found with TnphoA insertions and as is indicative of a transmembrane distribution , we found a periodic alternation of alkaline phosphatase activities with increasing lengths of the contributed UhpB , UhpC , or UhpT sequences .
The topology deduced for UhpT extended our previous results and agreed well with our previous model ( 15 ) .
The one site of discrepancy with the model for UhpT involves the longest fusion to residue 411 , which had much lower activity than expected .
Several explanations are possible .
There may be only 10 transmembrane segments .
On the other hand , the junction between UhpT411 and PhoA introduces several Arg residues , and this concentration of positive charge may interfere with the translocation of the preceding segment across the cytoplasmic membrane .
Another possibility is that insertion of the 11th transmembrane segment , which has the lowest mean hydropathy value of the putative transmembrane segments , requires the presence of the 12th transmembrane segment , which is disrupted in the fusion .
It is noteworthy that the same behavior is exhibited by a PhoA fusion to the analogous area of UhpC ( UhpC404-PhoA ) .
The set of UhpC-PhoA fusions was not as extensive as that of UhpT-PhoA fusions and did not allow an independent assignment of all of the extramembranous loops .
However , the activities of the fusions that were constructed were fully compatible with the UhpT topological model and provide new support for the cytoplasmic location of the central loop in both proteins The amino-terminal half of UhpB ( residues 1 to 273 ) exhibits substantial hydrophobic character .
A model predicting 10 transmembrane segments can be drawn on the basis of the hydropathy distribution and the distribution of charges in the extramembranous loops , according to the `` interiorpositive '' rule of von Heijne ( 29 ) .
Two charged residues are included in the transmembrane region , with no net charge .
This model is fully compatible with the properties of the UhpB-PhoA fusions , although other models can not be excluded .
The removal of putative transmembrane segments 3 and 4 or 7 and 8 or both from the membrane to cytoplasmic loops would also be consistent with the results presented .
Nonetheless , these results indicate that UhpB contains 6 , 8 , or 10 transmembrane segments and that the carboxy-termi-nal polar half is cytoplasmic .
Our results do not exclude the possibility that the amino terminus is periplasmic , although the absence of a signal sequence renders this possibility unlikely .
This topology of UhpB supports models of uhp regulation which postulate that the membrane-embedded portions of UhpB and UhpC interact to transmit the signal presented by external Glu6P , while the kinase portion of UhpB is accessible to cytoplasmic UhpA .
new diagnostic chromogenic reagent , and comparison with This work was supported by Public Health Service research grant GM38681 from the National Institute of General Medical Sciences .
M.D.I. received postdoctoral training support from NRSA CA09109 from the National Cancer Institute .
We thank Tod Merkel for many helpful discussions and for supplying XRZ5-P1Jac and pRS415 : PTRsaI .
We are also grateful to Kate Jensen for excellent technical assistance .
Ambudkar , S. V. , T. J. Larson , and P. C. Maloney .
Reconstitution of sugar phosphate transport systems of Esche-richia coli .
Birnboim , H. C. , and J. Doly .
A rapid alkaline extraction procedure for screening recombinant plasmid DNA .
Derman , A. I. , and J. Beckwith .
Eschenchia coli alkaline phosphatase fails to acquire disulfide bonds when retained in the cytoplasm .
The hexose-phosphate transport system of Escherichia coli .
Dietz , G. W. , and L. A. Heppel .
Studies on the uptake of hexose-phosphates .
The induction of the glucose-6-phos-phate transport system by exogenous but not by endogenously formed glucose-6-phosphate .
Ehrmann , M. , D. Boyd , and J. Beckwith .
Genetic analysis of membrane protein topology by a sandwich gene fusion approach .
Eidels , L. , P. D. Rick , N. P. Stimler , and M. J. Osborn .
Transport of D-arabinose-5-phosphate and D-sedoheptulose-7-phosphate by the hexose-phosphate transport system of Salmo-nella typhimurium .
Eiglmeier , K. , W. Boos , and S. T. Cole .
Nucleotide sequence and transcriptional startpoint of the glpT gene of E. coli : extensive sequence homology of the G-3-P transport protein with components of the H-6-P transport system .
Friedrich , M. J. , and R. J. Kadner .
Nucleotide sequence of the uhp region of Eschenichia coli .
Nucleotide sequence and transcription start point of the phosphoglycerate transporter gene of Salmonella typhimurium .
Greener , L. , and C. W. Hill .
Identification of a novel genetic element in Escherichia col K-12 .
Jones , R. N. , H. W. Wilson , and W. J. Novick , Jr. 1982 .
In vitro evaluation of pyridine-2-azo-p-dimethylaniline cephalosporin , a nitrocefin , cephacetrile , and other beta-lactam compounds .
Kadner , R. J. , and D. M. Shattuck-Eidens .
Genetic control of the hexose-phosphate transport system of Escherichia coli : mapping of deletion and insertion mutations in the uhp region .
Kofoid , E. C. , and J. S. Parkinson .
Transmitter and receiver modules in bacterial signaling proteins .
Lloyd , A. D. , and R. J. Kadner .
Topology of the Esche-richia coli uhpT sugar-phosphate transporter analyzed by using TnphoA fusions .
Manoil , C. , and J. Beckwith .
TnphoA : a transposon probe for protein export signals .
Merkel , T. J. , D. M. Nelson , C. L. Brauer , and R. J. Kadner .
Promoter elements required for positive control of transcription of the Escherichia coli uhpT gene .
Michaelis , S. , H. Inouye , D. Oliver , and J. Beckwith .
Mutations that alter the signal sequence of alkaline phosphatase in Escherichia coli .
Experiments in molecular genetics .
Cold Spring Harbor Laboratory , Cold Spring Harbor , N.Y. 20 .
Oishi , M. , and S. D. Cosloy .
The genetic and biochemical basis of the transformability of Escherichia coli K12 .
Pogell , B. M. , B. R. Maity , S. Frumkin , and S. Shapiro .
Induction of an active transport system for glucose-6-phosphate in Escherichia coli .
Roland , K. L. , C. Liu , and C. L. Turnbough .
Role of the ribosome in suppressing transcriptional termination at thepyrBl attenuator of Escherichia coli K-12 .
Shattuck-Eidens , D. M. , and R. J. Kadner .
Exogenous induction of the Escherichia coli hexose-phosphate transport system defined by uhp-lac operon fusions .
Silhavy , T. J. , M. L. Berman , and L. W. Enquist .
Experiments with gene fusions .
Cold Spring Harbor Laboratory , Cold Spring Harbor , N.Y. 25 .
Simons , R. W. , F. Houman , and N. Kleckner .
Improved single and multicopy lac-based cloning vectors for protein and operon fusions .
Sonna , L. A. , S. V. Ambudkar , and P. C. Maloney .
The mechanism of glucose 6-phosphate transport by Eschenchia coli .
Sorge , J. A. , and L. A. Blinderman .
ExoMeth sequencing of DNA : eliminating the need for subcloning and oligonucleo-tide primers .
Stock , J. B. , A. J. Ninfa , and A. M. Stock .
Protein phosphorylation and regulation of adaptive responses in bacteria .
The distribution of positively charged residues in bacterial inner membrane proteins correlates with the trans-membrane topology .
Weston , L. A. , and R. J. Kadner .
Identification of Uhp polypeptides and evidence for their role in exogenous induction of the sugar phosphate transport system of Escherichia coli K-12 .
Weston , L. A. , and R. J. Kadner .
Role of uhp genes in expression of the Escherichia coli sugar-phosphate transport system .
Winans , S. C. , S. J. Elledge , J. H. Krueger , and G. C. Walker .
Site-directed insertion and deletion mutagenesis with cloned fragments in Escherichia coli .
Compartmentation in the induction of the hexose-6-phosphate transport system of Escherichia coli .