0.15 % Bile Salt Mix Stress , 90 minutes , static , 5 % CO2 ( EHEC strain : <Gtype> 86-24 ) </Gtype> 
0.5 mg/ml SHX for <Supp> 20 min </Supp> 
0.5 % ( w/v ) sodiumbenzoate _ <Supp> 0 min </Supp> 
0.5 % ( w/v ) sodiumbenzoate _ <Supp> 15 min </Supp> 
0.5 % ( w/v ) sodiumbenzoate _ <Supp> 30 min </Supp> 
0.5 % ( w/v ) sodiumbenzoate _ <Supp> 5 min </Supp> 
0.5 % ( w/v ) sodiumbenzoate _ <Supp> 60 min </Supp> 
0 % sodiumbenzoate _ <Supp> 0 min </Supp> 
0 % sodiumbenzoate _ <Supp> 15 min </Supp> 
0 % sodiumbenzoate _ <Supp> 30 min </Supp> 
0 % sodiumbenzoate _ <Supp> 5 min </Supp> 
0 % sodiumbenzoate _ <Supp> 60 min </Supp> 
0x58 replicate 3 state 2 <Supp> ( IPTG </Supp> + / aTc - / Ara - ) 
1005 fork-blocking strain induced for Tus : <Supp> fork5 _ 2 </O> 
1005 fork-blocking strain induced for Tus : <Supp> fork5 _ 3 </O> 
1005 , LB + <Supp> 0.2 % glucose </Supp> ( tus repressed ) 
10 _ HF _ <Gtype> HP _ </O> <Supp> noDP _ </O> <Gtype> noRh -LSB- COPRO-Seq -RSB- </Gtype> 
10 ml of cell culture was mixed with 5 ml ice cold killing buffer ( 20mM Tris and 5mM MgCl2 and 20mM NaN3 ) and cells collected by centrifugation ( 8000g , 4C , 3 min ) . The supernatant was discarded and the pellet resuspended in 300μL TE with 40 μl 10 % SDS and 3 μl 0.5 M EDTA . After incubation for 5 min at 65 °C 750μl isopropanole was added before centrifugation at 15600 rcf for 5 min . The pellet was resuspended in 500μL TE and 2μL RNase A ( 25mg/ml ) was added and incubated for <Supp> 30 min </Supp> at 65 °C . Subsequently , 2μL proteinase K ( 25 mg/ml ) was added and samples incubated at <Temp> 37 °C </Temp> for 15 min followed by phenol extraction and precipitation with ethanol and Na-acetate . Precipitated DNA was resuspended in 50μL dH2O . 
10 pmol of a pre-adenylated ( rApp ) adapter were ligated to 1 μg of nascent ( or mature ) RNA in a reaction volume of 20 μl , using 400 U T4 RNA Ligase 2 , Deletion Mutant ( Epicentre , cat . LR2D11310K ) in the presence of 20 % PEG-8000 , by incubation at 25 °C for 2 hours . Reaction clean-up was performed using RNA Clean & Concentrator ™ -5 columns , and RNA was eluted in 20 μl of Fragmentation buffer -LSB- 65 mM Tris pH 8.3 ; 100 mM KCl ; 5 mM MgCl2 -RSB- . RNA was fragmented by incubation at 95 °C for 8 minutes . Fragmented RNA was purified using RNA Clean & Concentrator ™ -5 columns , and eluted in 5.5 μl of nuclease-free water . RNA was heat-denatured at 70 °C for 5 minutes , and reverse transcription was carried out in a final volume of 10 μl , in the presence of 0.5 mM dNTPs , 5 pmol of RT primer , 20 U RNaseOUT ™ Recombinant Ribonuclease Inhibitor ( Invitrogen , cat . 10777-019 ) , and 100 U SuperScript ® III Reverse Transcriptase ( Invitrogen , cat . 18080-044 ) , by incubation at 50 °C for 50 minutes . Template RNA was degraded by adding 1 μl of 1 M NaOH , and incubating at 95 °C for 5 minutes . Reaction clean-up was performed using RNA Clean & Concentrator ™ -5 columns , and cDNA was eluted in 6 μl nuclease-free water . cDNA fragments were resolved on a 10 % TBE-Urea polyacrylamide gel , and a gel slice corresponding to fragments in the range 40-150 nt was cut . DNA was recovered by passive diffusion in Diffusion buffer for <Supp> 16 hours </Supp> at <Temp> 37 °C </Temp> with moderate shaking . cDNA was precipitated by addition of 1 ml Isopropanol , and 2 μl Glycogen ( 20 μg/μl ) , and resuspended in 8.25 μl nuclease-free water . 10 pmol of a 5 ' - phosphorylated adapter were ligated to the 3 ' - OH of cDNA fragments in a final reaction volume of 25 μl , in the presence of 0.05 mM ATP , 20 % PEG-4000 , and 100 U CircLigase ™ II ssDNA Ligase ( Epicentre , cat . CL9025K ) , by incubation at 60 °C for 4 hours , and 68 °C for 2 hours . Adapter-ligated cDNA fragments were purified from excess adapter using 1.8 volumes of Agencourt AMPure XP beads ( Beckman Coulter , cat . A63881 ) , following manufacturer 's instructions . cDNA was eluted in 20 μl of nuclease-free water , and indexed sequencing adapters were introduced by 15 cycles of PCR in the presence of 25 pmol of each primer , and 25 μl NEBNext ® High-Fidelity 2X PCR Master Mix ( NEB , cat . M0541L ) . 
10 pmol of a pre-adenylated ( rApp ) adapter were ligated to 1 μg of nascent RNA ( either total , or rRNA-depleted using Ribo-Zero rRNA Removal Kit ( Illumina , cat . MRZB12424 ) ) in a reaction volume of 20 μl , using 400 U T4 RNA Ligase 2 , Deletion Mutant in the presence of 20 % PEG-8000 , by incubation at 25 °C for 2 hours . Reaction clean-up was performed using RNA Clean & Concentrator ™ -5 columns , and RNA was eluted in 5.5 μl nuclease-free water . RNA was heat-denatured at 70 °C for 5 minutes , and reverse transcription was carried out in a final volume of 10 μl , in the presence of 0.5 mM dNTPs , 5 pmol of RT primer , 20 U RNaseOUT ™ Recombinant Ribonuclease Inhibitor , and 100 U SuperScript ® III Reverse Transcriptase , by incubation at 50 °C for 50 minutes . Template RNA was degraded by adding 1 μl of 1 M NaOH , and incubating at 95 °C for 5 minutes . Reaction clean-up was performed using RNA Clean & Concentrator ™ -5 columns , and cDNA was eluted in 6 μl nuclease-free water . cDNA fragments were resolved on a 10 % TBE-Urea polyacrylamide gel , and three gel slices corresponding to fragments in the ranges of 40-200 nt , 200-400 nt , and 400-600 nt were cut . DNA was recovered by passive diffusion in Diffusion buffer for <Supp> 16 hours </Supp> at <Temp> 37 °C </Temp> with moderate shaking . cDNA was precipitated by addition of 1 ml Isopropanol , and 2 μl Glycogen ( 20 μg/μl ) , and resuspended in 8.25 μl nuclease-free water . 10 pmol of a 5 ' - phosphorilated adapter were ligated to the 3 ' - OH of cDNA fragments in a final reaction volume of 25 μl , in the presence of 0.05 mM ATP , 20 % PEG-4000 , and 100 U CircLigase ™ II ssDNA Ligase , by incubation at 60 °C for 4 hours , and 68 °C for 2 hours . Adapter-ligated cDNA fragments were purified from excess adapter using 1.8 volumes of Agencourt AMPure XP beads , following manufacturer 's instructions . cDNA was eluted in 20 μl of nuclease-free water , and indexed sequencing adapters were introduced by 15 cycles of PCR in the presence of 25 pmol of each primer , and 25 μl NEBNext ® High-Fidelity 2X PCR Master Mix . 
10 pmol of a pre-adenylated ( rApp ) adapter were ligated to rnpB nascent RNA in a reaction volume of 20 μl , using 400 U T4 RNA Ligase 2 , Deletion Mutant in the presence of 20 % PEG-8000 , by incubation at 25 °C for 2 hours . Reaction clean-up was performed using RNA Clean & Concentrator ™ -5 columns , and RNA was eluted in 5.5 μl nuclease-free water . RNA was heat-denatured at 70 °C for 5 minutes , and reverse transcription was carried out in a final volume of 10 μl , in the presence of 0.5 mM dNTPs , 5 pmol of RT primer , 20 U RNaseOUT ™ Recombinant Ribonuclease Inhibitor , and 100 U SuperScript ® III Reverse Transcriptase , by incubation at 50 °C for 50 minutes . Template RNA was degraded by adding 1 μl of 1 M NaOH , and incubating at 95 °C for 5 minutes . Reaction clean-up was performed using RNA Clean & Concentrator ™ -5 columns , and cDNA was eluted in 6 μl nuclease-free water . cDNA fragments were resolved on a 10 % TBE-Urea polyacrylamide gel , and a gel slice corresponding to fragments in the range of 40-300 nt was cut . DNA was recovered by passive diffusion in Diffusion buffer for <Supp> 16 hours </Supp> at <Temp> 37 °C </Temp> with moderate shaking . cDNA was precipitated by addition of 1 ml Isopropanol , and 2 μl Glycogen ( 20 μg/μl ) , and resuspended in 8.25 μl nuclease-free water . 10 pmol of a 5 ' - phosphorilated adapter were ligated to the 3 ' - OH of cDNA fragments in a final reaction volume of 25 μl , in the presence of 0.05 mM ATP , 20 % PEG-4000 , and 100 U CircLigase ™ II ssDNA Ligase , by incubation at 60 °C for 4 hours , and 68 °C for 2 hours . Adapter-ligated cDNA fragments were purified from excess adapter using 1.8 volumes of Agencourt AMPure XP beads , following manufacturer 's instructions . cDNA was eluted in 20 μl of nuclease-free water , and indexed sequencing adapters were introduced by 15 cycles of PCR in the presence of 25 pmol of each primer , and 25 μl NEBNext ® High-Fidelity 2X PCR Master Mix . 
12 _ HF _ <Gtype> LP _ </O> <Gtype> noDP -LSB- COPRO-Seq -RSB- </Gtype> 
13 _ HF _ <Gtype> LP _ </O> <Gtype> noDP -LSB- COPRO-Seq -RSB- </Gtype> 
14 _ HF _ <Gtype> LP _ </O> <Gtype> noDP -LSB- COPRO-Seq -RSB- </Gtype> 
15 _ HF _ <Gtype> LP _ </O> <Gtype> noDP -LSB- COPRO-Seq -RSB- </Gtype> 
15 ml of culture was mixed with <Supp> 30 ml of RNAprotect </Supp> bacterial reagent ( QIAGEN Ltd ) . 
17 _ HF _ <Gtype> HP _ </O> <Gtype> noDP -LSB- COPRO-Seq -RSB- </Gtype> 
18 _ HF _ <Gtype> HP _ </O> <Gtype> noDP -LSB- COPRO-Seq -RSB- </Gtype> 
19 _ HF _ <Gtype> HP _ </O> <Gtype> noDP -LSB- COPRO-Seq -RSB- </Gtype> 
1-butanol was added at a final concentration of 0.9 % ( vol/vol ) and cells were further incubated for <Supp> 30 min </Supp> . 
1 _ HF _ <Gtype> LP _ </O> <Supp> noDP _ </O> <Gtype> noRh -LSB- COPRO-Seq -RSB- </Gtype> 
1 . Holme T , Arvidson S , Lindholm B , and Pavlu B. 1970 . Enzymes : <Gtype> Laboratory-scale production . Process Biochemistry 62-66 . </O> 
1 ml aliquot of culture was transferred to pressure vessel and pressurized at 1MPa for <Supp> 15 min </Supp> 
252978410001 _ B7A _ <Supp> CY5 _ BCE001MS16 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410001 _ B7A _ <Supp> CY5 _ BCE022DS6 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410001 _ B7A _ <Supp> CY5 _ ETP98015 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410001 _ B7A _ <Supp> CY5 _ </O> <Supp> BCE063MS14 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410002 _ B7A _ <Supp> CY5 _ BCE007 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410002 _ B7A _ <Supp> CY5 _ BCE063 _ </O> <Supp> DS4 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410002 _ B7A _ <Supp> CY5 _ ETP98028 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410002 _ B7A _ <Supp> CY5 _ </O> <Supp> BCE041 _ </O> <Supp> MS11 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410003 _ B7A _ <Supp> CY5 _ </O> <Supp> C35662 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410003 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP05 _ 007 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410003 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP05 _ 017 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410003 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP98062 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410004 _ B7A _ <Supp> CY5 _ BCE003 _ </O> <Supp> DS5 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410004 _ B7A _ <Supp> CY5 _ BCE069 _ </O> <Supp> MS9 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410004 _ B7A _ <Supp> CY5 _ BCE129 _ </O> <Supp> DS2 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410004 _ B7A _ <Supp> CY5 _ </O> <Supp> BCE058 _ </O> <Supp> MS13 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410005 _ B7A _ <Supp> CY5 _ BCE013 _ </O> <Supp> DS1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410005 _ B7A _ <Supp> CY5 _ BCE035 _ </O> <Supp> MS8 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410005 _ B7A _ <Supp> CY5 _ BCE039 _ </O> <Supp> DS2 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410005 _ B7A _ <Supp> CY5 _ </O> <Supp> BCE008 _ </O> <Supp> MS13 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410006 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP05 _ 012 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410006 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP05 _ 019 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410006 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP05 _ 026 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410006 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP05 _ 044 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410007 _ B7A _ <Supp> CY5 _ BCE049 _ </O> <Supp> MS9 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410007 _ B7A _ <Supp> CY5 _ </O> <Supp> BCE002 _ </O> <Supp> MS12 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410007 _ B7A _ <Supp> CY5 _ </O> <Supp> BCE021 _ </O> <Supp> DS7 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410007 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP98061 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410008 _ B7A _ <Supp> CY5 _ 180050 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410008 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP98103 _ </O> <Gtype> CY3.mev.refIsIB.ou 
252978410008 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP98111 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410008 _ B7A _ <Supp> CY5 _ </O> <Supp> TW03741 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410009 _ B7A _ <Supp> CY5 _ </O> <Gtype> WS3572A1.mev.refIsIB.out 
252978410009 _ B7A _ <Supp> CY5 _ </O> <Supp> E1787 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410009 _ B7A _ <Supp> CY5 _ </O> <Supp> E747 _ 0 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410009 _ B7A _ <Supp> CY5 _ </O> <Supp> F595C _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410010 _ B7A _ <Supp> CY5 _ 229 _ 1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410010 _ B7A _ <Supp> CY5 _ </O> <Supp> ICDDR _ B _ p13 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410010 _ B7A _ <Supp> CY5 _ </O> <Supp> ICDDR _ B _ p1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410010 _ B7A _ <Supp> CY5 _ </O> <Supp> ICDDR _ B _ p4 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410011 _ B7A _ <Supp> CY5 _ </O> <Supp> DS26 _ 1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410011 _ B7A _ <Supp> CY5 _ </O> <Supp> E1777 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410011 _ B7A _ <Supp> CY5 _ </O> <Supp> E9034A _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410011 _ B7A _ <Supp> CY5 _ </O> <Supp> NN _ 34 _ 1 _ 3 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410012 _ B7A _ <Supp> CY5 _ 42 _ 1 _ C1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410012 _ B7A _ <Supp> CY5 _ </O> <Supp> ETEC _ 18 _ 2 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410012 _ B7A _ <Supp> CY5 _ </O> <Supp> ICDDR _ B _ p12 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410012 _ B7A _ <Supp> CY5 _ </O> <Supp> LSN02 _ 012560 _ A _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410013 _ B7A _ <Supp> CY5 _ 180600 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410013 _ B7A _ <Supp> CY5 _ ETEC _ 10 _ 1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410013 _ B7A _ <Supp> CY5 _ </O> <Supp> TW3574 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410013 _ B7A _ <Supp> CY5 _ TW3585 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410014 _ B7A _ <Supp> CY5 _ </O> <Supp> E20738A _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410014 _ B7A _ <Supp> CY5 _ </O> <Supp> PUTI _ O26 _ </O> <Supp> UMN _ O26 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410014 _ B7A _ <Supp> CY5 _ </O> <Supp> sPRH450 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410015 _ B7A _ <Supp> CY5 _ </O> <Supp> E1392 _ 75 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410015 _ B7A _ <Supp> CY5 _ </O> <Supp> ICDDR _ B _ p5 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410015 _ B7A _ <Supp> CY5 _ </O> <Supp> ICDDR _ B _ p8 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410015 _ B7A _ <Supp> CY5 _ </O> <Supp> sPRH613 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410016 _ B7A _ <Supp> CY5 _ E1785 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410016 _ B7A _ <Supp> CY5 _ ETP98068 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410016 _ B7A _ <Supp> CY5 _ </O> <Supp> D02 _ 2 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410016 _ B7A _ <Supp> CY5 _ </O> <Supp> ICDDR _ B _ p11 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410017 _ B7A _ <Supp> CY5 _ C35776 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410017 _ B7A _ <Supp> CY5 _ ETEC _ JURUA _ 18 _ 11 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410017 _ B7A _ <Supp> CY5 _ </O> <Supp> E1788 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410017 _ B7A _ <Supp> CY5 _ </O> <Supp> ICDDR _ B _ p9 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410018 _ B7A _ <Supp> CY5 _ MG1655 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410018 _ B7A _ <Supp> CY5 _ </O> <Supp> ARG3 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410018 _ B7A _ <Supp> CY5 _ </O> <Supp> E1792 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410018 _ B7A _ <Supp> CY5 _ </O> <Supp> sPRH21 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410019 _ B7A _ <Supp> CY5 _ </O> <Supp> E1786 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410019 _ B7A _ <Supp> CY5 _ </O> <Supp> WS0115A _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410020 _ B7A _ <Supp> CY5 _ 179550 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410020 _ B7A _ <Supp> CY5 _ BCE046 _ </O> <Supp> DS2 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410020 _ B7A _ <Supp> CY5 _ BCE046 _ </O> <Supp> DS7 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410020 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP98114 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410021 _ B7A _ <Supp> CY5 _ 1080200 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410021 _ B7A _ <Supp> CY5 _ </O> <Supp> BCE008 _ </O> <Supp> MS1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410021 _ B7A _ <Supp> CY5 _ </O> <Supp> BCE054 _ </O> <Supp> MS24 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410021 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP05 _ 046 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410022 _ B7A _ <Supp> CY5 _ BCE062 _ </O> <Supp> DS2 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410022 _ B7A _ <Supp> CY5 _ BCE069 _ </O> <Supp> DS2 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410022 _ B7A _ <Supp> CY5 _ ETP98038 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410022 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP98042 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410023 _ B7A _ <Supp> CY5 _ 173150 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410023 _ B7A _ <Supp> CY5 _ 174750 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410023 _ B7A _ <Supp> CY5 _ 178850 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410023 _ B7A _ <Supp> CY5 _ ETP98115 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410024 _ B7A _ <Supp> CY5 _ BCE046 _ </O> <Supp> MS16 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410024 _ B7A _ <Supp> CY5 _ BCE069 _ </O> <Supp> MS15 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410024 _ B7A _ <Supp> CY5 _ </O> <Supp> BCE018 _ </O> <Supp> DS6 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410024 _ B7A _ <Supp> CY5 _ </O> <Supp> BCE019 _ </O> <Supp> MS16 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410025 _ B7A _ <Supp> CY5 _ BCE007 _ </O> <Supp> MS11 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410025 _ B7A _ <Supp> CY5 _ BCE039 _ </O> <Supp> MS13 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410025 _ B7A _ <Supp> CY5 _ C35959 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410025 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP05 _ 050 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410026 _ B7A _ <Supp> CY5 _ </O> <Supp> E24377A _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410026 _ B7A _ <Supp> CY5 _ </O> <Supp> sPRH _ 418 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410026 _ B7A _ <Supp> CY5 _ </O> <Supp> WS1896A _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410026 _ B7A _ <Supp> CY5 _ </O> <Supp> WS2068A _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410027 _ B7A _ <Supp> CY5 _ </O> <Supp> LSN03 _ 016011 _ A _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410027 _ B7A _ <Supp> CY5 _ </O> <Supp> sPRH _ 414 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410027 _ B7A _ <Supp> CY5 _ </O> <Supp> sPRH _ 420 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410027 _ B7A _ <Supp> ETEC20 _ 10 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410028 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP98073 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410028 _ B7A _ <Supp> CY5 _ </O> <Supp> TW3439 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410028 _ B7A _ <Supp> CY5 _ </O> <Supp> TW3576 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410028 _ B7A _ <Supp> CY5 _ </O> <Supp> WS3080A _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410029 _ B7A _ <Supp> CY5 _ </O> <Supp> sPRH _ 403 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410029 _ B7A _ <Supp> CY5 _ </O> <Supp> sPRH _ 443 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410029 _ B7A _ <Supp> CY5 _ </O> <Supp> sPRH _ 604 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410029 _ B7A _ <Supp> CY5 _ </O> <Supp> sPRH _ 606 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410030 _ B7A _ <Supp> CY5 _ C36255 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410030 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP05 _ 008 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410030 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP98105 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410030 _ B7A _ <Supp> ETP98066 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410031 _ B7A _ <Supp> CY5 _ </O> <Supp> BCE054 _ </O> <Supp> DS4 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410031 _ B7A _ <Supp> CY5 _ </O> <Supp> BCE068 _ </O> <Gtype> MS23.mev.refIsIB.out 
252978410031 _ B7A _ <Supp> CY5 _ </O> <Supp> BCE068 _ </O> <Supp> MS10 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410031 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP05 _ 015 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410032 _ B7A _ <Supp> CY5 _ BCE049 _ </O> <Supp> DS3 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410032 _ B7A _ <Supp> CY5 _ BCE062 _ </O> <Supp> MS24 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410032 _ B7A _ <Supp> CY5 _ BCE066 _ </O> <Supp> DS5 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410032 _ B7A _ <Supp> CY5 _ </O> <Supp> BCE011 _ </O> <Supp> DS3 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410033 _ B7A _ <Supp> CY5 _ BCE035 _ </O> <Supp> DS6 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410033 _ B7A _ <Supp> CY5 _ C35209 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410033 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP _ 98004 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410033 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP98056 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410034 _ B7A _ <Supp> CY5 _ BCE005 _ </O> <Supp> MS23 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410034 _ B7A _ <Supp> CY5 _ </O> <Supp> BCE061 _ </O> <Supp> DS1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410034 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP05 _ 038 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410034 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP98053 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410035 _ B7A _ <Supp> CY5 _ BCE055 _ </O> <Supp> DS1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410035 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP05 _ 016 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410035 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP05 _ 020 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410035 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP05 _ 039 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410058 _ B7A _ <Supp> CY5 _ 178900 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410058 _ B7A _ <Supp> CY5 _ 179100 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410058 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP05 _ 009 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410058 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP05 _ 010 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410059 _ B7A _ <Supp> CY5 _ 532 _ WS6866B1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410059 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP05 _ 047 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410059 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP98097 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410059 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP98112 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410060 _ B7A _ <Supp> CY5 _ </O> <Supp> ARG2 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410060 _ B7A _ <Supp> CY5 _ </O> <Supp> C35134 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410060 _ B7A _ <Supp> CY5 _ </O> <Supp> E1791 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410060 _ B7A _ <Supp> CY5 _ WS3596 _ </O> <Supp> A4 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410061 _ B7A _ <Supp> CY5 _ COCAR07 _ 40 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410061 _ B7A _ <Supp> CY5 _ COSIN07 _ 88 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410061 _ B7A _ <Supp> CY5 _ COSIN07 _ 92 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410062 _ B7A _ <Supp> CY5 _ </O> <Supp> DS168 _ 1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410062 _ B7A _ <Supp> CY5 _ </O> <Supp> PE360 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410062 _ B7A _ <Supp> CY5 _ </O> <Supp> WS4087 _ </O> <Supp> A1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410062 _ B7A _ <Supp> CY5 _ WS7179 _ </O> <Supp> A2 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410063 _ B7A _ <Supp> CY5 _ COSIN07 _ 14 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410063 _ B7A _ <Supp> CY5 _ </O> <Supp> B7A _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410063 _ B7A _ <Supp> CY5 _ </O> <Supp> sPRH372 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410063 _ B7A _ <Supp> CY5 _ </O> <Supp> TW3452 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410064 _ B7A _ <Supp> CY5 _ </O> <Supp> E1789 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410064 _ B7A _ <Supp> CY5 _ </O> <Supp> E1790 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410064 _ B7A _ <Supp> CY5 _ </O> <Supp> HS _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410064 _ B7A _ <Supp> CY5 _ </O> <Supp> sPRH609 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410065 _ B7A _ <Supp> CY5 _ 350C1A _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410065 _ B7A _ <Supp> CY5 _ </O> <Supp> E2528 _ </O> <Supp> C1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410065 _ B7A _ <Supp> CY5 _ </O> <Supp> E8775 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410065 _ B7A _ <Supp> CY5 _ </O> <Supp> M424 _ </O> <Supp> C1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410066 _ B7A _ <Supp> CY5 _ 2230 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410066 _ B7A _ <Supp> CY5 _ </O> <Supp> ICDDR _ </O> <Supp> P _ 2 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410066 _ B7A _ <Supp> CY5 _ </O> <Supp> WS1933D _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410066 _ B7A _ <Supp> CY5 _ </O> <Supp> WS6582 _ </O> <Supp> A1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410067 _ B7A _ <Supp> CY5 _ ETEC _ 8 _ 11 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410067 _ B7A _ <Supp> CY5 _ </O> <Supp> B2C _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410067 _ B7A _ <Supp> CY5 _ </O> <Supp> F5656 _ </O> <Supp> C1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410067 _ B7A _ <Supp> CY5 _ </O> <Supp> WS7162 _ </O> <Supp> A1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410068 _ B7A _ <Supp> CY5 _ CFT073 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410068 _ B7A _ <Supp> CY5 _ </O> <Supp> ICDDR _ B _ p _ 10 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410068 _ B7A _ <Supp> CY5 _ </O> <Supp> M408C1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410068 _ B7A _ <Supp> CY5 _ </O> <Supp> WS3294A _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410069 _ B7A _ <Supp> CY5 _ 278485 _ 1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410069 _ B7A _ <Supp> CY5 _ </O> <Supp> sPRH25 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410069 _ B7A _ <Supp> CY5 _ </O> <Supp> sPRH421 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410069 _ B7A _ <Supp> CY5 _ </O> <Supp> sPRH610 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410070 _ B7A _ <Supp> CY5 _ </O> <Supp> ICDDR _ B _ p7 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410070 _ B7A _ <Supp> CY5 _ </O> <Supp> NR _ 12 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410070 _ B7A _ <Supp> CY5 _ </O> <Supp> sPRH20 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410070 _ B7A _ <Supp> CY5 _ </O> <Supp> sPRH612 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410071 _ B7A _ <Supp> CY5 _ 292 _ 1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410071 _ B7A _ <Supp> CY5 _ COSIN07 _ 61 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410071 _ B7A _ <Supp> CY5 _ </O> <Supp> COCAR07 _ 043 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410071 _ B7A _ <Supp> CY5 _ </O> <Supp> O157 _ h7 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410072 _ B7A _ <Supp> CY5 _ COSIN07 _ 36 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410072 _ B7A _ <Supp> CY5 _ </O> <Supp> ICDDR _ B _ p6 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410072 _ B7A _ <Supp> CY5 _ </O> <Supp> O63 _ nm _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410072 _ B7A _ <Supp> CY5 _ </O> <Supp> sPRH605 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410073 _ B7A _ <Supp> CY5 _ 214 _ 4 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410073 _ B7A _ <Supp> CY5 _ </O> <Supp> E7476A _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410073 _ B7A _ <Supp> CY5 _ </O> <Supp> WS2173A _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410073 _ B7A _ <Supp> CY5 _ WS1896 _ </O> <Supp> A1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410075 _ B7A _ <Supp> CY5 _ O78 _ h11 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410075 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP05 _ 011 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410075 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP05 _ 035 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410075 _ B7A _ <Supp> CY5 _ </O> <Supp> sPRH445 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410076 _ B7A _ <Supp> CY5 _ 178200 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410076 _ B7A _ <Supp> CY5 _ C35213 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410076 _ B7A _ <Supp> CY5 _ C35605 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410076 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP98109 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410077 _ B7A _ <Supp> CY5 _ 174900 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410077 _ B7A _ <Supp> CY5 _ C34666 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410077 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP05 _ 002 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410077 _ B7A _ <Supp> CY5 _ </O> <Supp> ETP05 _ 003 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410078 _ B7A _ <Supp> CY5 _ 2 _ 1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410078 _ B7A _ <Supp> CY5 _ </O> <Supp> WS2741 _ </O> <Supp> A1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410078 _ B7A _ <Supp> CY5 _ </O> <Supp> WS4264 _ </O> <Supp> A1 _ </O> <Gtype> CY3.mev.refIsIB.out 
252978410078 _ B7A _ <Supp> CY5 _ </O> <Supp> WS5874 _ </O> <Supp> A1 _ </O> <Gtype> CY3.mev.refIsIB.out 
285c/control vector at <Supp> 30 C 1 </Supp> 
285c/control vector at <Supp> 30 C </Supp> 2 
2 _ HF _ <Gtype> LP _ </O> <Supp> noDP _ </O> <Gtype> noRh -LSB- COPRO-Seq -RSB- </Gtype> 
2 ' RNA Decay of MG1655 ( Repaired NCM 3416 ) in M9 + <Supp> 0.2 % Glucose </Supp> Trial A 
2 ' RNA Decay of MG1655 ( Repaired NCM 3416 ) in M9 + <Supp> 0.2 % Glucose </Supp> Trial B 
2 μg of RNA from the cytoplasmic fraction were diluted in 20 μl of Fragmentation buffer , and fragmented by incubation at 95 °C for 5 minutes . Fragmented RNA was purified using RNA Clean & Concentrator ™ -5 columns . End repair of RNA fragments was performed in a final volume of 20 μl , in the presence of 20 U T4 Polynucleotide Kinase ( NEB , cat . M0201L ) , and 20 U SUPERase • In ™ RNase Inhibitor , by incubation at <Temp> 37 °C </Temp> for 1 hour . End-repaired RNA was purified again using RNA Clean & Concentrator ™ -5 columns , and eluted in 6 μl of nuclease-free water . 6 μl of 2X RNA Loading Dye were added to end-repaired RNA . RNA was heated to 95 °C for 2 minutes , and immediately placed on ice . Samples were resolved on a 10 % TBE-Urea polyacrylamide gel , and a gel slice corresponding to fragments above 200 nt was cut . The gel slice was crushed by centrifugation through a punctured 0.5 ml tube , and resuspended in 500 μl of Diffusion buffer supplemented with 60 U SUPERase • In ™ RNase Inhibitor , then rotated at 4 °C for 16 hours to allow passive diffusion of RNA fragments into buffer . RNA was precipitated by addition of 1 ml Isopropanol , and 2 μl Glycogen ( 20 μg/μl ) , and resuspended in 6 μl nuclease-free water . 10 pmol of a pre-adenylated ( rApp ) adapter were ligated to size-selected RNA fragments in a reaction volume of 20 μl , using 400 U T4 RNA Ligase 2 , Deletion Mutant in the presence of 20 % PEG-8000 , by incubation at 25 °C for 2 hours . Reaction clean-up was performed using RNA Clean & Concentrator ™ -5 columns , and RNA was eluted in 5.5 μl nuclease-free water . RNA was heat-denatured at 70 °C for 5 minutes , and reverse transcription was carried out in a final volume of 10 μl , in the presence of 0.5 mM dNTPs , 5 pmol of RT primer , 20 U RNaseOUT ™ Recombinant Ribonuclease Inhibitor , and 100 U SuperScript ® III Reverse Transcriptase , by incubation at 50 °C for 50 minutes . Template RNA was degraded by adding 1 μl of 1 M NaOH , and incubating at 95 °C for 5 minutes . Reaction clean-up was performed using RNA Clean & Concentrator ™ -5 columns , and cDNA was eluted in 6 μl nuclease-free water . cDNA fragments were resolved on a 10 % TBE-Urea polyacrylamide gel , and a gel slice corresponding to fragments in the range of 40-150 nt was cut ( corresponding to truncated cDNA products ) . DNA was recovered by passive diffusion in Diffusion buffer for <Supp> 16 hours </Supp> at <Temp> 37 °C </Temp> with moderate shaking . cDNA was precipitated by addition of 1 ml Isopropanol , and 2 μl Glycogen ( 20 μg/μl ) , and resuspended in 8.25 μl nuclease-free water . 10 pmol of a 5 ' - phosphorilated adapter were ligated to the 3 ' - OH of cDNA fragments in a final reaction volume of 25 μl , in the presence of 0.05 mM ATP , 20 % PEG-4000 , and 100 U CircLigase ™ II ssDNA Ligase , by incubation at 60 °C for 4 hours , and 68 °C for 2 hours . Adapter-ligated cDNA fragments were purified from excess adapter using 1.8 volumes of Agencourt AMPure XP beads , following manufacturer 's instructions . cDNA was eluted in 20 μl of nuclease-free water , and indexed sequencing adapters were introduced by 15 cycles of PCR in the presence of 25 pmol of each primer , and 25 μl NEBNext ® High-Fidelity 2X PCR Master Mix . 
3a ) . If both channels ( QUERY _ <Supp> MEDIAN _ INTENSITY and REF _ </O> <Supp> MEDIAN _ INTENSITY ) are zero , assign the value . </O> 
3b ) . If one channel is zero and the other is not zero , substitute the zero with one ( 1 ) and then , assign the log2 ratio of QUERY _ MEDIAN _ <Supp> INTENSITY/REF _ </O> <Supp> MEDIAN _ INTENSITY to VALUE </O> 
3c ) . If neither channel is zero , assign the log2 ratio of QUERY _ MEDIAN _ <Supp> INTENSITY/REF _ </O> <Supp> MEDIAN _ INTENSITY to VALUE . </O> 
3C-seq of E. coli fis cells in exponential phase <Temp> 30 °C </Temp> 
3C-seq of E. coli hns cells in exponential phase <Temp> 30 °C </Temp> 
3C-seq of E. coli hupAB cells in <Phase> exponential phase </Phase> <Temp> 37 °C </Temp> 
3C-seq of E. coli hupAB cells in <Phase> exponential phase </Phase> <Temp> 37 °C </Temp> - Replicate 1 
3C-seq of E. coli matP cells in exponential phase <Temp> 30 °C </Temp> 
3C-seq of E. coli matP cells in <Phase> exponential phase </Phase> <Temp> 22 °C </Temp> 
3C-seq of E. coli matPDC20 cells harbouring plasmid pGBM2-5xmatS in exponential phase <Temp> 30 °C </Temp> 
3C-seq of E. coli matPDC20 cells harbouring plasmid pGBM2 in exponential phase <Temp> 30 °C </Temp> 
3C-seq of E. coli matPDC20 cells in exponential phase <Temp> 30 °C </Temp> 
3C-seq of E. coli mukB cells in <Phase> exponential phase </Phase> <Temp> 22 °C </Temp> 
3C-seq of E. coli mukBmatP cells in <Phase> exponential phase </Phase> <Temp> 22 °C </Temp> 
3C-seq of E. coli wt cells harbouring plasmid pGBM2-5xmatS in exponential phase <Temp> 30 °C </Temp> 
3C-seq of E. coli wt cells harbouring plasmid pGBM2 in exponential phase <Temp> 30 °C </Temp> 
3C-seq of E. coli wt cells in exponential phase <Temp> 30 °C </Temp> 
3C-seq of E. coli wt cells in <Phase> exponential phase </Phase> <Temp> 22 °C </Temp> 
3C-seq of E. coli wt cells in <Phase> exponential phase </Phase> <Temp> 37 °C </Temp> 
3C-seq of E. coli wt cells in <Phase> exponential phase </Phase> <Temp> 37 °C </Temp> - Replicate 1 
3C-seq of E. coli zapB cells harbouring plasmid pGBM2-5xmatS in exponential phase <Temp> 30 °C </Temp> 
3C-seq of E. coli zapB cells harbouring plasmid pGBM2 in exponential phase <Temp> 30 °C </Temp> 
3C-seq of E. coli zapB cells in exponential phase <Temp> 30 °C </Temp> 
3 _ HF _ <Gtype> LP _ </O> <Supp> noDP _ </O> <Gtype> noRh -LSB- COPRO-Seq -RSB- </Gtype> 
4 ' RNA Decay of MG1655 ( Repaired NCM 3416 ) in M9 + <Supp> 0.2 % Glucose </Supp> Trial A 
4 ' RNA Decay of MG1655 ( Repaired NCM 3416 ) in M9 + <Supp> 0.2 % Glucose </Supp> Trial B 
500 ng chrom . DNA was digested with 10U of MseI ( NEB ) in 10μL volume for 3h at <Temp> 37 °C </Temp> and heat inactivated for <Supp> 20 min </Supp> at 65 °C . To prepare adapters 100pmol of MseIlong ( AGTGGGATTCCGCATGCTAGT ) and MseIshortnewNo ( TAACTAGCATGC ) were annealed in 8µl ddH2O by heating to 95 °C for 3 min and than cooling to 70 °C and subsequently to 15 °C with 1 °C per min . At 15 °C 10µl MseI digested DNA , 2µl ligase buffer and 400U T4-ligase ( NEB ) were added and ligated over night . Ligase was inactivated at 65 °C for 10 min . One halve of the ligation mix was digested with 20 U DpnI for <Supp> 2h at </O> <Temp> 37 °C </Temp> in a volume of 50µl and the other halve treated similar with water instead of DpnI as control . 5µl of the DNA was amplified in a 50 µl PCR reaction with <Supp> 0.2 mM dNTPs , 0.5 µM </Supp> primer MseIlong , 10µl Phusion HF buffer and 1U Phusion DNA polymerase ( Finnzymes ) with the program 30sec 98 °C , 20x ( 30sec 98 °C , 30 sec 62 °C , 60sec 72 °C ) , 10 min 72 °C . DNA was purified with a Qiagen PCR cleanup kit . 
50 OD600 of bacteria have been grown to the desired growth stage and harvested by centrifugation . They were lysed in 500 µl of the lysis buffer ( 20 mM Tris-HCl , pH7 .5 , 150 mM KCl , 1 mM MgCl2 , 1 mM DTT , 1 mM PMSF , 0.2 % Triton X100 , 20 U/ml DNase I , Thermo Scientific , 200 U/ml SUPERase-IN , Life Technologies ) . Lysis was carried out on a Retsch MM400 machine at 30 Hz for 10 min in the presence of 750 µl 0.1 mm glass beads . The lysate was cleared by centrifugation at 14,000 g at 4 °C for 10 min . The lysate was added 35 µl of monoclonal anti-FLAG M2 antibody ( Sigma , #F1804 ) and rocked for <Supp> 30 min </Supp> at 4 °C . Then 75 µl of pre-washed Protein A sepharose ( Sigma , #P6649 ) were added and the mixture was rocked for additional <Supp> 30 min </Supp> . Afterwards , beads were washed extensively with the lysis buffer , and similar flow-through and wash protein and RNA samples were collected . 
5 _ HF _ <Gtype> LP _ </O> <Supp> noDP _ </O> <Gtype> noRh -LSB- COPRO-Seq -RSB- </Gtype> 
5 ml bacterial cultures with a known inoculum of E. coli cells ( 1.0 × 109 cfu/ml ) was added at 1:1 ( v/v ) to the microemulsion and incubated on a tube rotator at 200 rpm for 4 h at <Temp> 37 °C </Temp> for the subsequent DNA microarray analysis . In the preliminary experiment , a complete loss of E. coli viability was achieved after 8 h by the aforementioned treatment . The prepared microemulsion has an oil phase of glycerol monolaurate ( 5.5 % w/w of the total emulsion ) , ethanol ( 5.5 % ) , and a surfactant phase of Tween 20 ( <Temp> 43 % ) </Temp> . Mixtures of the surfactant-oil phase were prepared in stoppered flasks and kept in a 25 °C water bath . Subsequently , the water phase was added , and the mixture was treated in an ultrasonic bath until the system became optically clear , and allowed to equilibrate at 25 °C for at least 24 h to guarantee steady-state conditions . 
5mL of culture was mixed with 5mL of hot acid phenol : <Supp> chloroform . Samples were held at 65ºC with periodic shaking for at least 10 minutes before centrifuging at 4000 rpm for 20 min . Supernatant was extracted again with acid-phenol : </O> <Supp> chloroform and then with chloroform : isoamyl alcohol ( 24.1 ) . RNA was precipitated overnight at -- 80ºC in 2.5 V 100 % ethanol and 1/10V 3M sodium acetate pH 5.2 . RNA samples were purified and treated with DNase using the Rneasy kit ( Qiagen ) . </O> 
5 ml of the culture was mixed with 1/10V 10 % phenol : ethanol buffer to stabilize the RNA , and centrifuged at 4 oC , 4300 × g for <Supp> 30 min </Supp> to pellet cells . The supernatant was decanted and cell pellets were suspended in 5 ml of buffer ( 2 mM EDTA , 20 mM NaOAc , pH 5.2 ) before mixing with equal volume of hot acid-phenol : <Gtype> chloroform ( pH 4.5 </Gtype> with Iso Amyl Alcohol ( IAA ) , 125:25:1 ) ( Ambion , Austin , TX ) and incubating at 65 oC with periodic shaking for 10 min . The samples were centrifuged at 3220 × g for 20 min and the supernatant was subjected to further extractions with phenol : <Supp> chloroform and chloroform : </O> <Anti> IAA ( 3 ) . RNA was precipitated overnight at -70 oC in 2.5 volume 100 % ethanol and 1/10 volume 3 M sodium acetate pH 5.2 . RNA purification and DNase treatment of RNA samples were done with the Rneasy kit ( Qiagen , Valencia , CA ) and RNA quality was assessed on a formaldehyde-agarose gel . </O> 
6 _ HF _ <Gtype> HP _ </O> <Supp> noDP _ </O> <Gtype> noRh -LSB- COPRO-Seq -RSB- </Gtype> 
6 ' RNA Decay of MG1655 ( Repaired NCM 3416 ) in M9 + <Supp> 0.2 % Glucose </Supp> Trial A 
6 ' RNA Decay of MG1655 ( Repaired NCM 3416 ) in M9 + <Supp> 0.2 % Glucose </Supp> Trial B 
7 _ HF _ <Gtype> HP _ </O> <Supp> noDP _ </O> <Gtype> noRh -LSB- COPRO-Seq -RSB- </Gtype> 
8 ml of the culture was mixed with 1/10V 10 % phenol : ethanol buffer to stabilize the RNA , and centrifuged at 4 oC , 4300 × g for <Supp> 30 min </Supp> to pellet cells . The supernatant was decanted and cell pellets were suspended in 5 ml of buffer ( 2 mM EDTA , 20 mM NaOAc , pH 5.2 ) before mixing with equal volume of hot acid-phenol : <Gtype> chloroform ( pH 4.5 </Gtype> with Iso Amyl Alcohol ( IAA ) , 125:25:1 ) ( Ambion , Austin , TX ) and incubating at 65 oC with periodic shaking for 10 min . The samples were centrifuged at 3220 × g for 20 min and the supernatant was subjected to further extractions with phenol : <Supp> chloroform and chloroform : </O> <Anti> IAA ( 3 ) . RNA was precipitated overnight at -70 oC in 2.5 volume 100 % ethanol and 1/10 volume 3 M sodium acetate pH 5.2 . RNA purification and DNase treatment of RNA samples were done with the Rneasy kit ( Qiagen , Valencia , CA ) and RNA quality was assessed on a formaldehyde-agarose gel . </O> 
8 ' RNA Decay of MG1655 ( Repaired MCM 3416 ) in M9 + <Supp> 0.2 % Glucose </Supp> Trial A 
8 ' RNA Decay of MG1655 ( Repaired NCM 3416 ) in M9 + <Supp> 0.2 % Glucose </Supp> Trial B 
9 _ HF _ <Gtype> HP _ </O> <Supp> noDP _ </O> <Gtype> noRh -LSB- COPRO-Seq -RSB- </Gtype> 
A10 : <Gtype> LJ110 del pdhr MMAcetat </Gtype> 
A11 : <Gtype> LJ110 pTM30 MMAcetat </Gtype> 
A12 : <Gtype> LJ110 pTM30pdhr MMAcetat </Gtype> 
A1 : <Gtype> LJ110 LBo </Gtype> 
A2 : <Gtype> LJ110 del pdhr LBo </Gtype> 
A3 : <Gtype> LJ110 pTM30 LBo </Gtype> 
A4 : <Gtype> LJ110 pTM30pdhr LBo </Gtype> 
A5 : <Gtype> LJ110 MMPyruvat </Gtype> 
A 5 ml overnight culture of E. coli O157 : <Anti> H7 ( Sakai ) was grown in Neidhardt 's EZ Rich Defined Medium for 18 h at 37C . The culture was diluted 1:100 into 50 ml of fresh , prewarmed Neidhardt 's EZ Rich Defined Medium in a 125 ml Ehrlenmeyer flask and shaken at 37C , 150 rpm in a New Brunswick Shaking water bath until the culture density reached 0.4 . Half of the culture was transferred to a second identical flask containing menadione bisulphite to a final concentration of 0.5 mg/ml . The flasks were shaken for a further 10 min before 2 volumes of RNAprotect ( TM ) ( Qiagen Ltd ) were added to stabilise the RNA . This sample corresponds to the culture that was not treated with menadione . Three independent cultures were processed on different occasions to make the 3 replicates used in this study . </O> 
A 5 ml overnight culture of E. coli O157 : <Supp> H7 was grown in Neidhardt 's EZ Rich Defined Medium for 18 h at 37C . The culture was diluted 1:100 into 50 ml of fresh , prewarmed Neidhardt 's EZ Rich Defined Medium in a 125 ml Ehrlenmeyer flask and shaken at 37C , 150 rpm in a New Brunswick Shaking water bath until the culture density reached 0.4 . Half of the culture was transferred to a second identical flask containing menadione bisulphite to a final concentration of 0.5 mg/ml ( this </O> <Temp> sample ) </Temp> . The flasks were shaken for a further 10 min before 2 volumes of RNAprotect ( TM ) ( Qiagen Ltd ) were added to stabilise the RNA . Three independent cultures were processed on different occasions to make the 3 replicates used in this study . 
A 5 ml overnight culture of MG1655 was grown in Neidhardt 's EZ Rich Defined Medium for 18 h at 37C . The culture was diluted 1:100 into 50 ml of fresh , prewarmed Neidhardt 's EZ Rich Defined Medium in a 125 ml Ehrlenmeyer flask and shaken at 37C , 150 rpm in a New Brunswick Shaking water bath until the culture density reached 0.4 . Half of the culture was transferred to a second identical flask containing menadione bisulphite to a final concentration of 0.5 mg/ml ( this <Temp> sample ) </Temp> . The flasks were shaken for a further 10 min before 2 volumes of RNAprotect ( TM ) ( Qiagen Ltd ) were added to stabilise the RNA . Three independent cultures were processed on different occasions to make the 3 replicates used in this study . 
A6 : <Gtype> LJ110 del pdhr MMPyruvat </Gtype> 
A7 : <Gtype> LJ110 pTM30 MMPyruvat </Gtype> 
A8 : <Gtype> LJ110 pTM30pdhr MMPyruvat </Gtype> 
A9 : <Gtype> LJ110 MMAcetat </Gtype> 
accession : <Gversion> NC _ 000913.2 + NC _ 000913.3 </O> 
accession : <Gversion> NC _ 000913.2 + </O> <Supp> NC _ </O> <Technique> 000913.3 
Acid adaptation was done in DMEM at pH 5.0 at room temperature , followed by acid-stress at pH 3.0 for <Supp> 30 minutes </Supp> 
Acid shocking was done in DMEM at pH 3.0 at room temperature for <Supp> 30 minutes </Supp> 
Adaptor Sequences were removed using fastx _ clipper . ( http://hannonlab.cshl.edu/fastx_toolkit/index.html ) - Example : <Supp> fastx _ clipper - a GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATG - i DL4900 _ raw.fasta - o DL4900 _ clipped.fasta </O> 
Add 100 μl 1 mg/ml lysozyme buffer ( TE buffer : <Supp> 10 mM Tris-HCL , 1 mM EDTA </Supp> pH = 8.0 containing 1 mg/ml lysozyme ) . Vortex for 10 s and incubate at RT for at least 15 min . Add 350 μl Buffer RLT and vortex vigorously . Add 250 μl 100 % ethanol , mix by pipetting . 
affyexp _ <Gtype> delta-arcA _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Air> anaerobic 
affyexp _ <Gtype> delta-arcA _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Air> anaerobic _ 1 . CEL </O> 
affyexp _ <Gtype> delta-arcA _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Air> anaerobic _ 2 . CEL </O> 
affyexp _ <Gtype> delta-arcA _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Air> anaerobic _ 3 . CEL </O> 
affyexp _ <Gtype> delta-arcA _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ </O> <Supp> NO3 
affyexp _ <Gtype> delta-arcA _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ </O> <Supp> NO3 _ 1 . CEL </O> 
affyexp _ <Gtype> delta-arcA _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ </O> <Supp> NO3 _ 2 . CEL </O> 
affyexp _ <Gtype> delta-arcA _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ </O> <Supp> NO3 _ 3 . CEL </O> 
affyexp _ <Gtype> delta-fnr _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Air> anaerobic 
affyexp _ <Gtype> delta-fnr _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Air> anaerobic _ 1 . CEL </O> 
affyexp _ <Gtype> delta-fnr _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Air> anaerobic _ 2 . CEL </O> 
affyexp _ <Gtype> delta-fnr _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Air> anaerobic _ 3 . CEL </O> 
affyexp _ <Gtype> delta-fnr _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ </O> <Supp> NO3 
affyexp _ <Gtype> delta-fnr _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ </O> <Supp> NO3 _ 1 . CEL </O> 
affyexp _ <Gtype> delta-fnr _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ </O> <Supp> NO3 _ 2 . CEL </O> 
affyexp _ <Gtype> delta-fnr _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ </O> <Supp> NO3 _ 3 . CEL </O> 
affyexp _ <Gtype> wt _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Air> anaerobic 
affyexp _ <Gtype> wt _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Air> anaerobic _ 1 . CEL </O> 
affyexp _ <Gtype> wt _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Air> anaerobic _ 2 . CEL </O> 
affyexp _ <Gtype> wt _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Air> anaerobic _ 3 . CEL </O> 
affyexp _ <Gtype> wt _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ </O> <Supp> NO3 
affyexp _ <Gtype> wt _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ </O> <Supp> NO3 _ 1 . CEL </O> 
affyexp _ <Gtype> wt _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ </O> <Supp> NO3 _ 2 . CEL </O> 
affyexp _ <Gtype> wt _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ </O> <Supp> NO3 _ 3 . CEL </O> 
Affymetrix . CEL files data were normalized with dChip using the array of median brightness ( BS ) . Model method : model-base expression ; background substraction : <Med> Mismatch Probe ( PM/MM difference ) </Med> 
Affymetrix GeneChip Operating Software ( GCOS ) Version 1.4 Details : <Gtype> Intra-chip normalizations were performed using Affymetrix Gene Chip Operating Software ( GCOS ) . Default statistical parameters were used to normalize each chip to the same target intensity ( 1500 ) as described in the Affymetrix GeneChip Expression Analysis manual . All nine possible inter-chip comparisons were performed in GCOS . The data were subsequently exported to a Microsoft Excel spreadsheet for manipulation . Consensus `` detection p-value '' , `` change p-value '' , and `` signal log ratios '' were calculated , and the default E. coli array p-value cutoff parameters were applied to these consensus values to estimate the transcript change between two conditions and the transcript presence under each condition . Background-subtracted data sets were used to calculate up-regulated and down-regulated genes based on fold changes of greater than 2 . </O> 
After 6 hours of growth both control and test strains were induced with <Supp> 0.5 mM IPTG and harvested 2 hours </Supp> post-induction . 
After reaching an OD600nm of 0.9 , cell cultures were placed immediately in a shaking water bath along with another BHI flask carrying a type T thermocouple connected to a MultiPaq 21 datalogger ( Datapaq Inc. ) for temperature profile and the process lethality values monitoring in real time . Bacteria suspension were heated at 58 °C to process lethality values of 2 and 3 , at 60 °C to a process lethality value of 3 , or until a temperature of 71 °C was reached . Just after heating , cell suspension was cooled in an iced water bath under constant agitation ( 150 rpm ) until the temperature dropped back to no less than <Temp> 37 °C </Temp> in order to avoid cold stress . Cell suspensions were then centrifuged and the remaining cell pellets were treated with RNA protect bacteria reagent ( Qiagen Inc. ) prior to freezing at -80 °C . 
AG102MB is an isogenic mutant derived from hyper-resistant AG102 ( marR1 ) . It contains a mutation at the acrB locus ( marR1 , acrB : <Gtype> : kan </Gtype> ) resulting in a multidrug efflux negative phenotype . 
agent : <Anti> control ( 1 ml of LB broth added ) </O> 
agent : <Anti> ethanol ( 1 ml of ethanol 20 % added ) </O> 
agent : <Anti> no triclosan </Anti> 
agent : <Anti> polyphenols ( 1 ml of OVWPE diluted in ethanol 20 % added ) </O> 
agent : <Gtype> 0.05 mg/ml Phloretin </Gtype> 
agent : <Gtype> 0.5 % honey </Gtype> 
agent : <Gtype> 1x CORM2 </Gtype> 
agent : <Phase> 1x vehicle </Phase> 
agent : <Supp> 20x CORM2 </Supp> 
agent : <Supp> 20x vehicle </Supp> 
agent : <Supp> DPD and rifampicin </Supp> 
agent : <Supp> Fe and </O> <Supp> rifampicin 
agitation speed : <Agit> 1200 rpm </Agit> 
agitation speed : <Agit> 600 rpm </Agit> 
<Air> Aerobic 1 </O> 
<Air> Aerobic 2 </O> 
<Air> Aerobic 3 </O> 
<Air> Aerobic and anaerobic cultures were grown in 600 mL aliquots of DM25 and incubated at </O> <Temp> 37 °C </Temp> with an orbital shaking of 150 RPM and inoculated with 1/100th volume of overnight culture . Aerobic cultures were grown for 9 h while anaerobic cultures were grown for 16 h. 
<Air> Aerobic culture </O> 
<Air> Aerobic Cultures </Air> 
<Air> Aerobic cultures </O> 
<Air> Aerobic Cultures </O> 
<Air> Aerobic E. coli exposed to CO-RMs for 15 minutes </O> 
<Air> Aerobic E. coli not exposed to CO-RMs for 15 minutes ( control cells ) </O> 
<Air> Aerobic growth at </O> <Temp> 37 °C </Temp> in specified media 
<Air> Aerobic MG1655 exposed to CO-RMs for 15 minutes </O> 
<Air> Aerobic MG1655 not exposed to CO-RMs for 15 minutes ( control cells ) </O> 
<Air> Anaerobic 1 </O> 
<Air> Anaerobic 3 </O> 
<Air> Anaerobic cultures </O> 
<Air> Anaerobic Cultures </O> 
<Air> Anaerobic E. coli exposed to CO-RMs for 15 minutes </O> 
<Air> Anaerobic E. coli not exposed to CO-RMs for 15 minutes ( control cells ) </O> 
<Air> Anaerobic E. coli were exposed to CO-RMs for 15 minutes </O> 
<Air> anaerobic INPUT DNA </O> 
<Air> Anaerobic , Iron Deficient cultures </O> 
<Air> Anaerobic MG1655 exposed to CO-RMs for 15 minutes </O> 
<Air> Anaerobic MG1655 not exposed to CO-RMs for 15 minutes ( control cells ) </O> 
<Air> Anaerobic MG1655 were exposed to CO-RMs for 15 minutes </O> 
<Air> Anaerobic , minus nitrate , IP </O> 
<Air> Anaerobic , plus nitrate , IP </O> 
<Air> anaerobic reference </Air> 
Algorithm : <Anti> ExpressionStat 5.0 </Anti> ( Affymetrix Microarray Suite Version 5.0 ) 
alignment : <Gtype> STAR 2.4.0 i </Gtype> 
Alignment , Quantiatino and Normalization , Differential Expression : <Gtype> We used </Gtype> the SPARTA ( version 1 ) software package for alignment , differential expression analysis , and post-analysis diagnostics . SPARTA is an RNA-Seq package specifically designed for bacterial studies . It uses the Bowtie ( version 1.1.1 ) short read aligner , HTSeq ( version 0.6.1 ) to count gene features , and edgeR for differential expression . 
Alignment : reads were mapped to bespoke reference sequence ( DL4201 _ in _ lab _ reference _ genome ( available on series record ) ) using the default parameters of software Bowtie 2 ( Langmead , B. and Salzberg , S.L. ( 2012 ) Fast gapped-read alignment with <Supp> Bowtie 2 . Nat Methods , 9 , 357-359 ) . </O> 
All culture experiments were performed in <Med> MOPS medium </Med> supplemented with <Supp> 0.2 % glucose </Supp> , 19 amino acids ( without methionine ) , vitamins , bases and micronutrients ( MOPS rich defined medium minus methionine , Teknova ) . Cells were grown in an overnight liquid culture at <Temp> 37 °C </Temp> , diluted to an OD420 = .001 in fresh medium and grown until OD420 reached 0.4 where samples were collected . For 10 °C samples , cultures were grown to OD420 = 1.1 at <Temp> 37 °C </Temp> and cold shock was performed by mixing 70mL of <Temp> 37 °C </Temp> culture with 130mL of 0 °C media pre-chilled in ice-water slurry , with continued growth of the culture in a 10 °C shaker . 
All cultures grown up to 0.6 OD600 with shaking at 200 rpm . Samples 1,2,5 and 6 were grown at 30 °C whereas samples 3 and 4 were grown at <Temp> 37 °C </Temp> . 
All cultures were based on MOPS media with <Supp> 0.2 % glucose </Supp> ( Teknova ) , with either full supplement ( Neidhardt et al. , 1974 ) . An overnight liquid culture was diluted 400-fold into 200 ml <Med> fresh media </Med> . The culture was kept in a 2.8-liter flask at 37C with aeration ( 180 rpm ) until OD600 reached 0.3 . 
All cultures were based on MOPS media with <Supp> 0.2 % glucose </Supp> ( Teknova ) , with full supplement ( Neidhardt et al. , 1974 ) minus methionine . An overnight liquid culture was diluted 400-fold into 200 ml <Med> fresh media </Med> . The culture was kept in a 1 liter flask at <Temp> 37 °C </Temp> with aeration until OD420 reached 0.4 . 
All cultures were carried out in a 5 l fermentor BIOSTAT B-DCU ( Sartorius BBI Systems Inc. . Melsungen ) at controlled temperature <Temp> 37 °C </Temp> , pH 7.0 , and dissolved oxygen tension 30 % . The culture volume was 2 l. All reagents were purchased from Sigma-Aldrich , Inc. . The synthetic culture medium had the following composition ( g l-1 ) : 8 , glucose ; 14.6 , K2HPO4 ; 3.6 , NaH2PO4 · H2O ; 2.68 , ( NH4 ) 2SO4 ; 2 , Na2SO4 ; 1 , MgSO4 ; 1 , Na-citrate ; 0.5 , NH4Cl ; 2 ml of 10 mg l-1 of thiamine ; 3 ml of trace element solution ( g l-1 20.0 , Na-EDTA ; 15.0 , FeCl3 · 6H2O ; 0.5 , CaCl2 · 2H2O ; 0.2 , ZnSO4 · 7H2O ; 0.2 , CoCl2 · 6H2O ; 0.2 , CuSO4 · 5H2O ; 0.2 , MnSO4 · 4H2O ) . The chemostat culture was performed with adding feed medium 
All cultures were grown aerobically in a thermostatically controlled 37oC culture room . Cultures ( 150 ml culture volume ) were stirred by magnetic stirrers at 330 rpm ( Thermo Scientific Variomag Multipoint 6in ) 1000 ml Erlenmeyer flask . Starting cultures were inoculated from a single colony and grown overnight . Each experimental culture was then inoculated from such an overnight culture at a dilution of 1:20 into 150 ml <Med> fresh MOPS minimal medium </Med> in a 1000 ml flask . The minimal medium used for all experiments was a modification of <Med> MOPS ( morpholinopropane sulfonate ) minimal medium </Med> obtained from Teknova , CA ( product number M2006 ) which contains 86 mM NaCl , 9.5 mM NH4Cl , 5 mM K2HPO4 and <Supp> 0.2 % glucose </Supp> . 
All cultures were grown at 37C in well-mixed minimal media modified with M63 ( mM63 : <Gtype> pH 7.0 , 62 mM K2HPO4 , 39 mM KH2PO4 , 15 mM ammonium sulfate , </O> <Supp> 1.8 µM FeSO4-7H2O , 15 µM thiamine </Supp> hydrochloride , <Supp> 0.2 mM MgSO4-7H2O and 22 mM glucose </Supp> ) . One amino acid , Ile or Leu , was added to the monoculture medium when appropriate . Prior to coculturing , at both the initial inoculation and transfer , we washed the E. coli cells with fresh mM63 without amino acids to exclude the carry-over of supplements from the pre-culture . For coculture samples , we used cell culture inserts with a pore size of 0.45 µm at a density of 10 ^ 8/cm ^ 2 , and used six-well cell culture companion plates for the inserts ( BD Falcon , Franklin Lakes , NJ , USA ) , to separately harvest I -- and L -- populations from cocultures ( Hosoda et al. , \ Transcriptome Analysis of a Microbial Coculture in which the Cell Populations Are Separated by a Membrane \ , in Engineering and Analyzing Multicellular Systems ( Methods in Molecular Biology ) , vol 1151 , p151 , 2014 ) . We inoculated I -- and L -- cells at the initial concentration of 3x10 ^ 7 cells/mL and 6x10 ^ 5 cells/mL for the cocultures of ancestral ( IA and LA ) and evolved ( IE and LE ) cells , respectively , to adjust the late growth phase in one day . We incubated the coculture for 26 hours and then harvested the cells separately from the above and below the membrane insert . For monoculture samples , the required amino acid was supplied at 1mM , and 0.01 mM for log-phase and starvation cells , respectively . 
All data analysis was performed using Rockhopper ( McClure et al. , 2013 ) and Escherichia coli str . <Strain> K-12 substr . MG1655 as the reference genome . </O> 
All data was processed using Rockhopper Ver .2.03 . Rockhopper is an utomatic \ bacterial RNA-seq analysis tool ; for additional information see : McClure , R. , et al. ( 2013 ) . \ Computational analysis of bacterial RNA-Seq data . \ Nucleic Acids Res 41 ( 14 ) : <Supp> e140 . The default general parameters were used with the erbose output \ tab ticked and the \ orientation of mate-pair reads \ changed to f \ . </O> 
All sequencing reads were mapped to E. coli MG1655 reference genome ( <Gversion> NC _ 000913 </Gversion> ) using CLC Genomics Workbench5 with the length fraction of 0.9 and the similarity of 0.99 . 
All strains used are E. coli K-12 MG1655 and its derivatives . Glycerol stock of the E. coli strain was inoculated into 3 mL Luria broth supplemented with 150 μg kanamycin and cultured overnight at <Temp> 37 °C </Temp> with constant agitation . 
All strains used in this study were E. coli K-12 MG1655 and its derivatives . The deletion mutants ( Δfnr and ΔarcA ) were constructed by a λ red and FLP-mediated site-specific recombination method . Glycerol stocks of E. coli strains were inoculated into M9 minimal medium containing 0.2 % ( w/v ) carbon source ( glucose ) and 0.1 % ( w/v ) nitrogen source ( NH4Cl ) , and cultured overnight at <Temp> 37 °C </Temp> with constant agitation . The cultures were diluted 1:100 into fresh <Med> minimal medium </Med> and then cultured at <Temp> 37 °C </Temp> to an appropriate cell density with constant agitation . For the anaerobic cultures , the minimal medium were flushed with nitrogen and then continuously monitored using a polarographic-dissolved oxygen probe ( Cole-Parmer Instruments ) to ensure anaerobicity . For nitrate respiration <Supp> 20 mmol potassium nitrate </Supp> was added . 
All strains were grown in <Med> M9 minimal media </Med> supplemented with 25 ug/ml streptomycin and <Supp> 0.52 mM arginine </Supp> . Samples were grown to OD = 0.5 @ 30 C ; experimental samples were then transferred to a shaking water bath @ 42 C. 
All strains were grown shaking at <Temp> 37 °C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 
A minimal growth medium as described in the study by Ihssen and Egli ( 2004 ) was used for all experiments . Bacterial stock cultures were streaked onto agar plates and incubated overnight . One colony was then transferred into 20 ml minimal medium , grown at <Temp> 37 °C </Temp> ( 250 r.p.m. ) over night culture ( ONC ) and served as the inoculum for experiments . For continuous culture experiments we designed and constructed 500 ml bioreactors according to the study by Huwiler et al. , ( 2012 ) that were half-filled with medium ( 0.5 g glucose per l ) and incubated at <Temp> 37 °C </Temp> in a temperature controlled water bath . Before continuous cultivation ( dilution rate = 0.25 ) , 1 -- 2 ml of the ONC was transferred and grown in batch-mode until reactors became visibly turbid . Subsequently , cells were grown to steady-state ( defined as constant optical density over time ) and harvested for experimentation . For starvation experiments the medium flow was stopped during steady-state and bacteria were collected after 4 h. To avoid gene-expression signatures of stationary cells from the ONC , batch cultures ( 1000 ml Erlenmeyer flasks containing 100 ml <Med> of pre-warmed medium </Med> ( 1 g glucose per l ) ; <Temp> 37 °C </Temp> ; 250 r.p.m. ) ) were inoculated with 5 ml of an exponentially growing pre-culture that derived from the ONC . 
Ampicilin _ treatment _ plasmidmappedreads _ <Gtype> statistical _ output.txt : </O> <Gversion> NC _ </O> <Technique> 012692.1 
Amp _ Treatment _ genomemappedreads _ <Gtype> statistical _ output.txt : </O> <Gversion> NC _ </O> <Technique> 000913.2 
analysis : <Anti> in vitro </Anti> 
analysis : <Anti> in vivo </Anti> 
An overnight culture of E. coli O104 : <Gtype> H4 strain LB226692 was diluted 1:10,000 in pre-warmed LB medium ( 10 g/L tryptone , 5 g/L yeast extract , 5 g/L NaCl ) and cells were grown at 37oC , 180 rpm for 3.5 h to an OD600 of 0.52 . </O> 
An overnight culture was diluted to an <OD> OD600 of 0.02 </OD> in <Med> LB media </Med> supplemented with 100 µg/ml of carbenicillin , 40 µg/ml biotin , and <Supp> 70 µM IPTG </Supp> . The back diluted culture was grown at <Temp> 37 °C </Temp> until reaching an OD600 of 0.45 . 
Antibodies for beta of RNAP - NeoClone , Cat Number : <Gtype> W0002 , Lot Number : 2008L10-001 </Gtype> Antibodies for sigma70 of RNAP - NeoClone , Cat Number : <Gtype> W0004 , Lot Number : 2008K12-001 </Gtype> All other antibodies ( FNR , H-NS , IHF ) were produced in this study and are not commercially available . 
antibody : <Anti> 9E10 Myc tag </Anti> antibody 
antibody : <Anti> Affinity Purified FNR antibody </Anti> 
antibody : <Anti> Affinity purified FNR polyclonal antibody </Anti> 
antibody : <Anti> anti-DksA rabbit polyclonal antisera </Anti> 
antibody : <Anti> Anti-Dps antibodies </Anti> 
antibody : <Anti> anti-FLAG mAb </Anti> 
antibody : <Anti> anti-s70 monoclonal antibodies </Anti> 
antibody : <Anti> Monoclonal antibody </Anti> for RNA polymerase Beta ' subunit ( NT73 ) 
antibody : <Anti> Monoclonal antibody </Anti> for RNA polymerase Beta subunit ( W0002 ) 
antibody : <Anti> Monoclonal ANTI-FLAG M2 antibody </Anti> ( F3165 ) - Sigma 
antibody : <Anti> None , input DNA </O> 
antibody : <Anti> polyclonal antiserum </Anti> was raised against His6-ArcA then Affinity Purified using purified ArcA to yield the polyclonal antibodies used for ChIP 
antibody : <Anti> Pre-cleared FNR antibody </Anti> 
antibody : <Anti> Pre-cleared H-NS polyclonal antibody </Anti> 
antibody : <Anti> Pre-cleared IHF polyclonal antibody </Anti> 
antibody : <Anti> RNA Polymerase ß monoclonal antibody </Anti> from NeoClone ( W0002 ) 
antibody : <Anti> RNA Polymerase σ70 monoclonal antibody </Anti> from NeoClone ( W0004 ) 
antibody : <Gtype> anti-RNAP b subunit NT63 monoclonal antibodies </O> 
antibody : <Gtype> normal mouse IgG </Gtype> 
antibody : <Gtype> normal mouse IgG ( Upstate ) </Gtype> 
antibody : <Gtype> polycolonal antiserum was raised against His6-ArcA then Affinity Purified against ArcA to yield the polyclonal antibodies used for ChIP </O> 
antibody : <Gtype> rabbit pre-immune IgG </Gtype> 
antibody : <Med> RNAP beta subunit ( NT63 ) </Med> 
antibody vendor/catalog # : <Gtype> Sigma/Cat . No . F1804 </O> 
ArcA - <Air> Aerobic - Affinity Purified - A </O> 
ArcA - <Air> Anaerobic - Affinity Purified - biological rep A </O> 
ArcA - <Air> Anaerobic - Affinity Purified - biological rep B </O> 
ArcA _ <Air> anaerobic _ ChIP-seq _ IP _ A.wig : </O> <Gversion> U00096 .2 </Gversion> 
ArcA _ <Air> anaerobic _ ChIP-seq _ IP _ B.wig : </O> <Gversion> U00096 .2 </Gversion> 
ArgR _ <Supp> Arginine _ 1 </O> 
ArgR _ <Supp> Arginine _ 2 </O> 
ArgR _ <Supp> NH4Cl _ 1 </O> 
ArgR _ <Supp> NH4Cl _ 2 </O> 
At each time point , 15 ml of each culture was mixed with <Supp> 30 ml of RNAprotect </Supp> Bacteria Reagent ( Qiagen ) , vortexed for 5s , incubated for 5 min at room temperature , and centrifuged for 10 min at 5000g . The pellet was processed using a Qiagen RNeasy Midi kit with on-column DNase digestion using Qiagen DNase . The final elution of RNA from the column was with 160 μl RNase-free water . 
At OD ~ 0.3 , cultures were induced with <Supp> 1mM IPTG </Supp> for the appropriate length of time . 
At <OD> OD450 = 0.3 </OD> , cultures induced with <Supp> 1 mM IPTG </Supp> . Cells harvested 0 min after induction 
At <OD> OD450 = 0.3 </OD> , cultures induced with <Supp> 1 mM IPTG </Supp> . Cells harvested 10 min after induction 
At <OD> OD450 = 0.3 </OD> , cultures induced with <Supp> 1 mM IPTG </Supp> . Cells harvested 15 min after induction 
At <OD> OD450 = 0.3 </OD> , cultures induced with <Supp> 1 mM IPTG </Supp> . Cells harvested 20 min after induction 
At <OD> OD450 = 0.3 </OD> , cultures induced with <Supp> 1 mM IPTG </Supp> . Cells harvested 2.5 min after induction 
At <OD> OD450 = 0.3 </OD> , cultures induced with <Supp> 1 mM IPTG </Supp> . Cells harvested 30 min after induction 
At <OD> OD450 = 0.3 </OD> , cultures induced with <Supp> 1 mM IPTG </Supp> . Cells harvested 5 min after induction 
At <OD> OD450 = 0.3 </OD> , cultures induced with <Supp> 1 mM IPTG </Supp> . Cells harvested 60 min after induction 
At <OD> OD600 ~ 0.3 </OD> , serine hydroxamate was added to a final concentration of 0.5 mg/ml , cells were collected 40 minutes later . 
At <OD> OD600 of 0.5 </OD> , cell cultures were separated into two flasks . D-galactose ( final 0.3 % ) was added to one and cells were grown for 1.5 h further . 
A total of six samples were analyzed . oxyR-8myc , soxR-8myc , and soxS-8myc tagged cells were cultured in <Med> M9 minimal media </Med> with <Supp> 0.2 % glucose </Supp> . Then cells were treated with 250 uM of paraquat at mid-log pahse for 20 min with agitation . 
A total of two samples were analyzed . ompR-8myc tagged cells were cultured in <Med> M9 minimal media </Med> with <Supp> 0.2 % glucose </Supp> . Then cells were treated with <Supp> 0.3 M of NaCl </Supp> at mid-log pahse for <Supp> 30 min </Supp> with agitation . 
At time point 0 , <Supp> rifampicin was added to a final concentration of 500ug/ml . Samples were collected at 0 , 2 , 4 , 6 , and 8 minutes . </O> 
AW1 .7 , steady-state continuous cultured experimental samples at <Temp> 37 °C </Temp> 
AW1 .7 , steady-state continuous cultured experimental samples at <Temp> 37 °C </Temp> and then 15 minutes heatshock at 50 °C 
B10 DH10BGFP _ <Supp> pSB1C3 _ 2 </O> 
B10 : <Gtype> LJ110 del pdhr MMAcetat </Gtype> 
B11 : <Gtype> LJ110 pTM30 MMAcetat </Gtype> 
B12 : <Gtype> LJ110 pTM30pdhr MMAcetat </Gtype> 
B17 MG1655GFP _ <Supp> pSB1C3 _ 2 </O> 
B1 : <Gtype> LJ110 LBo </Gtype> 
B22 MG1655GFP _ <Supp> pSB1C3 _ </O> <Supp> H3 _ 2 </O> 
B26 MG1655GFP _ <Supp> Lux _ 2 </O> 
B2 : <Gtype> LJ110 del pdhr LBo </Gtype> 
B3 DH10BGFP _ <Supp> pSB1C3 _ 2 </O> 
B3 : <Gtype> LJ110 pTM30 LBo </Gtype> 
B4 DH10BGFP _ <Supp> pLys _ 2 </O> 
B4 : <Gtype> LJ110 pTM30pdhr LBo </Gtype> 
B5 : <Gtype> LJ110 MMPyruvat </Gtype> 
B6 : <Gtype> LJ110 del pdhr MMPyruvat </Gtype> 
B7 DH10BGFP _ <Supp> pD864 _ 2 </O> 
B7 : <Gtype> LJ110 pTM30 MMPyruvat </Gtype> 
B8 : <Gtype> LJ110 pTM30pdhr MMPyruvat </Gtype> 
B9 DH10BGFP _ <Supp> pLys _ M1 _ 2 </O> 
B9 : <Gtype> LJ110 MMAcetat </Gtype> 
background : <Gtype> crp mutant background , fis flag tag </O> 
background : <Gtype> wild type </Gtype> , crp flag tag 
background : <Gtype> wild type </Gtype> , fis flag tag 
bacteria grown at 37 ° C with shaking until <Phase> log phase </Phase> 
Bacterial cells from an overnight culture were washed and diluted in fresh <Med> SILAC ( stable isotope labeling with amino acids in cell culture ) medium optimized for non-auxotrophic E. coli ( Ping LY et al. . J Proteome Res. , 2013 ) , before incubation at </O> <Temp> 37 °C </Temp> with agitation until reaching an OD600 of approximately 0.3 . 
Bacterial cells were grown aerobically in M9 medium supplemented with <Supp> 0.2 % glucose </Supp> and 5 % LB at <Temp> 37 °C </Temp> under constant shaking ( ~ 120 rpm ) in a water bath and harvested at OD ~ 0.6 . 
Bacterial cells were grown in dYT medium ( Miller , JH ( 1972 ) Experiments in Molecular Genetics ( Cold Spring Harbor Laboratory , Cold Spring Harbor , NY ) supplemented with kanamycin ( 10 mg/L ) , ampicillin ( 100 mg/L ) and IPTG ( 0.1 mM ) at <Temp> 30 °C </Temp> in a shaking water bath . At a turbidity ( measured at OD536 ) of approximately 0.1 bacteria were harvested by centrifugation at ambient temperature and resuspended in fresh <Med> dYT medium </Med> containing antibiotics and 0.2 % arabinose . Growth was continued at 30 °C and 10 hours after inducer shift 3 ml sample were withdrawn , treated with RNAPROTECT ( Qiagen , Ballerup ) , harvested by centrifugation and frozen . 
Bacterial culture with <Supp> 0.2 ppm deoxynivalenol </Supp> 
Bacterial culture with <Supp> 0.2 ppm nivalenol </Supp> 
Bacterial strains were grown in LB . Overnight cultures were diluted 1:100 in fresh LB and grown at <Temp> 37 °C </Temp> with shaking to an OD600 = 0.5 . 
Bacteria were cultured in an M9 minimal medium supplemented with 2 g/L lactose and 5 mM phenylethylamine ( PEA , M9 + L+PEA ) . To induce ECAO expression from tynA gene , o/n culture of wt E. coli in M9-lactose medium was diluted 1:20 in M9 + L+PEA with 5 μM CuSO4 . The bacteria were grown aerobically at +30 °C with <Agit> 250 rpm </Agit> shaking . 
Bacteria were grown at 30C with shaking ( ~ 200 rpm ) in fully supplemented <Med> MOPS glucose media </Med> ( Teknova ) to OD420 ~ 0.4 . Cultures were split into 4 subcultures , and grown to OD ~ 0.3 . 
Bacteria were grown in batch or bioreactor vessels in <Med> M9 minimal media </Med> supplemented with <Supp> 0.4 % glucose </Supp> . 
basal media : <Med> M9 + 4 g/L glc ( glucose minimal media ) </Med> 
Batch anaerobically grown cultures in hemA defined medium , exposed to 100uM CORM-3 for <Supp> 10 min </Supp> 
Batch anaerobically grown cultures in hemA defined medium , exposed to 100uM CORM-3 for <Supp> 120 min </Supp> 
Batch anaerobically grown cultures in hemA defined medium , exposed to 100uM CORM-3 for <Supp> 20 min </Supp> 
Batch anaerobically grown cultures in hemA defined medium , exposed to 100uM CORM-3 for <Supp> 40 min </Supp> 
Batch anaerobically grown cultures in hemA defined medium , exposed to 100uM CORM-3 for <Supp> 60 min </Supp> 
Batch anaerobically grown cultures in hemA defined medium , exposed to 100uM iCORM-3 for <Supp> 10 min </Supp> 
Batch anaerobically grown cultures in hemA defined medium , exposed to 100uM iCORM-3 for <Supp> 120 min </Supp> 
Batch anaerobically grown cultures in hemA defined medium , exposed to 100uM iCORM-3 for <Supp> 20 min </Supp> 
Batch anaerobically grown cultures in hemA defined medium , exposed to 100uM iCORM-3 for <Supp> 40 min </Supp> 
Batch anaerobically grown cultures in hemA defined medium , exposed to 100uM iCORM-3 for <Supp> 60 min </Supp> 
batch culture rep1 <Supp> , 2 min </Supp> 
batch culture rep2 <Supp> , 2 min </Supp> 
batch culture rep3 <Supp> , 2 min </Supp> 
Batch cultures of E. coli MG1655 were grown at <Temp> 37 °C </Temp> with shaking in Luria-Bertani medium ( 0.1 % Bacto Tryptone , 0.05 % yeast extract , 0.05 % NaCl ) . 
biological replicate : <Gtype> t = </Gtype> <Supp> 0 Replicate 1 </Supp> 
biological replicate : <Gtype> t = </Gtype> <Supp> 0 replicate 2 </Supp> 
biological replicate : <Supp> Replicate 1 </Supp> 
biomass collected in the transition between exponential to <Phase> stationary phase </Phase> 
bioremediation treatment : <Med> Alert ( ex situ ) </Med> 
bioremediation treatment : <Med> Eureka ( in situ ) </Med> 
bla _ <Supp> 0 min </Supp> 
bla _ <Supp> 10 min </Supp> 
bla _ <Supp> 15 min </Supp> 
bla _ <Supp> 4 min </Supp> 
bla _ <Supp> 6 min </Supp> 
bla _ <Supp> 8 min </Supp> 
BnTR1 _ <Supp> 37 _ </O> <Phase> rep3 
BnTR1 _ <Supp> 37 _ rep1 </O> 
BnTR1 _ <Supp> 37 _ rep2 </O> 
BnTR1 , <Temp> 37 °C </Temp> , replicate 1 
BnTR1 , <Temp> 37 °C </Temp> , replicate 2 
BnTR1 , <Temp> 37 °C </Temp> , replicate 3 
BRP Induction 45 minutes against <Supp> 30 minutes </Supp> 
B strain _ <Gtype> wild type </Gtype> 
B strain , <Gtype> wild type </Gtype> 
Butanol _ Challenge _ <Gtype> Step _ </O> <Gtype> 1-2 
Butanol _ Challenge _ <Gtype> Step _ </O> <Technique> 1-1 
Butanol _ Challenge _ <Gtype> Step _ </O> <Technique> 1-2 
Butanol _ Challenge _ <Gtype> Step _ </O> <Technique> 2-1 
Butanol _ Challenge _ <Gtype> Step _ </O> <Technique> 2-2 
Butanol _ Challenge _ <Gtype> Step _ </O> <Technique> 3-1 
Butanol _ Challenge _ <Gtype> Step _ </O> <Technique> 3-2 
Butanol _ Challenge _ <Gtype> Step _ </O> <Technique> 4-1 
Butanol _ Challenge _ <Gtype> Step _ </O> <Technique> 4-2 
BW25113 HEPES-glu <Supp> 30 min 4.5 % deoxycholate </Supp> 
BW25113/pCA24N at OD600 = 0.5 LB 37C 2 <Supp> mM IPTG suspension cell </Supp> 
BW25113/pCA24N at OD600 = 0.5 LB 37C <Supp> then 2 mM IPTG </Supp> for 15 min short time suspension cell 
BW25113-pCA24N LB 90 <Supp> min 1 mM IPTG </Supp> 
BW25113/pCA24N-mqsR at OD600 = 0.5 LB 37C 2 <Supp> mM IPTG suspension cell </Supp> 
BW25113/pCA24N-mqsR at OD600 = 0.5 LB 37C <Supp> then 2 mM IPTG </Supp> for 15 min short time suspension cell 
BW25113 ΔmqsRA HEPES-glu <Supp> 30 min 4.5 % deoxycholate </Supp> 
carbon source : <Supp> glycerol + propionate </Supp> 
Caulobacter crescentus and derivatives were grown at <Temp> 30 °C </Temp> in PYE ( Peptone yeast extract ) or LB 
cDNA library of the nascent RNA was constructed according to Churchman and Weissman , Nature 2011 ( PMID : <Temp> 21248844 ) </Temp> . 
Cell cultures were cross linked by addition of 27 µl of formaldehyde ( 37 % ) per ml <Med> medium ( final concentration 1 % ) . Crosslinking was performed at slow shaking ( 100 rpm ) for 20 min followed by quenching with </O> <Supp> 0.2 ml of 2.5 M glycine </Supp> per ml <Med> medium ( final concentration 0.5 M ) . Cells were collected from 15 ml by centrifugation and washed twice with cold TBS ( pH7 .5 ) . The pellet wa resuspended in 300μL TE with 40 μl 10 % SDS and 3 μl 0.5 M EDTA . After incubation for 5 min at 65 °C 750μl isopropanole was added before centrifugation at 15600 rcf for 5 min . The pellet was resuspended in 500μL TE and 3μL RNase A ( 25mg/ml ) was added and incubated for </O> <Supp> 30 min </Supp> at 65 °C . Subsequently , 100μL proteinase K ( 25 mg/ml ) was added and samples incubated at 42 °C for 2 h and 65 °C for 6 h to reverse the crosslink followed by phenol extraction and precipitation with ethanol and Na-acetate . Precipitated DNA was resuspended in 50μL dH2O . 
Cell culture was rapidly filtered in 250 mL increments at <Temp> 37 °C </Temp> over 0.22 μm nitrocellulose filters ( GE ) and frozen in liquid nitrogen to simultaneously halt all transcriptional progress . Frozen cells ( 100 μg ) were pulverized on a Qiagen TissueLyser II mixer mill 6 times at 15 Hz for 3 min in the presence of 500 μL frozen lysis buffer ( 20 mM Tris pH 8 , 0.4 % Triton X-100 , 0.1 % NP-40 , 100 mM NH4Cl , 50 U/mL SUPERase • In ( Ambion ) ) and 1X protease inhibitor cocktail ( Complete , EDTA-free , Roche ) , supplemented with 10 mM MnCl2 . The lysate was resuspended on ice by pipetting . RQ1 DNase I ( 110 U total , Promega ) was added and incubated for 20 min on ice . The reaction was quenched with EDTA ( 25 mM final ) , which releases polysomes from the transcript and reduces contamination from ribosomal RNA and ribosome-associated tRNAs . The lysate was clarified at 4 °C by centrifugation at 20,000 g for 10 min . The lysate was loaded onto a PD MiniTrap G-25 column ( GE Healthcare ) and eluted with lysis buffer supplemented with 1 mM EDTA . Total RNA was purified from the clarified lysate using the miRNeasy kit ( Qiagen ) . 
Cell exposure to NP-TiO2 was conducted in 50 ml of sterile Milli-Q water supplemented with <Supp> 10 mM NaCl </Supp> . Briefly , 500 µl of the E. coli bacterial suspension and 500 µl of the NP-TiO2 stock suspension ( or mQ water for the control ) were prepared as previously described and then added to the NaCl solution to obtain final concentrations of 10E7 cells/ml and 100 mg/l of TiO2 nanoparticles . The flasks were then incubated at 20 °C on a dark rotary shaker ( 150 rpm ) for 5 h. 
Cell pellets ( from initial 50 ml of culture ) were thawed and resuspended in 250ul of IP buffer ( 100 mM Tris pH 8 , 300 mM NaCl , 2 % TritonX-100 ) and sonicated using a microtip sonicator set at 10 % output for 20 second intervals with periods of cooling in between . Cells were then treated for one hour at 4 °C with RNase A ( 2 ng/ml ) micrococcal nuclease ( 50 units ) , <Supp> 20 µM CaCl2 ,1.2 </Supp> mM KCl , 0.3 mM NaCl , 6 mM sucrose , and <Supp> 10 µM DTT </Supp> . After treatment , a distribution of DNA fragments ranging from 200-600 bp was detected by agarose-gel electrophoretic separation of a small sample that was de-crosslinked by incubation at 65 °C for > 4 hr . EDTA was added to 10 mM to stop the micrococcal nuclease and the samples were spun down to remove cell debris . The lysate was then incubated with a 50/50 slurry of Sepharose protein A beads and protein G beads in IP buffer for 2-3 hours at 4 °C . The beads were removed by centrifugation and antibody was added to the pre-cleared lysate for an overnight incubation . The next day , 30 µl of a 50/50 slurry of Sepharose protein A and G beads in IP buffer was added to the lysate to capture antibody-protein-DNA complex for one hour at 4 °C . Beads were then washed once with 1 ml of 250 mM LiCl wash buffer ( 100 mM Tris pH 8 , 250 mM LiCl , 2 % TritonX-100 ) , twice with 600 mM NaCl wash buffer ( 100 mM Tris pH 8 , 600 mM NaCl , 2 % SDS ) , twice with 300 mM NaCl wash buffer ( 100 mM Tris pH 8 , 300 mM NaCl , 2 % SDS ) , and twice with TE . Elution buffer ( 50 mM Tris pH 8 , 10 mM EDTA , 1 % SDS ) was added after the final wash step , and beads were incubated at 65 °C for 30 minutes toremove the crosslinked protein-DNA complexes from the beads . After centrifugation to remove the beads , the samples were incubated overnight at 65 °C to reverse the protein-DNA formaldehyde crosslinks . DNA was purified using Qiagen 's PCR Purification kit and eluted to a final volume of 50ul with EB . 
Cell pellets were lysed and RNA collected using Qiagen 's RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit . RNA samples were then treated with DNase ( New England Biolabs ) for <Supp> 30 min </Supp> at <Temp> 37 °C </Temp> . 
Cells aerobically grown to <Phase> mid-log phase </Phase> in MOPS/0 .5 % glucose at 37C and ~ 250 RPM . 
Cells at appropriate cell density were cross-linked by 1 % formaldehyde at room temperature for 25 min . Following quenching the unused formaldehyde with a final concentration of 125 mM glycine at room temperature for 5 min . The cross-linked cells were harvested and washed three times with 50 mL of ice-cold TBS ( Tris Buffered Saline ) . The washed cells were re-suspended in 0.5 mL lysis buffer composed of 50 mM Tris-HCl ( pH 7.5 ) , 100 mM NaCl , 1 mM EDTA , 1 ug/mL RNaseA , protease inhibitor cocktail ( Sigma ) and 1 kU Ready-LyseTM lysozyme ( Epicentre ) . The cells were incubated at room temperature for <Supp> 30 min </Supp> and then treated with 0.5 mL of 2XIP buffer with the protease inhibitor cocktail . The lysate was then sonicated four times for 20 sec each in an ice bath to fragment the chromatin complexes using Misonix sonicator 3000 ( output level = 2.5 ) . The range of the DNA size resulting from the sonication procedure was 300 -- 1000 bp . 6 uL of mouse antibody ( NT63 , Neoclone ) was used to immunoprecipitate the chromatin complex of RNA polymerase subunit and DNA . For the control ( mock-IP ) , 2 ug of normal mouse IgG ( Upstate ) was added into the cell extract . IP DNAs were purified with QIAquick PCR Purification Kit ( Qiagen ) then amplified PCR . 
Cells at appropriate cell density were cross-linked by 1 % formaldehyde at room temperature for 25 min . Following quenching the unused formaldehyde with a final concentration of 125 mM glycine at room temperature for 5 min . The cross-linked cells were harvested and washed three times with 50 mL of ice-cold TBS ( Tris Buffered Saline ) . The washed cells were re-suspended in 0.5 mL lysis buffer composed of 50 mM Tris-HCl ( pH 7.5 ) , 100 mM NaCl , 1 mM EDTA , 1 ug/mL RNaseA , protease inhibitor cocktail ( Sigma ) and 1 kU Ready-LyseTM lysozyme ( Epicentre ) . The cells were incubated at room temperature for <Supp> 30 min </Supp> and then treated with 0.5 mL of 2XIP buffer with the protease inhibitor cocktail . The lysate was then sonicated four times for 20 sec each in an ice bath to fragment the chromatin complexes using Misonix sonicator 3000 ( output level = 2.5 ) . The range of the DNA size resulting from the sonication procedure was 300 -- 1000 bp . 6 uL of mouse antibody ( NT63 , Neoclone ) was used to immunoprecipitate the chromatin complex of RNA polymerase subunit ( rpoB ) and DNA . For the control ( mock-IP ) , 2 ug of normal mouse IgG ( Upstate ) was added into the cell extract . IP DNAs were purified with QIAquick PCR Purification Kit ( Qiagen ) then amplified PCR . 
Cells at appropriate cell density were cross-linked by 1 % formaldehyde at room temperature for 25 min . Following quenching the unused formaldehyde with a final concentration of 125 mM glycine at room temperature for 5 min . The cross-linked cells were harvested and washed three times with 50 mL of ice-cold TBS ( Tris Buffered Saline ) . The washed cells were re-suspended in 0.5 mL lysis buffer composed of 50 mM Tris-HCl ( pH 7.5 ) , 100 mM NaCl , 1 mM EDTA , 1 ug/mL RNaseA , protease inhibitor cocktail ( Sigma ) and 1 kU Ready-LyseTM lysozyme ( Epicentre ) . The cells were incubated at room temperature for <Supp> 30 min </Supp> and then treated with 0.5 mL of 2XIP buffer with the protease inhibitor cocktail . The lysate was then sonicated four times for 20 sec each in an ice bath to fragment the chromatin complexes using Misonix sonicator 3000 ( output level = 2.5 ) . The range of the DNA size resulting from the sonication procedure was 300 - 1000 bp . For the control ( mock-IP ) , 2 ug of normal mouse IgG was added into the cell extract . IP DNAs were purified with QIAquick PCR Purification Kit ( Qiagen ) then amplified PCR . 
Cells at mid-log phase ( OD600nm 0.5 ) in W2 media supplemented with <Supp> 0.2 % glucose </Supp> and <Supp> 0.2 % glutamine </Supp> 
Cells corresponding to 10 ml culture volume were harvested at 1.5 hrs after induction with <Supp> 0.1 mM IPTG </Supp> using centrifugation . The cell pellet was immediately resuspended in RNAlater ( Ambion , Austin , TX , USA ) and stored at -20 °C until further processing . Prior to RNA extraction using MasterPure RNA purification kit ( Epicentre , Madison , WI , USA ) the pellet was washed in cold phosphate-buffered saline to remove RNAlater . 
Cells corresponding to 10 ml culture volume were harvested at 1.5 hrs after induction with <Supp> 0 mM IPTG </Supp> using centrifugation . The cell pellet was immediately resuspended in RNAlater ( Ambion , Austin , TX , USA ) and stored at -20 °C until further processing . Prior to RNA extraction using MasterPure RNA purification kit ( Epicentre , Madison , WI , USA ) the pellet was washed in cold phosphate-buffered saline to remove RNAlater . 
Cells corresponding to 10 ml culture volume were harvested at 1.5 hrs after induction with <Supp> 1.0 mM IPTG </Supp> using centrifugation . The cell pellet was immediately resuspended in RNAlater ( Ambion , Austin , TX , USA ) and stored at -20 °C until further processing . Prior to RNA extraction using MasterPure RNA purification kit ( Epicentre , Madison , WI , USA ) the pellet was washed in cold phosphate-buffered saline to remove RNAlater . 
Cells corresponding to 10 ml culture volume were harvested at 3.5 hrs after induction with <Supp> 0.1 mM IPTG </Supp> using centrifugation . The cell pellet was immediately resuspended in RNAlater ( Ambion , Austin , TX , USA ) and stored at -20 °C until further processing . Prior to RNA extraction using MasterPure RNA purification kit ( Epicentre , Madison , WI , USA ) the pellet was washed in cold phosphate-buffered saline to remove RNAlater . 
Cells corresponding to 10 ml culture volume were harvested at 3.5 hrs after induction with <Supp> 0 mM IPTG </Supp> using centrifugation . The cell pellet was immediately resuspended in RNAlater ( Ambion , Austin , TX , USA ) and stored at -20 °C until further processing . Prior to RNA extraction using MasterPure RNA purification kit ( Epicentre , Madison , WI , USA ) the pellet was washed in cold phosphate-buffered saline to remove RNAlater . 
Cells corresponding to 10 ml culture volume were harvested at 3.5 hrs after induction with <Supp> 1.0 mM IPTG </Supp> using centrifugation . The cell pellet was immediately resuspended in RNAlater ( Ambion , Austin , TX , USA ) and stored at -20 °C until further processing . Prior to RNA extraction using MasterPure RNA purification kit ( Epicentre , Madison , WI , USA ) the pellet was washed in cold phosphate-buffered saline to remove RNAlater . 
Cells for inoculation were from overnight planktonic culture in 10 % Luria-Bertani broth at 30 degree Celsius . Cells were washed in equal volume of fresh 10 % LB broth before inoculated into 30 ml 10 % LB in a flask . 300 ul E. coli culture was inoculated for mono-species pure culture . 150 ul E. coli and 60 ul S. maltophilia were mixed and inoculated for mixed-species cultures . Flasks were set on a shaker ( <Agit> 250 rpm </Agit> ) at room temperature ( 20 C ) for 18 h. 
Cells for inoculation were from overnight planktonic culture in 10 % Luria-Bertani broth at 30 degree Celsius . Cells were washed in equal volume of fresh 10 % LB broth before inoculation . Planktonic cultures were conducted in flasks with 30 ml 10 % LB , inoculated with 300 ul E. coli overnight culture . Flasks were set on a shaker ( <Agit> 250 rpm </Agit> ) at room temperature ( 20 C ) for 18 h. Biofilms were cultivated in static disposable petri dishes ( 60 mm x 15 mm ) with 5 ml 10 % LB , inoculated with 50 ul E. coli overnight culture . The petri dishes were set static at room temperature ( 20 C ) for 18 h. 
Cells grew in <Med> MOPS minimal medium </Med> with <Supp> 0.4 % glucose </Supp> and 0.2 mM K2HPO4 and harvested at the OD600 value of 1.0 . 
Cells harvested at <OD> OD450 = 0.3 </OD> 
Cells used for expression analysis were grown in <Med> minimal medium </Med> ( Glansdorff , 1965 ) supplemented with 0.5 % glucose ( w/v ) , L-methionine ( 100 mg ml-1 ) and with L-arginine ( 100ug ml-1 ) . For expression analysis , cells were grown in a rotary shaker at <Temp> 37 °C </Temp> and harvested by centrifugation at mid-log phase ( ( OD ) 660nm = 0.5 ) and the metabolism was quenched in liquid nitrogen . 
Cells used for expression analysis were grown in <Med> minimal medium </Med> ( Glansdorff , 1965 ) supplemented with 0.5 % glucose ( w/v ) , L-methionine ( 100ug ml-1 ) and with L-arginine ( 100ug ml-1 ) . For expression analysis , cells were grown in a rotary shaker at <Temp> 37 °C </Temp> and harvested by centrifugation at mid-log phase ( ( OD ) 660nm = 0.5 ) and the metabolism was quenched in liquid nitrogen . 
Cells used for expression analysis were grown in <Med> minimal medium </Med> ( Glansdorff , 1965 ) supplemented with 0.5 % glucose ( w/v ) , L-methionine ( 100ug ml-1 ) . For expression analysis , cells were grown in a rotary shaker at <Temp> 37 °C </Temp> and harvested by centrifugation at mid-log phase ( ( OD ) 660nm = 0.5 ) and the metabolism was quenched in liquid nitrogen . 
Cell suspension was ammended with <Supp> 1.37 M NaCl </Supp> to obtain an osmotic pressure of 2.7 Os kg-1 for 10 minutes . The biomass was centrifuged at 4000 rpm and the pellet treated with RNAProtect ( Qiagen ) following the manufacturer 's protocol . 
Cells were cross-linked by the addition of formaldehyde at 1 % final concentration with continued shaking at <Temp> 37 °C </Temp> for 5 min before quenching with glycine ( 100 mM final ) . 
Cells were enyzmatically lysed in the presence of protease inhibitors prior to fragmentation using sonication . Protein/DNA complexes were recovered using an appropriate mouse monoclonal antibody followed by recovery using Pan Mouse IgG Dynabeads . While complexed on the magnetic bead , a series of enzymatic reactions were performed to 1 ) end repair , fragmented DNA , 2 ) ligate sequencing adpator 2 , 3 ) nick repair , 4 ) lambda exonuclease treatment , 5 ) RecJ nuclease treatment . This was based on the method developed by Rhee et al. ( doi : <Gtype> 10.1016 / j.cell .2011.11.013 </Gtype> ) . IP DNA was then rleased from the complex and recovered . 
Cells were grown <Air> aerobically ( 25 % O2 , 70 % N2 and 5 % CO2 ) </Air> until <Phase> mid-log phase </Phase> ( <OD> OD600 of 0.35 </OD> ) and treated with 1 % final volumen formaldehyde for ten minutes . Sodium phosphate ( 1/100 vol . of 1M , pH 7.6 ; 10 mM final ) was added to the mid-log cultures followed by formaldehyde to 1 % final , and anaerobic sparging was continued for 10 min . Cold 2.5 M glycine was added to 100mM and the mixture was incubated at 4 °C with anaerobic sparging for 30 minutes to stop the crosslinking . Cells were spun at 5000 x g , and washed repeatedly with phosphate buffered saline before being frozen at -80 °C . 
Cells were grown <Air> aerobically ( 70 % N2 , 25 % O2 , and 5 % CO2 ) </Air> or anaerobically ( 95 % N2 and 5 % CO2 ) until <Phase> mid-log phase </Phase> ( <OD> OD600 of ~ 0.3-0.35 </OD> ) . 
Cells were grown <Air> aerobically ( 70 % N2 , 25 % O2 , and 5 % CO2 ) </Air> or anaerobically ( 95 % N2 and 5 % CO2 ) until <Phase> mid-log phase </Phase> ( <OD> OD600 of ~ 0.3-0.35 </OD> <Med> ) in MOPS minimal glucose media </Med> containing <Supp> 10 µM FeSO4 </Supp> . 
Cells were grown anaerobically ( 95 % N2 and 5 % CO2 ) until <Phase> mid-log phase </Phase> ( <OD> OD600 of 0.3 </OD> ) and treated with 1 % final volumen formaldehyde for ten minutes . Sodium phosphate ( 1/100 vol . of 1M , pH 7.6 ; 10 mM final ) was added to the mid-log cultures followed by formaldehyde to 1 % final , and anaerobic sparging was continued for 10 min . Cold 2.5 M glycine was added to 100mM and the mixture was incubated at 4 °C with anaerobic sparging for 30 minutes to stop the crosslinking . Cells were spun at 5000 x g , and washed repeatedly with phosphate buffered saline before being frozen at -80 °C . 
Cells were grown at 30 °C to an <OD> OD450 of about 0.07 </OD> in AB glucose CAA medium , shifted to 39 °C for 70 min and back to 30 °C for 0 min before crosslinking . 
Cells were grown at 30 °C to an <OD> OD450 of about 0.07 </OD> in AB glucose CAA medium , shifted to 39 °C for 70 min and back to 30 °C for 15 min before crosslinking . 
Cells were grown at 30 °C to an <OD> OD450 of about 0.07 </OD> in AB glucose CAA medium , shifted to 39 °C for 70 min and back to 30 °C for 16 min before crosslinking . 
Cells were grown at 30 °C to an <OD> OD450 of about 0.07 </OD> in AB glucose CAA medium , shifted to 39 °C for 70 min and back to 30 °C for 17 min before crosslinking . 
Cells were grown at 30 °C to an <OD> OD450 of about 0.07 </OD> in AB glucose CAA medium , shifted to 39 °C for 70 min and back to 30 °C for 35 min before crosslinking . 
Cells were grown at 30 °C to an <OD> OD450 of about 0.07 </OD> in AB glucose CAA medium , shifted to 39 °C for 70 min and back to 30 °C for 50 min before crosslinking . 
Cells were grown at 30 °C to an <OD> OD450 of about 0.07 </OD> in AB glucose CAA medium , shifted to 39 °C for 70 min and back to 30 °C for 5 min before crosslinking . 
Cells were grown at 37oC without shaking in 18 mm test tubes containing 5 ml of the MOPS-based culture medium designed by Neidhardt . Mouse cecal mucus was prepared from streptomycin-treated CD-1 mice ( not colonized with E. coli ) . Cultures were grown to <Med> A600 = 0.4 in MOPS medium </Med> containing glucose or mannose ( 0.2 % ) and also in 10 mg/ml of lyophilized mucus at A600 = 0.2 ( P1 ) or 0.5 ( P2 ) . 
Cells were grown at <Temp> 30 °C </Temp> in LB medium to an <OD> OD600 of 0.55-0.6 </OD> 
Cells were grown at <Temp> 37 °C </Temp> , 200 rpm in M9 glucose , for 16 hours ( stationary phase ) . 
Cells were grown at <Temp> 37 °C </Temp> in M4 minimal medium under oxic and anoxic conditions . <Med> The minimal medium </Med> ( 1.27 mM K2HPO4 , 0.73 mM KH2PO4 , 5 mM sodium HEPES , 150 mM NaCl , 9 mM ( NH4 ) 2SO4 ) was supplemented with <Supp> 0.1 g/l caseinhydrolysate 1 mM MgSO4 , 0.1 mM CaCl2 </Supp> and trace elements ( 5 μM CoCl2 , 0.2 μM CuSO4 , 57 μM H3BO3 , 5.4 μM FeCl2 , 1.3 μM MnSO4 , 67.2 μM Na2EDTA , 3.9 μM Na2MoO4 , 1.5 μM Na2SeO4 , 5 μM NiCl2 , and 1 μM ZnSO4 ) . The pH of the media was adjusted to 7.2 . Glycerol ( 50 mM ) or glycerol ( 50mM ) plus propionate ( 10 mM ) served as the carbon and electron sources , respectively . Potassium nitrate ( 50 mM ) was the electron acceptor under anoxic conditions . 
Cells were grown at <Temp> 37 °C </Temp> in <Med> Luria-Bertani ( LB ) medium </Med> containing 50 μg/ml ampicillin overnight , then diluted at a ratio of 1:100 into LB medium containing 1.5 % ( v/v ) ethanol and 50 μg/ml ampicillin , and grown at <Temp> 37 °C </Temp> . 
Cells were grown at <Temp> 37 °C </Temp> in <Med> Luria-Bertani ( LB ) medium </Med> supplemented with 50 μg/ml ampicillin overnight , then inoculated into LB medium supplemented with 0.095 % ( v/v ) furfural and 50 μg/ml ampicillin at an initial OD600 value of 0.02 , and grown at <Temp> 37 °C </Temp> . 
Cells were grown at <Temp> 37 °C </Temp> to an <OD> OD450 of about 0.15 </OD> in 100 ml AB acetate medium before crosslinking . 
Cells were grown at <Temp> 37 °C </Temp> to an <OD> OD600 of about 0.15 </OD> in 100 ml <Med> LB ( + </O> <Supp> 0.2 % glucose </Supp> ) . 
Cells were grown at <Temp> 37 °C </Temp> to an <OD> OD600 of about 0.15 </OD> in 50 ml <Med> LB ( + </O> <Supp> 0.2 % glucose </Supp> ) before crosslinking . 
Cells were grown in 65 ml LB medium at 30 °C to an <OD> OD600 of about 0.3 </OD> . Subsequently 30 ml of culture were transformed to a pre warmed <Vess> flask at </O> <Temp> 43 °C ( see heat sample ) </Temp> and the remainder kept at <Temp> 30 °C </Temp> . 
Cells were grown in 65 ml LB medium at 30 °C to an <OD> OD600 of about 0.3 </OD> . Subsequently 30 ml of culture were transformed to a pre warmed <Vess> flask at </O> <Temp> 43 °C </Temp> and the remainder kept at <Temp> 30 °C ( see control sample ) </Temp> . 
Cells were grown in a 250 ml fermenter containing 100 ml LB medium supplemented with 3 g/L glucose , <Supp> 0.1 mM IPTG , </Supp> and 50 μg/mL antibiotics . The fermentors were operated at <Temp> 37 °C </Temp> and <Agit> 250 rpm </Agit> with aeration ( 200 mL/min ) . Flow rate was 1.162 ml/min ( dilution rate 0,7 / h ) . The pellets were used for RNA . 
Cells were grown in anaerobic incubator for 1h at 37 ℃ and drugs were added according to the different concentrations . The cultures were incubated for <Supp> 30 min </Supp> . 
Cells were grown in LB at 22 °C or <Temp> 37 °C </Temp> , as indicated . 
Cells were grown in Luria Bertani ( <Med> LB ) media </Med> at 37C at 200 rpm . Overnight cultures were inoculated with single , independent colonies in triplicate , incubated <Air> aerobically overnight </Air> at 37oC , and sub-cultured to a starting OD600 of 0.0001 . Cultures were harvested at <OD> OD600 = 0.3 </OD> in exponential phase and at OD600 = 1.5 in stationary phase . 
Cells were grown in M9 medium supplemented with <Supp> 0.2 % glucose </Supp> and 0.4 % casamino acid at <Temp> 37 ℃ </Temp> 
Cells were grown in <Med> LB media </Med> supplemented with <Supp> 0.2 % arabinose </Supp> at <Temp> 37 °C </Temp> to and OD600nm of 0.2-0.25 
Cells were grown in <Med> LB media </Med> with <Supp> 1mM IPTG </Supp> at <Temp> 37 °C </Temp> with shaking for <Supp> 2 hours </Supp> 
Cells were grown in <Med> M63 glucose ( 0.2 % ) minimal media </Med> at 37oC at 200 rpm . Overnight cultures were inoculated with single , independent colonies in triplicate , incubated <Air> aerobically overnight </Air> at 37oC , and sub-cultured to a starting OD600 of 0.0001 . Cultures were harvested at an OD600 = 0.3 after being maintained in exponential phase for at least eight generations . 
Cells were grown in <Med> M63 glucose ( 0.2 % ) minimal media </Med> at 37oC at 200 rpm . Overnight cultures were inoculated with single , independent colonies in triplicate , incubated <Air> aerobically overnight </Air> at 37oC , and sub-cultured to a starting OD600 of 0.0001 . Cultures were harvested at an OD600 = 1.5 . 
Cells were grown in <Med> M9 minimal media </Med> supplemented with 0.2 % casamino acids , 0.5 % glucose 5μM CaCl2 and 1mM MgSO4 at <Temp> 37 °C </Temp> to and OD600nm of 0.2-0.25 
Cells were grown in <Med> MOPS minimal medium </Med> with <Supp> 0.2 % glucose </Supp> at 37 degrees C in gas-sparged Roux bottles to mid-log phase . 
Cells were grown in <Med> MOPS minimal medium </Med> with <Supp> 0.2 % glucose </Supp> at <Temp> 37 oC </Temp> in gas-sparged Roux bottles or shaking flasks to <Phase> mid-log phase </Phase> ( OD600 ~ 0.3-0.4 ) . 
Cells were grown in shake flasks to mid-exponential phase under either aerobic or anaerobic conditions depending on the sample . <Med> M9 minimal media </Med> supplement with either glucose , fructose , or glycerol as the sole carbon source was used depending on the sample . 
Cells were grown in TB7 supplemented with <Supp> 22 mM glucose </Supp> until OD600 ~ 1.8 . 
Cells were grown to an OD of 0.4 and then <Supp> 0.5 mM IPTG </Supp> was added to induce the protein expression 
Cells were grown with <Supp> 16 µM IPTG and 300 µL Cm20 </Supp> <Air> anaerobically ( 95 % N2 and 5 % CO2 ) </Air> until <Phase> mid-log phase </Phase> ( <OD> OD600 of 0.3 </OD> ) and treated with 1 % final volumen formaldehyde for ten minutes . Sodium phosphate ( 1/100 vol . of 1M , pH 7.6 ; 10 mM final ) was added to the mid-log cultures followed by formaldehyde to 1 % final , and anaerobic sparging was continued for 10 min . Cold 2.5 M glycine was added to 100mM and the mixture was incubated at 4 °C with anaerobic sparging for 30 minutes to stop the crosslinking . Cells were spun at 5000 x g , and washed repeatedly with phosphate buffered saline before being frozen at -80 °C . 
Cells were grown with <Supp> 4 µM IPTG and 300 µL Cm20 </Supp> <Air> anaerobically ( 95 % N2 and 5 % CO2 ) </Air> until <Phase> mid-log phase </Phase> ( <OD> OD600 of 0.3 </OD> ) and treated with 1 % final volumen formaldehyde for ten minutes . Sodium phosphate ( 1/100 vol . of 1M , pH 7.6 ; 10 mM final ) was added to the mid-log cultures followed by formaldehyde to 1 % final , and anaerobic sparging was continued for 10 min . Cold 2.5 M glycine was added to 100mM and the mixture was incubated at 4 °C with anaerobic sparging for 30 minutes to stop the crosslinking . Cells were spun at 5000 x g , and washed repeatedly with phosphate buffered saline before being frozen at -80 °C . 
Cells were grown with <Supp> 8 µM IPTG and 300 µL Cm20 </Supp> <Air> anaerobically ( 95 % N2 and 5 % CO2 ) </Air> until <Phase> mid-log phase </Phase> ( <OD> OD600 of 0.3 </OD> ) and treated with 1 % final volumen formaldehyde for ten minutes . Sodium phosphate ( 1/100 vol . of 1M , pH 7.6 ; 10 mM final ) was added to the mid-log cultures followed by formaldehyde to 1 % final , and anaerobic sparging was continued for 10 min . Cold 2.5 M glycine was added to 100mM and the mixture was incubated at 4 °C with anaerobic sparging for 30 minutes to stop the crosslinking . Cells were spun at 5000 x g , and washed repeatedly with phosphate buffered saline before being frozen at -80 °C . 
Cells were grown with vigorous shaking at <Temp> 37 °C </Temp> to <Phase> mid-log ( light scattering at 600 nm equivalent to 0.4 OD ) . Sodium phosphate ( 1/100 vol . of 1M , pH 7.6 ; 10 mM final ) was added to the mid-log cultures followed by formaldehyde to 1 % final , and shaking was continued for 5 min . Cold 2.5 M glycine was added to 100mM and the mixture was incubated at 4 °C with agitation for 30 minutes to stop the crosslinking . Cells were spun at 5000 x g , and washed repeatedly with phosphate buffered saline before being frozen at -80 °C . </O> 
Cells were resuspended in Lysis buffer ( 10mM tris , 20 % sucrose , 50mM NaCl , 10mM EDTA , 10mg/ml lysosyme , 0.1 mg/ml EDTA , 0.1 mg/ml RNaseA ) and subsequently incubated for <Supp> 30 min </Supp> at 37C . Next , IP buffer was added ( 50mM Hepes , 150mM NaCl , 1mM EDTA , 1 % triton , 0.1 % sodium deoxycholate , 0.1 % SDS ) . Cells have been sonicated , centrifugated , and the supernatent was used for the immunoprecipitation . 
Cells were then lysed with <Supp> 0.2 µM of lysozyme </Supp> in TE ( 10 mM Tris-Cl , 1 mM EDTA , pH 8.0 ) for 5 min at room temperature , and total RNA was extracted using the RNeasy Mini Kit ( Qiagen ) . DNA contamination was eliminated by treatment with TURBO DNase ( Thermo Fisher ) . Depletion of ribosomal RNA was accomplished with the Ribominus Transcriptome Isolation Kit ( Thermo Fisher ) followed by ethanol precipitation . 
Cells were then placed on ice and RNAprotect ™ bacteria reagent ( Qiagen ) was added to stabilize the RNA . Total RNAs of cells were purified by RNeasy mini kit ( Qiagen ) . Isolated RNA ( 10 ug ) was used for random primer cDNA synthesis using SuperScript II reverse transcriptase , 18064 -- 071 ( Invitrogen ) . The reaction mixture was then subsequently treated with 1 N NaOH to degrade any remaining RNA and treated with 1 N HCl to neutralize the NaOH . Synthesized cDNA was then purified using MiniElute PCR purification columns , 28004 ( Qiagen ) . Purified cDNA ( 3 ug ) was fragmented to between 50 and 200 bps by 0.6 U / g of DNase I , 27 -- 0514-01 ( Amersham Biosciences ) for 10 min at <Temp> 37 °C </Temp> in 1 One-Phor-All buffer , 27 -- 0901-02 ( Amersham Biosciences ) . Heat inactivation of the DNase I enzyme was performed at 98 °C for 10 min . 
Cells were transferred to the <Med> fresh minimal media </Med> , mM63 , in the presence or absence of histidine . The initial cell concentrations were controlled as 104-105 cells/mL , and the final ones ~ 108 cells/mL within the exponential growth phase . 
Cells were treated with <Supp> rifampicin before sample collection . In some cases , kasugamycin was added 15 minutes before the rifampicin addition . </O> 
CFT073 + <Supp> pBAD rep 1 </Supp> 
CFT073 + <Supp> pBAD rep </Supp> 2 
CFT073 + <Supp> pBAD-tosR rep 1 </Supp> 
CFT073 + <Supp> pBAD-tosR rep </Supp> 2 
Cfx _ IN _ Mu _ <Gtype> 10mkM _ 1 </O> 
Cfx _ IN _ Mu _ <Gtype> 10mkM _ 2 </O> 
Cfx _ IN _ <Supp> 10mkM _ 3 </O> 
Cfx _ IP _ Mu _ <Gtype> 10mkM _ 1 </O> 
Cfx _ IP _ Mu _ <Gtype> 10mkM _ 2 </O> 
chip antibody : <Anti> 9E10 Myc tag </Anti> antibody 
chip antibody : <Anti> anti-c-myc antibody </Anti> 
chip antibody : <Anti> anti-FecI antibody </Anti> 
chip antibody : <Anti> anti-FLAG antibody </Anti> ( Sigma Cat # : <Gtype> F3165-1MG ) </Gtype> 
chip antibody : <Anti> Anti-FLAG ( sigma-aldrich cat no F3165 ) </O> 
chip antibody : <Anti> anti-myc ( Santa Cruz Biotech , sc-28207 ) </O> 
chip antibody : <Anti> anti-RecA antibody </Anti> 
chip antibody : <Anti> anti-RpoB antibody </Anti> 
chip antibody : <Anti> anti-RpoB ( Neoclone , WP002 ) </O> 
chip antibody : <Anti> anti-rpoB ( Santa Cruz Biotech , sc-56766 ) </O> 
chip antibody : <Anti> anti-RpoD antibody </Anti> 
chip antibody : <Anti> anti-RpoF antibody </Anti> 
chip antibody : <Anti> anti-RpoN antibody </Anti> 
chip antibody : <Anti> anti-RpoS antibody </Anti> 
chip antibody : <Anti> anti-RpoS ( neoclone , WP009 ) </O> 
chip antibody : <Anti> biotin conjugated anti-c-myc antibody </Anti> 
chip antibody : <Anti> c-Myc Antibody </Anti> ( 9E10 ) , Santa Cruz Biotech , sc-40 
chip antibody : <Anti> Custom anti-Fur polyclonal antibody </Anti> 
chip antibody : <Anti> FLAG antibody </Anti> 
chip antibody : <Anti> Monoclonal anti-FLAG antibody , Murine IgG </Anti> 
chip antibody : <Anti> Monoclonal ANTI-FLAG M5 </Anti> ( Sigma-Aldrich , catalog number : <Gtype> F4042 ) </Gtype> 
chip antibody : <Anti> none , input </Anti> 
chip antibody : <Anti> normal rabbit IgG </Anti> ( Upstate Biotechnology , Cat . no. 12-370 ) 
chip antibody : <Anti> RNAP beta subunit antibody </Anti> 
chip antibody : <Anti> RNA polymerase subunit β </Anti> 
chip antibody : <Anti> RpoS ( Neoclone cat . no . WP009 ) </O> 
chip antibody : <Gtype> antiFlag M2 </Gtype> 
chip antibody : <Gtype> HRP-conjugated sheep anti-mouse IgG </Gtype> 
chip antibody : <Gtype> normal mouse IgG ( Upstate ) </Gtype> 
chip antibody manufacturer/lot # : <Gtype> Sigma-Aldrich , M8823-1ML , Lot # SLBD7244V </Gtype> 
chip antibody : <Med> anti-b ( RNAP ) NT63 </Med> 
chip antibody : <Med> anti-Flag ( Sigma ) </Med> 
chip antibody : <Med> Anti-myc ( 9E10 ) </Med> ( Santa Cruz , Dallas , TX ) 
chip antibody vendor : <Anti> Santa Cruz Biotech </Anti> 
chip antibody vendor : <Anti> Santa Cruz Biotechnology </Anti> 
chip antibody vendor : <Gtype> Amersham Biosciences </Gtype> 
chip-ArcA _ <Gtype> ArcA8myc _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Air> anaerobic _ 1 </O> 
chip-ArcA _ <Gtype> ArcA8myc _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Air> anaerobic _ 2 </O> 
chip-ArcA _ <Gtype> ArcA8myc _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Air> anaerobic _ 3 </O> 
chip-ArcA _ <Gtype> ArcA8myc _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Supp> NO3 _ 1 </O> 
chip-ArcA _ <Gtype> ArcA8myc _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Supp> NO3 _ 2 </O> 
chip-ArcA _ <Gtype> ArcA8myc _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Supp> NO3 _ 3 </O> 
Chipchip BW25113/pCA24N in LB for 24 h 37oC with <Supp> 2 mM IPTG biofilm cell </Supp> 
Chipchip BW25113/pCA24N-mqsR in LB for 24 h 37oC with <Supp> 2 mM IPTG biofilm cell </Supp> 
ChIP DNA from <Gtype> MG1655 wild type </Gtype> strain 
ChIP DNA from MG1655 _ <Supp> PhoB _ </O> <Supp> FLAG 
ChIPExo-Crp _ delAr1delAr2 _ glycerol _ <Supp> NH4Cl _ O2 _ 1 _ anti-crp </O> 
ChIPExo-Crp _ delAr1delAr2 _ glycerol _ <Supp> NH4Cl _ O2 _ 2 _ anti-crp </O> 
ChIPExo-Crp _ delAr1delAr2 _ glycerol _ <Supp> NH4Cl _ O2 _ 3 _ anti-crp </O> 
ChIPExo-Crp _ delAr1 _ glycerol _ <Supp> NH4Cl _ O2 _ 1 _ anti-crp </O> 
ChIPExo-Crp _ delAr1 _ glycerol _ <Supp> NH4Cl _ O2 _ 2 _ anti-crp </O> 
ChIPExo-Crp _ delAr1 _ glycerol _ <Supp> NH4Cl _ O2 _ 3 _ anti-crp </O> 
ChIPExo-Crp _ delAr2 _ glycerol _ <Supp> NH4Cl _ O2 _ 1 _ anti-crp </O> 
ChIPExo-Crp _ delAr2 _ glycerol _ <Supp> NH4Cl _ O2 _ 2 _ anti-crp </O> 
ChIPExo-Crp _ delAr2 _ glycerol _ <Supp> NH4Cl _ O2 _ 3 _ anti-crp </O> 
ChIPExo-Crp _ delta-crp _ glycerol _ <Supp> NH4Cl _ O2 _ 1 _ anti-crp </O> 
ChIPExo-Crp _ delta-crp _ glycerol _ <Supp> NH4Cl _ O2 _ 2 _ anti-crp </O> 
ChIPExo-Crp _ delta-crp _ glycerol _ <Supp> NH4Cl _ O2 _ 3 _ anti-crp </O> 
ChIPExo-Crp _ <Gtype> wt _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 1 _ anti-crp </O> 
ChIPExo-Crp _ <Gtype> wt _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 1 _ anti-crp _ </O> <Phase> rif 
ChIPExo-Crp _ <Gtype> wt _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 2 _ anti-crp </O> 
ChIPExo-Crp _ <Gtype> wt _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 2 _ anti-crp _ </O> <Phase> rif 
ChIPExo-Crp _ <Gtype> wt _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 3 _ anti-crp </O> 
ChIPExo-Crp _ <Gtype> wt _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 3 _ anti-crp _ </O> <Phase> rif 
ChIPExo-Crp _ <Gtype> wt _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 4 _ anti-crp </O> 
ChIPExo-Crp _ <Gtype> wt _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 5 _ anti-crp </O> 
ChIPExo-Crp _ <Gtype> wt _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 6 _ anti-crp </O> 
ChIPExo-Crp _ <Gtype> wt _ </O> <Supp> fructose _ </O> <Supp> NH4Cl _ O2 _ 1 _ anti-crp </O> 
ChIPExo-Crp _ <Gtype> wt _ </O> <Supp> fructose _ </O> <Supp> NH4Cl _ O2 _ 2 _ anti-crp </O> 
ChIPExo-Crp _ <Gtype> wt _ </O> <Supp> fructose _ </O> <Supp> NH4Cl _ O2 _ 3 _ anti-crp </O> 
ChIPExo-Crp _ <Gtype> wt _ </O> <Supp> fructose _ </O> <Supp> NH4Cl _ O2 _ 4 _ anti-crp </O> 
ChIPExo-Crp _ <Gtype> wt _ </O> <Supp> fructose _ </O> <Supp> NH4Cl _ O2 _ 5 _ anti-crp </O> 
ChIPExo-Crp _ <Gtype> wt _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ O2 _ 1 _ anti-crp </O> 
ChIPExo-Crp _ <Gtype> wt _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ O2 _ 2 _ anti-crp </O> 
ChIPExo-Fnr _ <Gtype> Fnr8myc _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ </O> <Air> anaerobic _ 1 _ </O> <Anti> anti-myc 
ChIPExo-Fnr _ <Gtype> Fnr8myc _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ </O> <Air> anaerobic _ 2 _ </O> <Anti> anti-myc 
ChIPExo-Fnr _ <Gtype> Fnr8myc _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ </O> <Air> anaerobic _ 3 _ </O> <Anti> anti-myc 
ChIP-exo reads were aligned to the <Gversion> ASM584v2 genome reference sequence using using bowtie v1 .0.0 with parameters - S </O> 
chip-Fnr _ <Gtype> Fnr8myc _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Air> anaerobic _ 1 </O> 
chip-Fnr _ <Gtype> Fnr8myc _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Air> anaerobic _ 2 </O> 
chip-Fnr _ <Gtype> Fnr8myc _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Air> anaerobic _ 3 </O> 
chip-Fnr _ <Gtype> Fnr8myc _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Supp> NO3 _ 1 </O> 
chip-Fnr _ <Gtype> Fnr8myc _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Supp> NO3 _ 2 </O> 
chip-Fnr _ <Gtype> Fnr8myc _ </O> <Supp> glucose _ </O> <Supp> NH4CL _ </O> <Supp> NO3 _ 3 </O> 
ChIP _ <Gtype> hns-F _ bcm - # 1 </O> 
ChIP _ <Gtype> hns-F _ bcm - # 2 </O> 
ChIP-seq experiments were performed in duplicate using similar growth condition and protocols for chromatin immunoprecipitation . The first experiment was done in the Centre for Genomic Regulation ( CRG , Barcelona , Spain ) , while the second one in the Immanuel Kant Baltic Federal University ( Kaliningrad , Russia ) . In both cases , bacterial cells were grown aerobically at <Temp> 37 °C </Temp> until OD600 ~ 0.6 were treated with formaldehyde ( final concentration of 1 % , 20 min incubation ) . Cross-linking was stopped with glycine ( final concentration of 450 mM ) . After 5 minutes of incubation the cells were pelleted by centrifugation at 14,000 rpm for 15 minutes ( +4 °C ) , washed twice with 5 ml of PBS and resuspended in 1.3 ml of ice-cold immunoprecipitation buffer prepared from 50 ml of buffer containing 100 mM NaCl , 50 mM Tris-HCl ( pH 8.1 ) , 5 mM EDTA , 0.2 % NaN3 , 0.5 % SDS , and 25 ml of buffer containing 100 mM Tris-HCl ( pH 8.6 ) ; 100 mM NaCl ; 5 mM EDTA ; 0,2 % NaN3 , 5 % Triton-X-100 . Then phenylmethylsulfonyl fluoride ( final concentration of 1 mM ) or 20 μl of Protease Inhibitor Cocktail ( PIC , Sigma ) for the first and the second experiment , respectively , were added followed by incubation for <Supp> 30 min </Supp> at +4 °C . 
ChIP _ <Supp> hns-F _ bcm + </O> <Supp> # 1 </Supp> 
ChIP _ <Supp> hns-F _ bcm + </O> <Supp> # 2 </Supp> 
Clinical isolate , minus ciprofloxacin , <Supp> 30 min </Supp> 
Clinical isolate , plus ciprofloxacin , <Supp> 30 min </Supp> 
Clones were grown in M9 with 0.4 % ( w/v ) glucose as carbon source minimal medium with 0.3 M NaCl ( osmotic stress medium ) to <Phase> mid-log phase </Phase> ( OD600 approx. 0.8 ) . 
Co-hybridization of E. coli G 1/2 isolate with E. coli O157 : <Gtype> H7 EDL933 </Gtype> 
Co-hybridization of E. coli G 3/10 isolate with E. coli O157 : <Gtype> H7 EDL933 </Gtype> 
Co-hybridization of E. coli G5 isolate with E. coli O157 : <Gtype> H7 EDL933 </Gtype> 
Co-hybridization of E. coli isolate G 4/9 with E. coli O157 : <Gtype> H7 EDL933 </Gtype> 
Co-hybridization of E. coli O157 : <Gtype> H7 EDL933 </Gtype> with E. coli K-12 M1655 # 1 
Co-hybridization of E. coli O157 : <Gtype> H7 EDL933 </Gtype> with E. coli K-12 M1655 # 2 
concentration : <Supp> 0.2 ppm </Supp> 
concentration : <Supp> 2 ppm </Supp> 
condition : <Anti> in vitro </Anti> 
condition : <Anti> in vivo </Anti> 
condition : <Gtype> acetonitrile ( control ) </Gtype> 
condition : <Gtype> heat-shocked condition without </O> <Supp> rifampicin treatment </Supp> 
condition : <Gtype> LB +3 g/L Glc +0.1 </O> <Supp> mM IPTG + 50μg/ml Amp </Supp> 
condition : <Gtype> LB +3 g/L Glc +0.1 </O> <Supp> mM IPTG </Supp> 
condition : <Gtype> mid-exponential condition </Gtype> with <Supp> rifampicin treatment </Supp> 
condition : <Gtype> mid-exponential condition without </O> <Supp> rifampicin treatment </Supp> 
condition : <Gtype> nitrogen-limiting condition without </O> <Supp> rifampicin treatment </Supp> 
condition : <Gtype> osmotic pressure </Gtype> 
condition : <Phase> exponential growth , 36.9 ºC </O> 
condition : <Phase> exponential growth , 41.2 ºC </O> 
condition : <Phase> exponential growth , 43.2 ºC </O> 
condition : <Phase> exponential growth , 44.8 ºC </O> 
condition : <Phase> stationary condition without </O> <Supp> rifampicin treatment </Supp> 
condition : <Phase> temperature change </Phase> 
condition : <Supp> glucose limited </O> 
condition : <Supp> histidine depleted </Supp> 
condition : <Supp> histidine supplied , 1 mM </Supp> 
contamination status : <Anti> hydrocarbon contaminated </Anti> 
Continuous aerobically grown cultures in Evans medium , exposed to 0.1 L/min CO gas for <Supp> 10 min </Supp> 
Continuous aerobically grown cultures in Evans medium , exposed to 0.1 L/min CO gas for <Supp> 20 min </Supp> 
Continuous aerobically grown cultures in Evans medium , exposed to 0.1 L/min CO gas for <Supp> 2.5 min </Supp> 
Continuous aerobically grown cultures in Evans medium , exposed to 0.1 L/min CO gas for <Supp> 40 min </Supp> 
Continuous aerobically grown cultures in Evans medium , exposed to 0.1 L/min CO gas for <Supp> 5 min </Supp> 
Continuous aerobically grown cultures in Evans medium , exposed to 0.1 L/min CO gas for <Supp> 80 min </Supp> 
Continuous aerobically grown cultures in Evans medium , exposed to 40uM CORM-3 for <Supp> 10 min </Supp> 
Continuous aerobically grown cultures in Evans medium , exposed to 40uM CORM-3 for <Supp> 20 min </Supp> 
Continuous aerobically grown cultures in Evans medium , exposed to 40uM CORM-3 for <Supp> 2.5 min </Supp> 
Continuous aerobically grown cultures in Evans medium , exposed to 40uM CORM-3 for <Supp> 40 min </Supp> 
Continuous aerobically grown cultures in Evans medium , exposed to 40uM CORM-3 for <Supp> 5 min </Supp> 
Continuous aerobically grown cultures in Evans medium , exposed to 40uM CORM-3 for <Supp> 80 min </Supp> 
Continuous aerobically grown cultures in Evans medium , exposed to 40uM iCORM-3 for <Supp> 10 min </Supp> 
Continuous aerobically grown cultures in Evans medium , exposed to 40uM iCORM-3 for <Supp> 20 min </Supp> 
Continuous aerobically grown cultures in Evans medium , exposed to 40uM iCORM-3 for <Supp> 2.5 min </Supp> 
Continuous aerobically grown cultures in Evans medium , exposed to 40uM iCORM-3 for <Supp> 40 min </Supp> 
Continuous aerobically grown cultures in Evans medium , exposed to 40uM iCORM-3 for <Supp> 5 min </Supp> 
Continuous aerobically grown cultures in Evans medium , exposed to 40uM iCORM-3 for <Supp> 80 min </Supp> 
Continuous anaerobically grown cultures in Evans medium , exposed to 40uM CORM-3 for <Supp> 10 min </Supp> 
Continuous anaerobically grown cultures in Evans medium , exposed to 40uM CORM-3 for <Supp> 20 min </Supp> 
Continuous anaerobically grown cultures in Evans medium , exposed to 40uM CORM-3 for <Supp> 2.5 min </Supp> 
Continuous anaerobically grown cultures in Evans medium , exposed to 40uM CORM-3 for <Supp> 40 min </Supp> 
Continuous anaerobically grown cultures in Evans medium , exposed to 40uM CORM-3 for <Supp> 5 min </Supp> 
Continuous anaerobically grown cultures in Evans medium , exposed to 40uM CORM-3 for <Supp> 80 min </Supp> 
Continuous anaerobically grown cultures in Evans medium , exposed to 40uM iCORM-3 for <Supp> 10 min </Supp> 
Continuous anaerobically grown cultures in Evans medium , exposed to 40uM iCORM-3 for <Supp> 20 min </Supp> 
Continuous anaerobically grown cultures in Evans medium , exposed to 40uM iCORM-3 for <Supp> 2.5 min </Supp> 
Continuous anaerobically grown cultures in Evans medium , exposed to 40uM iCORM-3 for <Supp> 40 min </Supp> 
Continuous anaerobically grown cultures in Evans medium , exposed to 40uM iCORM-3 for <Supp> 5 min </Supp> 
Continuous anaerobically grown cultures in Evans medium , exposed to 40uM iCORM-3 for <Supp> 80 min </Supp> 
Continuous anaerobically grown cultures in Evans medium , exposed to CO gas at 0.1 L/min for <Supp> 10 min </Supp> 
Continuous anaerobically grown cultures in Evans medium , exposed to CO gas at 0.1 L/min for <Supp> 20 min </Supp> 
Continuous anaerobically grown cultures in Evans medium , exposed to CO gas at 0.1 L/min for <Supp> 2.5 min </Supp> 
Continuous anaerobically grown cultures in Evans medium , exposed to CO gas at 0.1 L/min for <Supp> 40 min </Supp> 
Continuous anaerobically grown cultures in Evans medium , exposed to CO gas at 0.1 L/min for <Supp> 5 min </Supp> 
Continuous anaerobically grown cultures in Evans medium , exposed to CO gas at 0.1 L/min for <Supp> 80 min </Supp> 
Control bacteria at <Temp> 37 °C </Temp> ( common reference ) . Total RNA isolated from 5 indepedent cultures ( pooled after cDNA labeling ) . 
control strain O157 : <Gtype> H7 EDL933 </Gtype> 
control strain w/o hypoxanthine <Supp> 30 min </Supp> at low dilution protocol 
conversion : <Gtype> Convert SOLiD </Gtype> output to fastq ( Galaxy Version 1.0.0 ) ; default parameters . 
counting : <OD> countOverlaps of Iranges ; default parameters </O> 
Cra <Supp> acetate 1 </O> 
Cra <Supp> acetate 2 </O> 
Cra <Supp> fructose 1 </O> 
Cra <Supp> fructose 2 </O> 
Cra <Supp> glucose 1 </O> 
Cra <Supp> glucose 2 </O> 
Cross-linked cells were harvested and washed two times with ice-cold PBS . Cells were resuspended in 450μl of TES buffer ( 50mM Tris-HCl pH 7.5 , 150mM NaCl ) and 20μl of lysis solution ( 13.6 mg/ml lysozyme , 50 % glycerol , 50mM Tris-HCl pH7 .5 , 100mM NaCl , 1mM DTT , 0.1 % Triton X-100 ) followed of a 5 min incubation at room temperature . 10μl of cOmplete EDTA free protease inhibitor ( Roche ) were added and incubated 10 min at room temperature . 550μl of ChIP buffer ( 1.1 % Triton X-100 , 1.2 mM EDTA , 16.7 mM Tris-HCl , 167mM NaCl , 20μl/ml of cOmplete EDTA free protease inhibitor ( Roche ) were added followed of 10 min incubation at 37ºC . The lysate was then sonicated ( UP200S-Hielscher ) to an average size between 300bp and 700bp with 5 cycles of and amplitude of 55 % , 0.45 sec pulse during 10sec and 50sec in ice . Insoluble cell debris were removed by centrifugation at 20000g for 3 min at 4ºC and the supernatant collected . The supernatant was added to α-Flag-agarose beads ( Sigma ) and incubated at 4ºC under rotation . The samples were then washed once with low salt wash buffer ( 0.1 % SDS , 1 % Triton X-100 , 2mM EDTA , 20mM Tris-HCl pH 8.1 , 150mM NaCl ) , once with high salt wash buffer ( 0.1 % SDS , 1 % Triton X-100 , 2mM EDTA , 20mM Tris-HCl pH 8.1 , 500mM NaCl ) , once with LiCl wash buffer ( 250mM LiCl , 1 % NP-40 , 1 % deoxycholate , 1mM EDTA , 10mM Tris-HCl pH 8.1 ) , and twice with TE buffer ( 10mM Tris-HCl pH 8.1 , 1mM EDTA ) . Two washes with 250μl of freshly prepared elution buffer ( 1 % SDS , 100mM NaHCO3 ) were done followed by vortexing and incubation under rotation at room temperature for 15 min . To reverse the cross-link 30μl of 5M NaCl were added to the elute and incubated over night at 65ºC . Finally , 4μl of 0.5 M EDTA , 20μl of 1M Tris-HCl pH 6.5 and 2μl of 10mg/ml Proteinase-K ( Sigma ) were added and the suspension incubated at 45ºC for <Supp> 2h . DNA was purified and recovered by standard phenol-chloroform extraction and ethanol precipitation with 20μg of glycogen . </O> 
Cross-linked cells were harvested by centrifugation , washed thrice with ice-cold TBS ( pH 7.5 ) , resuspended in 1 ml lysis buffer -LSB- 10 mM Tris ( pH 8.0 ) , 20 % sucrose , 50 mM NaCl , 10 mM EDTA , 20 mg/ml lysozyme and 0.1 mg/ml RNase A -RSB- and incubated at <Temp> 37 °C </Temp> for <Supp> 30 min </Supp> . After lysis , 3 ml immunoprecipitation ( IP ) buffer -LSB- 50 mM HEPES -- KOH ( pH 7.5 ) , 150 mM NaCl , 1 mM EDTA , 1 % Triton X-100 , 0.1 % sodium deoxycholate , 0.1 % sodium dodecyl sulphate ( SDS ) and PMSF ( final 1 mM ) -RSB- was added and the DNA sheared to an average size of ~ 250 bp using a Bioruptor ( Diagenode ) . Insoluble cellular matter was removed by centrifugation for 10 min at 4 °C . An 800 μl aliquot was incubated with 20 μl Protein A/G UltraLink Resin ( Pierce ) on a rotary shaker for 45 minutes at room temperature . The supernatant was removed and incubated with mouse monoclonal antibody ( Neoclone cat . no . WP009 ) and 30 μl Protein A/G UltraLink Resin ( pre-incubated with 1mg/ml BSA in TBS ) , on a rotary shaker at room temperature for 90 min . Samples were washed once with IP buffer , twice with IP buffer + 500 mM NaCl , once with wash buffer -LSB- 10 mM Tris ( pH 8.0 ) , 250 mM LiCl , 1 mM EDTA , 0.5 % Nonidet P-40 and 0.5 % sodium deoxycholate -RSB- and once with TE ( pH 7.5 ) . Immunoprecipitated complexes were eluted in 100 μl elution buffer -LSB- 10 mM Tris ( pH 7.5 ) , 10 mM EDTA and 1 % SDS -RSB- at 65 °C for 20 min . Immunoprecipitated samples and the sheared DNA from the Bioruptor were uncrosslinked in elution buffer containing 0.8 mg/ml Pronase at 42 °C for 2 h followed by 65 °C for 6 h. DNA was purified using the phenol-chloroform method . 
Crosslinked cells were then resuspended in 500 ul of lysis buffer ( 10 mM Tris-HCl ( pH 7.5 ) , 100 mM NaCl and 1 mM EDTA ) with 40 ul of protease inhibitor cocktail ( 50 mg in 0.25 ml of DMSO and 0.75 ml of TDW ) . Cells were lyzed with 1 ul of lysozyme for <Supp> 30 min </Supp> at 37C on a rocker . 0.55 ml of 2X IP buffer ( 100 mM Tris-HCl ( pH 7.5 ) , 200 mM NaCl , 2 % Triton X-100 and 1 mM EDTA ) were added to the sample , and then was sonicated to fragmentize genomic DNA . 0.3 ml of Wash buffer I ( 50 mM Tris-HCl ( pH 7.5 ) , 140 mM NaCl , 1 % Triton X-100 and 1mM EDTA ) was added to make the volume up to 1.4 ml . Only 0.7 ml was taken and transfered to a new tube , and 15 ul of Anti-c-myc mouse antibody was added , and the sample was incubated overnight at 4C to make Antibody-TF complex . 50 ul of Dynabeads Pan mouse IgG were washed 3 times with bead washing solution ( 250 mg BSA in 50 ml of PBS ) , and were added to the sample . Cell lysate with beads were incubated for 6 hours or overnight at 4C to make Dynabead-antibody-TF complex . The beads were pulled down on a magnet stand , and washed 2 times with wash buffer I and with wash buffer II ( 50 mM Tris-HCl ( pH 7.5 ) , 500 mM NaCl , 1 % Triton X-100 and 1mM EDTA ) , wash buffer III ( 10 mM Tris-HCl ( pH 8.0 ) , 250 mM LiCl , 1 % Triton X-100 and 1mM EDTA ) , and wash buffer IV ( 10 mM Tris-HCl ( pH 8.0 ) , 1mM EDTA ) . The bead-bound TF-DNA complex was then end-repaired , dA-tailed , and ligated to the first adapter . Adapter-ligated sample was then treated with nick-repair reagent , and was treated with lambda exonuclease and RecJ exonuclease . Then DNA was eluted away from Dynabeads by incubating in 200 ul of elution buffer ( 50 mM Tris-HCl ( pH 8.0 ) , 1 % SDS and 1 mM EDTA ) at 65C overnight . Protein was removed by treating 4 ul of protease K and being incubated at 55C for 2 hours , and by Phenol-Chloroform-IAA extraction . Purified DNA was used to bulid the second strand synthesis , followed by another dA-tailing , second strand ligation , and 3 ' overhang removal stpes . Then the sequencing library was amplified with PCR enrichment . 
Crosslinked cells were then resuspended in 500 ul of lysis buffer ( 10 mM Tris-HCl ( pH 7.5 ) , 100 mM NaCl and 1 mM EDTA ) with 40 ul of protease inhibitor cocktail ( 50 mg in 0.25 ml of DMSO and 0.75 ml of TDW ) . Cells were lyzed with 1 ul of lysozyme for <Supp> 30 min </Supp> at 37oC on a rocker . 0.55 ml of 2X IP buffer ( 100 mM Tris-HCl ( pH 7.5 ) , 200 mM NaCl , 2 % Triton X-100 and 1 mM EDTA ) were added to the sample , and then was sonicated to fragmentize genomic DNA . 0.3 ml of Wash buffer I ( 50 mM Tris-HCl ( pH 7.5 ) , 140 mM NaCl , 1 % Triton X-100 and 1mM EDTA ) was added to make the volume up to 1.4 ml . Only 0.7 ml was taken and transfered to a new tube , and 10 ul of Anti-rpoB mouse antibody was added , and the sample was incubated overnight at 4 oC to make Antibody-TF complex . 50 ul of Dynabeads Pan mouse IgG were washed 3 times with bead washing solution ( 250 mg BSA in 50 ml of PBS ) , and were added to the sample . Cell lysate with beads were incubated for 6 hours or overnight at 4oC to make Dynabead-antibody-TF complex . The beads were pulled down on a magnet stand , and washed 2 times with wash buffer I and with wash buffer II ( 50 mM Tris-HCl ( pH 7.5 ) , 500 mM NaCl , 1 % Triton X-100 and 1mM EDTA ) , wash buffer III ( 10 mM Tris-HCl ( pH 8.0 ) , 250 mM LiCl , 1 % Triton X-100 and 1mM EDTA ) , and wash buffer IV ( 10 mM Tris-HCl ( pH 8.0 ) , 1mM EDTA ) . The bead-bound TF-DNA complex was then end-repaired , dA-tailed , and ligated to the first adapter . Adapter-ligated sample was then treated with nick-repair reagent , and was treated with lambda exonuclease and RecJ exonuclease . Then DNA was eluted away from Dynabeads by incubating in 200 ul of elution buffer ( 50 mM Tris-HCl ( pH 8.0 ) , 1 % SDS and 1 mM EDTA ) at 65oC overnight . Protein was removed by treating 4 ul of protease K and being incubated at 55 oC for 2 hours , and by Phenol-Chloroform-IAA extraction . Purified DNA was used to bulid the second strand synthesis , followed by another dA-tailing , second strand ligation , and 3 ' overhang removal stpes . Then the sequencing library was amplified with PCR enrichment . 
Crosslinked cells were then resuspended in 500 ul of lysis buffer ( 10 mM Tris-HCl ( pH 7.5 ) , 100 mM NaCl and 1 mM EDTA ) with 40 ul of protease inhibitor cocktail ( 50 mg in 0.25 ml of DMSO and 0.75 ml of TDW ) . Cells were lyzed with 1 ul of lysozyme for <Supp> 30 min </Supp> at 37oC on a rocker . 0.55 ml of 2X IP buffer ( 100 mM Tris-HCl ( pH 7.5 ) , 200 mM NaCl , 2 % Triton X-100 and 1 mM EDTA ) were added to the sample , and then was sonicated to fragmentize genomic DNA . 0.3 ml of Wash buffer I ( 50 mM Tris-HCl ( pH 7.5 ) , 140 mM NaCl , 1 % Triton X-100 and 1mM EDTA ) was added to make the volume up to 1.4 ml . Only 0.7 ml was taken and transfered to a new tube , and 15 ul of Anti-c-myc mouse antibody was added , and the sample was incubated overnight at 4 oC to make Antibody-TF complex . 50 ul of Dynabeads Pan mouse IgG were washed 3 times with bead washing solution ( 250 mg BSA in 50 ml of PBS ) , and were added to the sample . Cell lysate with beads were incubated for 6 hours or overnight at 4oC to make Dynabead-antibody-TF complex . The beads were pulled down on a magnet stand , and washed 2 times with wash buffer I and with wash buffer II ( 50 mM Tris-HCl ( pH 7.5 ) , 500 mM NaCl , 1 % Triton X-100 and 1mM EDTA ) , wash buffer III ( 10 mM Tris-HCl ( pH 8.0 ) , 250 mM LiCl , 1 % Triton X-100 and 1mM EDTA ) , and wash buffer IV ( 10 mM Tris-HCl ( pH 8.0 ) , 1mM EDTA ) . The bead-bound TF-DNA complex was then end-repaired , dA-tailed , and ligated to the first adapter . Adapter-ligated sample was then treated with nick-repair reagent , and was treated with lambda exonuclease and RecJ exonuclease . Then DNA was eluted away from Dynabeads by incubating in 200 ul of elution buffer ( 50 mM Tris-HCl ( pH 8.0 ) , 1 % SDS and 1 mM EDTA ) at 65oC overnight . Protein was removed by treating 4 ul of protease K and being incubated at 55 oC for 2 hours , and by Phenol-Chloroform-IAA extraction . Purified DNA was used to bulid the second strand synthesis , followed by another dA-tailing , second strand ligation , and 3 ' overhang removal stpes . Then the sequencing library was amplified with PCR enrichment . 
cultivation : <Gtype> continuous cultivation , A-stat </Gtype> 
cultivation : <Gtype> continuous cultivation , chemostat </O> 
culture condition : <Air> Aerobic cultures </O> 
culture condition : <Air> Anaerobic cultures </O> 
culture condition : <Air> Anaerobic Cultures </O> 
culture condition : <Air> anaerobic fermentive condition </O> 
culture condition : <Anti> nitrate respiratory condition </Anti> 
Culture conditions : <Temp> 37 C with shaking at 220 RPM </O> 
Cultured cells ( 50 mL ) were cross-linked with 1 % formaldehyde at room temperature for <Supp> 30 min and added 2 mL of 2.5 M </Supp> glycine to quench the unused formaldehyde . After washing three times with 50 mL of ice-cold Tris-buffered saline ( TBS ) , the washed cells were resuspended in 0.5 mL of lysis buffer composed of 50 mM Tris-HCl ( pH 7.5 ) , 100 mM NaCl , 1 mM EDTA , 1 μg/mL RNaseA , protease inhibitor cocktail and 1 kU Ready-Lyse lysozyme ( Epicentre , Madison , WI ) and incubated at 37oC for <Supp> 30 min </Supp> . The cells were then treated with 0.5 mL of 2 × IP buffer ( 100 mM Tris-HCl ( pH 7.5 ) , 100 mM NaCl , 1 mM EDTA , 2 % ( v/v ) Triton X-100 , and protease inhibitor cocktail ) , followed by incubation on ice for <Supp> 30 min </Supp> . The lysate was then sonicated in an ice bath using Sonic Dismembrator Model 500 ( four times for 20 s each , output level , 2.5 ) . Size distribution of the fragmented DNAs was confirmed using agarose gel electrophoresis ( 200-400 bp ) after removing cell debris by centrifugation . 
culture denity : <Gtype> OD600 = 0.55-0.6 culture </Gtype> 
cultured in : <Med> M9 minimal media </Med> with <Supp> 0.2 % acetate </Supp> 
cultured in : <Med> M9 minimal media </Med> with <Supp> 0.2 % fructose </Supp> 
cultured in : <Med> M9 minimal media </Med> with <Supp> 0.2 % glucose </Supp> 
culture/growth condition : <Gtype> MOPS-P 0h </Gtype> 
culture/growth condition : <Gtype> MOPS-P 4h </Gtype> 
culture/growth condition : <Med> LB ( OD = 0.87 ) </Med> 
culture/growth condition : <Supp> Heatshock 15 min </Supp> 
culture/growth condition : <Supp> Heatshock 30 min </Supp> 
culture/growth condition : <Supp> Heatshock 60 min </Supp> 
culture/growth condition : <Supp> MOPS-P 2h </Supp> 
culture media : <Gtype> LB with </O> <Supp> 2.5 mM Fumaric acid </Supp> 
Cultures grown in <Med> MOPS minimal glucose media </Med> containing <Supp> 10 µM FeSO4 </Supp> 
Cultures of both strains were started with a 2 % overnight inoculum in <Med> LB media </Med> containing 35ug/ml chloramphenicol . 
Cultures of Caulobacter ( TLS1631-TLS1633 ) were grown at 30oC in PYE and supplemented with antibiotics , as necessary , at appropriate concentrations . To deplete wild-type non-tagged ParB , exponential-phase cells were washed off xylose and re-introduced to PYE +0.2 % glucose for an additional <Supp> 5 hours </Supp> . After 4 hours , vanillate was added to induce the expression of flag-parB ( WT ) or flag-parB ( G101S/R104A ) for an hour . Cultures of Escherichia coli ( TLS1637-TLS1650 ) were grown at 30oC in LB and supplemented with antibiotics , as necessary , at appropriate concentrations . IPTG ( 0.5 mM ) was added to induce the production of T18-ParB ( WT ) or T18-ParB ( G101S ) . After an hour , formadehyde ( 1 % final concentration ) were added to fix cells for ChIP-seq . 
Cultures of E. coli CFT073 were maintained at -- 80ºC in Luria-Bertani broth with 15 % glycerol . Cultures were streaked onto LB agar plates and incubated ( <Temp> 37 °C </Temp> , 24 h ) . A single colony was inoculated into 150 mL of LB broth ( in a 500 mL baffled flask ) . Three inoculated flasks contained LB broth alone ( controls ) , and three inoculated flasks were supplemented with cranberry derived PAC extract ( 100 µg/mL ) . Bacteria were incubated at <Temp> 37 °C </Temp> , 5 h , 200 rpm to mid-log growth phase . 
Cultures of E. coli MG1655 and its derivates were cross linked by addition of 27 µl of formaldehyde ( 37 % ) per ml <Med> medium ( final concentration 1 % ) . Crosslinking was performed at slow shaking ( 100 rpm ) for 20 min followed by quenching with </O> <Supp> 0.2 ml of 2.5 M glycine </Supp> per ml <Med> medium ( final concentration 0.5 M ) . Cells were collected by centrifugation and washed twice with cold TBS ( pH7 .5 ) . After resuspension in 1 ml lysis buffer ( 10mM Tris ( pH 8.0 ) , 20 % sucrose , 50mM NaCl , 10mM EDTA , 10 mg/ml lysozyme ) and incubation at </O> <Temp> 37 °C </Temp> for <Supp> 30 min </Supp> C followed by addition of 4 ml IP buffer cells were sonicated on ice with 12 times 30 sec and 30 sec breaks at an UP 400s Ultrasonic processor ( Dr. Hielscher GmbH ) with 100 % power . After centrifugation for 10 min at 9000 g , 800 µl aliquotes of the supernatant were stored at -20 °C . 800 µl of sonicated cell extract ( see above ) were incubated with 20 µl protein A/G agarose beads ( Ultralink ) and antibody rotating at 4 °C . Washing was done with 500 µl buffer ( 2 x 500 µl IP buffer -LSB- 50 mM HEPES-KOH pH 7.5 , 150 mM NaCl , 1 mM EDTA , 1 % Triton X 100 , 0.1 % Sodium deoxycholate , 0.1 % SDS -RSB- , 1 x IP buffer with 500mM NaCl , 1 x wash buffer -LSB- 10mM Tris pH 8.0 , 250 mM LiCl , 1 mM EDTA , 0.5 % Nonidet-P40 , 0.5 % Sodium deoxycholate -RSB- and 1 x TE ) followed by rotation at room temperature for three minutes with subsequent collection of the beads by centrifugation . For elution , 100 µl elution buffer ( 50 mM Tris ( pH 7.5 ) , 10 mM EDTA , 1 % SDS ) was added to the beads , incubated in a 65 °C water bath for 10 min and centrifuged as above . After reversion of crosslink the DNA was purified with phenol/chloroform . 
Cultures of E. coli MG1655 and its derivates were cross linked by addition of 27 µl of formaldehyde ( 37 % ) per ml <Med> medium ( final concentration 1 % ) . Crosslinking was performed at slow shaking ( 100 rpm ) for 20 min followed by quenching with </O> <Supp> 0.2 ml of 2.5 M glycine </Supp> per ml <Med> medium ( final concentration 0.5 M ) . Cells were collected by centrifugation and washed twice with cold TBS ( pH7 .5 ) . After resuspension in 1 ml lysis buffer ( 10mM Tris ( pH 8.0 ) , 20 % sucrose , 50mM NaCl , 10mM EDTA , 10 mg/ml lysozyme ) and incubation at </O> <Temp> 37 °C </Temp> for <Supp> 30 min </Supp> C followed by addition of 4 ml IP buffer cells were sonicated on ice with 12 times 30 sec and 30 sec breaks at an UP 400s Ultrasonic processor ( Dr. Hielscher GmbH ) with 100 % power . After centrifugation for 10 min at 9000 g , 800 µl aliquotes of the supernatant were stored at -20 °C . 800 µl of sonicated cell extract ( see above ) were incubated with 20 µl protein A/G agarose beads ( Ultralink ) and antibody rotating at 4 °C . Washing was done with 500 µl buffer ( 2 x 500 µl IP buffer -LSB- 50 mM HEPES-KOH pH 7.5 , 150 mM NaCl , 1 mM EDTA , 1 % Triton X 100 , 0.1 % Sodium deoxycholate , 0.1 % SDS -RSB- , 1 x IP buffer with 500mM NaCl , 1 x wash buffer -LSB- 10mM Tris pH 8.0 , 250 mM LiCl , 1 mM EDTA , 0.5 % Nonidet-P40 , 0.5 % Sodium deoxycholate -RSB- and 1 x TE ) followed by rotation at room temperature for three minutes with subsequent collection of the beads by centrifugation . For elution , 100 µl elution buffer ( 50 mM Tris ( pH 7.5 ) , 10 mM EDTA , 1 % SDS ) was added to the beads , incubated in a 65 °C water bath for 10 min and centrifuged as above . After reversion of crosslink the DNA was purified with phenol/chloroform . METHOD DETAILS are given and are important for the different arrays . METHOD DETAILS : For RNAP old , SeqA old and SeqA old <Gtype> deltaSeqA : Cell </Gtype> extracts were incubated with agarose beads and antibody over night . Samples were transferred to a Spin-X centrifuge column ( Costar ) , centrifuged for 2 min at 4.000 rpm to collect the beads on the column . The flow through was removed . Washing was by adding the described buffers to the beads on the spin column and rotation at room temperature for three minutes with subsequent collection of the beads by centrifugation as above . For elution , 100 µl elution buffer was added to the column with the beads , incubated in a 65 °C water bath for 10 min and centrifuged as above . To prepare the control DNA , 800 µl of sonicated cell extract was incubated at 65 °C over night followed by <Supp> 30 min </Supp> after addition of 1 µl RNase A ( 20 mg/ml ) and extraction with phenol/chloroform . For SeqA new , SeqA new deltaSeqA , sigma32 30 °C and sigma 32 <Temp> 43 °C </Temp> : <Gtype> The ChIP protocol as described above resulted in the high background signal . The following modifications were applied . First , agarose beads were not collected on a spin column but instead at the bottom of a usual 1.5 ml reaction tube . The supernatant was than removed by pipetting . Second , the control DNA was taken from the supernatant resulting from centrifugation of the precipitated chromatin beads processed further as the immuno precipitated DNA after elution . Third , before addition of proteinase K sample and control DNA were incubated with RNase A ( 50 µg/ml ) for at least 90 min at 42 °C . Incubation of 800 µl cell extract with σ32 - or SeqA antiserum was for 1 h at 4 °C . For sigma32 </O> <Temp> 30 °C </Temp> short RNase and sigma32 <Temp> 30 °C </Temp> short RNase : <Gtype> The ChIP protocol was as described for sigma 32 30 °C and sigma 32 </O> <Temp> 43 °C </Temp> but with a shorter RNase A incubation for only 30 instead of 90 min . 
culture : <Supp> 18 h </Supp> at <Temp> 37 °C </Temp> 
Cultures were grown aerobically at <Temp> 37 °C </Temp> in 1 L volumes of M9 minimal medium , supplemented with MgSO4 ( 1 mM ) , CaCl2 ( 0.1 mM ) , and glucose ( 10 g/L ) in vigorously shaken ( 225 rpm ) Fernbach flasks . 
Cultures were grown to <Phase> mid-log phase </Phase> in Luria-Bertani ( Miller ) broth medium at 37C . 
Cultures were grown to <Phase> mid-log phase </Phase> in Luria-Bertani ( Miller ) broth medium at 37C . Cells were cultured with 25 ug/ml chloramphenicol to maintain selection . However , this genomic mutation is stable and RNA was prepared from non-selectively grown cultures inoculated with overnight stocks ( grown with selection ) to eliminate any unrelated effects of exogenous drugs on gene expression . 
Cultures were grown to <Phase> mid-log phase </Phase> in Luria-Bertani ( Miller ) broth medium at 37C . Cells were cultured with 25 ug/ml kanamycin to maintain selection . However , this genomic mutation is stable and RNA was prepared from non-selectively grown cultures inoculated with overnight stocks ( grown with selection ) to eliminate any unrelated effects of exogenous drugs on gene expression . 
Cultures were grown to the OD600 value of 1.0 and treated with 1 % formaldehyde for 10 min . To quench the reaction , glycine was added at the final concentration of 0.125 M for 5 min . Cells were washed twice with lysis buffer ( 10 mM Tris-HCl ( pH 7.4 ) , 0.1 M NaCl , 1 mM EDTA and 0.5 % Tween-20 ) . The washed cells were then lysed with the lysis buffer containing 8 KU/ml lysozyme , 1 mM PMSF and protease inhibitor cocktail ( Sigma ) for <Supp> 30 min </Supp> at 4 ℃ . The lysates were sonicated by a sonicator ( Bioruptor ) and this sonication resulted in the size of DNA ranged from 100 bps to 1000 bps with the average size of 500 bps . After sonication , the lysates were centrifuged at 12,000 g for <Supp> 20 min </Supp> at 4 ℃ and the resulting supernatant was used for immunoprecipitation . Before immunoprecipitation , the magnetic beads coated with Dynabeads Protein G ( Invitrogen ) were pre-incubated with 0.05 mg/ml anti-FLAG antibody ( Sigma ) and the lysates were also pre-cleared by incubating with the beads only . To immunoprecipitate the PhoB-FLAG-DNA complex , beads pre-incubated with antibody were added in both lysates of MG1655 _ <Supp> PhoB _ FLAG and MG1655 strains at 4 ℃ overnight . The beads were washed once with IP buffer ( 10 mM Tris-HCl ( pH 7.4 ) , 0.1 M NaCl , 1 mM EDTA , and 0.05 % -LSB- v/v -RSB- Tween-20 and 1 mM fresh PMSF ) , twice with ChIP wash buffer I ( 10 mM Tris HCl ( pH 7.4 ) , 300 mM NaCl , 1 mM EDTA , 0.1 % Tween-20 and 1 mM fresh PMSF ) , three times with ChIP wash buffer II ( 10 mM Tris-HCl ( pH 7.4 ) , 500 mM NaCl , 1 mM EDTA , 0.1 % -LSB- v/v -RSB- Tween-20 and 1 mM fresh PMSF ) , once with ChIP wash buffer III ( 10 mM Tris-HCl ( pH 7.4 ) , 250 mM LiCl , 1 mM EDTA , 0.1 % -LSB- v/v -RSB- Tween-20 and 1 mM fresh PMSF ) and once with TE buffer ( 10 mM Tris-HCl ( pH 7.4 ) and 1 mM EDTA ) . After removing the TE buffer , beads were incubated with elution buffer ( 50 mM Tris-HCl ( pH 7.4 ) , 10 mM EDTA and 1 % SDS ) at 65 ℃ for 15 min twice and then the resulting eluted solutions combined . After incubating with the final concentration of 10.5 U/ml proteinase K ( Sigma ) at 42 ℃ for 2 hours , the reverse cross-link procedure was performed by incubating at 65 ℃ overnight . Samples were then treated with the final concentration of 26 μg/ml RNase A ( Sigma ) . The PCR purification kit ( Qiagen ) was used to purify DNA from the RNase A-treated samples . </O> 
Cultures were maintained on tryptic soy agar ( TSA ) ( Becton Dickinson , Le Pont Claix , France ) . Overnight cultures were grown in Difco Luria-Bertani ( <Med> LB ) broth </Med> ( Lennox ; Franklin Lakes , NJ , USA ) at <Temp> 37 °C </Temp> <Air> aerobically on a shaker at 200 rpm . Bacteria ( picked from 5-10 colonies ) were suspended in 1 ml of PBS , yielding a suspension corresponding to the turbidity of McFarland 0.5 , and diluted 1:100 in minimal salt ( MS ) - medium ( ~ 106 CFU/ml ) . The suspension was exposed to CORM-2 ( 250 µM ) or vehicle ( 2.5 % DMSO ) for 4 hours at </O> <Temp> 37 °C </Temp> . A volume ( 10 µl ) was spread onto TSA-agar plates and incubated at <Temp> 37 °C </Temp> overnight . This procedure was repeated 10 times ( 10x , ~ 45 generations ) or 20 times ( 20x , ~ 90 generations ) . 
culture system : <Med> static petri dish ( disposable ) </Med> 
culture system : <Vess> flask with continous shaking ( </O> <Agit> 250 rpm </Agit> ) 
culture system : <Vess> flask with continuous shaking ( </O> <Agit> 250 rpm </Agit> ) 
culture temperature : <Supp> 30 °C </Supp> for <Supp> 60 min </Supp> 
culture temperature : <Temp> 37 °C </Temp> 
culture temperature : <Temp> 42 °C </Temp> 
culture temperature : <Temp> 42 °C </Temp> for <Supp> 60 min </Supp> 
culture time : <Supp> 18 h </Supp> 
Custom anti-Fur antibodies were purified over a His6-Fur bound HiTrap NHS-activated HP column ( GE Healthcare ) as previously described ( PMID : <Temp> 21478858 ) </Temp> . Western blot analyses showed that the purified antibody was specific for Fur . 
CV108 _ plus _ <Supp> aMG _ 1 </O> 
CV108 _ plus _ <Supp> aMG _ 2 </O> 
CV108 _ plus _ <Supp> aMG _ 3 </O> 
Data collapsed using fastx collapser to remove identical sequencing reads ( http://hannonlab.cshl.edu/fastx_toolkit/index.html ) - Example : <Supp> fastx _ collapser - i DL4900 _ clipped.fasta - o DL4900 _ clip _ clp.fasta </O> 
Data extraction from Images was done using Feature Extraction software v 9.5.1 of Agilent . Feature extracted raw data was analyzed using GeneSpring GX V 7.3.1 software from Agilent . Normalization of the data was done in GeneSpring GX using the recommended one color Per Chip and Per Gene Data Transformation : <Gtype> Set measurements less than 0.01 to 0.01 , Per Chip : Normalize to 50th percentile , Per Gene : Normalize to Specific Samples . Significant genes up and down regulated showing one fold and above among the samples was identified . </O> 
Data filtering was done with in-house script with the set value as follows : <Gtype> Removal if % of N nucleotide is more than 10 % , if more than 40 % of the nucleotide is Q20 or less , if average quality of the reads is less than Q20 . </O> 
Data obtained from E. coli O157 : <Gtype> H7 microarrays were normalized using the Ratio-based and Lowess methods in Acuity 3.1 ( Axon instruments ) before analysis . The normalized data for all strains were converted into log2 ( Fluor 647/Fluor 546 ) in Acuity 3.1 and subsequently analyzed in Microsoft Excel . Control , blank , and test spots with a mean intensity below that of the mean of all negative controls were removed from the analysis . The arithmetic mean of the remaining spots across the duplicates was taken to construct the dataset . GACK ( Genomotyping Analysis by Charles Kim ) , was used to generate a cut off value determining the presence or absence of genes , and a dendrogram using the Euclidean distance metric with average linkage was created with tMEV v4 .1 . </O> 
DdksA cells were grown in <Med> MOPS medium </Med> with <Supp> 0.2 % glucose </Supp> , leucine , isoleucine , valine , glycine , phenylalanine , threonine ( 40 mg/ml ) and uracil ( 50 mg/ml ) until <Phase> mid-log phase </Phase> and treated with 0.5 mg/ml serine hydroxamate ( SHX ) for <Supp> 20 min </Supp> at <Temp> 37 °C </Temp> with vigorous shaking . 
DdksA cells were grown in <Med> MOPS medium </Med> with <Supp> 0.2 % glucose </Supp> , leucine , isoleucine , valine , glycine , phenylalanine , threonine ( 40 mg/ml ) and uracil ( 50 mg/ml ) until <Phase> mid-log phase </Phase> at <Temp> 37 °C </Temp> with vigorous shaking . 
DdksA cells were grown in <Med> MOPS medium </Med> with <Supp> 0.2 % glucose </Supp> , leucine , isoleucine , valine , glycine , phenylalanine , threonine ( 40 mg/ml ) and uracil ( 50 mg/ml ) until <Phase> mid-log phase </Phase> ( OD600 ~ 0.4 ) at <Temp> 37 °C </Temp> with vigorous shaking . 
developmental stage : <Anti> mixed population , </Anti> <Phase> exponential phase </Phase> 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > APPLE : 250 , OAT : 250 , RICE : 250 , BEEF : </O> <Supp> 250 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > APPLE : 250 , RICE : 250 , OAT : 250 , BEEF : </O> <Supp> 250 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > APPLE : 250 , RICE : 250 , PEACH : 250 , CHICK : </O> <Supp> 250 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > APPLE : 666.7 , BEEF : 222.2 , CHICK : 55.6 , PEACH : </O> <Gtype> 55.6 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > APPLE : 666.7 , OAT : 222.2 , CHICK : </O> <Gtype> 55.6 , BEEF : 55.6 </Gtype> 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > APPLE : 666.7 , PEACH : 222.2 , CHICK : 55.6 , RICE : </O> <Gtype> 55.6 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > APPLE : 666.7 , PEACH : 222.2 , CHICK : 55.6 , SWEET _ POTATO : </O> <Gtype> 55.6 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > BEEF : 250 , PEA : 250 , CHICK : 250 , OAT : </O> <Supp> 250 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > BEEF : 666.7 , PEACH : 222.2 , SWEET _ POTATO : 55.6 , RICE : </O> <Gtype> 55.6 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > BEEF : 666.7 , RICE : 222.2 , PEA : 55.6 , CHICK : </O> <Gtype> 55.6 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > CHICK : 421.1 , BEEF : 421.1 , PEA : 105.3 , APPLE : </O> <Gtype> 52.6 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > CHICK : 666.7 , PEACH : 222.2 , BEEF : 55.6 , RICE : </O> <Gtype> 55.6 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > CHICK : 666.7 , PEACH : 222.2 , RICE : </O> <Gtype> 55.6 , OAT : 55.6 </Gtype> 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > CHICK : 666.7 , SWEET _ POTATO : 222.2 , RICE : </O> <Gtype> 55.6 , OAT : 55.6 </Gtype> 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > OAT : 421.1 , APPLE : 421.1 , BEEF : 105.3 , RICE : </O> <Gtype> 52.6 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > OAT : 421.1 , RICE : 421.1 , CHICK : </O> <Gtype> 105.3 : APPLE : 52.6 </Gtype> 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > OAT : 666.7 , RICE : 222.2 , BEEF : 55.6 , SWEET _ POTATO : </O> <Gtype> 55.6 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > PEA : 250 , OAT : 250 , BEEF : 250 , CHICK : </O> <Supp> 250 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > PEA : 421.1 , CHICK : 421.1 , RICE : 105.3 , PEACH : </O> <Gtype> 52.6 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > PEA : 666.7 , APPLE : 222.2 , SWEET _ POTATO : 55.6 , PEACH : </O> <Gtype> 55.6 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > PEA : 666.7 , CHICK : 222.2 , OAT : 55.6 , SWEET _ POTATO : </O> <Gtype> 55.6 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > PEA : 666.7 , PEACH : 222.2 , CHICK : </O> <Gtype> 55.6 , OAT : 55.6 </Gtype> 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > PEA : 666.7 , RICE : 222.2 , APPLE : </O> <Gtype> 55.6 , BEEF : 55.6 </Gtype> 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > PEA : 666.7 , RICE : 222.2 , SWEET _ POTATO : 55.6 , PEACH : </O> <Gtype> 55.6 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > PEACH : 250 , OAT : 250 , RICE : 250 , SWEET _ POTATO : </O> <Supp> 250 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > PEACH : 421.1 , OAT : 421.1 , SWEET _ POTATO : </O> <Gtype> 105.3 , BEEF : 52.6 </Gtype> 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > PEACH : 666.7 , OAT : 222.2 , SWEET _ POTATO : 55.6 , CHICK : </O> <Gtype> 55.6 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > PEACH : 666.7 , PEA : 222.2 , APPLE : 55.6 , CHICK : </O> <Gtype> 55.6 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > PEACH : 666.7 , PEA : 222.2 , OAT : 55.6 , RICE : </O> <Gtype> 55.6 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > PEACH : 666.7 , PEA : 222.2 , RICE : </O> <Gtype> 55.6 , BEEF : 55.6 </Gtype> 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > PEACH : </O> <Gtype> 421.1 , BEEF : 421.1 , OAT : 105.3 </Gtype> , RICE : <Gtype> 52.6 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > RICE : 666.7 , APPLE : 222.2 , SWEET _ POTATO : </O> <Gtype> 55.6 , BEEF : 55.6 </Gtype> 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > SWEET _ POTATO : 250 , APPLE : 250 , PEACH : 250 , BEEF : </O> <Supp> 250 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > SWEET _ POTATO : 250 , BEEF : 250 , PEACH : 250 , RICE : </O> <Supp> 250 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > SWEET _ POTATO : 421.1 , OAT : 421.1 , CHICK : 105.3 , RICE : </O> <Gtype> 52.6 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > SWEET _ POTATO : 421.1 , RICE : 421.1 , CHICK : 105.3 , PEA : </O> <Gtype> 52.6 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > SWEET _ POTATO : 666.7 , APPLE : 222.2 , BEEF : 55.6 , PEACH : </O> <Gtype> 55.6 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > SWEET _ POTATO : 666.7 , CHICK : 222.2 , BEEF : 55.6 , PEA : </O> <Gtype> 55.6 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > SWEET _ POTATO : 666.7 , OAT : 222.2 , PEACH : 55.6 , PEA : </O> <Gtype> 55.6 
diet : <Supp> Mouse was fed a meal of human pureed food in the following concentrations ( g/kg ) = > SWEET _ POTATO : 666.7 , RICE : 222.2 , PEACH : </O> <Gtype> 55.6 , BEEF : 55.6 </Gtype> 
diet : <Supp> Mouse was fed Harlan Teklad Diet TD .09049 </O> 
diet : <Supp> Mouse was fed Harlan Teklad Diet TD .09050 </O> 
diet : <Supp> Mouse was fed Harlan Teklad Diet TD .09051 </O> 
diet : <Supp> Mouse was fed Harlan Teklad Diet TD .09052 </O> 
diet : <Supp> Mouse was fed Harlan Teklad Diet TD .09053 </O> 
diet : <Supp> Mouse was fed Harlan Teklad Diet TD .09054 </O> 
diet : <Supp> Mouse was fed Harlan Teklad Diet TD .09055 </O> 
diet : <Supp> Mouse was fed Harlan Teklad Diet TD .09055 . </O> 
diet : <Supp> Mouse was fed Harlan Teklad Diet TD .09056 </O> 
diet : <Supp> Mouse was fed Harlan Teklad Diet TD .09057 </O> 
diet : <Supp> Mouse was fed Harlan Teklad Diet TD .09057 . </O> 
diet : <Supp> Mouse was fed Harlan Teklad Diet TD .09058 </O> 
diet : <Supp> Mouse was fed Harlan Teklad Diet TD .09059 </O> 
diet : <Supp> Mouse was fed Harlan Teklad Diet TD .09620 </O> 
diet : <Supp> Mouse was fed Harlan Teklad Diet TD .09621 </O> 
diet : <Supp> Mouse was fed Harlan Teklad Diet TD .09622 </O> 
diet : <Supp> Mouse was fed Harlan Teklad Diet TD .09623 </O> 
diet : <Supp> Mouse was fed Harlan Teklad Diet TD .09624 </O> 
diet : <Supp> Mouse was fed Harlan Teklad Diet TD .09625 </O> 
Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 
differential expression : <Gtype> Bioconductor package edgeR ( version 3.2.3 ) ; default parameters </O> 
disease state : <Gtype> cystic fibrosis </Gtype> 
Dividing t <Supp> = 2 hours </Supp> 
DMS-MaPSeq of purified cspA mRNA at 10 °C with <Supp> 0.025 mM CspA protein </Supp> 
DMS-MaPSeq of purified cspA mRNA at 10 °C with <Supp> 0.05 mM CspA protein </Supp> 
DMS-MaPSeq of purified cspA mRNA at 10 °C with <Supp> 0.1 mM CspA protein </Supp> 
DMS-MaPSeq of purified cspA mRNA at <Temp> 37 °C </Temp> 
DMS-MaPSeq of purified cspA mRNA at <Temp> 37 °C </Temp> , rep1 
DMS-MaPSeq of purified cspA mRNA at <Temp> 37 °C </Temp> , rep 2 
DMS-seq 8 hr after shift to 10 °C in <Gtype> ∆ cspABEG cells </Gtype> 
DMS-seq 8 hr after shift to 10 °C in <Gtype> ∆ cspBG cells </Gtype> 
dnaB-Ts Î '' ahpC _ <Supp> 30 °C </Supp> 
dnaB-Ts Î '' ahpC _ <Temp> 42 °C </Temp> 
dnaB-Ts _ <Supp> 30 °C </Supp> 
dnaB-Ts _ <Temp> 42 °C </Temp> 
DNA extraction : <Gtype> Genomic DNA was isolated and purified according to standard procedures ( Ausubel et al. 1994 ) . Genomic DNA was fragmented by nebulization as described by Girgis et al. . PLoS Genetics 3 ( 9 ) : </O> <Anti> e154 ( 2007 ) and purified by phenol/chloroform extraction and ethanol precipitated . </O> 
DNA was extracted in the same manner as described by McNulty et al. ( PMID : <Temp> 22030749 ) </Temp> . 
DNA were extracted and purified as described by Muniesa et al. ( 2003 ) . Shiga toxin 2-converting bacteriophages associated with clonal variability in Escherichia coli O157 : <Gtype> H7 strains of human origin isolated from a single outbreak . Infect Immun 71 , 4554-4562 . </O> 
d _ <Supp> rnr NO3 </Supp> 1 
d _ <Supp> rnr NO3 </Supp> 2 
d _ <Supp> rnr NO3 w/propionate 1 </Supp> 
d _ <Supp> rnr NO3 w/propionate </Supp> 2 
d _ <Supp> rnr O2 1 </Supp> 
d _ <Supp> rnr O2 2 </Supp> 
Duplicate O/N cultures in LB with 15 mg/L chloramphenicol each of strains pCA24N,-gfp / DA4201 , Svi3-3 comp . ( recoded Svi3-3 ) / DA4201 and pORF1/DA4201 were diluted 1:100 into two , four and four cultures of 20 mL M9 + <Supp> 0.2 % glucose </Supp> with 5 μg/mL chloramphenicol . The pCA24N,-gfp / DA4201 cultures and two cultures each of Svi3-3 comp . ( recoded Svi3-3 ) / DA4201 and pORF1/DA4201 were supplemented by 50 μM IPTG . The cells were grown to OD 0.15-0.2 and cells were withdrawn for RNA extraction and whole cell proteomics . 
Each bacteria pellet from a 25 ml culture ( OD600 ~ 0.3 ) was homogeneously resuspended in 200 µl of Buffer A -LSB- 10 mM Tris pH 8.0 ; 20 % Sucrose ; 100 mM NaCl -RSB- supplemented with 200 U SUPERase • In ™ RNase Inhibitor , by pipetting . 50 µl of Buffer B -LSB- 50 mM EDTA ; 120 mM Tris pH 8.0 -RSB- supplemented with 1 µl Ready-Lyse ™ Lysozyme Solution ( Epicentre , cat . R1810M ) were added dropwise , and the vial was gently tilted 5 times to ensure homogenous mixing . The sample was then incubated 1 minute at room temperature . 250 µl of Buffer C -LSB- 0.5 % Tween-20 : <Supp> 0.4 % NaDOC ; 2 M NaCl </Supp> ; 10 mM EDTA -RSB- were immediately added dropwise . The sample was then incubated 5 minutes at room temperature . At this stage the solution clears considerably without increasing its viscosity , and nucleoid becomes visible . Using a cut P1000 pipette tip , the whole sample was gently layered on the top of a 5-30 % w/v sucrose gradient -LSB- 10 mM Tris pH 8.0 <Supp> ; 1 M NaCl ; 1 mM EDTA ; 1 mM DTT </Supp> -RSB- , and centrifuged at 17,000 RPM in a SW55Ti rotor ( Beckman Coulter , cat . 342194 ) for 9 minutes ( 4 °C ) . After centrifugation , the nucleoid fraction was collected using a syringe with a 18G blunt fill needle , and transferred to a new centrifuge tube . The remaining gradient was assumed to represent the cytosolic fraction . The nucleoid was then resuspended in 2.5 ml Wash & Resuspension buffer -LSB- 40 mM Tris pH 7.5 ; <Supp> 150 mM KCl ; 10 mM MgCl2 ; 1 mM DTT </Supp> ; 0.01 % Triton X-100 -RSB- supplemented with 200 U SUPERase • In ™ RNase Inhibitor , pulse vortexed for 5 seconds , and then centrifuged at 28,000 RPM in a SW55Ti rotor for 30 minutes ( 0 °C ) . After centrifugation the supernatant was decanted , and the nucleoid pellet was washed twice with 2 ml of Wash & Resuspension buffer , taking care not to disturb it . The nucleoid was then resuspended in 500 µl Wash & Resuspension buffer , and solubilized by addition of 0.1 gr acid-washed glass beads ( Sigma , cat . G1145 ) , and shaking for 5 minutes in a TissueLyser ( QIAGEN ) . For each 100 µl of purified nucleoids ( or cytosolic fraction ) , 1 ml of TRIzol ® Reagent ( Invitrogen , cat . 15596-018 ) was added , and RNA was extracted following manufacturer 's instructions . RNA was analyzed on a 2100 Bioanalyzer ( Agilent ) . In all experiments , RNA from cytosolic fraction ( corresponding to mature RNA species ) had RIN > 9.5 . Total RNA yield from nucleoid fraction was ~ 6 % of the total RNA content . 
Each strain was inoculated from the frozen stock into 10 mL of M9 medium for preculture . Five-microliter aliquots of preculture medium cells were inoculated into the <Med> fresh minimal media </Med> , M9 with 5 % ( v/v ) ethanol in 10 mL test tube with screw cap and cultured for 10 generations . When OD600nm reached 0.05 within the exponential growth phase , cell were collected . 
EC18n018 hfq + <Supp> rpoE overexpression 20 min </Supp> 
EC18n019 hfq - rpoE overexpression <Supp> 20 min </Supp> 
EC18n136 hfq + <Supp> rpoE overexpression 20 min </Supp> 
Ec18n137 hfq - rpoE overexpression <Supp> 20 min </Supp> 
EC18n139 hfq + <Supp> rpoE overexpression 20 min </Supp> 
EC18n140 hfq - rpoE overexpression <Supp> 20 min </Supp> 
Eco 50ng - <Air> 25 % </Air> 
Eco 50ng - <Air> 32.5 % </Air> 
Eco 50ng - <Air> 5 % </Air> 
Eco 50ng - <Supp> 20 % </Supp> 
Eco 5ng - <Air> 25 % </Air> 
Eco 5ng - <Air> 32.5 % </Air> 
Eco 5ng - <Air> 5 % </Air> 
Eco 5ng - <Supp> 20 % </Supp> 
E.coli _ 0 % tannin _ <Supp> # 2 </Supp> 
E. coli 2 <Supp> % NaCl </Supp> 
E. coli AcrB <Gtype> Multidrug Efflux Mutant </Gtype> 
Ecoli _ <Air> Anaerobic growth in M9 + glucose , reference Genomic DNA T1 </O> 
Ecoli _ <Air> Anaerobic growth in M9 + glucose , reference Genomic DNA T2 </O> 
Ecoli _ <Air> Anaerobic growth in M9 + glucose , reference Genomic DNA T3 </O> 
Ecoli _ <Air> Anaerobic growth in M9 + glucose , reference Genomic DNA T4 </O> 
Ecoli _ <Air> Anaerobic growth in M9 + glucose , reference Genomic DNA T5 </O> 
Ecoli _ <Air> Anaerobic growth in M9 + glucose , reference Genomic DNA T6 </O> 
Ecoli _ <Air> Anaerobic growth in M9 + </O> <Supp> glucose + fumarate , reference Genomic DNA T1 </O> 
Ecoli _ <Air> Anaerobic growth in M9 + </O> <Supp> glucose + fumarate , reference Genomic DNA T2 </O> 
Ecoli _ <Air> Anaerobic growth in M9 + </O> <Supp> glucose + fumarate , reference Genomic DNA T3 </O> 
Ecoli _ <Air> Anaerobic growth in M9 + </O> <Supp> glucose + fumarate , reference Genomic DNA T4 </O> 
Ecoli _ <Air> Anaerobic growth in M9 + </O> <Supp> glucose + fumarate , reference Genomic DNA T5 </O> 
Ecoli _ <Air> Anaerobic growth in M9 + </O> <Supp> glucose + fumarate , reference Genomic DNA T6 </O> 
Ecoli _ <Air> Anaerobic growth in M9 + </O> <Supp> glucose + fumarate vs </O> <Air> Aerobic <Med> OD 0.4 T1 </Med> 
Ecoli _ <Air> Anaerobic growth in M9 + </O> <Supp> glucose + fumarate vs </O> <Air> Aerobic <Med> OD 0.4 T2 </Med> 
Ecoli _ <Air> Anaerobic growth in M9 + </O> <Supp> glucose + fumarate vs </O> <Air> Aerobic <Med> OD 0.4 T3 </Med> 
Ecoli _ <Air> Anaerobic growth in M9 + </O> <Supp> glucose + fumarate vs </O> <Air> Aerobic <Med> OD 0.4 T4 </Med> 
Ecoli _ <Air> Anaerobic growth in M9 + </O> <Supp> glucose + fumarate vs </O> <Air> Aerobic <Med> OD 0.4 T5 </Med> 
Ecoli _ <Air> Anaerobic growth in M9 + </O> <Supp> glucose + fumarate vs </O> <Air> Aerobic <Med> OD 0.4 T6 </Med> 
Ecoli _ <Air> Anaerobic growth in M9 + </O> <Supp> glucose vs </O> <Air> Aerobic <Med> OD 0.4 T1 </Med> 
Ecoli _ <Air> Anaerobic growth in M9 + </O> <Supp> glucose vs </O> <Air> Aerobic <Med> OD 0.4 T2 </Med> 
Ecoli _ <Air> Anaerobic growth in M9 + </O> <Supp> glucose vs </O> <Air> Aerobic <Med> OD 0.4 T3 </Med> 
Ecoli _ <Air> Anaerobic growth in M9 + </O> <Supp> glucose vs </O> <Air> Aerobic <Med> OD 0.4 T4 </Med> 
Ecoli _ <Air> Anaerobic growth in M9 + </O> <Supp> glucose vs </O> <Air> Aerobic <Med> OD 0.4 T5 </Med> 
Ecoli _ <Air> Anaerobic growth in M9 + </O> <Supp> glucose vs </O> <Air> Aerobic <Med> OD 0.4 T6 </Med> 
E. coli and S. Typhimurium cells ( at mid-exponential growth phase ) were fixed with formaldehyde ( 1 % final concentration ) for <Supp> 20 min </Supp> at 30 °C with shaking . The crosslinking reaction was then quenched by the addition of glycine ( 0.33 M final concentrationg ) for 5 minutes at room temperature with gentle mixing . Cells where then lysed on ice with lysozyme and sonication . 
E. Coli ArgR ChIP DNA <Supp> Arginine 1 </O> 
E. Coli ArgR ChIP DNA <Supp> Arginine 2 </O> 
E. Coli ArgR ChIP DNA <Supp> NH4Cl 1 </O> 
E. Coli ArgR ChIP DNA <Supp> NH4Cl 2 </O> 
E. coli ATCC 25922 marR deletion + <Supp> QnrS replicate 1 </Supp> 
E. coli ATCC 25922 marR deletion + <Supp> QnrS replicate 2 </Supp> 
E. coli ATCC 25922 Ser83Leu + <Supp> QnrS replicate 1 </Supp> 
E. coli ATCC 25922 Ser83Leu + <Supp> QnrS replicate 2 </Supp> 
E. coli BL21 ( DE3 ) cells expressing <Gtype> wild-type M.HpyAVIB </Gtype> 
E. coli CC72 was grown in water bath to early-exponential phase ( OD600 0.2 ) at <Temp> 37 °C </Temp> in LB medium . 
E.coli cells at 1.5 hrs after induction with <Supp> 0.1 mM IPTG </Supp> 
E.coli cells at 1.5 hrs after induction with <Supp> 0 mM IPTG </Supp> 
E.coli cells at 1.5 hrs after induction with <Supp> 1.0 mM IPTG </Supp> 
E.coli cells at 3.5 hrs after induction with <Supp> 0.1 mM IPTG </Supp> 
E.coli cells at 3.5 hrs after induction with <Supp> 0 mM IPTG </Supp> 
E.coli cells at 3.5 hrs after induction with <Supp> 1.0 mM IPTG </Supp> 
E.coli cells at the <Supp> time of IPTG induction </Supp> 
E. coli cells grown to mid-exponential phase after 6-8 generations after stationary phase in <Med> M9 minimal medium + </Med> <Supp> 0.4 % glucose </Supp> . 
E.coli cells grown with aeration in <Med> LB media </Med> at 37º C until early log phase ( 0.4 ) and were treated with/without 200 mM glyphosate for 1 h , after that the cells were harvested to extract RNA . LB medium recipe is as follow : 10g tryptone , 5g yeast extract , 10g NaCl per 1 liter . 
E. coli cells were grown at 22 °C , 30 °C and <Temp> 37 °C </Temp> in either Lennox Broth ( LB ) or liquid minimal medium A supplemented with 0.12 % casamino acids and 0.4 % glucose . The cultures were grown to OD600 = 0.2 ( early exponential ) or 2 ( stationary phase ) . 
E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 
E. coli cells with or without BnTR1 were transferred and incubated at <Temp> 37 °C </Temp> and 42 °C for 1 hour , respectively 
E. coli CFT073 carrying either pBAD or pBAD-tosR-his6 were cultured overnight in biological triplicates in LB medium containing ampicillin ( 100 µg/ml ) . Cultures were diluted 1:100 into fresh LB medium containing 10 mM L-arabinose and ampicillin and cultured at <Temp> 37 °C </Temp> with aeration . A 400 µL sample was collected between OD600 0.46-0.96 , and stabilized by the immediate addition of 800 µl of RNAprotect ( Qiagen ) . 
E. coli CMA540 ( MG1693 <Gtype> ∆ hfq : : cat ) </Gtype> 
E. coli _ control _ <Supp> 30 min </Supp> 
E.coli _ control _ <Supp> repA _ </O> <Phase> t1 
E.coli _ control _ <Supp> repA _ </O> <Phase> t2 
E.coli _ control _ <Supp> repA _ </O> <Phase> t3 
E.coli _ control _ <Supp> repB _ </O> <Phase> t1 
E.coli _ control _ <Supp> repB _ </O> <Phase> t2 
E.coli _ control _ <Supp> repB _ </O> <Phase> t3 
E.coli _ control _ <Supp> repC _ </O> <Phase> t1 
E.coli _ control _ <Supp> repC _ </O> <Phase> t2 
E.coli _ control _ <Supp> repC _ </O> <Phase> t3 
E. coli CRP N strain _ <Supp> acetate _ </O> <Phase> exponential phase </Phase> _ <Phase> repl1 
E. coli CRP N strain _ <Supp> acetate _ </O> <Phase> exponential phase </Phase> _ <Phase> repl2 
E. coli CRP N strain _ <Supp> acetate _ </O> <Phase> stationary phase </Phase> _ <Phase> repl1 
E. coli CRP N strain _ <Supp> acetate _ </O> <Phase> stationary phase </Phase> _ <Phase> repl2 
E. coli CRP N strain _ <Supp> glucose _ </O> <Phase> exponential phase </Phase> _ <Phase> repl1 
E. coli CRP N strain _ <Supp> glucose _ </O> <Phase> exponential phase </Phase> _ <Phase> repl2 
E. coli CRP N strain _ <Supp> glucose _ </O> <Phase> stationary phase </Phase> _ <Phase> repl1 
E. coli CRP N strain _ <Supp> glucose _ </O> <Phase> stationary phase </Phase> _ <Phase> repl2 
E. coli CRP Q strain _ <Supp> acetate _ </O> <Phase> exponential phase </Phase> _ <Phase> repl1 
E. coli CRP Q strain _ <Supp> acetate _ </O> <Phase> exponential phase </Phase> _ <Phase> repl2 
E. coli CRP Q strain _ <Supp> acetate _ </O> <Phase> stationary phase </Phase> _ <Phase> repl1 
E. coli CRP Q strain _ <Supp> acetate _ </O> <Phase> stationary phase </Phase> _ <Phase> repl2 
E. coli CRP Q strain _ <Supp> glucose _ </O> <Phase> exponential phase </Phase> _ <Phase> repl1 
E. coli CRP Q strain _ <Supp> glucose _ </O> <Phase> exponential phase </Phase> _ <Phase> repl2 
E. coli CRP Q strain _ <Supp> glucose _ </O> <Phase> stationary phase </Phase> _ <Phase> repl1 
E. coli CRP Q strain _ <Supp> glucose _ </O> <Phase> stationary phase </Phase> _ <Phase> repl2 
E. coli CRP R strain _ <Supp> acetate _ </O> <Phase> exponential phase </Phase> _ <Phase> repl1 
E. coli CRP R strain _ <Supp> acetate _ </O> <Phase> exponential phase </Phase> _ <Phase> repl2 
E. coli CRP R strain _ <Supp> acetate _ </O> <Phase> stationary phase </Phase> _ <Phase> repl1 
E. coli CRP R strain _ <Supp> acetate _ </O> <Phase> stationary phase </Phase> _ <Phase> repl2 
E. coli CRP R strain _ <Supp> glucose _ </O> <Phase> exponential phase </Phase> _ <Phase> repl1 
E. coli CRP R strain _ <Supp> glucose _ </O> <Phase> exponential phase </Phase> _ <Phase> repl2 
E. coli CRP R strain _ <Supp> glucose _ </O> <Phase> stationary phase </Phase> _ <Phase> repl1 
E. coli CRP R strain _ <Supp> glucose _ </O> <Phase> stationary phase </Phase> _ <Phase> repl2 
e.coli culture protocol : <Gtype> conditioned Caco-2 cell medium </Gtype> 
e.coli culture protocol : <Med> fresh medium </Med> 
E. coli cultures were grown at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> with glucose as the primary carbon source and harvested at mid exponetial phase . <Air> Aerobic E. coli conditions were grown in shake flasks and anaerobic conditions were grown in anoxic serum bottles . Condition specific media supplementation was added as described else where . </O> 
E. coli cultutures were grown in M9 media using standard protocol , to log phase ( <OD> OD600 of 0.7-0.8 ) </OD> 
Ecoli _ Early Recovery in <Med> LB T1 </Med> 
Ecoli _ Early Recovery in <Med> LB T2 </Med> 
Ecoli _ Early Recovery in <Med> LB T3 </Med> 
Ecoli _ Early Recovery in <Med> LB T4 </Med> 
Ecoli _ Early Recovery in <Med> LB T5 </Med> 
Ecoli _ Early Recovery in <Med> LB T6 </Med> 
Ecoli _ Early Recovery in <Med> LB T7 </Med> 
E. coli galT mutant cells were cultivated in 125-mL corning flasks containing <Supp> 30 mL </Supp> <Med> of M63 minimal medium </Med> plus glycerol ( final 0.3 % ) at <Temp> 37 °C </Temp> . 
E. coli _ gentamicin _ <Supp> 30 min </Supp> 
E. coli , glucose limitation , <Supp> 30 min </Supp> after depletion of extracellular acetate 
ecoli _ <Gtype> aerobicanaerobic _ </O> <Supp> 0 min </Supp> 
ecoli _ <Gtype> aerobicanaerobic _ </O> <Supp> 15 min </Supp> 
ecoli _ <Gtype> aerobicanaerobic _ </O> <Supp> 25 min </Supp> _ rep1 
ecoli _ <Gtype> aerobicanaerobic _ </O> <Supp> 25 min </Supp> _ rep2 
ecoli _ <Gtype> aerobicanaerobic _ </O> <Supp> 35 min </Supp> 
ecoli _ <Gtype> aerobicanaerobic _ </O> <Supp> 45 min </Supp> 
ecoli _ <Gtype> aerobicanaerobic _ </O> <Supp> 55 min </Supp> _ rep1 
ecoli _ <Gtype> aerobicanaerobic _ </O> <Supp> 55 min </Supp> _ rep2 
ecoli _ <Gtype> aerobicanaerobic _ </O> <Supp> 5 min </Supp> _ Rep1 
ecoli _ <Gtype> aerobicanaerobic _ </O> <Supp> 5 min </Supp> _ rep2 
Ecoli _ <Gtype> Ampicillin treatment T1 </Gtype> 
ecoli _ <Gtype> D1 _ 2x _ v2 </O> 
ecoli _ <Gtype> D1 _ 3x _ v2 </O> 
ecoli _ <Gtype> D1 _ 4x _ v2 </O> 
Ecoli _ <Gtype> dFNR _ rep1 _ </O> <Air> anaerobic 
Ecoli _ <Gtype> dFNR _ rep2 _ </O> <Air> anaerobic 
ecoli _ <Gtype> EDL933 _ 2x _ v2 </O> 
ecoli _ <Gtype> EDL933 _ 3x _ v2 </O> 
ecoli _ <Gtype> EDL933 _ 4x _ v2 </O> 
E.coli _ <Gtype> ethanol _ repA _ </O> <Phase> t1 
E.coli _ <Gtype> ethanol _ repA _ </O> <Phase> t2 
E.coli _ <Gtype> ethanol _ repA _ </O> <Phase> t3 
E.coli _ <Gtype> ethanol _ repB _ </O> <Phase> t1 
E.coli _ <Gtype> ethanol _ repB _ </O> <Phase> t2 
E.coli _ <Gtype> ethanol _ repB _ </O> <Phase> t3 
E.coli _ <Gtype> ethanol _ repC _ </O> <Phase> t1 
E.coli _ <Gtype> ethanol _ repC _ </O> <Phase> t2 
E.coli _ <Gtype> ethanol _ repC _ </O> <Phase> t3 
Ecoli _ <Gtype> gyrArparCr _ Norfloxacin ( 15 ug/ml ) treatment T1 </O> 
Ecoli _ <Gtype> gyrArparCr _ Norfloxacin ( 15 ug/ml ) treatment T2 </O> 
Ecoli _ <Gtype> gyrArparCr _ Norfloxacin ( 15 ug/ml ) treatment T3 </O> 
Ecoli _ <Gtype> gyrArparCr _ Norfloxacin ( 15 ug/ml ) treatment T4 </O> 
Ecoli _ <Gtype> gyrArparCr _ Norfloxacin ( 15 ug/ml ) treatment T5 </O> 
Ecoli _ <Gtype> gyrArparCr _ Norfloxacin ( 50 ug/ml ) treatment T1 </O> 
Ecoli _ <Gtype> gyrArparCr _ Norfloxacin ( 50 ug/ml ) treatment T2 </O> 
Ecoli _ <Gtype> gyrArparCr _ Norfloxacin ( 50 ug/ml ) treatment T3 </O> 
Ecoli _ <Gtype> gyrArparCr _ Norfloxacin ( 50 ug/ml ) treatment T4 </O> 
Ecoli _ <Gtype> gyrArparCr _ Norfloxacin ( 50 ug/ml ) treatment T5 </O> 
E.coli _ <Gtype> heat _ dynamic _ 1 </O> 
E.coli _ <Gtype> heat _ dynamic _ 2 </O> 
E.coli _ <Gtype> IVT-RNA _ </O> <Gtype> sigmaS 
E.coli _ <Gtype> IVT-RNA _ </O> <Gtype> sigmaS-2 
E.coli _ <Gtype> IVT-RNA _ </O> <Phase> sigma70-1 
E.coli _ <Gtype> IVT-RNA _ </O> <Phase> sigma70-2 
ecoli _ <Gtype> k12 _ 30C _ f _ 1 </O> 
ecoli _ <Gtype> k12 _ 30C _ f _ 2 </O> 
ecoli _ <Gtype> k12 _ 30C _ f _ 3 </O> 
ecoli _ <Gtype> k12 _ 30C _ m _ 1 </O> 
ecoli _ <Gtype> k12 _ 30C _ m _ 2 </O> 
ecoli _ <Gtype> k12 _ 30C _ m _ 3 </O> 
ecoli _ <Gtype> k12 _ 42C _ </O> <Supp> 10 min </Supp> _ f _ 1 
ecoli _ <Gtype> k12 _ 42C _ </O> <Supp> 10 min </Supp> _ f _ 2 
ecoli _ <Gtype> k12 _ 42C _ </O> <Supp> 10 min </Supp> _ f _ 3 
ecoli _ <Gtype> k12 _ 42C _ </O> <Supp> 10 min </Supp> _ m _ 1 
ecoli _ <Gtype> k12 _ 42C _ </O> <Supp> 10 min </Supp> _ m _ 2 
ecoli _ <Gtype> k12 _ 42C _ </O> <Supp> 10 min </Supp> _ m _ 3 
ecoli _ <Gtype> k12 _ 42C _ </O> <Supp> 20 min </Supp> _ f _ 1 
ecoli _ <Gtype> k12 _ 42C _ </O> <Supp> 20 min </Supp> _ f _ 2 
ecoli _ <Gtype> k12 _ 42C _ </O> <Supp> 20 min </Supp> _ f _ 3 
ecoli _ <Gtype> k12 _ 42C _ </O> <Supp> 20 min </Supp> _ m _ 1 
ecoli _ <Gtype> k12 _ 42C _ </O> <Supp> 20 min </Supp> _ m _ 2 
ecoli _ <Gtype> k12 _ 42C _ </O> <Supp> 20 min </Supp> _ m _ 3 
ecoli _ <Gtype> k12 _ </O> <Gtype> pBAD _ 30C _ m _ 1 </O> 
ecoli _ <Gtype> k12 _ </O> <Gtype> pBAD _ 30C _ m _ 2 </O> 
ecoli _ <Gtype> k12 _ </O> <Gtype> pBAD _ 30C _ m _ 3 </O> 
ecoli _ <Gtype> k12 _ </O> <Gtype> pBAD _ 30C _ m _ 4 </O> 
ecoli _ <Gtype> k12 _ </O> <Gtype> pBADsigma32I54N _ 30C _ f _ 1 </O> 
ecoli _ <Gtype> k12 _ </O> <Gtype> pBADsigma32I54N _ 30C _ f _ 2 </O> 
ecoli _ <Gtype> k12 _ </O> <Gtype> pBADsigma32I54N _ 30C _ m _ 1 </O> 
ecoli _ <Gtype> k12 _ </O> <Gtype> pBADsigma32I54N _ 30C _ m _ 2 </O> 
ecoli _ <Gtype> k12 _ </O> <Gtype> pBADsigma32wt _ 30C _ f _ 1 </O> 
ecoli _ <Gtype> k12 _ </O> <Gtype> pBADsigma32wt _ 30C _ f _ 2 </O> 
ecoli _ <Gtype> k12 _ </O> <Gtype> pBADsigma32wt _ 30C _ f _ 3 </O> 
ecoli _ <Gtype> k12 _ </O> <Gtype> pBADsigma32wt _ 30C _ m _ 1 </O> 
ecoli _ <Gtype> k12 _ </O> <Gtype> pBADsigma32wt _ 30C _ m _ 2 </O> 
ecoli _ <Gtype> k12 _ </O> <Gtype> pBADsigma32wt _ 30C _ m _ 3 </O> 
ecoli _ <Gtype> k12 _ pBAD _ 30C _ f _ 1 </O> 
ecoli _ <Gtype> k12 _ pBad _ 30C _ f _ 2 </O> 
ecoli _ <Gtype> k12 _ pBAD _ 30C _ f _ 3 </O> 
ecoli _ <Gtype> k12 _ pBAD _ 30C _ f _ 4 </O> 
Ecoli _ <Gtype> ko _ </O> <Supp> phoB _ 1 % </Supp> _ isobutanol _ Sample1 _ <Gtype> TechRep2 
Ecoli _ <Gtype> ko _ </O> <Supp> ubiE _ 1 % </Supp> _ isobutanol _ Sample1 _ <Gtype> TechRep1 
E.coli _ <Gtype> LB _ </O> <Phase> rep3 
E.coli _ <Gtype> LB _ rep2 </O> 
E.coli _ <Gtype> log _ dynamic _ 1 </O> 
E.coli _ <Gtype> log _ dynamic _ 2 </O> 
E.coli _ <Gtype> log _ dynamic _ 3 </O> 
E.coli _ <Gtype> log _ rif _ 1 </O> 
E.coli _ <Gtype> log _ rif _ 3 </O> 
E.coli _ <Gtype> Na10 _ </O> <Phase> rep3 
E.coli _ <Gtype> Na10 _ rep1 </O> 
E.coli _ <Gtype> Na10 _ rep2 </O> 
E.coli _ <Gtype> Na20 _ </O> <Phase> rep3 
E.coli _ <Gtype> Na20 _ rep1 </O> 
E.coli _ <Gtype> Na20 _ rep2 </O> 
E.coli _ <Gtype> Na45 _ </O> <Phase> rep3 
E.coli _ <Gtype> Na45 _ rep1 </O> 
E.coli _ <Gtype> Na45 _ rep2 </O> 
E.coli _ <Gtype> nitrogen _ dynamic _ 1 </O> 
E.coli _ <Gtype> nitrogen _ dynamic _ 2 </O> 
E.coli _ <Gtype> ∆ ompR pH 5.6 C </Gtype> 
E.coli _ <Gtype> ∆ ompR pH 5.6 </Gtype> A 
E.coli _ <Gtype> ∆ ompR pH 5.6 </Gtype> B 
E.coli _ <Gtype> ∆ ompR pH 7.2 +15 % </Gtype> sucrose A 
E.coli _ <Gtype> ∆ ompR pH 7.2 +15 % </Gtype> sucrose B 
Ecoli _ <Gtype> pUC expression OD 0.5 </Gtype> 
Ecoli _ <Gtype> pUC expression OD 0.9 </Gtype> 
E.coli _ <Gtype> RviaT1 _ </O> <Supp> SR1 
E.coli _ <Gtype> RviaT1 _ </O> <Supp> SR2 
E.coli _ <Gtype> RviaT1 _ </O> <Supp> SR3 
E.coli _ <Gtype> RviaT2 _ </O> <Supp> SR1 
E.coli _ <Gtype> RviaT2 _ </O> <Supp> SR2 
E.coli _ <Gtype> RviaT2 _ </O> <Supp> SR3 
E.coli _ <Gtype> RviaT3 _ </O> <Supp> SR1 
E.coli _ <Gtype> RviaT3 _ </O> <Supp> SR2 
E.coli _ <Gtype> RviaT3 _ </O> <Supp> SR3 
E.coli _ <Gtype> RviaT4 _ </O> <Supp> SR1 
E.coli _ <Gtype> RviaT4 _ </O> <Supp> SR2 
E.coli _ <Gtype> RviaT4 _ </O> <Supp> SR3 
E.coli _ <Gtype> RviaT5 _ </O> <Supp> SR2 
E.coli _ <Gtype> RviaT5 _ </O> <Supp> SR3 
E.coli _ <Gtype> RviaT6 _ </O> <Supp> SR2 
E.coli _ <Gtype> RviaT6 _ </O> <Supp> SR3 
E.coli _ <Gtype> RviaT7 _ </O> <Supp> SR2 
E.coli _ <Gtype> RviaT7 _ </O> <Supp> SR3 
E.coli _ <Gtype> RviaT8 _ </O> <Supp> SR2 
E.coli _ <Gtype> RviaT8 _ </O> <Supp> SR3 
E.coli _ <Gtype> T1viaR _ </O> <Supp> SR1 
E.coli _ <Gtype> T1viaR _ </O> <Supp> SR2 
E.coli _ <Gtype> T1viaR _ </O> <Supp> SR3 
E.coli _ <Gtype> T2viaR _ </O> <Supp> SR1 
E.coli _ <Gtype> T2viaR _ </O> <Supp> SR2 
E.coli _ <Gtype> T2viaR _ </O> <Supp> SR3 
E.coli _ <Gtype> T3viaR _ </O> <Supp> SR1 
E.coli _ <Gtype> T3viaR _ </O> <Supp> SR2 
E.coli _ <Gtype> T3viaR _ </O> <Supp> SR3 
E.coli _ <Gtype> T4viaR _ </O> <Supp> SR1 
E.coli _ <Gtype> T4viaR _ </O> <Supp> SR2 
E.coli _ <Gtype> T4viaR _ </O> <Supp> SR3 
E.coli _ <Gtype> T5viaR _ </O> <Supp> SR2 
E.coli _ <Gtype> T5viaR _ </O> <Supp> SR3 
E.coli _ <Gtype> T6viaR _ </O> <Supp> SR2 
E.coli _ <Gtype> T6viaR _ </O> <Supp> SR3 
E.coli _ <Gtype> T7viaR _ </O> <Supp> SR2 
E.coli _ <Gtype> T7viaR _ </O> <Supp> SR3 
E.coli _ <Gtype> T8viaR _ </O> <Supp> SR2 
E.coli _ <Gtype> T8viaR _ </O> <Supp> SR3 
ecoli _ <Gtype> W3110 _ 2x _ v2 </O> 
ecoli _ <Gtype> W3110 _ 3x _ v2 </O> 
ecoli _ <Gtype> W3110 _ 4x _ v2 </O> 
Ecoli _ <Gtype> wildtype _ 1 % _ butanol _ Sample1 _ </O> <Gtype> TechRep1 
Ecoli _ <Gtype> wildtype _ 1 % _ butanol _ Sample1 _ </O> <Gtype> TechRep2 
Ecoli _ <Gtype> wildtype _ 1 % _ butanol _ Sample2 _ </O> <Gtype> TechRep1 
Ecoli _ <Gtype> wildtype _ 1 % _ butanol _ Sample2 _ </O> <Gtype> TechRep2 
Ecoli _ <Gtype> wildtype _ 1 % _ butanol _ Sample3 _ </O> <Gtype> TechRep1 
Ecoli _ <Gtype> wildtype _ 1 % _ butanol _ Sample3 _ </O> <Gtype> TechRep2 
Ecoli _ <Gtype> wildtype _ 1 % _ butanol _ Sample4 _ </O> <Gtype> TechRep1 
Ecoli _ <Gtype> wildtype _ 1 % _ butanol _ Sample4 _ </O> <Gtype> TechRep2 
Ecoli _ <Gtype> wildtype _ 1 % _ isobutanol _ Sample1 _ </O> <Gtype> TechRep1 
Ecoli _ <Gtype> wildtype _ 1 % _ isobutanol _ Sample1 _ </O> <Gtype> TechRep2 
Ecoli _ <Gtype> wildtype _ 1 % _ isobutanol _ Sample2 _ </O> <Gtype> TechRep1 
Ecoli _ <Gtype> wildtype _ 1 % _ isobutanol _ Sample2 _ </O> <Gtype> TechRep2 
Ecoli _ <Gtype> wildtype _ 1 % _ isobutanol _ Sample3 _ </O> <Gtype> TechRep1 
Ecoli _ <Gtype> wildtype _ 1 % _ isobutanol _ Sample3 _ </O> <Gtype> TechRep2 
Ecoli _ <Gtype> wildtype _ 1 % _ isobutanol _ Sample4 _ </O> <Gtype> TechRep1 
Ecoli _ <Gtype> wildtype _ 1 % _ isobutanol _ Sample4 _ </O> <Gtype> TechRep2 
Ecoli _ <Gtype> wildtype _ 1 % _ isobutanol _ Sample5 _ </O> <Gtype> TechRep1 
Ecoli _ <Gtype> wildtype _ 1 % _ isobutanol _ Sample5 _ </O> <Gtype> TechRep2 
Ecoli _ <Gtype> wildtype _ 3 % _ ethanol _ Sample1 _ </O> <Gtype> TechRep1 
Ecoli _ <Gtype> wildtype _ 3 % _ ethanol _ Sample1 _ </O> <Gtype> TechRep2 
Ecoli _ <Gtype> wildtype _ 3 % _ ethanol _ Sample2 _ </O> <Gtype> TechRep1 
Ecoli _ <Gtype> wildtype _ 3 % _ ethanol _ Sample2 _ </O> <Gtype> TechRep2 
Ecoli _ <Gtype> wildtype _ 3 % _ ethanol _ Sample3 _ </O> <Gtype> TechRep1 
Ecoli _ <Gtype> wildtype _ 3 % _ ethanol _ Sample3 _ </O> <Gtype> TechRep2 
Ecoli _ <Gtype> wildtype _ 3 % _ ethanol _ Sample4 _ </O> <Gtype> TechRep1 
Ecoli _ <Gtype> wildtype _ 3 % _ ethanol _ Sample4 _ </O> <Gtype> TechRep2 
Ecoli _ <Gtype> wildtype _ calibration _ </O> <Supp> Sample1 _ </O> <Gtype> TechRep1 
Ecoli _ <Gtype> wildtype _ calibration _ </O> <Supp> Sample1 _ </O> <Gtype> TechRep2 
Ecoli _ <Gtype> wildtype _ calibration _ Sample2 _ </O> <Gtype> TechRep1 
Ecoli _ <Gtype> wildtype _ calibration _ Sample2 _ </O> <Gtype> TechRep2 
E. coli <Gtype> Wild type </Gtype> _ <Supp> acetate _ </O> <Phase> exponential phase </Phase> _ <Phase> repl1 
E. coli <Gtype> Wild type </Gtype> _ <Supp> acetate _ </O> <Phase> exponential phase </Phase> _ <Phase> repl2 
E. coli <Gtype> Wild type </Gtype> _ <Supp> acetate _ </O> <Phase> stationary phase </Phase> _ <Phase> repl1 
E. coli <Gtype> Wild type </Gtype> _ <Supp> acetate _ </O> <Phase> stationary phase </Phase> _ <Phase> repl2 
E. coli <Gtype> Wild type </Gtype> _ <Supp> glucose _ </O> <Phase> exponential phase </Phase> _ <Phase> repl1 
E. coli <Gtype> Wild type </Gtype> _ <Supp> glucose _ </O> <Phase> exponential phase </Phase> _ <Phase> repl2 
E. coli <Gtype> Wild type </Gtype> _ <Supp> glucose _ </O> <Phase> stationary phase </Phase> _ <Phase> repl1 
E. coli <Gtype> Wild type </Gtype> _ <Supp> glucose _ </O> <Phase> stationary phase </Phase> _ <Phase> repl2 
Ecoli _ <Gtype> wild-type _ rep1 _ </O> <Air> anaerobic 
Ecoli _ <Gtype> wild-type _ rep2 _ </O> <Air> anaerobic 
Ecoli _ <Gtype> WT _ 100uM _ </O> <Supp> KCN _ Sample1 _ </O> <Gtype> TechRep1 
Ecoli _ <Gtype> WT _ 100uM _ </O> <Supp> KCN _ Sample1 _ </O> <Gtype> TechRep2 
Ecoli _ <Gtype> WT _ 100uM _ </O> <Supp> KCN _ Sample2 _ </O> <Gtype> TechRep1 
Ecoli _ <Gtype> WT _ 100uM _ </O> <Supp> KCN _ Sample2 _ </O> <Gtype> TechRep2 
Ecoli _ <Gtype> WT _ 100uM _ </O> <Supp> KCN _ Sample3 _ </O> <Gtype> TechRep1 
Ecoli _ <Gtype> WT _ 100uM _ </O> <Supp> KCN _ Sample3 _ </O> <Gtype> TechRep2 
Ecoli _ <Gtype> WT _ 100uM _ </O> <Supp> KCN _ Sample4 _ </O> <Gtype> TechRep1 
Ecoli _ <Gtype> WT _ 100uM _ </O> <Supp> KCN _ Sample4 _ </O> <Gtype> TechRep2 
Ecoli _ <Gtype> WT _ </O> <Technique> RNAseq 
E.coli _ <Gtype> WT pH 5.6 B </O> 
E.coli _ <Gtype> WT pH 5.6 C </Gtype> 
E.coli _ <Gtype> WT pH 5.6 </Gtype> A 
E.coli _ <Gtype> WT pH 7.2 +15 % </Gtype> sucrose A 
E.coli _ <Gtype> WT pH 7.2 +15 % </Gtype> sucrose B 
E.coli _ <Gtype> WT pH 7.2 +15 % sucrose C </Gtype> 
E. coli incubated with GST-fused Drosophila immune proteins for <Supp> 10 min </Supp> 
E. coli incubated with GST protein alone for <Supp> 10 min </Supp> 
E. coli K-12 BW25113/pCA24N at OD600 = 0.5 LB 37C 2 <Supp> mM IPTG suspension cell </Supp> 
E. coli K-12 BW25113/pCA24N at OD600 = 0.5 LB 37C <Supp> then 2 mM IPTG </Supp> for 15 min short time suspension cell 
E. coli K-12 BW25113/pCA24N in LB for 24 h 37oC with <Supp> 2 mM IPTG biofilm cell </Supp> 
E. coli K-12 BW25113/pCA24N-mqsR at OD600 = 0.5 LB 37C 2 <Supp> mM IPTG suspension cell </Supp> 
E. coli K-12 BW25113/pCA24N-mqsR at OD600 = 0.5 LB 37C <Supp> then 2 mM IPTG </Supp> for 15 min short time suspension cell 
E. coli K-12 BW25113/pCA24N-mqsR in LB for 24 h 37oC with <Supp> 2 mM IPTG biofilm cell </Supp> 
E. coli K12 grown in M63 glucose ( 0.2 % ) minimal media , sampled in exponential phase <OD> OD600 = 0.3 </OD> 
E. coli K12 _ <Gtype> WT _ M9 _ rep1 </O> 
E. coli K12 _ <Gtype> WT _ M9 _ rep2 </O> 
E. coli K-12 MG1655 cra-8myc tagged strains was grown to <Phase> mid-log phase </Phase> <Air> aerobically at </O> <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> , fructose and acetate . 
E. coli K-12 MG 1655 was grown in LB-Miller broth at <Temp> 37 °C </Temp> ,160 rpm to an O.D. 600 nm of 0 . 7 
E. coli K12 MG1655 was grown to <Phase> mid-log phase </Phase> ( <OD> O.D. 600nm 0.5 </OD> ) or to stationary phase ( <OD> O.D. 600nm 1.5 </OD> ) <Air> aerobically at </O> <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> or <Med> W2 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> and 0.2 % glutamine . For heatshock conditions , cells were grown to mid-log phase and incubated at 42oC for 10 min . 
E. coli K-12 MG1655 WT and Fur-8-myc tagged strains were grown to <Phase> mid-log phase </Phase> <Air> aerobically at </O> <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h . For the rifampicin-treated cultures , the rifampicin dissolved in methanol was added to a final concentration of 150 mg/mL at mid-log phase and stirred for 20 min . </O> 
E. coli K-12 MG1655 WT , and Δcra were grown to <Phase> mid-log phase </Phase> <Air> aerobically at </O> <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> , fructose and acetate . 
E. coli K-12 MG1655 WT and Δfur were grown to <Phase> mid-log phase </Phase> <Air> aerobically at </O> <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h . </O> 
E. coli K-12 MG1655 WT and ΔompR were grown to <Phase> mid-log phase </Phase> <Air> aerobically at </O> <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . Then cells were treated with <Supp> 0.3 M of NaCl </Supp> at mid-log pahse for <Supp> 30 min </Supp> with agitation . 
E. coli K-12 MG1655 WT , GadE-8-myc , GadW-8-myc , and GadX-8-myc tagged strains were grown to <Phase> mid-log phase </Phase> ( <OD> OD600 = 0.3 </OD> ) <Air> aerobically ( </O> <Agit> 250 rpm </Agit> ) at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> at <pH> pH 5.5 </pH> . 
E. coli K-12 MG1655 WT , gadE , gadW and gadX mutant cells were grown to <Phase> mid-log phase </Phase> ( <OD> OD600 = 0.3 </OD> ) <Air> aerobically ( </O> <Agit> 250 rpm </Agit> ) at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> at <pH> pH 5.5 </pH> . 
E. coli K-12 MG1655 WT , ΔoxyR , ΔsoxR , and ΔsoxS were grown to <Phase> mid-log phase </Phase> <Air> aerobically at </O> <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . Then cells were treated with 250 uM of paraquat at mid-log pahse for 20 min with agitation . 
E. coli K-12 strain BW25113 was evolved in chemostats . The cells were grown in <Med> M9 minimal media </Med> ( 5 g/L glucose ) with increasing concentrations of n-butanol . 
E. coli K12 substrain W3110 was used in this study . Bioreactor cultivations were performed using a two-compartment bioreactor system consisting of an STR ( 3L ) with a recycle loop ( PFR ) in defined medium at pH7 and <Temp> 37 °C </Temp> . Bioreactor cultivations were carried out with a minimal medium containing ( per liter ) 19.0 g glucose , 1.0 g NaH2PO4 . · 2 H2O , 2.6 g K2HPO4 , 3.8 g ( NH4 ) 2SO4 , and a trace element solution ( 0.11 g Na3C6H5O7 , 0.00835 g FeCl3 · 6 H2O , 0.00009 g ZnSO4 · 7 H2O , 0.00005 g MnSO4 · H2O , 0.0008 g CuSO4 · 5 H2O , 0.00009 g CoCl2 · 6 H2O , 0.0044 g CaCl2 · 2 H2O , 0.1 g MgSO4 · 7 H2O ) . The STR-PFR was operated as a chemostat with ammonia as the growth-limiting substrate . First , a reference steady state ( µ = 0.2 h − 1 ) was established in the STR and sampled three times during a 16 h period following establishment of the steady state . Then , the PFR was added and samples for RNA-sequencing were aquired . 
E. coli K12 _ <Supp> ybjN _ MUTANT _ M9 _ </O> <Phase> rep3 
E. coli K12 _ <Supp> ybjN _ MUTANT _ M9 _ rep1 </O> 
E. coli K12 _ <Supp> ybjN _ MUTANT _ M9 _ rep2 </O> 
E. coli K12 _ <Supp> ybjN _ OVER-EXPRESSION _ </O> <Supp> M9 _ </O> <Phase> rep3 
E. coli K12 _ <Supp> ybjN _ OVER-EXPRESSION _ </O> <Supp> M9 _ rep1 </O> 
E. coli K12 _ <Supp> ybjN _ OVER-EXPRESSION _ </O> <Supp> M9 _ rep2 </O> 
E. coli K12 ( W3110 ) , fed-batch/linear feed , glucose limitation , <Supp> 30 min </Supp> after depletion of extracellular acetate 
E.coli K12 was cultured in LB and grown at <Temp> 37 °C </Temp> 
E. coli K-12 was incubated in 5 ml LB liquid for 16 h at <Temp> 37 °C </Temp> with constant shaking , and then 100 µl of each myxotoxin dissolved in acetonitrile was added to each culture to a final concentration of 0.2 , and 2 ppm . Additional incubation was performed for 2 h. 
Ecoli ko-arcA grown in <Med> MOPS , 10 minutes after 1 % isobutanol treatment </O> 
Ecoli ko-fur grown in <Med> MOPS , 10 minutes after 1 % isobutanol treatment </O> 
Ecoli ko-ihfA grown in <Med> MOPS , 10 minutes after 1 % isobutanol treatment </O> 
Ecoli ko-phoB grown in <Med> MOPS , 10 minutes after 1 % isobutanol treatment </O> 
Ecoli _ ko _ <Supp> arcA _ 1 % </Supp> _ isobutanol _ Sample1 _ <Gtype> TechRep1 
Ecoli _ ko _ <Supp> arcA _ 1 % </Supp> _ isobutanol _ Sample1 _ <Gtype> TechRep2 
Ecoli _ ko _ <Supp> arcA _ 1 % </Supp> _ isobutanol _ Sample2 _ <Gtype> TechRep1 
Ecoli _ ko _ <Supp> arcA _ 1 % </Supp> _ isobutanol _ Sample2 _ <Gtype> TechRep2 
Ecoli _ ko _ <Supp> arcA _ 1 % </Supp> _ isobutanol _ Sample3 _ <Gtype> TechRep1 
Ecoli _ ko _ <Supp> arcA _ 1 % </Supp> _ isobutanol _ Sample3 _ <Gtype> TechRep2 
Ecoli _ ko _ <Supp> arcA _ 1 % </Supp> _ isobutanol _ Sample4 _ <Gtype> TechRep1 
Ecoli _ ko _ <Supp> arcA _ 1 % </Supp> _ isobutanol _ Sample4 _ <Gtype> TechRep2 
Ecoli _ ko _ <Supp> fur _ 1 % </Supp> _ isobutanol _ Sample1 _ <Gtype> TechRep1 
Ecoli _ ko _ <Supp> fur _ 1 % </Supp> _ isobutanol _ Sample1 _ <Gtype> TechRep2 
Ecoli _ ko _ <Supp> fur _ 1 % </Supp> _ isobutanol _ Sample2 _ <Gtype> TechRep1 
Ecoli _ ko _ <Supp> fur _ 1 % </Supp> _ isobutanol _ Sample2 _ <Gtype> TechRep2 
Ecoli _ ko _ <Supp> fur _ 1 % </Supp> _ isobutanol _ Sample3 _ <Gtype> TechRep1 
Ecoli _ ko _ <Supp> fur _ 1 % </Supp> _ isobutanol _ Sample3 _ <Gtype> TechRep2 
Ecoli _ ko _ <Supp> fur _ 1 % </Supp> _ isobutanol _ Sample4 _ <Gtype> TechRep1 
Ecoli _ ko _ <Supp> fur _ 1 % </Supp> _ isobutanol _ Sample4 _ <Gtype> TechRep2 
Ecoli _ ko _ <Supp> ihfA _ 1 % </Supp> _ isobutanol _ Sample1 _ <Gtype> TechRep1 
Ecoli _ ko _ <Supp> ihfA _ 1 % </Supp> _ isobutanol _ Sample1 _ <Gtype> TechRep2 
Ecoli _ ko _ <Supp> ihfA _ 1 % </Supp> _ isobutanol _ Sample2 _ <Gtype> TechRep1 
Ecoli _ ko _ <Supp> ihfA _ 1 % </Supp> _ isobutanol _ Sample2 _ <Gtype> TechRep2 
Ecoli _ ko _ <Supp> ihfA _ 1 % </Supp> _ isobutanol _ Sample3 _ <Gtype> TechRep1 
Ecoli _ ko _ <Supp> ihfA _ 1 % </Supp> _ isobutanol _ Sample3 _ <Gtype> TechRep2 
Ecoli _ ko _ <Supp> ihfA _ 1 % </Supp> _ isobutanol _ Sample4 _ <Gtype> TechRep1 
Ecoli _ ko _ <Supp> ihfA _ 1 % </Supp> _ isobutanol _ Sample4 _ <Gtype> TechRep2 
Ecoli _ ko _ <Supp> phoB _ 1 % </Supp> _ isobutanol _ Sample1 _ <Gtype> TechRep1 
Ecoli _ ko _ <Supp> phoB _ 1 % </Supp> _ isobutanol _ Sample2 _ <Gtype> TechRep1 
Ecoli _ ko _ <Supp> phoB _ 1 % </Supp> _ isobutanol _ Sample2 _ <Gtype> TechRep2 
Ecoli _ ko _ <Supp> phoB _ 1 % </Supp> _ isobutanol _ Sample3 _ <Gtype> TechRep1 
Ecoli _ ko _ <Supp> phoB _ 1 % </Supp> _ isobutanol _ Sample3 _ <Gtype> TechRep2 
Ecoli _ ko _ <Supp> phoB _ 1 % </Supp> _ isobutanol _ Sample4 _ <Gtype> TechRep1 
Ecoli _ ko _ <Supp> phoB _ 1 % </Supp> _ isobutanol _ Sample4 _ <Gtype> TechRep2 
Ecoli _ ko _ <Supp> ubiE _ 1 % </Supp> _ isobutanol _ Sample1 _ <Gtype> TechRep2 
Ecoli _ ko _ <Supp> ubiE _ 1 % </Supp> _ isobutanol _ Sample2 _ <Gtype> TechRep1 
Ecoli _ ko _ <Supp> ubiE _ 1 % </Supp> _ isobutanol _ Sample2 _ <Gtype> TechRep2 
Ecoli ko-ubiE grown in <Med> MOPS , 10 minutes after 1 % isobutanol treatment </O> 
Ecoli _ Late Recovery in <Med> LB T1 </Med> 
Ecoli _ Late Recovery in <Med> LB T2 </Med> 
Ecoli _ Late Recovery in <Med> LB T3 </Med> 
Ecoli _ Late Recovery in <Med> LB T4 </Med> 
Ecoli _ Late Recovery in <Med> LB T5 </Med> 
Ecoli _ Late Recovery in <Med> LB T6 </Med> 
Ecoli _ Late Recovery in <Med> LB T7 </Med> 
E. coli -LSB- K-12 MG1655 strain ( <Gversion> U00096 .2 </Gversion> ) -RSB- was grown overnight at <Temp> 30 °C </Temp> in LB medium . The resulting culture was diluted 500-fold in fresh LB medium and grown at 30 °C for 3.5 hours such that O.D. at 600 nm became 0.30-0.35 . 
E. coli MC4100 strain was cultured at <Temp> 37 °C </Temp> to <Phase> mid-log phase </Phase> ( OD600 ~ 0.4 ) in <Med> LB media </Med> 
Ecoli _ <Med> LB growth T10 </Med> 
Ecoli _ <Med> LB growth T11 </Med> 
Ecoli _ <Med> LB growth T1 </Med> 
Ecoli _ <Med> LB growth T2 </Med> 
Ecoli _ <Med> LB growth T3 </Med> 
Ecoli _ <Med> LB growth T4 </Med> 
Ecoli _ <Med> LB growth T5 </Med> 
Ecoli _ <Med> LB growth T6 </Med> 
Ecoli _ <Med> LB growth T7 </Med> 
Ecoli _ <Med> LB growth T8 </Med> 
Ecoli _ <Med> LB growth T9 </Med> 
E. coli MG1655 10 min after TMP + adenine + glycine + methionine treatment in <Med> M9 media </Med> 
E. coli MG1655 10 min after TMP + adenine treatment in <Med> M9 media </Med> 
E. coli MG1655 10 min after TMP + glycine + methionine treatment in <Med> M9 media </Med> 
E. coli MG1655 10 min after TMP + thymine + adenine + glycine + methionine treatment in <Med> M9 media </Med> 
E. coli MG1655 10 min after TMP treatment in <Med> LB media </Med> 
E. coli MG1655 10 min after TMP treatment in <Med> M9 media </Med> 
E. coli MG1655 120 min after TMP + adenine + glycine + methionine treatment in <Med> M9 media </Med> 
E. coli MG1655 120 min after TMP + adenine treatment in <Med> M9 media </Med> 
E. coli MG1655 120 min after TMP + glycine + methionine treatment in <Med> M9 media </Med> 
E. coli MG1655 120 min after TMP + thymine + adenine + glycine + methionine treatment in <Med> M9 media </Med> 
E. coli MG1655 120 min after TMP treatment in <Med> LB media </Med> 
E. coli MG1655 120 min after TMP treatment in <Med> M9 media </Med> 
E. coli MG1655 30 min after TMP + adenine + glycine + methionine treatment in <Med> M9 media </Med> 
E. coli MG1655 30 min after TMP + adenine treatment in <Med> M9 media </Med> 
E. coli MG1655 30 min after TMP + glycine + methionine treatment in <Med> M9 media </Med> 
E. coli MG1655 30 min after TMP + thymine + adenine + glycine + methionine treatment in <Med> M9 media </Med> 
E. coli MG1655 30 min after TMP treatment in <Med> LB media </Med> 
E. coli MG1655 30 min after TMP treatment in <Med> M9 media </Med> 
E. coli MG1655 60 min after TMP + adenine + glycine + methionine treatment in <Med> M9 media </Med> 
E. coli MG1655 60 min after TMP + adenine treatment in <Med> M9 media </Med> 
E. coli MG1655 60 min after TMP + glycine + methionine treatment in <Med> M9 media </Med> 
E. coli MG1655 60 min after TMP + thymine + adenine + glycine + methionine treatment in <Med> M9 media </Med> 
E. coli MG1655 60 min after TMP treatment in <Med> LB media </Med> 
E. coli MG1655 60 min after TMP treatment in <Med> M9 media </Med> 
E. coli MG1655 90 min after TMP + adenine + glycine + methionine treatment in <Med> M9 media </Med> 
E. coli MG1655 90 min after TMP treatment in <Med> M9 media </Med> 
E. coli MG1655 Cold Shock was grown at 15 °C for 4 hour then grown untill reach to half of O.D. 600nm of Standard sample at <Temp> 37 °C </Temp> in <Med> LB media </Med> . 
E. coli MG1655 <Gtype> ∆ Rac G324D , treated-Replicate1-mutant </Gtype> 
E. coli MG1655 <Gtype> ∆ Rac G324D , treated-Replicate2-mutant </Gtype> 
E. coli MG1655 <Gtype> ∆ Rac N340S , treated-Replicate1-mutant </Gtype> 
E. coli MG1655 <Gtype> ∆ Rac N340S , treated-Replicate2-mutant </Gtype> 
E. coli MG1655 <Gtype> ∆ Rac WT , control-Replicate1-Wildtype </Gtype> 
E. coli MG1655 <Gtype> ∆ Rac WT , control-Replicate2-Wildtype </Gtype> 
E. coli MG1655 , <Gtype> WT Rho treated-Replicate1 </Gtype> 
E. coli MG1655 , <Gtype> WT Rho treated-Replicate2 </Gtype> 
E. coli MG1655 Heat Shock was grown at 50 °C for 4 hour then grown untill reach to half of O.D. 600nm of Standard sample at <Temp> 37 °C </Temp> in <Med> LB media </Med> . 
E. coli MG1655 Low pH was grown at <Temp> 37 °C </Temp> for 1 hour in <Med> LB media </Med> with pH4 .5 then grown untill reach to half of O.D. 600nm of Standard sample at <Temp> 37 °C </Temp> in <Med> LB media </Med> . 
E. coli MG1655 mid-log phase in <Med> LB media </Med> 
E. coli MG1655 mid-log phase in <Med> M9 media </Med> 
E. coli MG1655 minimal C&N Source was grown untill reach to quater of O.D. 600nm of Standard sample at <Temp> 37 °C </Temp> in minimal C and N source <Med> MOPS media </Med> ( C-N - MOPS ) . 
E. coli MG1655 minimal C Source was grown untill reach to half of O.D. 600nm of Standard sample at <Temp> 37 °C </Temp> in <Med> minimal C source MOPS media </Med> ( C - MOPS ) . 
E. coli MG1655 minimal N Source was grown untill reach to half of O.D. 600nm of Standard sample at <Temp> 37 °C </Temp> in <Med> minimal N source MOPS media </Med> ( N - MOPS ) . 
E. coli MG1655 Osmotic Stress was grown untill reach to half of O.D. 600nm of Standard sample at <Temp> 37 °C </Temp> in 45 ml <Med> MOPS media </Med> with 6 ml 4M Sodium Chloride . 
E. coli MG1655 Oxidative Stress was grown untill reach to half of O.D. 600nm of Standard sample at <Temp> 37 °C </Temp> in 49 ml <Med> MOPS media </Med> with 400μl 7 % Hydrogen peroxide . 
E. coli MG1655 parC : <Gtype> : flag </Gtype> 
E. coli MG1655 parE : <Gtype> : flag </Gtype> 
E. coli MG1655 Standard was grown to <Phase> mid-log phase </Phase> ( <OD> O.D. 600nm 0.6 ~ 0.8 ) </OD> at <Temp> 37 °C </Temp> in <Med> LB media </Med> . 
E. coli MG1655 strain was cultured in M9 complete medium at <Temp> 37 °C </Temp> with constant agitation and harvested at mid-exponential phase . ( OD600nm ~ 0.6 ) 
E. coli MG1655 strain was cultured in M9 complete medium at <Temp> 37 °C </Temp> with constant agitation and harvested at stationary phase . ( OD600nm ~ 1.5 ) 
E. coli MG1655 strain was cultured in M9 complete medium at <Temp> 37 °C </Temp> with constant agitation . For heat-shock , culture was mix with pre-warmed medium ( 50 °C ) and incubated at 45 °C for 10 min . 
E. coli MG1655 strain was cultured in <Med> W2 minimal medium </Med> ( for nitrogen-limiting condition ) at <Temp> 37 °C </Temp> with constant agitation and harvested at mid-exponential phase . ( OD600nm ~ 0.6 ) ( Powell , B. S. et al. . J of Biol . Chem .270 ( 9 ) : <Supp> 4822 ) </Supp> 
E. coli MG1655 thyA - cells grown in <Med> M9 minimal medium </Med> + <Supp> 0.2 % glucose </Supp> and 20 ug/ml thymine 
E. coli MG1655 UV was exposed to UV light for 15 minutes then grown untill reach to half of O.D. 600nm of Standard sample at <Temp> 37 °C </Temp> in <Med> LB media </Med> . 
E. coli MG1655 was grown in <Med> MOPS + 2 % Dextrose minimal media </Med> + - 10 mM octanoic acid ( pH = 7.0 ) from OD550 0.05 to ~ 0.8 and harvested at Midlog . 
E. coli O157 : <Gtype> H7 86-24 </Gtype> in LB at 37oC at OD 4.0 
E.coli O157 : <Gtype> H7 EDL 933 genomic DNA hybridization to LLNL virulence mechanism array v2A </O> 
E.coli O157 : <Gtype> H7 EDL 933 genomic DNA </O> 
E. coli O157 : <Gtype> H7 EDL933 </Gtype> 
E. coli O157 : <Gtype> H7 EDL933 </Gtype> in LB at 37oC at 7 hrs incubation 
E. coli O157 : <Gtype> H7 EDL933 </Gtype> in LB at 37oC at 7 hrs incubation with <Supp> phloretin 
E. coli O157 : <Gtype> H7 EDL933 </Gtype> in LB at 37oC at OD 4.0 
E. coli O157 : <Gtype> H7 EDL933 </Gtype> in LB at 37oC for 7 hrs incubation 
E. coli O157 : <Gtype> H7 EDL933 </Gtype> in LB at 37oC for 7 hrs incubation with indole-3-acetaldehyde 
E. coli O157 : <Gtype> H7 EDL933 </Gtype> in LB at 37oC for 7 hrs incubation with <Supp> DMSO 
E. coli O157 : <Gtype> H7 EDL933 </Gtype> in LB at 37oC for 7 hrs incubation with <Supp> honey 
E.coli O157 : <Gtype> H7 in LB at </O> <Phase> mid-log phase </Phase> 
E. coli O157 : <Gtype> H7 interacted with lettuce rhizosphere biological rep 1 slide 1 </O> 
E. coli O157 : <Gtype> H7 interacted with lettuce rhizosphere biological rep 1 slide 2 </O> 
E. coli O157 : <Gtype> H7 interacted with lettuce rhizosphere biological rep 2 slide 3 </O> 
E. coli O157 : <Gtype> H7 interacted with lettuce rhizosphere biological rep 2 slide 4 </O> 
E. coli O157 : <Gtype> H7 interacted with lettuce rhizosphere biological rep 3 slide 5 </O> 
E. coli O157 : <Gtype> H7 interacted with lettuce rhizosphere biological rep 3 slide 6 </O> 
E. coli O157 : <Supp> H7 86-24 </Supp> was inoculated in 25 ml of LB in 250 ml shake flasks with overnight cultures that were diluted 1:100 . Cells were shaken at 250 rpm and <Temp> 37 °C </Temp> for an absorbance of 4.0 at 600 nm . Cells were immediately chilled with dry ice and 95 % ethanol ( to prevent RNA degradation ) for 30 sec before centrifugation at 13,000 g for 2 min ; cell pellets were frozen immediately with dry ice and stored -80 °C . RNA was isolated using Qiagen RNeasy mini Kit ( Cat # 74104 ) . 
E. coli O157 : <Supp> H7 EDL933 </Supp> was inoculated in 100 ml of LB in 250 ml shake flasks with overnight cultures that were diluted 1:100 . Cells were shaken with 4 g of glass wool at 250 rpm and <Temp> 37 °C </Temp> for 7 hrs . Cells were immediately chilled with dry ice and 95 % ethanol ( to prevent RNA degradation ) for 30 sec before centrifugation in 50 ml centrifuge tubes at 13,000 g for 2 min ; cell pellets were frozen immediately with dry ice and stored -80 °C . RNA was isolated using Qiagen RNeasy mini Kit ( Cat # 74104 ) with Qiagen RNase-free DNase I ( Cat # 79254 ) . 
E. coli O157 : <Supp> H7 EDL933 </Supp> was inoculated in 250 ml of LB in 1000 ml shake flasks with overnight cultures that were diluted 1:100 . Cells were shaken with 10 g of glass wool at 100 rpm and <Temp> 37 °C </Temp> for 7 hrs . Cells were immediately chilled with dry ice and 95 % ethanol ( to prevent RNA degradation ) for 30 sec before centrifugation in 50 ml centrifuge tubes at 13,000 g for 2 min ; cell pellets were frozen immediately with dry ice and stored -80 °C . RNA was isolated using Qiagen RNeasy mini Kit ( Cat # 74104 ) with Qiagen RNase-free DNase I ( Cat # 79254 ) . 
E. coli O157 : <Supp> H7 EDL933 </Supp> was inoculated in 25 ml of LB in 250 ml shake flasks with overnight cultures that were diluted 1:100 . Cells were shaken at 100 rpm and <Temp> 37 °C </Temp> for 7 hrs . Cells were immediately chilled with dry ice and 95 % ethanol ( to prevent RNA degradation ) for 30 sec before centrifugation in 50 ml centrifuge tubes at 13,000 g for 2 min ; cell pellets were frozen immediately with dry ice and stored -80 °C . RNA was isolated using Qiagen RNeasy mini Kit ( Cat # 74104 ) with Qiagen RNase-free DNase I ( Cat # 79254 ) . 
E. coli O157 : <Supp> H7 EDL933 </Supp> was inoculated in 25 ml of LB in 250 ml shake flasks with overnight cultures that were diluted 1:100 . Cells were shaken at 250 rpm and <Temp> 37 °C </Temp> for an absorbance of 4.0 at 600 nm . Cells were immediately chilled with dry ice and 95 % ethanol ( to prevent RNA degradation ) for 30 sec before centrifugation at 13,000 g for 2 min ; cell pellets were frozen immediately with dry ice and stored -80 °C . RNA was isolated using Qiagen RNeasy mini Kit ( Cat # 74104 ) . 
E. coli O157 : <Supp> H7 was grown in 15mL falcon tubes containing 8mL of filtered rat 's caecal content . Growth were performed in static condition at </O> <Temp> 37 °C </Temp> for 6 hours . 
E. coli _ PGRP _ <Supp> 30 min </Supp> 
Ecoli _ <pH> Ag6 .5 </pH> _ <Phase> rep3 
Ecoli _ <pH> Ag6 .5 </pH> _ rep1 
Ecoli _ <pH> Ag6 .5 </pH> _ rep2 
Ecoli _ <pH> Ag8 .5 </pH> _ <Phase> rep3 
Ecoli _ <pH> Ag8 .5 </pH> _ rep1 
Ecoli _ <pH> Ag8 .5 </pH> _ rep2 
E.coli _ polyphenols _ <Gtype> repA _ </O> <Phase> t1 
E.coli _ polyphenols _ <Gtype> repA _ </O> <Phase> t2 
E.coli _ polyphenols _ <Gtype> repA _ </O> <Phase> t3 
E.coli _ polyphenols _ <Gtype> repB _ </O> <Phase> t1 
E.coli _ polyphenols _ <Gtype> repB _ </O> <Phase> t2 
E.coli _ polyphenols _ <Gtype> repB _ </O> <Phase> t3 
E.coli _ polyphenols _ <Gtype> repC _ </O> <Phase> t1 
E.coli _ polyphenols _ <Gtype> repC _ </O> <Phase> t2 
E.coli _ polyphenols _ <Gtype> repC _ </O> <Phase> t3 
E. Coli PurR ChIP DNA <Supp> glucose 2 </O> 
Ecoli _ Recovery in 10mM Na-P + <Supp> 0.2 % glucose </Supp> T1 
Ecoli _ Recovery in 10mM Na-P + <Supp> 0.2 % glucose </Supp> T2 
Ecoli _ Recovery in 10mM Na-P + <Supp> 0.2 % glucose </Supp> T3 
Ecoli _ Recovery in 10mM Na-P + <Supp> 0.2 % glucose </Supp> T4 
Ecoli _ Recovery in 10mM Na-P + <Supp> 0.2 % glucose </Supp> T5 
Ecoli _ Recovery in 10mM Na-P + <Supp> 0.2 % glucose </Supp> T6 
Ecoli _ Recovery in 10mM Na-P + <Supp> 0.2 % glucose </Supp> T7 
E.coli RNAP beta subunit ChIP DNA from heat-shocked condition without <Supp> rifampicin treatment </Supp> 
E.coli RNAP beta subunit ChIP DNA from mid-exponential condition without <Supp> rifampicin treatment </Supp> 
E.coli RNAP beta subunit ChIP DNA from mid-exponential condition with <Supp> rifampicin treatment </Supp> 
E.coli RNAP beta subunit ChIP DNA from nitrogen-limiting condition without <Supp> rifampicin treatment </Supp> 
E.coli RNAP beta subunit ChIP DNA from stationary condition without <Supp> rifampicin treatment </Supp> 
E. coli RNA polymerase core enzyme was purchased from Epicentre ( Madison , WI , USA ) . Histidine-tagged σ factors were produced and purified as described ( Lacour et al. , 2003 ; Checroun et al. , 2004 ) ; proteins appeared pure from contaminants as determined by denaturing protein gel electrophoresis ( data not shown ) . For reconstitution of RNA polymerase holoenzymes , the core enzyme was incubated for 10 minutes at <Temp> 37 °C </Temp> with either σS or σ70 at a 1:10 ratio . For calculation of RNA polymerase concentrations in transcription assays , it was assumed that , after reconstitution , core enzyme would be 100 % active and fully saturated by either σ factor . 2 ug of genomic DNA from E. coli MG1655 digested with EcoRI were used in transcription assays for ROMA experiments . RNA polymerase holoenzyme concentrations were 100 nM in 50 ul reaction mixture . Ten independent run-off transcription assays were performed , and transcripts were pooled together ( ca. 1 ug total RNA ) . 
E. coli Rosetta cells transformed with pET-28a or pET-28a-BnTR1 ( OD600nm = 0.6 ) were induced with <Supp> 0.1 mM IPTG </Supp> at <Temp> 37 °C </Temp> for 1 hour . 
E. coli samples for RNA extraction were taken during fermentation . Cells were harvested by centrifugation at the cultivation temperature ( <Temp> 37 °C </Temp> , 10,000 g , 1 min ) , separated from the supernatant , and rapidly frozen in dry ice . The samples were stored at -70 °C until <Phase> analysis 
E _ coli _ sham _ powerline _ interm _ <Supp> 8 min </Supp> _ <Phase> rep3 
E _ coli _ sham _ powerline _ interm _ <Supp> 8 min </Supp> _ rep1 
E _ coli _ sham _ powerline _ interm _ <Supp> 8 min </Supp> _ rep2 
E _ coli _ sham _ sinusoidal _ cont _ <Supp> 8 min </Supp> _ <Phase> rep3 
E _ coli _ sham _ sinusoidal _ cont _ <Supp> 8 min </Supp> _ rep1 
E _ coli _ sham _ sinusoidal _ cont _ <Supp> 8 min </Supp> _ rep2 
E. coli ST131 UR40 was treated with ciprofloxacin ( 2µg/mL ) and samples were taken at time points 0 min , <Supp> 30 min </Supp> and 90 min . 
Ecoli _ Stationary phase in <Med> LB T5 </Med> 
Ecoli _ Stationary phase in <Med> LB T6 </Med> 
E. coli strain B178 ( Georgopoulos et al. ( 1973 ) J Mol Biol 76 : <Gtype> 45-60 ) </Gtype> in which the endogenous groES and groEL genes have been deleted and that is maintained alive by the pOFX-tac1-derived plasmid carrying an IPTG-inducible operon with cDNA encoding human Hsp10 and the mature part of <Gtype> human wild type </Gtype> Hsp60 ( Hansen et al. , 2002 ) . These cells were subsequently transformed by electroporation with a second plasmid , derivative of pBAD/hisA ( Invitrogen ) , that contained an operon with Hsp10 and <Gtype> wild type </Gtype> Hsp60 under control of the arabinose-inducible BAD promoter . The pBAD/hisA-derived plasmids carry a pBR322 origin of replication and an ampicillin resistance gene and can be stably maintained in the same cell with the p15A-origin/kanamycin resistance gene containing pOFX-tac derivative . 
E. coli strain B178 ( Georgopoulos et al. ( 1973 ) J Mol Biol 76 : <Gtype> 45-60 ) </Gtype> in which the endogenous groES and groEL genes have been deleted and that is maintained alive by the pOFX-tac1-derived plasmid carrying an IPTG-inducible operon with cDNA encoding human Hsp10 and the mature part of <Gtype> human wild type </Gtype> Hsp60 ( Hansen et al. , 2002 ) . These cells were subsequently transformed by electroporation with a second plasmid , derivative of pBAD/hisA ( Invitrogen ) , that contained an operon with Hsp10 and the Val98Ile mutant variant of Hsp60 under control of the arabinose-inducible BAD promoter . The pBAD/hisA-derived plasmid carries a pBR322 origin of replication and an ampicillin resistance gene and can be stably maintained in the same cell with the p15A-origin/kanamycin resistance gene containing pOFX-tac derivative . 
E. coli strain NM580 ( genotype MG1655 ermBL-ermB ' : <Gtype> : LacZ </Gtype> ) cells were grown in LB broth ( <Temp> 37 °C </Temp> ) until <OD> OD600 of ~ 0.3 </OD> . 
E. coli strains harboring ArgR-8myc were grown in <Med> glucose ( 2 g/L ) minimal W2 medium </Med> supplemented with <Supp> 1g/L arginine </Supp> . 
E. coli strains harboring ArgR-8myc were grown in <Med> glucose ( 2 g/L ) minimal W2 medium </Med> supplemented with <Supp> 2g/L glutamine </Supp> . 
E. coli strains harboring Lrp-8myc were grown in <Med> glucose ( 2 g/L ) minimal M9 medium </Med> supplemented without <Supp> 10 mM leucine </Supp> . 
E. coli strains harboring Lrp-8myc were grown in <Med> glucose ( 2 g/L ) minimal M9 medium </Med> supplemented with <Supp> 10 mM leucine </Supp> . 
E. coli strains harboring PurR-8myc were grown in minimal M9 medium supplemented with glucose ( 2 g/L ) then inoculated into 100mL of fresh <Med> M9 minimal medium </Med> . 
E. coli strains harboring PurR-8myc were grown in minimal M9 medium supplemented with glucose ( 2 g/L ) then inoculated into 100mL of fresh <Med> M9 minimal medium </Med> supplemented with 100ug/L adenine . 
E. coli strains harboring TrpR-8myc were grown in <Med> glucose ( 2 g/L ) minimal M9 medium </Med> supplemented without <Supp> 20 mg/L tryptophan </Supp> . 
E. coli strains harboring TrpR-8myc were grown in <Med> glucose ( 2 g/L ) minimal M9 medium </Med> supplemented with <Supp> 20 mg/L tryptophan </Supp> . 
E. coli strains were grown in minimal M9 medium supplemented with glucose ( 2 g/L ) to mid-exponential phase and treated with heatshock for <Supp> 10 min </Supp> 
E. coli strains were grown in minimal M9 medium supplemented with glucose ( 2 g/L ) to mid-exponential phase with heatshock for <Supp> 10 min </Supp> 
E. coli strains were grown in minimal M9 medium supplemented with glucose ( 2 g/L ) to <Phase> stationary phase </Phase> 
e. coli subset : <Gtype> enterohemorrhagic E.coli </Gtype> 
E.coli _ <Supp> 15 min </Supp> _ <Air> aerobic 
E. coli _ <Supp> 15 min </Supp> _ <Air> anaerobic 
E.coli _ <Supp> 15 min </Supp> _ <Air> anaerobic 
E.coli _ <Supp> 15 min </Supp> _ CORM-2 treated _ <Air> aerobic 
E.coli _ <Supp> 15 min </Supp> _ CORM-2 treated _ <Air> anaerobic 
E.coli _ <Supp> 15 min </Supp> _ CORM _ ANA _ 1 
E.coli _ <Supp> 15 min </Supp> _ CORM _ ANA _ 2 
E.coli _ <Supp> 15 min </Supp> _ <Supp> AE _ 1 </O> 
E.coli _ <Supp> 15 min </Supp> _ <Supp> AE _ 2 </O> 
E.coli _ <Supp> 15 min </Supp> _ <Supp> ANA _ 1 </O> 
E. coli _ <Supp> 15 min </Supp> _ <Supp> ANA _ 2 </O> 
E.coli _ <Supp> 15 min </Supp> _ <Supp> CORM _ AE _ 1 </O> 
E.coli _ <Supp> 15 min </Supp> _ <Supp> CORM _ </O> <Supp> AE _ 2 </O> 
E. coli <Supp> 30 mins </Supp> 
E. coli - <Supp> 30 min </Supp> after shift to limiting medium 
E. coli - <Supp> 30 min </Supp> after shift to thymineless medium 
ecoli _ <Supp> aerobicanaerobic _ 2 min </Supp> 
E. coli _ <Supp> CCCP _ </O> <Supp> 15 min </Supp> 
Ecoli _ <Supp> NP-TiO2 _ 5h _ </O> <Phase> rep3 
Ecoli _ <Supp> NP-TiO2 _ 5h _ </O> <Phase> rep4 
Ecoli _ <Supp> NP-TiO2 _ 5h _ rep1 </O> 
Ecoli _ <Supp> NP-TiO2 _ 5h _ rep2 </O> 
e.coli , <Temp> 37 °C </Temp> , 60 min 
E.coli , <Temp> 37 °C </Temp> , 60 min 
e.coli , <Temp> 43 °C </Temp> , 60 min 
E.coli , <Temp> 43 °C </Temp> , 60 min 
E.coli ， <Temp> 43 °C </Temp> ， 60 min 
E. coli TolC cells were grown o/n in LB medium at <Temp> 37 °C </Temp> and 200 rpm . 
E. coli was grown in M9 medium supplemented with <Supp> 0.4 % glucose </Supp> . The cultures were grown on a rotary shaker ( 200 rpm ) at <Temp> 37 °C </Temp> until the contents of the flask reached an <OD> OD600 of 0.3 </OD> ( mid-log phase of growth ) . Each culture was divided into 25 mL aliquots , transferred to 50 mL conical tubes , and centrifuged at 2540 x g for 12 minutes . The supernatant was decanted , and the cells were resuspended in 25 mL of M9 medium at pH 7 in the presence of <Supp> 5.4 µM ( </Supp> 1 µg/mL ) total cadmium , added as CdCl2 . The cultures were incubated at 25 °C for 15 minutes with manual rotations of the flasks once per minute to resuspend the cells . 
E. coli was grown in M9 medium supplemented with <Supp> 0.4 % glucose </Supp> . The cultures were grown on a rotary shaker ( 200 rpm ) at <Temp> 37 °C </Temp> until the contents of the flask reached an <OD> OD600 of 0.3 </OD> ( mid-log phase of growth ) . Each culture was divided into 25 mL aliquots , transferred to 50 mL conical tubes , and centrifuged at 2540 x g for 12 minutes . The supernatant was decanted , and the cells were resuspended in 25 mL of M9 medium at pH 7 . The cultures were incubated at 25 °C for 15 minutes with manual rotations of the flasks once per minute to resuspend the cells . 
E. coli was grown in M9 medium supplemented with <Supp> 0.4 % glucose </Supp> . The cultures were grown on a rotary shaker ( 200 rpm ) at <Temp> 37 °C </Temp> until the contents of the flask reached an <OD> OD600 of 0.3 </OD> ( mid-log phase of growth ) . Each culture was divided into 25 mL aliquots , transferred to 50 mL conical tubes , and centrifuged at 2540 x g for 12 minutes . The supernatant was decanted , and the cells were resuspended in 25 mL of M9 medium at pH 7 . The cultures were incubated at 25 °C for 5 minutes with manual rotations of the flasks once per minute to resuspend the cells . 
E. coli was grown in M9 medium supplemented with <Supp> 0.4 % glucose </Supp> . The cultures were grown on a rotary shaker ( 200 rpm ) at <Temp> 37 °C </Temp> until the contents of the flask reached an <OD> OD600 of 0.3 </OD> ( mid-log phase of growth ) . Each culture was divided into 25 mL aliquots , transferred to four 50 mL conical tubes , and centrifuged at 2540 x g for 12 minutes . The supernatant was decanted , and the cells were resuspended in 25 mL of M9 medium at pH 5 in the presence of <Supp> 5.4 µM ( </Supp> 1 µg/mL ) total cadmium , added as CdCl2 . The cultures were incubated at 25 °C for 15 minutes with manual rotations of the flasks once per minute to resuspend the cells . 
E. coli was grown in M9 medium supplemented with <Supp> 0.4 % glucose </Supp> . The cultures were grown on a rotary shaker ( 200 rpm ) at <Temp> 37 °C </Temp> until the contents of the flask reached an <OD> OD600 of 0.3 </OD> ( mid-log phase of growth ) . Each culture was divided into 25 mL aliquots , transferred to four 50 mL conical tubes , and centrifuged at 2540 x g for 12 minutes . The supernatant was decanted , and the cells were resuspended in 25 mL of M9 medium at pH 5 in the presence of <Supp> 5.4 µM ( </Supp> 1 µg/mL ) total cadmium , added as CdCl2 . The cultures were incubated at 25 °C for 5 minutes with manual rotations of the flasks once per minute to resuspend the cells . 
E. coli was grown in M9 medium supplemented with <Supp> 0.4 % glucose </Supp> . The cultures were grown on a rotary shaker ( 200 rpm ) at <Temp> 37 °C </Temp> until the contents of the flask reached an <OD> OD600 of 0.3 </OD> ( mid-log phase of growth ) . Each culture was divided into 25 mL aliquots , transferred to four 50 mL conical tubes , and centrifuged at 2540 x g for 12 minutes . The supernatant was decanted , and the cells were resuspended in 25 mL of M9 medium at pH 5 . The cultures were incubated at 25 °C for 15 minutes with manual rotations of the flasks once per minute to resuspend the cells . 
E. coli was grown in M9 medium supplemented with <Supp> 0.4 % glucose </Supp> . The cultures were grown on a rotary shaker ( 200 rpm ) at <Temp> 37 °C </Temp> until the contents of the flask reached an <OD> OD600 of 0.3 </OD> ( mid-log phase of growth ) . Each culture was divided into 25 mL aliquots , transferred to four 50 mL conical tubes , and centrifuged at 2540 x g for 12 minutes . The supernatant was decanted , and the cells were resuspended in 25 mL of M9 medium at pH 5 . The cultures were incubated at 25 °C for 5 minutes with manual rotations of the flasks once per minute to resuspend the cells . 
E. coli was grown in M9 medium supplemented with <Supp> 0.4 % glucose </Supp> . The cultures were grown on a rotary shaker ( 200 rpm ) at <Temp> 37 °C </Temp> until the contents of the flask reached an <OD> OD600 of 0.3 </OD> ( mid-log phase of growth ) . Each culture was divided into 25 mL aliquots , transferred to four 50 mL conical tubes , and centrifuged at 2540 x g for 12 minutes . The supernatant was decanted , and the cells were resuspended in 25 mL of M9 medium at pH 7 in the presence of <Supp> 5.4 µM ( </Supp> 1 µg/mL ) total cadmium , added as CdCl2 . The cultures were incubated at 25 °C for 5 minutes with manual rotations of the flasks once per minute to resuspend the cells . 
E. coli was grown to <Phase> mid-log phase </Phase> in Luria-Bertani ( Miller ) broth medium at 37C in the presence of dimethyl sulfoxide ( DMSO ) - dissolved cholic acid at 1 mM final culture concentration . 
E. coli was grown to <Phase> mid-log phase </Phase> in Luria-Bertani ( Miller ) broth medium at 37C in the presence of dimethyl sulfoxide ( DMSO ) - dissolved estradiol at 1 mM final culture concentration . 
E. coli was grown to <Phase> mid-log phase </Phase> in Luria-Bertani ( Miller ) broth medium at 37C in the presence of dimethyl sulfoxide ( DMSO ) - dissolved hydrocortisone at 1 mM final culture concentration . 
E. coli was grown to <Phase> mid-log phase </Phase> in Luria-Bertani ( Miller ) broth medium at 37C in the presence of dimethyl sulfoxide ( DMSO ) - dissolved progesterone at 1 mM final culture concentration . 
E. coli was grown to <Phase> mid-log phase </Phase> in Luria-Bertani ( Miller ) broth medium at 37C in the presence of dimethyl sulfoxide ( DMSO ) - only steroid carrier . 
E. coli was grown to <Phase> mid-log phase </Phase> ( <OD> O.D. 600nm 0.3-0.4 ) </OD> in Lennox LB broth ( Becton Dickinson , Franklin Lakes , NJ ) at <Temp> 37 °C </Temp> . 
E. coli Wild type and its mutants were grown in <Med> M9 minimal medium </Med> with 10mM glucose or 30mM acetate as sole carbon source . Samples for RNA extraction were taken in middle exponential phase ( OD600 ≈ 0.5 ) and in stationary phase ( OD600 ≈ 1.5 ) 
Ecoli wildtype grown in <Med> MOPS , 10 minutes after 1 % butanol treatment </O> 
Ecoli wildtype grown in <Med> MOPS , 10 minutes after 1 % isobutanol treatment </O> 
Ecoli wildtype grown in <Med> MOPS , 10 minutes after 3 % ethanol treatment </O> 
EDL ( O157 : <Gtype> H7 ) </Gtype> 
EJW3 in M9 supplemented with <Supp> 0.6 M NaCl Replicate 1 </Supp> 
EJW3 in M9 supplemented with <Supp> 0.6 M NaCl Replicate 2 </Supp> 
Emplty Vector , <Temp> 37 °C </Temp> , replicate 1 
Emplty Vector , <Temp> 37 °C </Temp> , replicate 2 
Emplty Vector , <Temp> 37 °C </Temp> , replicate 3 
emptyvec _ <Gtype> mRNA _ 5m _ rep1 </O> 
emptyvec _ <Gtype> mRNA _ 5m _ rep2 </O> 
emptyvec _ <Gtype> totalRNA _ 30m _ rep1 </O> 
emptyvec _ <Gtype> totalRNA _ 30m _ rep2 </O> 
emptyvec _ <Gtype> totalRNA _ 5m _ rep1 </O> 
emptyvec _ <Gtype> totalRNA _ 5m _ rep2 </O> 
EmptyVector _ <Supp> 37 _ rep2 </O> 
Enterohemorrhagic Escherichia coli O157 : <Gtype> H7 strain EDL933 </Gtype> 
ercc spike-in : <Anti> Prior to extraction </Anti> 
Escherchia coli HB101 exposed to C. elegans and Giardia for <Supp> 24 hours </Supp> 
Escherchia coli HB101 exposed to C. elegans for <Supp> 24 hours </Supp> 
Escherchia coli HB101 exposed to Giardia for <Supp> 24 hours </Supp> 
Escherichia coli 60 min vs <Supp> 30 min </Supp> Rep2 
Escherichia coli B strain REL606 was revived from a freezer stock via overnight growth in 10 ml <Med> Davis Minimal medium </Med> supplemented with limiting glucose at 0.5 g/l ( DM500 ) in a 50 ml Erlenmeyer flask . This culture was diluted 100-fold into 50 ml <Med> fresh DM500 </Med> in a 250 ml Erlenmeyer flask and incubated for 24 hours . To initiate the experiment , these preconditioned cultures were diluted 100-fold into 50 ml <Med> fresh DM500 </Med> in multiple 250 ml Erlenmeyer flasks and grown for the specified times until harvesting cells for total RNA isolation . All growth steps were conducted with incubation at <Temp> 37 °C </Temp> and orbital shaking at 120 r.p.m. over a one-inch diameter . 
Escherichia coli BW13711 grown anaerobically in continuous culture in <Med> MOPS medium plus </Med> 0.4 % glucose with 1 % Acacia mearnsii condensed tannins . 
Escherichia coli BW13711 grown anaerobically in continuous culture in <Med> MOPS medium plus </Med> 0.4 % glucose without Acacia mearnsii condensed tannins . 
Escherichia coli BW25113 and fur mutant strains were cultivated at 37Co in 25 ml of LB medium using Erlenmeyer flasks . 1 ml of OVN culture was transferred to 20 ml <Med> of fresh LB </Med> medium and cells were incubated in the presence or absence of ciprofloxacin ( 100 ng/ml ) . 
Escherichia coli C600 ( gyrArparCr ) , <Supp> 30 min </Supp> after Norfloxacin ( 15 ug/ml ) addition in <Med> LB 
Escherichia coli C600 ( gyrArparCr ) , <Supp> 30 min </Supp> after Norfloxacin ( 50 ug/ml ) addition in <Med> LB 
Escherichia coli C600 , <Supp> 30 min </Supp> after Norfloxacin ( 50 ug/ml ) addition in <Med> LB 
Escherichia coli DH1 <Gtype> ∆ fadE </Gtype> control and test strains were seeded with OD600nm 0.03 overnight cultures into 15 ml tryptic soy broth media and grown at <Temp> 37 °C </Temp> with 200rpm agitation . 
Escherichia coli EDL 933 were grown in 10 ml of LB medium until <Phase> stationary phase , collected by centrifugation at 8,000 × g for 10 min , and washed twice with sterilized , plant growth medium ( Caspersen et al. 1999 ) . The resultant cells were re-suspended in 10 ml of the same plant growth medium to a final concentration of approximately 10E9 cells/ml . Germinated lettuce seedlings were each aseptically transferred into holes in the growth boxes filled with 300 ml of plant growth medium , and 3 ml washed bacterial suspension was added to provide approximately 10E7 cells/ml of growth medium . Seedling boxes were germinated for a week and transferred to a plant growth chamber , and the aeration pump ( Luft Pump ; Oceanic systems Inc. . Dallas , TX ) was immediately started . Each pump supplied aeration of three growth boxes , at a rate of 1.3 L / min . The seedling boxes were incubated under 80 % RH at 25 °C with a photoperiod of 16 h for 3 days </O> 
Escherichia coli , expressing NsrR with a C-terminal Flag-tag , was grown anaerobically in L broth supplemented with <Supp> glucose and nitrate . </O> 
Escherichia coli , expressing NsrR with a C-terminal Flag-tag , was grown anaerobically in L broth supplemented with <Supp> glucose . </O> 
Escherichia coli <Gtype> wild type </Gtype> strain 
Escherichia coli <Gtype> wild type </Gtype> vs luxS mutants with 10 % H2O2 Rep1 
Escherichia coli <Gtype> wild type </Gtype> vs luxS mutants with 10 % H2O2 Rep2 
Escherichia coli <Gtype> wild type </Gtype> vs luxS mutants without H2O2 Rep1 
Escherichia coli <Gtype> wild type </Gtype> vs luxS mutants without H2O2 Rep2 
Escherichia coli <Gtype> wild type </Gtype> vs luxS mutants with <Supp> 30 % H2O2 Rep1 </Supp> 
Escherichia coli <Gtype> wild type </Gtype> vs luxS mutants with <Supp> 30 % H2O2 Rep2 </Supp> 
Escherichia coli K12 MG1655 was cultivated using <Med> M9 minimal medium </Med> containing 4.5 g/L α - ( D ) - glucose , pH = 7 , temperature 37 ºC , aerobic conditions 
Escherichia coli K12 MG1655 were grown in <Med> M9 minimal medium </Med> with <Supp> 10 g/L glucose </Supp> . The bacteria were cultivated in a chemostat at specific growth rate 0.3 h-1 . After reaching steady state , dilution rate was increased with constant rate ( 0.01 h-2 ) and the samples were acquired when specific growth rate reached 0.47 h-1 . 
Escherichia coli K12 MG1655 were grown in <Med> M9 minimal medium </Med> with <Supp> 10 g/L glucose </Supp> . The bacteria were cultivated in a chemostat at specific growth rate 0.3 h-1 and the samples were acquired after culture reached steady state . 
Escherichia coli K12 strain BW25113 ( Datsenko & Wanner 2000 . PNAS 97 : <Supp> 6640 ) </Supp> was cultivated in 100 mL of LB broth ( Miller 1972 . In : <Gtype> Experiments in molecular genetics . Cold Spring Harbor Laboratory , NY ) in a 250 mL Erlenmeyer flask at </O> <Temp> 37 °C </Temp> with shaking ( <Agit> 250 rpm </Agit> ) to an O.D. 600nm of 0.6 . S. coelicolor A3 ( 2 ) strain M145 ( Kieser et al. 2000 . Practical Streptomyces Genetics . The John Innes Foundation , Norwich . ) was incubated in YEME broth ( Kieser et al. 2000 ) at 30 °C with shaking until the mycelia became pigmented . 
Escherichia coli K-12 strain MG1655 was cultivated <Air> aerobically ( ~ 0.5 l/min air supply ) in a defined mineral medium containing 1 g/l glucose in continous cultures growing in a chemostat ( dilution rate = 0.4 h-1 , working volume = 100 ml ) . </O> 
Escherichia coli K-12 treated with menadione _ <Supp> rep # 1 </Supp> 
Escherichia coli MG1655 , 0 min recovery in 10mM Na-P + <Supp> 0.2 % glucose </Supp> 
Escherichia coli MG1655 , 0 min recovery in 10 mM Na-P + <Supp> 0.2 % glucose </Supp> ( pH 7.5 ) at OD 0.4 
Escherichia coli MG1655 , 0 min recovery in LB + <Supp> glucose at OD 0.4 </O> 
Escherichia coli MG1655 , 0 min recovery in LB + <Supp> glucose at OD 1.0 </O> 
Escherichia coli MG1655 , 15 min recovery in 10mM Na-P + <Supp> 0.2 % glucose </Supp> 
Escherichia coli MG1655 , 15 min recovery in 10 mM Na-P + <Supp> 0.2 % glucose </Supp> ( pH 7.5 ) at OD 0.4 
Escherichia coli MG1655 , 15 min recovery in LB + <Supp> glucose at OD 0.4 </O> 
Escherichia coli MG1655 , 15 min recovery in LB + <Supp> glucose at OD 1.0 </O> 
Escherichia coli MG1655 , 30 min recovery in 10mM Na-P + <Supp> 0.2 % glucose </Supp> 
Escherichia coli MG1655 , 30 min recovery in 10 mM Na-P + <Supp> 0.2 % glucose </Supp> ( pH 7.5 ) at OD 0.4 
Escherichia coli MG1655 , 30 min recovery in LB + <Supp> glucose at OD 0.4 </O> 
Escherichia coli MG1655 , 30 min recovery in LB + <Supp> glucose at OD 1.0 </O> 
Escherichia coli MG1655 , 45 min recovery in 10mM Na-P + <Supp> 0.2 % glucose </Supp> 
Escherichia coli MG1655 , 45 min recovery in 10 mM Na-P + <Supp> 0.2 % glucose </Supp> ( pH 7.5 ) at OD 0.4 
Escherichia coli MG1655 , 45 min recovery in LB + <Supp> glucose at OD 0.4 </O> 
Escherichia coli MG1655 , 45 min recovery in LB + <Supp> glucose at OD 1.0 </O> 
Escherichia coli MG1655 , 60 min recovery in 10mM Na-P + <Supp> 0.2 % glucose </Supp> 
Escherichia coli MG1655 , 60 min recovery in 10 mM Na-P + <Supp> 0.2 % glucose </Supp> ( pH 7.5 ) at OD 0.4 
Escherichia coli MG1655 , 60 min recovery in LB + <Supp> glucose at OD 0.4 </O> 
Escherichia coli MG1655 , 60 min recovery in LB + <Supp> glucose at OD 1.0 </O> 
Escherichia coli MG1655 , 75 min recovery in 10mM Na-P + <Supp> 0.2 % glucose </Supp> 
Escherichia coli MG1655 , 75 min recovery in 10 mM Na-P + <Supp> 0.2 % glucose </Supp> ( pH 7.5 ) at OD 0.4 
Escherichia coli MG1655 , 75 min recovery in LB + <Supp> glucose at OD 0.4 </O> 
Escherichia coli MG1655 , 75 min recovery in LB + <Supp> glucose at OD 1.0 </O> 
Escherichia coli MG1655 , 90 min recovery in 10mM Na-P + <Supp> 0.2 % glucose </Supp> 
Escherichia coli MG1655 , 90 min recovery in 10 mM Na-P + <Supp> 0.2 % glucose </Supp> ( pH 7.5 ) at OD 0.4 
Escherichia coli MG1655 , 90 min recovery in LB + <Supp> glucose at OD 0.4 </O> 
Escherichia coli MG1655 , 90 min recovery in LB + <Supp> glucose at OD 1.0 </O> 
Escherichia coli MG1655 Aerobic growth on M9 + <Supp> glucose + fumarate , OD 0.4 </O> 
Escherichia coli MG1655 after <Supp> 30 min incubation </Supp> 
Escherichia coli MG1655 fis : <Gtype> : kan </Gtype> grown 150 minutes 
Escherichia coli MG1655 fis : <Gtype> : kan </Gtype> grown 240 minutes 
Escherichia coli MG1655 fis : <Gtype> : kan </Gtype> grown 360 minutes 
Escherichia coli MG1655 fis : <Gtype> : kan </Gtype> grown 90 minutes 
Escherichia coli MG1655 K-12 <Gtype> dFNR ( PK4854 ) </Gtype> 
Escherichia coli MG1655 K-12 WT and ∆ fnr were grown to <Phase> mid-log phase </Phase> ( <OD> O.D. 600nm 0.3 </OD> ) <Air> anerobically ( 95 % N2 , 5 % CO2 ) </Air> at <Temp> 37 °C </Temp> in <Med> MOPS +0.2 % glucose media </Med> ( Ref ) . 
Escherichia coli MG1655 , OD 0.05 , anaerobic growth in M9 + <Supp> glucose + fumarate , </O> 
Escherichia coli MG1655 , OD 0.15 , anaerobic growth in M9 + <Supp> glucose + fumarate , </O> 
Escherichia coli MG1655 , OD 0.21 , anaerobic growth in M9 + <Supp> glucose + fumarate , </O> 
Escherichia coli MG1655 , OD 0.30 , anaerobic growth in M9 + <Supp> glucose + fumarate , </O> 
Escherichia coli MG1655 , OD 0.43 , anaerobic growth in M9 + <Supp> glucose + fumarate , </O> 
Escherichia coli MG1655 , OD 0.63 , anaerobic growth in M9 + <Supp> glucose + fumarate , </O> 
Escherichia coli MG1655 , OD 0.7 , anaerobic growth in M9 + <Supp> glucose + fumarate , </O> 
Escherichia coli MG1655 , OD 0.85 , anaerobic growth in M9 + <Supp> glucose + fumarate , </O> 
Escherichia coli MG1655 , OD 1.07 , anaerobic growth in M9 + <Supp> glucose + fumarate , </O> 
Escherichia coli MG1655 , OD 1.29 anaerobic growth in M9 + <Supp> glucose + fumarate , </O> 
Escherichia coli MG1655 , OD 1.2 , anaerobic growth in M9 + <Supp> glucose + fumarate , </O> 
Escherichia coli MG1655 , stationary phase anaerobic growth in M9 + <Supp> glucose + fumarate , </O> 
Escherichia coli MG1655 , Stationary phase in LB OD 3.1 for <Supp> 20 min </Supp> 
Escherichia coli MG1655 , Stationary phase in LB OD 3.1 for <Supp> 40 min </Supp> 
Escherichia coli MG1655 , stationary phase in LB , OD 3.1 for <Supp> 60 min </Supp> 
Escherichia coli MG1655 , <Supp> 30 min </Supp> after Ampicillin ( 100 ug/ml ) addition in M9 + <Supp> glucose 
Escherichia coli MG1655 , <Supp> 30 min </Supp> after Indol-acrylate ( 10 ug/ml ) addition in Bonner-Vogel 
Escherichia coli MG1655 , <Supp> 30 min </Supp> after Indol-acrylate ( 15 ug/ml ) addition in Bonner-Vogel 
Escherichia coli MG1655 , <Supp> 30 min </Supp> after Kanamycin ( 100 ug/ml ) addition in M9 + <Supp> glucose 
Escherichia coli MG1655 were grown in 10 ml of LB medium until <Phase> stationary phase , collected by centrifugation at 8,000 × g for 10 min , and washed twice with sterilized , plant growth medium ( Caspersen et al. 1999 ) . The resultant cells were re-suspended in 10 ml of the same plant growth medium to a final concentration of approximately 10E9 cells/ml . Germinated lettuce seedlings were each aseptically transferred into holes in the growth boxes filled with 300 ml of plant growth medium , and 3 ml washed bacterial suspension was added to provide approximately 10E7 cells/ml of growth medium . Seedling boxes were germinated for a week and transferred to a plant growth chamber , and the aeration pump ( Luft Pump ; Oceanic systems Inc. . Dallas , TX ) was immediately started . Each pump supplied aeration of three growth boxes , at a rate of 1.3 L / min . The seedling boxes were incubated under 80 % RH at 25 °C with a photoperiod of 16 h for 3 days </O> 
Escherichia coli O157 : <Gtype> H7 EDL933 </Gtype> Inside Acanthamoeba vs. Control Slide 3 
Escherichia coli O157 : <Gtype> H7 EDL933 </Gtype> Inside Acanthamoeba vs. Control Slide 4 
Escherichia coli O157 : <Gtype> H7 EDL933 </Gtype> Inside Acanthamoeba vs. Control Slide 5 
Escherichia coli O157 : <Gtype> H7 EDL933 </Gtype> Inside Acanthamoeba vs. Control Slide 6 
Escherichia coli O157 : <Gtype> H7 EDL933 </Gtype> Inside Acanthamoeba vs. Control Slide 7 
Escherichia coli O157 : <Gtype> H7 EDL933 </Gtype> Inside Acanthamoeba vs. Control Slide 8 
Escherichia coli O157 : <Gtype> H7 EDL933 </Gtype> Inside Acanthamoeba vs. Control Slide 9 
Escherichia coli O157 : <Gtype> H7 EDL933 Inside Acanthamoeba </Gtype> 
Escherichia coli O157 : <Gtype> H7 EDL933 Inside Acanthamoeba vs. Control Slide </Gtype> 1 
Escherichia coli O157 : <Gtype> H7 EDL933 Inside Acanthamoeba vs. Control Slide </Gtype> 2 
Escherichia coli O157 : <Gtype> H7 EDL933 Outside Control </Gtype> 
Escherichia coli O157 : <Gtype> H7 str . EDL933 </O> 
Escherichia coli O157 : <Gtype> H7 str . Sakai </O> 
Escherichia coli O157 ( Sakai ) treated with menadione _ <Supp> rep # 1 </Supp> 
Escherichia coli O157 TUV93-0 was grown at 37 degrees C to OD 0.7 in MEM-HEPES supplemented with <Supp> 0.1 % Glucose </Supp> and 250nM Fe ( NO3 ) 2 . 
Escherichia coli O157 TUV93-0 was grown at 37 degrees C to OD 0.7 in MEM-HEPES supplemented with <Supp> 0.1 % Glucose </Supp> and 250nM Fe ( NO3 ) 2 and and equivalent volume of DMSO . 
Escherichia coli strains E.coli C ( DSMZ 4860 ) , E. coli Crooks ( DSMZ 1576 ) , E. coli DH5α ( DSMZ 6897 ) E. coli W ( DSMZ 1116 ) , E. coli W3110 ( DSMZ 5911 ) were obtained from DSMZ-German Collection of Microorganism and Cell Cultures ; E. coli BL21 ( DE3 ) was purchased as competent cells from Agilent ( Agilent Technologies Inc. , USA ) , E. coli K-12 MG1655 ( ATCC 700926 ) . All strains were cultured in <Med> M9 minimal medium </Med> ( 1 ) containing Na2HPO4 x 7H2O ( 6.8 g ) , KH2PO4 ( 3 g ) , NaCl ( 0.5 g ) , NH4Cl ( 1 g ) , MgSO4 ( 2 mmol ) , CaCl2 ( 0.1 mmol ) , trace elements , Wolf 's vitamin solution ( 2 ) and glucose ( 2 g L-1 ) . Anoxic <Med> M9 minimal media </Med> with <Supp> glucose was obtained by flushing solution with oxygen free nitrogen ( 95 % ) . Overnight cultures from single colonies of each of seven E. coli strains were diluted to a starting optical density ( OD600 ) of 0.01 . Cultures were grown in 250 ml flasks or 300 ml oxygen-free sealed bottles containing 50 ml </O> <Med> glucose-M9 minimal media </Med> in a shaking incubator at <Temp> 37 °C </Temp> and <Agit> 250 rpm </Agit> . 
Escherichia coli str . <Strain> K-12 substr . </O> <Substrain> MG1655 
Escherichia coli str . <Strain> K-12 substr . </O> <Substrain> MG1655star 
Escherichia coli str . <Strain> K-12 substr . W3110 </O> 
Escherichia coli , <Supp> 0 µM AgNO3 </Supp> 
Escherichia coli , <Supp> 5 µM AgNO3 </Supp> 
Escherichia coli , <Supp> 6.5 µM AgNO3 </Supp> 
Escherichia coli , <Supp> 8.5 µM AgNO3 </Supp> 
Escherichia coli _ <Supp> Biofilm _ bioreplicate1 _ techreplicate _ 1 </O> 
Escherichia coli _ <Supp> Biofilm _ bioreplicate1 _ techreplicate _ 2 </O> 
Escherichia coli _ <Supp> Biofilm _ bioreplicate2 _ techreplicate _ 1 </O> 
Escherichia coli _ <Supp> Biofilm _ bioreplicate2 _ techreplicate _ 2 </O> 
Escherichia coli _ <Supp> MixedSpeciesBiofilm _ bioreplicate1 _ techreplicate _ 1 </O> 
Escherichia coli _ <Supp> MixedSpeciesBiofilm _ bioreplicate1 _ techreplicate _ 2 </O> 
Escherichia coli _ <Supp> MixedSpeciesBiofilm _ bioreplicate1 _ techreplicate _ 3 </O> 
Escherichia coli _ <Supp> MixedSpeciesBiofilm _ bioreplicate2 _ techreplicate _ 1 </O> 
Escherichia coli _ <Supp> MixedSpeciesBiofilm _ bioreplicate2 _ techreplicate _ 2 </O> 
Escherichia coli _ <Supp> MixedSpeciesPlanktonic _ bioreplicate1 _ techreplicate _ 1 </O> 
Escherichia coli _ <Supp> MixedSpeciesPlanktonic _ bioreplicate1 _ techreplicate _ 2 </O> 
Escherichia coli _ <Supp> MixedSpeciesPlanktonic _ bioreplicate2 _ techreplicate _ 1 </O> 
Escherichia coli _ <Supp> MixedSpeciesPlanktonic _ bioreplicate2 _ techreplicate _ 2 </O> 
Escherichia coli treated with <Supp> 0.5 MIC of cyadox </Supp> 
Escherichia coli treated with <Supp> MBC of cyadox </Supp> 
Escherichia coli treated with <Supp> MBC of olaquindox </Supp> 
Escherichia coli treated with <Supp> MIC of olaquindox </Supp> 
Escherichia coli W3110 , 0 min before treatment , Bonner-Vogel + <Supp> 50 ug/ml Tryptophan </Supp> 
Escherichia coli W3110 , 0 min before treatment in Bonner-Vogel + <Supp> 50 ug/ml Tryptophan </Supp> 
Escherichia coli W3110 ,5 min 0.01 M Sodium Azide treatment vs 0 min before treatment in Bonner-Vogel + <Supp> 50 ug/ml Tryptophan </Supp> 
Escherichia coli was grown aerobically in Luria-Bertani ( LB ) broth and LB + glycerol at <Temp> 30 °C </Temp> in an incubator shaker at 150 r.p.m. 
Escherichia coli was grown aerobically in Luria-Bertani ( LB ) broth at <Temp> 30 °C </Temp> in an incubator shaker at 150 r.p.m. 
ethanol treatment : <Anti> no ethanol exposure </Anti> 
evolved _ <Supp> temperature _ </O> <Gtype> Up _ </O> <Supp> 16 min </Supp> 
evolved _ <Supp> temperature _ </O> <Gtype> Up _ </O> <Supp> 44 min </Supp> 
evolved _ temperature _ Up _ <Supp> 0 min </Supp> 
Experiments were performed at <Temp> 37 °C </Temp> and followed three steps : seed culture , pre-culture and experimental culture . In the seed culture the cells were grown overnight in Luria Broth , then diluted 1:100 in either <Med> M9 minimal media </Med> with glycerol or glucose for the pre-cultures . Finally , the experimental cultures were started from the overnight grown pre-cultures containing the same carbon source at a normalized optical density at 600 nm ( OD600 ) of 0.05 . Cultures were harvested at mid-exponential phase , cells were immediately spun down and cell pellets stored at -80 °C until processed . 
Exponential cultures of transformants were inoculated from fresh overnight cultures in LB medium supplemented with 25 µg/ml of kanamycin to an optical density at 600 nm ( OD ) of 0.1 and grown for <Supp> 30 min </Supp> at <Temp> 37 °C </Temp> to an OD of 0.15 . Then , IPTG was added to a final concentration of 1 mM for induction of expression . After 60 min of additional growth cells were harvested for RNA isolation . 
Exponential phase culture of EDL933 rpoS mutants in LB at <OD> OD600 of 0.3 </OD> 
Exponential phase culture of <Gtype> EDL933 wild type </Gtype> in LB at <OD> OD600 of 0.3 </OD> 
Expression of introduced enzymes for 3-HP productionm was induced by <Supp> 0.05 mM IPTG and 50 µM vitamin </Supp> B12 when the cell reached at the early-exponential growth phase . T 
extracted molecule : <Gtype> plasmid DNA </Gtype> 
Extraction : <Gtype> TRI Reagent </Gtype> 
EYG in M9 supplemented with <Supp> 0.6 M NaCl Replicate 1 </Supp> 
EYG in M9 supplemented with <Supp> 0.6 M NaCl Replicate 2 </Supp> 
FastQ files were examined using the FastQC tool . All the relevant SPET-seq data ( nascent RNA ) analysis and normalization steps were performed using a custom wrapper built on top of the RNA Framework13 . Briefly , reads were clipped from 3 ' adapter sequences using Cutadapt v1 .10 , discarding reads shorter than 15 nucleotides . Escherichia coli str . <Strain> K-12 substr . MG1655 ( GenBank : </O> <Gversion> U00096 .2 </Gversion> ) was used as the reference genome to extract transcripts ' sequences . Forward and reverse reads were independently mapped to the reference transcriptome using Bowtie v1 .1.2 , by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes ( parameters : - n 2 - m 7 - a -- best -- strata -5 5 -LSB- -- norc for forward reads , -- nofw for reverse reads -RSB- ) . Forward and reverse mapped reads were then re-paired . Using reverse read mapping positions ( corresponding to RNA Polymerase positions along gene ) , forward reads were split into separate SAM files for each transcription intermediate . When analysis was performed in deciles of transcription , genes were split into 10 equally sized deciles , and reads belonging to transcription intermediates falling in the same decile were pooled . SAM files were then passed to the rf-count tool of the RNA Framework to generate RT-stop counts ( RC ) files . Resulting RC files were normalized using the rf-norm tool of the RNA Framework in 50 nt sliding windows , with a 25 nt offset ( parameters : - sm 2 - nm 2 - ec 0 - mc 0 - n 50 - nw 50 - wo 25 ) . Mapping of DMS-seq data ( mature RNA ) was performed by using the rf-count tool ( parameters : - cl 15 - bm 7 - ba - b5 5 ) . Resulting RC files were normalized using the rf-norm tool ( parameters : - sm 2 - nm 2 - ec 50 - mc 50 - n 50 - nw 50 - wo 25 ) . The rf-norm tool generates a XML file for each transcript ( or for each transcription intermediate/decile in the case of SPET-seq data ) . XML files for mature RNA were passed to the rf-fold tool of the RNA Framework ( using ViennaRNA Package 2.2 with soft constraints14 ) to infer mature RNA structures ( parameters : - md 600 - nlp ) . 
FastQ files were examined using the FastQC tool . Reads were clipped from 3 ' adapter sequences using Cutadapt v1 .10 , discarding reads shorter than 15 nucleotides . Escherichia coli str . <Strain> K-12 substr . MG1655 ( GenBank : </O> <Gversion> U00096 .2 </Gversion> ) was used as the reference genome . Reads were mapped to the reference genome using Bowtie v1 .1.2 , by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes ( parameters : - n 2 - m 7 - a -- best -- strata -5 5 ) . 
FASTQ formatted sequence files from strand-specific Illumina RNA-Seq reads were aligned to the GLBRCE1 reference genome NC _ 000913 using Bowtie version 0.12.7 ( Langmead et al. , 2009 ) with ' -- nofw ' strand-specific parameter and maximal distance between the paired reads of 1000 bp . NOTE : Genome NC _ <Gversion> 000913 ( ASM584v2 </Gversion> ) represents the parental strain . The strain used in our study was modified from the parental strain by replacing gene pflB with an insertion that contained 3 different genes . 
Fecal samples obtained from mice were immediately frozen in liquid nitrogen and stored at -80 °C until processing . All of the samples were suspended in a solution containing 500 ul of acid-washed glass beads ( Sigma-Aldrich ) , 500 ul of extraction buffer A ( 200 mM Tris -LSB- pH 8 -RSB- , 200 mM NaCl , 20 mM EDTA ) , 200 ul of 20 % SDS , and 500 ul of a mixture of phenol : <Gtype> chloroform : isoamyl </Gtype> alcohol ( 25:24:1 , pH 8.0 ; Ambion ) and lysed by using a bead beater ( BioSpec Products ) . Cellular debris was removed by centrifugation ( 8,000 g ; 3 min ) . The nucleic acids were precipitated with isopropanol and sodium acetate and resuspended in 100 ul TE . The resuspension was further purified with a Qiagen PCR column and eluted into 30 ul of EB buffer . 
Fecal samples obtained from mice were immediately frozen in liquid nitrogen and stored at -80 °C until processing . All of the samples were treated with RNAProtect ( Qiagen ) and suspended in a solution containing 500 μl of acid-washed glass beads ( Sigma-Aldrich ) , 500 μl of extraction buffer A ( 200 mM NaCl , 20 mM EDTA ) , 210 μl of 20 % SDS , and 500 μl of a mixture of phenol : <Gtype> chloroform : isoamyl </Gtype> alcohol ( 125:24:1 , pH 4.5 ; Ambion ) and lysed by using a bead beater ( BioSpec Products ) . Cellular debris was removed by centrifugation ( 8,000 × g ; 3 min ) . The nucleic acids were precipitated with isopropanol and sodium acetate ( <pH> pH 5.5 </pH> ) . 
First biological repeat <Temp> 37 °C </Temp> 
Florfenicol _ treatment _ plasmidmappedreads _ <Gtype> statistical _ output.txt : </O> <Gversion> NC _ </O> <Technique> 012692.1 
Flor _ treatment _ genomemappedreads _ <Gtype> statistical _ output.txt : </O> <Supp> NC _ 000913.2 </O> 
FNR - <Air> Anaerobic - Affinity Purified - A </O> 
FNR - <Air> Anaerobic - Affinity Purified - B </O> 
fnr - <Air> anaerobic AN rep 1 </O> 
fnr - <Air> anaerobic AN rep 2 </O> 
fnr - <Air> anaerobic AN rep 3 </O> 
FNR - <Air> Anaerobic - A </O> 
FNR - <Air> Anaerobic - B </O> 
FNR - <Air> Anaerobic - C </O> 
FNR - _ <Air> Anaerobic _ </O> <Technique> RNAseq _ A _ Tag _ Count.txt : </O> <Gversion> U00096 .2 </Gversion> 
FNR - _ <Air> Anaerobic _ </O> <Technique> RNAseq _ A _ WIG.wig : </O> <Gversion> U00096 .2 </Gversion> 
FNR - _ <Air> Anaerobic _ </O> <Technique> RNAseq _ B _ </O> <Supp> Tag _ Count.txt : </O> <Gversion> U00096 .2 </Gversion> 
FNR - _ <Air> Anaerobic _ </O> <Technique> RNAseq _ B _ WIG.wig : </O> <Gversion> U00096 .2 </Gversion> 
fnr - <Air> anaerobic plus NO2 AN rep 1 </O> 
fnr - <Air> anaerobic plus NO2 AN rep 2 </O> 
fnr - <Air> anaerobic plus NO2 AN rep 3 </O> 
fnr - <Air> anaerobic plus NO2 </O> 
fnr - <Air> anaerobic plus NO2 rep 1 </O> 
fnr - <Air> anaerobic plus NO2 rep 2 </O> 
fnr - <Air> anaerobic plus NO2 rep 3 </O> 
fnr - <Air> anaerobic plus NO3 AN rep 1 </O> 
fnr - <Air> anaerobic plus NO3 AN rep 2 </O> 
fnr - <Air> anaerobic plus NO3 AN rep 3 </O> 
fnr - <Air> anaerobic plus NO3 rep 1 </O> 
fnr - <Air> anaerobic plus NO3 rep 2 </O> 
fnr - <Air> anaerobic plus NO3 rep 3 </O> 
fnr - <Air> anaerobic rep 1 </O> 
fnr - <Air> anaerobic rep 2 </O> 
fnr - <Air> anaerobic rep 3 </O> 
fnr - <Air> anaerobic <Supp> plus NO3 </Supp> 
FNR ChIP DNA from <Gtype> ∆ hns / ∆ stpA </Gtype> E. coli MG1655 
FNR - <Gtype> ∆ hns ∆ stpA </Gtype> A 
FNR - <Gtype> ∆ hns ∆ stpA </Gtype> B 
FNR INPUT from PK8263 with <Supp> 16 µM INPUTTG </Supp> 
FNR INPUT from PK8263 with <Supp> 4 µM INPUTTG </Supp> 
FNR INPUT from PK8263 with <Supp> 8 µM INPUTTG </Supp> 
FNR IP from PK8263 with <Supp> 16 µM IPTG </Supp> 
FNR IP from PK8263 with <Supp> 4 µM IPTG </Supp> 
FNR IP from PK8263 with <Supp> 8 µM IPTG </Supp> 
FNR IP <Technique> ChIP-seq <Air> Anaerobic B </O> 
For 3C-seq : ≈ 1-2 x 109 crosslinked cells ( 7 % formaldehyde , unless otherwise stated ) are suspended in 600 μl Tris 10 mM EDTA 0.5 mM ( TE ) ( pH 8 ) with 4 μl of lysozyme ( 35 U/μl ; Tebu Bio ) , and incubated at RT for 20 minutes . SDS is added to the mix ( final concentration 0.5 % ) and the cells are incubated for 10 minutes at RT. 50μl of lysed cells are then transferred in 8 tubes containing 450μL of digestion mix ( 1X NEB 1 buffer , 1 % triton X-100 , and 100U HpaII enzyme ) . DNA is digested for 3 hours at <Temp> 37 °C </Temp> , split in 4 aliquots , and diluted in 8 ml ligation buffer ( 1X ligation buffer NEB without ATP , 1 mM ATP , 0.1 mg/ml BSA , 125 Units of T4 DNA ligase 5 U/μl ) . Ligation is then performed at 16 °C for 4 hours , followed by incubation overnight ( ON ) at 65 °C in presence of 250 μg/ml proteinase K and 5 mM EDTA . Precipitation of DNA is performed using an equal volume of 3 M Na-Acetate ( pH 5.2 ) and two volumes of iso-propanol . After one hour at -80 °C , DNA is pelleted , suspended in 500μl 1X TE buffer , and incubated for 30 minutes at <Temp> 37 °C </Temp> in presence of RNAse A ( 0.03 mg/ml ) . DNA is then transferred into 2 ml centrifuge tubes , extracted twice with 500 μl phenol-chloroform pH 8.0 , precipitated , washed with 1 ml cold ethanol 70 % and diluted in 30 μl 1X TE buffer . All tubes are pooled and the resulting 3C library is quantified on gel using Quantity One software ( BioRad ) . 
For alignment of the reads contained within the fastq files to the E. coli MG1655 reference genome ( RefSeq NC _ <Gversion> U00096 .3 </Gversion> ) , the short read alignment tool Bowtie2 was utilized under default settings . Bowtie parameters were set to include only perfect matches and map once reads that map to more than one genome location , i.e. , uniquely mapped reads are retained . The output Bowtie2 was a SAM files for each sample . 
For analysis of ChIP-seq data , Hiseq 2500 Illumina short reads ( 50 bp ) were mapped back to the Caulobacter NA1000 reference genome ( NCBI Reference Sequence : <Gtype> NC-011916.1 ) using Bowtie 1 ( Langmead et al. , 2009 ) and the following command : bowtie - m 1 - n 1 -- best -- strata - p 4 -- chunkmbs 512 NA1000-bowtie -- sam * . fastq > output.sam . Subsequently , the sequencing coverage at each nucleotide position was computed using BEDTools ( Quinlan and Hall , 2010 ) using the following command : bedtools genomecov - d - ibam output.sorted.bam - g NA1000.fna > coverage_output.txt . For analysis of E. coli ChIP-seq data , reference genomes were first reconstructed in silico by inserting the nucleotide sequence of parS and apramycin antibiotic resistance cassette to the ybbD locus of E. coli MG1655 genome . Afterwards , Hiseq 2500 Illumina short reads were mapped back to these reconstructed reference genomes using Bowtie 1 . Sequence coverage at each nucleotide position was also computed using BEDTools . Finally , ChIP-seq profiles were plotted with the x-axis representing genomic positions and the y-axis is the number of reads per base pair per million mapped reads ( RPBPM ) using custom R scripts . </O> 
For analysis of IDAP-seq data , Hiseq 2500 Illumina short reads ( 50 bp ) were mapped back to the Caulobacter NA1000 reference genome ( NCBI Reference Sequence : <Gtype> NC-011916.1 ) using Bowtie 1 ( Langmead et al. , 2009 ) and the following command : bowtie - m 1 - n 1 -- best -- strata - p 4 -- chunkmbs 512 NA1000-bowtie -- sam * . fastq > output.sam . Subsequently , sequencing reads were sorted to either being mapped to the upper DNA strand or to the lower strand of the reference genome , as suggested in the original IDAP-seq publication ( Belitsky and Sonenshein , 2013 ) . The number of 5 ' end of reads that were mapped to the upper strand was counted for each nucleotide position along the Caulobacter genome using BEDTools ( Quinlan & Hall , 2010 ) and the following command : bedtools genomecov - d -5 - strand + - ibam output.sorted.bam - g NA1000.fna > upper_strand_output.txt . To count the number of 5 ' end of reads that were mapped to the lower strand , the following command was used instead : bedtools genomecov - d -5 - strand - - ibam output.sorted.bam - g NA1000.fna > lower_strand_output.txt . The IDAP-seq profile was then plotted using R . The sequence in between the summit of upper strand profile and that of the lower strand profile defines the minimal parS sequence required for binding to ParB . </O> 
For each biological replicate , frozen aliquots ( 500μl ) of E. coli K12 stock cultures were subcultured in 10 ml of Brain Heart Infusion ( BHI ) and incubated overnight at <Temp> 37 °C </Temp> . Cells were then sub-cultured ( 1 % v/v ) into 50 ml BHI broth and incubated at <Temp> 37 °C </Temp> for 24h under constant agitation ( 150 rpm ) . The bacterial suspensions were then inoculated ( 1 % v/v ) in 200 ml BHI broth and grown in the same conditions to stationary phase ( OD600nm of 0.9 ) . 
For each biological RNA-Seq replicate E coli K-12 MG1655 was subcultured from cyrostorage on Luria-Bertani ( LB ) agar overnight at <Temp> 37 °C </Temp> . A half-dozen well-isolated colonies were used to inoculate a 20 ml starter culture in <Med> Neidhardt MOPS Minimal Medium ( NM3 ) </Med> ( Neidhardt et al. , 1974 , J Bacteriol ) ( 0.2 % final glucose concentration ) supplemented with <Supp> 20 mg/L uracil </Supp> and 500 µg/L thiamine , which was incubated at <Temp> 37 °C </Temp> with shaking at <Agit> 250 rpm </Agit> overnight ( ~ 18 hr ) . The overnight starter culture was diluted 1:30 to initiate the experimental culture and divided into three 500 ml flasks with 100 ml NM3 in each , which were incubated at <Temp> 37 °C </Temp> with shaking at <Agit> 250 rpm </Agit> . 
For each sample , 500 mL liquid cultures were grown in 2.8 L flasks with shaking ( 180 rpm ) at <Temp> 37 °C </Temp> from an OD ( 600 nm ) 0.05 to OD 0.45 ± 0.05 . Cells were grown in <Med> MOPS EZ </Med> rich defined medium with <Supp> 0.2 % glucose </Supp> ( Teknova ) . 
For immunoprecipitation , 800 μl of collected chromatin ( ~ 1000 μg of protein ) were incubated on a rotating wheel over night at 4 °C with 10 μg of either rabbit anti-Dps antibodies ( experimental sample ) or rabbit pre-immune IgG ( negative control ) . Next day 30 μl of Ultra Link Protein A/G beads ( Thermo Scientific , USA ) were added to the samples , and incubation was allowed for a <Supp> further 2 hours </Supp> at 4 °C on a rotating wheel . The beads were washed 3 times with 1 ml of the low-salt buffer ( 50 mM HEPES pH 7.5 , 140 mM NaCl , 1 % Triton X-100 , 1xPIC ) and then with 1 ml of the high-salt buffer ( 500 mM NaCl ) . Immunoprecipitated DNA-protein complexes were removed from the beads by 3 h shaking at 65 °C and 1000 rpm in 110 μl of freshly prepared elution buffer , containing 100 mM NaHCO3 and 1 % SDS . After centrifugation at 3000 rpm for 5 minutes , 100 μl of the supernatant was transferred to a new tube , and the DNA was purified with a PCR Purification Kit ( Qiagen , Germany ) . The DNA concentration was measured on Qubit 2.0 using Qubit dsDNA HS Assay kit . A total of 8-10 identical samples were combined and concentrated to a volume of 30-50 μl containing 5-10 ng of the DNA . 
For in vivo DMS modification , 15 mL of E. coli culture was incubated with 750 µL DMS . Incubation was performed for 2 min at <Temp> 37 °C </Temp> or for 45 min at 10 °C . DMS was quenched by adding 30 mL 0 °C stop solution ( 30 % β-mercaptoethanol , 25 % isoamyl alcohol ) , after which cells were quickly put on ice , collected by centrifugation at 8000 x g , 4 °C for 2 min , and washed with 8 mL 30 % BME solution . Cells were then resuspended in 450 µL total RNA lysis buffer ( 10 mM EDTA , 50 mM sodium acetate pH 5.5 ) , and total RNA was purified with hot acid phenol ( Ambion ) . 
For in vivo DMS modification , 15 mL of exponentially growing E. coli were incubated with 750 µL DMS for 2 min at <Temp> 37 °C </Temp> . For kasugamycin ( ksg ) experiments , ksg was added to a final concentration of 10 mg/mL to ΔgcvB cells for 2 min at <Temp> 37 °C </Temp> prior to DMS modification . DMS was quenched by adding 30 mL 0 °C stop solution ( 30 % β-mercaptoethanol , 25 % isoamyl alcohol ) . For in vitro DMS modifications , mRNA was denatured at 95 °C for 2 min , cooled on ice and refolded in 90 µL RNA folding buffer ( 10 mM Tris pH 8.0 , 100 mM NaCl , 6 mM MgCl2 ) at <Temp> 37 °C </Temp> for 30 min then incubated in either .2 % DMS for 1 min ( 95 °C ) or 4 % DMS for 5 min ( <Temp> 37 °C </Temp> ) . 
For quantification of gene expression ( read counting ) , the alignments generated with the Genomics Workbench were exported in BAM format . Read counting was then performed with the FeatureCounts v. 1.5.0-p1 program using the following parameters ; Level : <Gtype> meta-feature leve . Paired-end : no . Strand specific : </O> <Supp> yes . Multimapping reads : </O> <Anti> counted ( as fractions ) . Multi-overlapping reads : not counted . Overlapping bases : </O> <Supp> 30 . Read orientations : </O> <Supp> fr 
For RNA isolation , 0.5 mL of the cultures were mixed with 1 mL RNA protect ( Qiagen , Ontario , Canada ) and RNA was isolated using the RNeasy Mini kit ( Qiagen ) . RNA was quantified with a Nanodrop Spectrophotometer ( Thermo scientific , Wilmington , USA ) and RNA quality was determined with a Bioanalyzer 2100 ( Agilent Technologies , Santa Clara , USA ) . RNA samples ( approximately 30 µg ) were treated with 1U RNase free DNase I ( Ambion , Ontario , Canada ) at <Temp> 37 °C </Temp> for <Supp> 30 min </Supp> and 1U RNase inhibitor ( Ambion ) was added prior to storage at 4 °C . RNA was reverse-transcribed using the Array 900MPX Expression Array Detection Kit ( Genisphere , Hatfield , USA ) according to the instructions of the manufacturer . The cDNA was purified using the MinElute PCR Purification Kit ( Quiagen ) , and the purified DNA was used for microarray and qPCR experiments . 
For RNA-seq : <Gtype> total RNA </Gtype> was extracted using RNeasy Protect Bacteria according to manufacturer instructions ( QIAGEN - # 74524 ) 
For the first batch ( from <Gtype> WT _ </O> <Med> LB _ 1 to lacA _ M9 _ 2 ) , fresh colonies of E. coli cells were taken and inoculated in 1 ml LB and grown for 8 h at </O> <Temp> 37 °C </Temp> . 20 µL of grown culture was taken and transferred to 3 ml LB/M9 medium supplemented with 0.3 % glucose and grown for 12 h at <Temp> 37 °C </Temp> . At 12 h , cells were harvested for the RNA-seq . For the second batch ( from <Gtype> WT _ 1 to aspC _ 3 ) , a 1:100 dilution from an overnight culture in M9 0.4 % glucose was done . When the late stationary phase was reached , the samples were harvested . </O> 
For total RNA isolation , the bacteria were inoculated in 5 ml LB broth at 37 ℃ with shaking for 16 h. 50 µl of the above culture was inoculated in 5 ml <Med> fresh LB </Med> broth and the culture was shaken at <Temp> 37 °C </Temp> for about 2.5 h until the OD600 reached 0.6 . 500 µl of the culture were mixed with 1 ml RNA protect bacterial reagent ( Qiagen , Hilden , Germany ) to stabilize RNA according to the manufacturer 's instructions . 
FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 
fraction : <Gtype> input DNA </Gtype> 
From the cells cultured in <Med> LB media </Med> at 37 ℃ , total RNA was extracted using RNAsnapTM method , followed by the ethanol precipitation . rRNA was removed using ribo-zeroTM magnetic kit for bacteria in accordance with manufacturer 's instruction ( Epicentre ) . rRNA removal was confirmed using ExperionTM system . Subsequently , 4 µg of the purified RNA was fragmented to sizes of ~ 300 bp using RNA fragmentation reagent ( Ambion , Grand Island , NY ) . 
Frozen bacteria were grown overnight in 18 mm test tubes containing DMga medium , 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for 12hours <Temp> 37 °C </Temp> , 250rpm . Extraction was performed just after . 
Frozen bacteria were grown overnight in 18 mm test tubes containing DMga medium , 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for 18hours <Temp> 37 °C </Temp> , 250rpm . Extraction was performed just after . 
Frozen bacteria were grown overnight in 18 mm test tubes containing DMga medium , 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for 4hours <Temp> 37 °C </Temp> , 250rpm . Extraction was performed just after . 
Frozen bacteria were grown overnight in 18 mm test tubes containing DMga medium , 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for 7hours <Temp> 37 °C </Temp> , 250rpm . Extraction was performed just after . 
Frozen bacteria were grown overnight in 18 mm test tubes containing DMga medium , 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for <Supp> 12 hours </Supp> <Temp> 37 °C </Temp> , 250rpm . Extraction was performed just after . 
Frozen bacteria were grown overnight in 18 mm test tubes containing DMga medium , 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for <Supp> 18 hours </Supp> <Temp> 37 °C </Temp> , 250rpm . Extraction was performed just after . 
Frozen bacteria were grown overnight in 18 mm test tubes containing DMga medium , 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for <Supp> 3.5 hours </Supp> <Temp> 37 °C </Temp> , 250rpm . Extraction was performed just after . 
Fur IP <Technique> ChIP-Seq <Air> Aerobic A </O> 
Fur IP <Technique> ChIP-Seq <Air> Aerobic B </O> 
Fur IP <Technique> ChIP-Seq <Air> Aerobic C </O> 
Fur IP <Technique> ChIP-Seq <Air> Anaerobic A </O> 
Fur IP <Technique> ChIP-Seq <Air> Anaerobic B </O> 
Fur IP <Technique> ChIP-Seq <Air> Anaerobic C </O> 
Fur IP <Technique> ChIP-Seq <Air> Anaerobic , </O> <Supp> Iron Deficient A </O> 
Fur IP <Technique> ChIP-Seq <Air> Anaerobic , </O> <Supp> Iron Deficient B </O> 
Fur with <Supp> DPD 1 </O> <Technique> ( ChIP-exo ) </Technique> 
Fur with <Supp> DPD 2 </O> <Technique> ( ChIP-exo ) </Technique> 
Fur with <Supp> Fe 1 </O> <Technique> ( ChIP-exo ) </Technique> 
Fur with <Supp> Fe 2 </O> <Technique> ( ChIP-exo ) </Technique> 
G21 MG1655GFP _ <Supp> pD864 _ 3 </O> 
G23 MG1655GFP _ <Supp> pLys _ M1 _ 3 </O> 
G28 MG1655GFP _ <Supp> pD864 _ 3 </O> 
G29 DH10BGFP _ <Supp> None _ 3 </O> 
G5 DH10BGFP _ <Supp> Lux _ 3 </O> 
G6 DH10BGFP _ <Supp> pD864 _ </O> <Gtype> LacZ _ 3 </O> 
Galaxy1 - -LSB- CV104 _ <Supp> pHDB3 _ 5 . txt -RSB- </O> 
Galaxy2 - -LSB- CV104 _ <Supp> pLCV1 _ 5 . txt -RSB- </O> 
Galaxy3 - -LSB- CV104 _ <Supp> pLCV1 _ 10 . txt -RSB- </O> 
Galaxy4 - -LSB- CV104 _ <Supp> pHDB3 _ 20 . txt -RSB- </O> 
Galaxy5 - -LSB- CV104 _ <Supp> pLCV1 _ 20 . txt -RSB- </O> 
Galaxy6 - -LSB- CV104 _ <Supp> pHDB3 _ 10 . txt -RSB- </O> 
gene counting : <Gtype> HTSeq-Count 0.6.0 </Gtype> 
Gene expression was calculated as reads per gene by determining the number of reads that overlapped with the annotated gene loci using HTSeq ( Anders et al. , 2015 , doi : <Gtype> 10.1093 / bioinformatics/btu638 ) </Gtype> with the option ` intersection-nonempty ' . 
Genes from the amplified regions in O500 ( 12-fold ) and P500 ( two-fold ) strains are significantly over-expressed relative to the reference : <Gtype> average log Fold Change for concentrations is +3.6 and +0.8 ( both with p-values < 10-20 ) , respectively . </O> 
genetic background : <Gtype> O157 H19 </Gtype> 
Genetic background : <Gtype> wtGrowth conditions : </O> <Gtype> aerobic 
genetic modification : <Gtype> empty plasmid ( LJ110/pTM30 ) </Gtype> 
genetic modification : <Gtype> PdhR knockout mutant ( LJ110deltapdhR ) </Gtype> 
genetic modification : <Gtype> PdhR overexpression strain ( LJ110/pTM30PdhRhis ) </Gtype> 
genetic modification : <Gtype> wild type LJ110 </Gtype> 
genome accession : <Supp> GCA _ 000752975 </O> 
genome accession : <Supp> GCA _ 000753215 </O> 
genome accession : <Supp> GCA _ 000753275 </O> 
genome accession : <Supp> GCA _ 000936225 </O> 
genome accession : <Supp> GCA _ 000936245 </O> 
genome accession : <Supp> GCA _ 000936475 </O> 
genome accession : <Supp> GCA _ 000937275 </O> 
genome accession : <Supp> GCA _ 000938695 </O> 
genome accession : <Supp> GCA _ 000938995 </O> 
genome accession : <Supp> GCA _ 000939195 </O> 
genome accession : <Supp> GCA _ 000939755 </O> 
genome accession : <Supp> GCA _ 000939955 </O> 
genome accession : <Supp> GCA _ 000941395 </O> 
genome accession : <Supp> GCA _ 000941895 </O> 
genome accession : <Supp> GCA _ 000946755 </O> 
genome accession : <Supp> GCA _ 000947315 </O> 
genome accession : <Supp> GCA _ 000951835 </O> 
genome accession : <Supp> GCA _ 000951875 </O> 
genome accession : <Supp> GCA _ 000951915 </O> 
genome accession : <Supp> GCA _ 000965545 </O> 
genome accession : <Supp> GCA _ 000965555 </O> 
genome accession : <Supp> GCA _ 000965575 </O> 
genome accession : <Supp> GCA _ 000965625 </O> 
genome accession : <Supp> GCA _ 000965635 </O> 
genome accession : <Supp> GCA _ 000965655 </O> 
genome accession : <Supp> GCA _ 000965665 </O> 
genome accession : <Supp> GCA _ 000965705 </O> 
genome accession : <Supp> GCA _ 000965715 </O> 
genome accession : <Supp> GCA _ 000966935 </O> 
Genome _ build : <Anti> ASM1024v1 ( NCBI E. coli K12 subst . W3110 genome ( GenBank : </O> <Gtype> AP009048 .1 ) ) </Gtype> 
Genome _ build : <Anti> gi  387825439 </Anti> 
Genome _ build : <Anti> Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . </O> <Strain> K-12 substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . </O> 
Genome _ build : <Anti> Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . </O> <Strain> K-12 substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . </O> 
Genome _ build : E. coli : <Gversion> NC _ 000913 </Gversion> 
Genome build : E. coli -LSB- K-12 MG1655 strain ( <Gversion> U00096 .2 ) </Gversion> 
Genome _ build : E. coli MG1655 GenBank : <Gversion> U00096 .2 </Gversion> , total length : <Supp> 4639675 bp </Supp> 
Genome _ build : Escherichia coli MG1655 K-12 genome version <Gversion> U00096 .2 </Gversion> 
Genome _ build : Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 ) </Gversion> 
Genome _ build : Escherichia coli <Strain> K-12 substr . DH10B ASM1942v1 </O> 
Genome _ build : Escherichia coli str . <Strain> K-12 substr . MG1655 , NCBI Reference Sequence : </O> <Supp> NC _ 000913.3 </O> 
Genome _ build : Escherichia coli str . <Strain> K-12 substr . MG1655 ( U00096 .3 ) </O> 
Genome _ build : Escherichia coli str . <Strain> K-12 substr . </O> <Substrain> MG1655 
Genome _ build : <Gtype> ASM584v1 ; Reference genome for E. coli MG1655 ( RefSeq NC _ 000913 ) . Paper title : Escherichia coli K-12 : a cooperatively developed annotation snapshot -- 2005 </O> 
Genome _ build : <Gtype> ASM666v1 ; NC _ 002655.2 </O> 
Genome _ build : <Gtype> CP009273 .1 </Gtype> 
Genome _ build : <Gtype> E.coli K12 BW25113 </Gtype> 
Genome _ build : <Gtype> NC007779 .1 </Gtype> ( UCSC Archaeal Genome Browser ) 
Genome _ build : <Gtype> NCBI reference sequence : NC </Gtype> _ <Technique> 000913.2 
Genome _ build : <Gtype> NCBI reference sequence ( NC _ </O> <Technique> 017626.1 ) </Technique> 
Genome _ build : <Gtype> pPR9 plasmid ( ref is Kashlec et al. , 1989 , PMID : </O> <Supp> 2547695 ) </Supp> 
Genome _ build : <Gtype> Reference genome for E. coli MG1655 ( RefSeq NC _ 000913.3 ) . </O> 
Genome _ build : <Gtype> Reference genome used : Escherichia coli K12 MG1655 , version : </O> <Gtype> iGenome 
Genome _ build : <Gtype> RefSeq NC </Gtype> _ <Technique> 000913.3 
Genome _ build : <Gtype> Streptococcus pneumoniae D39 ( assembly ASM1436v1 ) </Gtype> 
Genome _ build : <Gtype> The reference genomes used for E. coli K12 strain BW25113 and S. coelicolor A3 ( 2 ) strain M145 were </O> <Gversion> U00096 .2 </Gversion> and AL645882 , respectively . 
Genome _ build : <Gversion> ASM584v1 , U00096 .2 </Gversion> 
Genome _ build : <Gversion> ASM584v2 ( Escherichia _ coli _ str _ k _ 12 _ substr _ </O> <Gtype> mg1655.GCA _ 000005845.2.24 . gtf ) </O> 
Genome _ build : <Gversion> NC000913 .2 </Gversion> 
Genome _ build : <Gversion> NC000913 .2 </Gversion> <Substrain> MG1655 
Genome _ build : <Gversion> NC _ 000913 </Gversion> 
genome build : <Gversion> U00096 .2 </Gversion> 
Genome _ build : <Gversion> U00096 .2 </Gversion> 
Genome _ build : <Gversion> U00096 .2 </Gversion> ( GenBank ) 
Genome _ build : <Gversion> U00096 .3 </Gversion> 
Genome _ build : <Gversion> U00096 .3 </Gversion> ( E. coli K12 ) and NC _ 001604.1 ( T7 ) , excluding ribosomal genes , and with recoded gene 10 sequence ( Bull , 2012 , PMCID : <Gtype> PMC3457771 ) </Gtype> in place of wild-type sequence for analysis of recoded and evolved strains 
Genome _ build : <Gversion> W3110 ( NC </Gversion> _ 007779 ) 
Genome _ build : <Med> CFT073 ( AE014075 .1 ) </Med> 
Genome _ build : <Med> CP018801 ( https://www.ncbi.nlm.nih.gov/nuccore/CP018801 ) </Med> 
Genome _ build : <Strain> K-12 subst . MG1655 genome ( NC _ </O> <Gtype> 000913.3 ) / ASM584v1 </Gtype> 
Genome _ build : <Strain> K-12 substr . MG1655 genome ( NC _ </O> <Gtype> 000913.3 ) / ASM584v1 </Gtype> 
Genome _ build : strain MG1655 , version <Gversion> U00096 .2 </Gversion> , downloaded from NCBI 
Genome _ build : <Supp> DL4201 _ in _ lab _ reference _ genome ( available on series record ) </O> 
Genome _ build : <Supp> NC _ 000913.2 </O> 
Genome _ build : <Supp> NC _ 000913.3 E. coli K12 substr . </O> <Substrain> MG1655 
genome build : <Supp> NC _ 000913.3 </O> 
Genome _ build : <Supp> NC _ 000913.3 </O> 
Genome _ build : <Supp> NC _ 002655.2 </O> 
Genome _ build : <Supp> NC _ 002655 </O> 
Genome _ build : <Supp> NC _ 007779.1 </O> 
Genome _ build : <Supp> NC _ 010473.1 </O> 
Genome _ build : <Supp> NC _ 011741 ( E.coli strain IAI1 ) , NC _ 000913.2 ( E.coli strain MG1655 ) , TW09308 ( E.coli strain TW09308 ) , and TW11588 ( E.coli strain TW11588 ) </O> 
Genome _ build : <Supp> NC _ 011916.1 </O> 
Genome _ build : <Supp> NC _ 012967.1 plus small RNAs as annotated in Rfam 11.0 database </O> 
Genome _ build : <Supp> NC _ 016856.1 </O> 
Genome _ build : <Supp> NC _ 017644.1 ( Escherichia coli NA114 ) </O> 
Genome _ build : <Supp> NC _ 018220 and NC _ </O> <Gversion> 000913 
Genome _ build : <Supp> NC _ 018658.1 , NC _ 018659.1 , NC _ 018660.1 , NC _ </O> <Technique> 018666.1 
Genome _ build : <Supp> NC _ </O> <Gtype> 000913/ASM584v1 
Genome _ build : <Supp> UCSC mm10 </Supp> 
Genomic DNA control from E. coli K-12 MG1655 HA3 : <Gtype> : nusG cells </Gtype> 
Genomic DNA Extraction : <Gtype> Genomic DNA was extracted according to Current Protocols in Molecular Biology . Protein-DNA complex isolation : </O> <Gtype> Protein-DNA complexes were isolated by phenol extraction with 150 μL 10 mM Tris and 500 μL 25:24:1 phenol : </O> <Gtype> chloroform : isoamyl </Gtype> alcohol . A white disk was readily discernible at the aqueous/organic interface . To purify this interface , all aqueous and organic liquid was removed by pipetting . A second extraction was performed by adding 500 μL 10 mM Tris and 450 μL 24:1 chloroform : isoamyl alcohol , vortexing and centrifuging . Again , all liquid was removed from the interface by pipetting , and residual liquid was removed . For cross-link reversal : the interface was suspended in 500 μL 10 mM Tris and 50 μL 10 % SDS , and placed at ~ 100 ˚C for 30 minutes . The tubes were placed on ice , then moved to 65 ˚C for 3 hours following addition of 5 μL proteinase K ( 20 mg/mL ) . After heat treatment , the solutions were phenol/chloroform extracted and ethanol precipitated in the presence of glycogen to purify the DNA . RNA extraction : the Qiagen RNeasy kit ( P/N 74104 ) was used to isolate total cellular RNA . Immediately following elution in RNase-free water , residual DNA was removed by treatment with DNaseI at <Temp> 37 °C </Temp> for 15 minutes . The samples were treated again using the RNeasy kit , resuspended in 40 μl RNase-free water , and stored at -20 °C . 
Genomic DNA from O55 : <Gtype> H6 strain ICC219 </Gtype> 
Genomic DNA from O55 : <Gtype> H6 strain ICC221 </Gtype> 
Genomic DNA from O55 : <Gtype> H6 strain ICC222 </Gtype> 
Genomic DNA from O55 : <Gtype> H7 strain st58 </Gtype> 
Genomic DNA from O55 : <Gtype> H7 strain st957 </Gtype> 
Genomic DNA from O55 : <Gtype> H7 strain TB182A </Gtype> 
Genomic DNA from O55 : <Gtype> H7 strain WC211 </Gtype> 
Genomic DNA from O55 : <Gtype> H7 strain WC416 </Gtype> 
Genomic DNA purified from <Gtype> wild type </Gtype> bacteri 
Genomic DNA purified from <Gtype> wild type </Gtype> bacteria 
Genomic DNA was extracted from 4 bacteria strains . Strains Fibrobacter succinogenes S85 ( ATCC 19169 ) , Ruminococcus albus 20 ( ATCC 27211 ) and Bacteroides xylanisolvens XB1A ( DSM 18836T ) were grown 15 h under strictly anaerobic conditions ( Hungate , 1950 ) in a complex medium containing 20 % of clarified rumen fluid ( Béra-Maillet et al. , 2000 ) and 0.2 g of cellobiose ( Sigma-Aldrich ) as carbon source , at 39 °C for the two first ones and <Temp> 37 °C </Temp> for the third one . The strain Escherichia coli K12 ( ATCC 10798 ) was cultivated 15 h at <Temp> 37 °C </Temp> in Luria-Bertani medium under shaking and aerobic conditions . ( 
Genomic DNA was extracted using an SDS lysis/phenol/chloroform method described by ( Syn CK , Swarup S ( 2000 ) A scalable protocol for the isolation of large-sized genomic DNA within an hour from several bacteria . Anal Biochem 278 : <Gtype> 86-90 ) </Gtype> with slight modifications as follows : subsequent to DNA precipitation , spun pellets were treated with 50μg mL-1 DNAse-free RNAse A and incubated at <Temp> 37 °C </Temp> for <Supp> 30 min </Supp> . Samples were then re-extracted once with phenol : <Anti> chloroform ( 3:1 ) , once with phenol : </O> <Anti> chloroform ( 1:1 ) , twice with chloroform , reprecipitated and then resuspended in TE , pH 8.0 . </O> 
Genomic DNA was purified from exponentially growing cells by lysis in lysozyme/mutanolysin , incubation in proteinase K/SDS , followed by a standard phenol/chloroform extraction procedure . Final pellets were dissolved in TE ( 10 mM Tris-HCl at pH 8.0 , 1 mM EDTA ) . Genomic DNA was digested to completion with Sau3A1 ( Promega ) and purified by phenol/chloroform extraction . Synthesis and degradation of RNA were stopped by adding 1/4 volume of stop-solution ( 95 % ethanol/5 % phenol ) . Cells were harvested by centrifugation ( 4,000 rpm , 20 min ) at 4 °C and resuspended in 0.5 mL of lysis buffer ( 0.5 mg/mL lysozyme , 10 % SDS , Tris-EDTA buffer , 3 M sodium acetate , pH 5.2 ) . Phenol ( 0.5 ml , pH 4.5 ) was added , and the samples were vortexed vigorously before incubation at 64 °C for 6 min . After placing the samples on ice , the aqueous layer was extracted with 1:1 phenol : <Supp> chloroform and with chloroform , and the RNA was precipitated with ethanol at -80 °C . After resuspension , RNA concentration and purity was assessed by NanoDrop ND-1000 UV spectrophotometer ( Nanodrop Technologies , Wilmingon , DE ) and Agilent 2100 Bioanalyzer ( Agilent Technologies , Santa Clara , CA ) , respectively . </O> 
Genomic Library of E. coli was enriched via serial transfers . The cells were grown in <Med> M9 minimal media </Med> ( 5 g/L glucose ) , and in increasing concentration of n-butanol ( 0.5 , 0.9 , 1.3 and 1.7 % v/v ) . 
genotype : <Anti> del rsd </Anti> 
genotype : <Anti> plasmid cured strain </Anti> 
genotype : <Gtype> 285c rpoD mutation </Gtype> 
genotype : <Gtype> AB1157 ybbD : : parS </Gtype> scrambled site 3 pUTC18 : <Gtype> : parB ( G101S ) </Gtype> 
genotype : <Gtype> AB1157 ybbD : : parS </Gtype> scrambled site 3 pUTC18 : <Gtype> : parB ( WT ) </Gtype> 
genotype : <Gtype> AB1157 ybbD : : parS </Gtype> site 3 pUTC18 : <Gtype> : parB ( G101S ) </Gtype> 
genotype : <Gtype> AB1157 ybbD : : parS </Gtype> site 3 pUTC18 : <Gtype> : parB ( WT ) </Gtype> 
genotype : <Gtype> AB1157 ybbD : : parS </Gtype> site 4 pUTC18 : <Gtype> : parB ( G101S ) </Gtype> 
genotype : <Gtype> AB1157 ybbD : : parS </Gtype> site 4 pUTC18 : <Gtype> : parB ( WT ) </Gtype> 
genotype : <Gtype> AB1157 ybbD : : parS </Gtype> site 5 pUTC18 : <Gtype> : parB ( G101S ) </Gtype> 
genotype : <Gtype> AB1157 ybbD : : parS </Gtype> site 5 pUTC18 : <Gtype> : parB ( WT ) </Gtype> 
genotype : <Gtype> AB1157 ybbD : : parS </Gtype> site 6 pUTC18 : <Gtype> : parB ( WT ) </Gtype> 
genotype : <Gtype> AB1157 ybbD : : parS </Gtype> site 7 pUTC18 : <Gtype> : parB ( G101S ) </Gtype> 
genotype : <Gtype> AB1157 ybbD : : parS </Gtype> site 7 pUTC18 : <Gtype> : parB ( WT ) </Gtype> 
genotype : <Gtype> AB1157 ybbD : : parS site </Gtype> 1 pUTC18 : <Gtype> : parB ( WT ) </Gtype> 
genotype : <Gtype> AB1157 ybbD : : parS site </Gtype> 2 pUTC18 : <Gtype> : parB ( G101S ) </Gtype> 
genotype : <Gtype> AB1157 ybbD : : parS site </Gtype> 2 pUTC18 : <Gtype> : parB ( WT ) </Gtype> 
genotype : <Gtype> BW27784 delta _ </O> <Gtype> recD lacZ : : XXX mhpR : : XXX proA : : ISceIcs tsx : : ISceIcs PBAD-sbcDC lacZ + cynX : : GmR lacIq lacZX </Gtype> - 
genotype : <Gtype> BW27784 delta _ </O> <Gtype> recD lacZ : : XXX mhpR : : XXX proA : : ISceIcs tsx : : ISceIcs PBAD-sbcDC lacZ : : pal246 cynX : : GmR lacIq lacZX </Gtype> - 
genotype : <Gtype> BW27784 lacZ : : XXX mhpR : : XXX proA : : ISceIcs tsx : : ISceIcs PBAD-sbcDC lacZ + cynX : : GmR lacIq lacZX </Gtype> - 
genotype : <Gtype> BW27784 lacZ : : XXX mhpR : : XXX proA : : ISceIcs tsx : : ISceIcs PBAD-sbcDC lacZ : : pal246 cynX : : GmR lacIq lacZX </Gtype> - 
genotype : <Gtype> crpfis mutant background </Gtype> 
genotype : <Gtype> crp mutant background </Gtype> 
genotype : <Gtype> cya mutant background </Gtype> 
genotype : <Gtype> cya mutant </Gtype> 
genotype : <Gtype> del rpoS </Gtype> 
genotype : <Gtype> del rsd ; del ssrS </Gtype> 
genotype : <Gtype> del ssrS </Gtype> 
genotype : <Gtype> delta-cra Knock-out strain </Gtype> 
genotype : <Gtype> delta-crp Knock-out strain </Gtype> 
genotype : <Gtype> delta dicF , lacIq </Gtype> 
genotype : <Gtype> deltahmp deltanrfA deltanorVW </Gtype> 
genotype : <Gtype> DH1 ΔhisC : : cat ΔintC : : Ptrc-rfp-tetR-zeocinr ΔgalK : : PtetA-gfp-hisC-kanr </Gtype> 
genotype : <Gtype> DH1 ΔhisC : : cat ΔintC : : Ptrc-rfp-tetR-zeocinr ΔgalK : : PtetA-gfp-kanr </Gtype> 
genotype : <Gtype> dnaC2 , pMQ430 </Gtype> 
genotype : <Gtype> ethanol-tolerant mutant E1 of IrrE </Gtype> 
genotype : <Gtype> EvgSc KO </Gtype> 
genotype : <Gtype> EvgSc ompR KO </Gtype> 
genotype : <Gtype> ∆ fadE </Gtype> with overexpression of ` tesA and MlfabH via an IPTG-inudcible promoter 
genotype : <Gtype> ∆ fadE </Gtype> with overexpression of ` tesA via an IPTG-inudcible promoter 
genotype : <Gtype> fis : : 3xFLAG </Gtype> 
genotype : <Gtype> fis mutant background </Gtype> 
genotype : <Gtype> F - lambda - ilvG - rfb-50 rph-1 -LSB- delta -RSB- fis : </O> <Gtype> : frt-kan-frt </Gtype> 
genotype : <Gtype> F - lambda - ilvG - rfb-50 rph-1 -LSB- delta -RSB- hns : </O> <Gtype> : frt </Gtype> - kan - frt 
genotype : <Gtype> F - lambda - ilvG - rfb-50 rph-1 -LSB- delta -RSB- matP : </O> <Gtype> : frt-cam-frt </Gtype> 
genotype : <Gtype> F - lambda - ilvG - rfb-50 rph-1 -LSB- delta -RSB- mukB : </O> <Gtype> : frt </Gtype> - kan 
genotype : <Gtype> F - lambda - ilvG - rfb-50 rph-1 -LSB- delta -RSB- zapB : </O> <Gtype> : frt-kan-frt </Gtype> 
genotype : <Gtype> F - lambda - ilvG - rfb-50 rph-1 matP -LSB- delta -RSB- C20 : </O> <Gtype> : frt-cam-frt </Gtype> 
genotype : <Gtype> F - lambda - ilvG - rfb-50 rph-1 </O> 
genotype : <Gtype> F - lambda - ilvG - rfb-50 rph-1 phi80 + -LSB- delta -RSB- hupA : </O> <Gtype> : frt </Gtype> - kan - frt -LSB- delta -RSB- hupB : <Gtype> : frt-cam-frt </Gtype> 
genotype : <Gtype> F - lambda - ilvG - rfb-50 rph-1phi80 + -LSB- delta -RSB- mukB : </O> <Gtype> : frt </Gtype> - apra -LSB- delta -RSB- matP : <Gtype> : frt-cam-frt </Gtype> 
genotype : <Gtype> F - , lambda - , rph-1 </O> 
Genotype : <Gtype> F - ompT hsdSB ( rB-mB - ) gal dcm ( DE3 ) </O> 
genotype : <Gtype> furfural-tolerant mutant F1-37 of IrrE </Gtype> 
genotype : <Gtype> Fusion of venus to the 3 ' end of rpoC in E. coli wild-type MG1655 </O> 
genotype : <Gtype> Galaxy1 - -LSB- CV104 _ </O> <Supp> pHDB3 _ 5 -RSB- </O> 
genotype : <Gtype> Galaxy2 - -LSB- CV104 _ </O> <Supp> pLCV1 _ 5 -RSB- </O> 
genotype : <Gtype> Galaxy3 - -LSB- CV104 _ </O> <Supp> pLCV1 _ 10 -RSB- </O> 
genotype : <Gtype> Galaxy4 - -LSB- CV104 _ </O> <Supp> pHDB3 _ </O> <Supp> 20 -RSB- </Supp> 
genotype : <Gtype> Galaxy5 - -LSB- CV104 _ </O> <Supp> pLCV1 _ </O> <Supp> 20 -RSB- </Supp> 
genotype : <Gtype> Galaxy6 - -LSB- CV104 _ </O> <Supp> pHDB3 _ 10 -RSB- </O> 
genotype : <Gtype> GATC-cluster : : hisA </Gtype> 
genotype : <Gtype> GATC-cluster : : srlA </Gtype> 
genotype : <Gtype> GATC-cluster : : ter </Gtype> 
genotype : <Gtype> GATC-cluster : : tnaA </Gtype> 
genotype : <Gtype> gss mutant </Gtype> 
genotype : <Gtype> hns : : 3xFLAG </Gtype> 
genotype : <Gtype> lacZ : : χχχ mhpR : : χχχ proA : : ISceIcs tsx : : ISceIcs PBAD-sbcDC lacZ + cynX : : GmR lacIq lacZχ </Gtype> - 
genotype : <Gtype> lacZ : : χχχ mhpR : : χχχ proA : : ISceIcs tsx : : ISceIcs PBAD-sbcDC lacZ : : pal246 cynX : : GmR lacIq lacZχ </Gtype> - 
genotype : <Gtype> -LCB- delta -RCB- hns </Gtype> 
genotype : <Gtype> -LCB- delta -RCB- nusG </Gtype> 
genotype : <Gtype> -LCB- delta -RCB- rho </Gtype> 
genotype : <Gtype> ∆ mazEF </Gtype> 
genotype : <Gtype> ∆ mazEFlexA3 </Gtype> 
genotype : <Gtype> MG1655 DdksA </Gtype> 
genotype : <Gtype> MG1655 del ssrS </Gtype> 
genotype : <Gtype> MG1655 wild-type </Gtype> 
genotype : <Gtype> mutant hhahha2 </Gtype> 
genotype : <Gtype> mutant hhs </Gtype> 
genotype : <Gtype> mutant hns2 </Gtype> 
genotype : <Gtype> mutant hnshns2 </Gtype> 
genotype : <Gtype> ompR deletion mutant </Gtype> 
genotype : <Gtype> ompR KO </Gtype> 
genotype : <Gtype> Pck over-expressed </Gtype> 
genotype : <Gtype> PNPase mutant </Gtype> 
genotype : <Gtype> RNase II mutant </Gtype> 
genotype : <Gtype> RNase R mutant </Gtype> 
genotype : <Gtype> rne wild-type </Gtype> 
genotype : <Gtype> rng mutant </Gtype> 
genotype : <Gtype> rng wild-type </Gtype> 
genotype : <Gtype> rpoC K370 </Gtype> _ <Gtype> A396dup mutant </Gtype> 
genotype : <Gtype> rpoN mutant ( EcJR-8 ) </Gtype> 
genotype : <Gtype> rpoS mutant </Gtype> 
genotype : <Gtype> TolC defective ( TolC - ) </O> 
genotype : <Gtype> triclosan tolerant mutant </Gtype> 
genotype : <Gtype> tynA - </O> 
genotype : <Gtype> wild _ type </Gtype> 
genotype : <Gtype> wild type </Gtype> 
genotype : <Gtype> Wild Type </Gtype> 
genotype : <Gtype> wild type IrrE </Gtype> 
genotype : <Gtype> Wild-type strain </Gtype> 
genotype : <Gtype> Wildtype with </O> <Supp> vector 
genotype : <Gtype> yajL mutant </Gtype> 
genotype : <Gtype> ybjN mutant </Gtype> 
genotype : <Gtype> ybjN over-expression </Gtype> 
genotype : <Gtype> Δ ( yjjP-yjjQ-bglJ ) ΔleuO </Gtype> 
genotype : <Gtype> Δ ( yjjP-yjjQ-bglJ ) ΔrcsB </Gtype> 
genotype : <Med> rne-3071 ( ts ) </Med> 
genotype : <Med> Δ ( yjjP-yjjQ-bglJ ) </Med> 
genotype : <Supp> delta _ </O> <Gtype> recG263 : : KanR lacZ : : χχχ mhpR : : χχχ proA : : ISceIcs tsx : : ISceIcs PBAD-sbcDC lacZ + cynX : : GmR lacIq lacZχ </Gtype> - 
genotype : <Supp> delta _ </O> <Gtype> recG263 : : KanR lacZ : : χχχ mhpR : : χχχ proA : : ISceIcs tsx : : ISceIcs PBAD-sbcDC lacZ : : pal246 cynX : : GmR lacIq lacZχ </Gtype> - 
genotype : <Supp> delta _ ompR </O> 
genotype : <Supp> Mfd + + </Supp> 
genotype/variation : <Anti> mqsR/pBS ( Kan ) - mqsR 2-1 </O> 
genotype/variation : <Anti> mqsR/pBS ( Kan ) - mqsR </O> 
genotype/variation : <Gtype> AB1157 deltamatP </Gtype> 
genotype/variation : <Gtype> AB1157 matP-3xflag </Gtype> 
genotype/variation : <Gtype> AB1157 mukB-3xflag deltamatP </Gtype> 
genotype/variation : <Gtype> AB1157 mukB-3xflag </Gtype> 
genotype/variation : <Gtype> AB1157 mukBDA-3xflag </Gtype> 
genotype/variation : <Gtype> AB1157 mukBEQ-3xflag deltamatP </Gtype> 
genotype/variation : <Gtype> AB1157 mukBEQ-3xflag </Gtype> 
genotype/variation : <Gtype> Adaptive mutant </Gtype> 
genotype/variation : <Gtype> adhE mutant </Gtype> 
genotype/variation : <Gtype> AR1 - / AR2 - </O> 
genotype/variation : <Gtype> aspC knockout </Gtype> 
genotype/variation : <Gtype> Combined input </Gtype> 
genotype/variation : <Gtype> cpxA mutant </Gtype> 
genotype/variation : <Gtype> cra KO ; BW25113 Dcra </Gtype> 
genotype/variation : <Gtype> cysA knockout </Gtype> 
genotype/variation : <Gtype> cysG knockout </Gtype> 
genotype/variation : <Gtype> cysH knockout </Gtype> 
genotype/variation : <Gtype> cysQ mutant </Gtype> 
genotype/variation : <Gtype> dcd knockout </Gtype> 
genotype/variation : <Gtype> delta _ cra </Gtype> 
genotype/variation : <Gtype> delta ptsN </Gtype> 
genotype/variation : <Gtype> DH1DilvE : : ( dsred.T3-cat ) </Gtype> 
genotype/variation : <Gtype> DH1DleuB : : ( gfpuv5-Kmr ) </Gtype> 
genotype/variation : <Gtype> DH1 ( GB : AP012030 ) </Gtype> 
genotype/variation : <Gtype> dnaJ mutant </Gtype> 
genotype/variation : <Gtype> DnaK deletant </Gtype> 
genotype/variation : <Gtype> empty vector ( pCA24N ) </Gtype> 
genotype/variation : <Gtype> entF knockout </Gtype> 
genotype/variation : <Gtype> expressing pFlagRhlBP238L </Gtype> 
genotype/variation : <Gtype> expressing pFlagRhlBwt </Gtype> 
genotype/variation : <Gtype> fadR knockout </Gtype> 
genotype/variation : <Gtype> fepA knockout </Gtype> 
genotype/variation : <Gtype> fliY knockout </Gtype> 
genotype/variation : <Gtype> fur-knockout mutant </Gtype> 
genotype/variation : <Gtype> gabT knockout </Gtype> 
genotype/variation : <Gtype> galE knockout </Gtype> 
genotype/variation : <Gtype> galT mutant </Gtype> 
genotype/variation : <Gtype> gcvT mutant </Gtype> 
genotype/variation : <Gtype> hfq mutant </Gtype> 
genotype/variation : <Gtype> Irp mutant </Gtype> 
genotype/variation : <Gtype> K-12 wild type </Gtype> 
genotype/variation : <Gtype> kefB knockout </Gtype> 
genotype/variation : <Gtype> lacA knockout </Gtype> 
genotype/variation : <Gtype> lacking the small RNA RyhB </Gtype> 
genotype/variation : <Gtype> lacking the transcription factor Fur and the small RNA RyhB </Gtype> 
genotype/variation : <Gtype> lacking the transcription factor Fur </Gtype> 
genotype/variation : <Gtype> -LCB- delta -RCB- cspABCEG </Gtype> 
genotype/variation : <Gtype> -LCB- delta -RCB- cspABEG </Gtype> 
genotype/variation : <Gtype> -LCB- delta -RCB- cspBG </Gtype> 
genotype/variation : <Gtype> -LCB- delta -RCB- lacZ , -LCB- delta -RCB- tonB , -LCB- delta -RCB- feoA , -LCB- delta -RCB- zupT K12 </Gtype> 
genotype/variation : <Gtype> -LCB- delta -RCB- perC : : kanR </Gtype> , coisogenic to <Gtype> WT 
genotype/variation : <Gtype> -LCB- delta -RCB- rnr </Gtype> 
genotype/variation : <Gtype> -LCB- delta -RCB- tonB , -LCB- delta -RCB- feoA , -LCB- delta -RCB- zupT K12 </Gtype> 
genotype/variation : <Gtype> lplA knockout </Gtype> 
genotype/variation : <Gtype> LuxS mutant </Gtype> 
genotype/variation : <Gtype> marR deletion and coding for QnrS1 </O> 
genotype/variation : <Gtype> MC4100 ∆ tig : : kan pTig-TEV-Avi </Gtype> 
genotype/variation : <Gtype> mgtA knockout </Gtype> 
genotype/variation : <Gtype> mhpD knockout </Gtype> 
genotype/variation : <Gtype> mntR KO ; BW25113 DmntR </Gtype> 
genotype/variation : <Gtype> mutant M.HpyAVIB </Gtype> 
genotype/variation : <Gtype> nac KO ; BW25113 Dnac </Gtype> 
genotype/variation : <Gtype> null polyphosphate metabolism </Gtype> 
genotype/variation : <Gtype> overexpression of arT ( pCA24N </Gtype> _ <Gtype> arT ) </Gtype> 
genotype/variation : <Gtype> overexpression of dosP ( pCA24N </Gtype> _ <Gtype> dosP ) </Gtype> 
genotype/variation : <Gtype> overexpression of empty vector ( pCA24N ) </Gtype> 
genotype/variation : <Gtype> pFlag-only control </Gtype> 
genotype/variation : <Gtype> pgi mutant </Gtype> 
genotype/variation : <Gtype> PhoB knock-out </Gtype> 
genotype/variation : <Gtype> ppk knockout </Gtype> 
genotype/variation : <Gtype> putP knockout </Gtype> 
genotype/variation : <Gtype> rfbA knockout </Gtype> 
genotype/variation : <Gtype> sdhA deletion mutant </Gtype> 
genotype/variation : <Gtype> sdhC knockout </Gtype> 
genotype/variation : <Gtype> Ser83Leu substitution </Gtype> in GyrA and coding for QnrS1 
genotype/variation : <Gtype> trpD knockout </Gtype> 
genotype/variation : <Gtype> ugpC knockout </Gtype> 
genotype/variation : <Gtype> W3110 rpoC-6xHis : : kan gal490 </Gtype> 
genotype/variation : <Gtype> W3110 rpoC-6xHis : : kan greA : : tet , greB : : amp </Gtype> 
genotype/variation : <Gtype> wild type ( control ) </Gtype> 
genotype/variation : <Gtype> wild type </Gtype> 
genotype/variation : <Gtype> Wild type </Gtype> strain 
genotype/variation : <Gtype> wild type ; MG1655 </Gtype> 
genotype/variation : <Gtype> wild type M.HpyAVIB </Gtype> 
genotype/variation : <Gtype> yghD knockout </Gtype> 
genotype/variation : <Gtype> Δrac ΔnusG </Gtype> 
genotype/variation : <Med> ydcR ( b1439 ) MUTANT </Med> 
genotype/variation : <Med> yjiR ( b4340 ) MUTANT </Med> 
genotype/variation : <Phase> khc knockout </Phase> 
genotype/variation : <Phase> polyphosphate accumulation </Phase> 
genotype/variation : <Phase> wzc knockout </Phase> 
genotype/variation : <Phase> σ70 mutation </Phase> 
genotype/variation : <Strain> K-12 <Med> delta-rnr mutant ( JW5741-1 ) </Med> 
genotype/variation : <Supp> 42 deletions </Supp> 
genotype/variation : <Supp> EDL 933 </Supp> 
genotype/variation : <Supp> PhoB _ </O> <Supp> FLAG 
genotype/variation : <Temp> 43 deletions </Temp> , ΔnusA * 
genotype/variation : <Temp> 43 deletions </Temp> , ΔnusG 
genotyp/variation : <Gtype> deltacrp JW5702-4 background </Gtype> with a <Gtype> wild type </Gtype> CRP ( CRP N ) inserted into paaH gene locus 
genotyp/variation : <Gtype> deltacrp JW5702-4 background </Gtype> with a K100Q mutant of CRP ( CRP Q ) inserted into paaH gene locus 
genotyp/variation : <Gtype> deltacrp JW5702-4 background </Gtype> with a K100R mutant of CRP ( CRP R ) inserted into paaH gene locus 
genotyp/variation : <Gtype> wild type </Gtype> 
GGG10 , steady-state continuous cultured experimental samples at <Temp> 37 °C </Temp> 
GGG10 , steady-state continuous cultured experimental samples at <Temp> 37 °C </Temp> and then 15 minutes heatshock at 50 °C 
gluconate _ growth : <Supp> MURI _ 091 </O> 
gluconate _ growth : <Supp> MURI _ 092 </O> 
gluconate _ growth : <Supp> MURI _ 093 </O> 
gluconate _ growth : <Supp> MURI _ 094 </O> 
gluconate _ growth : <Supp> MURI _ 095 </O> 
gluconate _ growth : <Supp> MURI _ 096 </O> 
Glycerol stocks of E. coli K12 strain MG1655 were inoculated into LB media grown at 37 ℃ with constant agitation overnight . Cultures were diluted 1:100 into fresh <Med> minimal medium </Med> and then cultured at 37 ℃ to mid-exponential phase ( OD600 nm ~ 0.6 ) . 
glycerol _ time _ course : <Supp> MURI _ 034 </O> 
glycerol _ time _ course : <Supp> MURI _ 035 </O> 
glycerol _ time _ course : <Supp> MURI _ 036 </O> 
glycerol _ time _ course : <Supp> MURI _ 037 </O> 
glycerol _ time _ course : <Supp> MURI _ 038 </O> 
glycerol _ time _ course : <Supp> MURI _ 039 </O> 
glycerol _ time _ course : <Supp> MURI _ 040 </O> 
glycerol _ time _ course : <Supp> MURI _ 041 </O> 
glycerol _ time _ course : <Supp> MURI _ 042 </O> 
glycerol _ time _ course : <Supp> MURI _ 043 </O> 
glycerol _ time _ course : <Supp> MURI _ 044 </O> 
glycerol _ time _ course : <Supp> MURI _ 045 </O> 
glycerol _ time _ course : <Supp> MURI _ 046 </O> 
glycerol _ time _ course : <Supp> MURI _ 047 </O> 
glycerol _ time _ course : <Supp> MURI _ 048 </O> 
glycerol _ time _ course : <Supp> MURI _ 049 </O> 
glycerol _ time _ course : <Supp> MURI _ 050 </O> 
glycerol _ time _ course : <Supp> MURI _ 052 </O> 
glycerol _ time _ course : <Supp> MURI _ 053 </O> 
glycerol _ time _ course : <Supp> MURI _ 054 </O> 
glycerol _ time _ course : <Supp> MURI _ 055 </O> 
glycerol _ time _ course : <Supp> MURI _ 056 </O> 
glycerol _ time _ course : <Supp> MURI _ 057 </O> 
glycerol _ time _ course : <Supp> MURI _ 058 </O> 
glycerol _ time _ course : <Supp> MURI _ 059 </O> 
gpt _ 0 _ <Gtype> Hx Rep2 </Gtype> 
gpt _ 0 _ <Gtype> Hx Rep3 </Gtype> 
gpt _ <Air> 30 ( Low Dilution ) Rep1 </Air> 
gpt _ <Air> 30 ( Low Dilution ) Rep2 </Air> 
gpt _ <Air> 30 ( Low Dilution ) Rep3 </Air> 
gpt strain w/o hypoxanthine <Supp> 30 min </Supp> at low dilution protocol 
Grow bacteria overnight in LB medium , reinoculate in <Med> M9 minimal medium </Med> at an initial OD600 of 0.005 . After eight hours growth at 34 °C in M9 medium , 2 mL of RNA Protect Reagent ( Qiagen ) was added to 1 ml bacterial cultures ( at <OD> OD600 of about 0.5-0.8 </OD> ) to stabilize RNA . Centrifuge for 10 min at 4000 g. Decant the supernatant . 
growing condition : <Med> M9 minimal medium </Med> 
Grown in glucose M9 media supplemented with <Supp> 0.55 M NaCl </Supp> 
Grown in glucose M9 media with or without <Supp> supplementation of 0.6 M NaCl </Supp> 
Growth : <Air> Anaerobic to early exponential growth </O> 
growth condition : 50 µl into K-medium + <Supp> 0.3 M NaCl </Supp> 
growth condition : 75 µl into K-medium + <Supp> 0.6 M urea </Supp> 
growth condition : <Air> Aerobic Cultures </Air> 
growth condition : <Air> Anaerobic Cultures </O> 
growth condition : <Anti> normal condtion </Anti> ( 5 % w/v glucose ) 
growth condition : <Gtype> Inside Acanthamoeba </Gtype> 
growth condition : <Gtype> LB broth alone ( control ) </O> 
growth condition : <Gtype> LB broth supplemented with cranberry PACs ( 100 µg/mL ) </O> 
growth condition : <Gtype> osmotic stress condtion ( 12 % w/v glucose ) </O> 
growth condition : <Gtype> Outside Control </Gtype> 
Growth conditions : <Air> anaerobic plus NO2 </O> 
Growth conditions : <Air> anaerobic <Supp> plus NO3 </Supp> 
growth conditions : <Gtype> LB growth OD 0,3 </O> 
growth conditions : <Gtype> LB growth OD 0,5 </O> 
growth conditions : <Gtype> Minimal Medium </Gtype> A supplemented with casaminoacids ( 0,1 % ) and succinate ( 0,2 % ) , OD 0,2 at 40 °C 
growth condition : <Supp> 16 µM IPTG </Supp> 
growth condition : <Supp> 4 µM IPTG </Supp> 
growth condition : <Supp> 8 µM IPTG </Supp> 
growth condition : <Supp> Exponential + O2 </Supp> 
growth condition : <Supp> LB at </O> <Temp> 30 °C </Temp> 
growth condition : <Supp> LB at </O> <Temp> 37 °C </Temp> 
growth condition : <Supp> MM + 0.12 % casaminoacids +0.4 % glucose </Supp> at 22 °C 
growth condition : <Supp> MM + 0.12 % casaminoacids +0.4 % glucose </Supp> at <Temp> 30 °C </Temp> 
growth condition : <Supp> Static + O2 </Supp> 
grow  The E. coli K-12 MG1655 bacterial strains used in this work are the following : E. coli MG1655 ( F - lambda - ilvG - rfb-50 rph-1 ) ; MG1655 hns ( hns : <Gtype> : Kanr ) ; MG1655 </Gtype> fis ( fis : <Gtype> : Kanr ) ; MG1655 </Gtype> hns-FLAG ( hns : <Gtype> : 3xFLAG : : Kanr ) ; MG1655 </Gtype> fis-FLAG ( fis : <Gtype> : 3xFLAG : : Kanr </Gtype> ) . Luria-Bertani ( 0.5 % NaCl ) broth and agar ( 15 g/liter ) were used for routine growth . Where needed , ampicillin , kanamycin , and chloramphenicol were used at final concentrations of 100 , 30 , and 30 ug/ml respectively . 
growth media : <Gtype> LB ; 0.8 % bile salts </O> 
growth media : <Med> DMEM growth media </Med> 
growth media : <Med> LB medium </Med> 
growth medium : <Gtype> Combined input </Gtype> 
growth medium : <Gtype> liquid culture </Gtype> 
growth medium : <Med> LB medium </Med> 
growth medium : <Med> MOPS minimal glucose media </Med> containing <Supp> 10 µM FeSO4 </Supp> 
growth medium : <Med> MOPS minimal glucose media </Med> containing <Supp> 1 µM FeSO4 </Supp> 
Growth medium : <Med> MOPS minimal , </Med> 0.4 % glucose , 0.5 % casamino acids 
growth medium : <Supp> LB + glycerol medium </O> 
growth mode : <Gtype> planktonic culture in annular reactor </O> 
growth phase : <Gtype> Early exponential </Gtype> 
growth phase : <Gtype> Early Exponential </Gtype> 
growth phase : <Gtype> Exponential Phase </Gtype> 
growth phase : <Gtype> Late exponential/Early stationary ( OD ~ 1.8 ) </Gtype> 
growth phase : <Gtype> late _ </O> <Phase> stationary 
growth phase : <Gtype> Late Stationary </Gtype> 
growth phase : <Gtype> logarithmic growth </Gtype> 
growth phase : <Gtype> Log phase OD 0.4 </Gtype> 
growth phase : <Gtype> Stationary phase </Gtype> 
growth phase : <Gtype> Transition to Stationary </Gtype> 
Growth phase : <OD> OD600 = 0.3 </OD> 
growth phase : <Phase> exponential growth phase </Phase> 
growth phase : <Phase> log phase </Phase> 
growth phase : <Phase> mid-log phase </Phase> 
growth phase : <Phase> mid-log phase </Phase> ( <OD> OD600 = 0.3 </OD> ) 
growth phase : <Phase> stationary growth phase </Phase> 
growth phase : <Phase> stationary phase </Phase> ( grown to an OD600nm of 0.9 ) 
growth phase : <Phase> transition growth phase </Phase> 
growth phase : <Supp> 30 min </Supp> <Phase> post stationary </Phase> 
growth phase : <Supp> stat 1 </Supp> 
growth phase : <Supp> stat 2 </O> 
growth protocol : Controls grown to an optimal temperature of <Temp> 37 °C </Temp> 
growth protocol : <Gtype> Bacteria liquid culture </O> 
growth protocol : <Gtype> in the caecal content of rats associated with the human microbiota </O> 
growth protocol : <Gtype> logarithmic phase in DMEM-MOPS </Gtype> 
growth protocol : <Gtype> Log-phase culture ( LB broth , Miller formulation ) inoculated with one blue colony and grown for 5 hr at 37 degrees celsius </O> 
growth protocol : <Gtype> Log-phase culture ( LB broth , Miller formulation ) inoculated with one pale colony and grown for 5 hr at 37 degrees celsius </O> 
growth protocol : <Gtype> steady growth </Gtype> 
growth protocol : <Gtype> Treatment 3 ( 60 °C F = 3 ) </O> 
growth protocol : <Gtype> Treatment 4 ( core temperature of 71 °C ) </O> 
growth protocol : <Phase> heat shock </Phase> 
growth protocol : <Phase> transition phase </Phase> in DMEM-MOPS 
growth protocol : <Supp> Treatment 1 ( 58 °C F = 2 ) </O> 
growth protocol : <Supp> Treatment 2 ( 58 °C F = 3 ) </O> 
growth stage : <Gtype> mid exponetial phase </Gtype> 
growth stage : <Phase> log phase </Phase> 
growth stage : <Phase> mid-log phase </Phase> 
growth temperature : <Temp> 22 °C </Temp> 
growth temperature : <Temp> 37 °C </Temp> 
<Gtype> 6-HT873-PS-60min3 </Gtype>
<Gtype> Annotation : The reference </Gtype> genome ( Escherichia _ coli _ cft073.ASM744v1.dna.chromosome.Chromosome.fa ) and annotations ( Escherichia _ coli _ cft073.ASM744v1 .32 . gtf ) were downloaded from EnsemblBacteria 
<Gtype> ∆ ArcA </Gtype> - <Air> Anaerobic - Affinity Purified - technical rep A </O> 
<Gtype> ∆ ArcA </Gtype> - <Air> Anaerobic - Affinity Purified - technical rep B </O> 
<Gtype> ∆ arcA </Gtype> IP DNA from PK9416 
<Gtype> Bacterial Cell Lysates </Gtype> 
<Gtype> Bacterial lysis </Gtype> 
<Gtype> BnTR1 _ 42 _ rep2 </O> 
<Gtype> Broiler Fecal </Gtype> 
<Gtype> cell type </Gtype> : <Anti> bacterial cells </Anti> 
<Gtype> cell type </Gtype> : Escherichia coli str . <Strain> K-12 substr . </O> <Substrain> MG1655 
<Gtype> cell type </Gtype> : Evolved I - cells 
<Gtype> cell type </Gtype> : Evolved L - cells 
<Gtype> cell type </Gtype> : <Gtype> Ancestral I - cells </O> 
<Gtype> cell type </Gtype> : <Gtype> Ancestral L </Gtype> - cells 
<Gtype> cell type </Gtype> : <Gtype> bacterial liquid culture </Gtype> 
<Gtype> cell type </Gtype> : <Gtype> Original prototroph DH1 cells </O> 
<Gtype> cell type </Gtype> : <Gtype> Persister cells </Gtype> 
<Gtype> cell type </Gtype> : <Gtype> Planktonic cells harvested at a turbidity of 0.5 at 600 nm , adjusted to the turbidity at 1 , and then exposed to 20 μg/mL ampicillin for 1 h. </O> 
<Gtype> cell type </Gtype> : <Supp> biofilm 
<Gtype> ChIP-exo GadW </Gtype> <pH> pH5 .5 </pH> 1 
<Gtype> ChIP-exo GadW </Gtype> <pH> pH5 .5 </pH> 2 
<Gtype> ChIP-exo RpoS </Gtype> <pH> pH5 .5 </pH> 1 
<Gtype> ChIP-exo RpoS </Gtype> <pH> pH5 .5 </pH> 2 
<Gtype> Cholic Acid Treatment </Gtype> 
<Gtype> Control Wild type </Gtype> E.coli SE15 vs. LuxS mutant E.coli SE15 
<Gtype> CRE Multi 0uM Rep1 Plasmid </Gtype> 
<Gtype> CRE Multi 0uM Rep2 Plasmid </Gtype> 
<Gtype> CRE Multi 100uM Rep1 Plasmid </Gtype> 
<Gtype> CRE Multi 100uM Rep2 Plasmid </Gtype> 
<Gtype> CRE Single 100uM Rep1 Plasmid </Gtype> 
<Gtype> CRE Single 100uM Rep2 Plasmid </Gtype> 
<Gtype> culture type </Gtype> : <Anti> evolved 
<Gtype> culture type </Gtype> : <Gtype> Ancestor 
<Gtype> culture type </Gtype> : <Supp> coculture 
<Gtype> culture type </Gtype> : <Supp> monoculture 
<Gtype> ∆ dapF </Gtype> parent Sample 28 
<Gtype> ∆ dapF </Gtype> parent Sample 47 
<Gtype> ∆ dapF </Gtype> parent Sample 9 
<Gtype> Demultiplexing </Gtype>
<Gtype> ∆ dgk </Gtype> parent Sample 16 
<Gtype> ∆ dgk </Gtype> parent Sample 35 
<Gtype> ∆ dgk </Gtype> parent Sample 54 
<Gtype> DH1-log </Gtype>
<Gtype> DH1-log-tr </Gtype>
<Gtype> DMSO-Only Treatment </Gtype> 
<Gtype> Each type </Gtype> of error rates per position was determined as the number of sequence reads with a particular type of base-substitution divided by the number of the reads with the reference base in each DNA position . 
<Gtype> E.coli O157 : H7 </Gtype> in LB at <Phase> mid-log phase </Phase> 
<Gtype> Ec-pR VS Ec-1558 rep3 </Gtype> 
<Gtype> EM1456 wild-type pNM12 </Gtype> <Supp> # 1 + arabinose </Supp> 
<Gtype> ∆ entC </Gtype> parent Sample 12 
<Gtype> ∆ entC </Gtype> parent Sample 31 
<Gtype> ∆ entC </Gtype> parent Sample 50 
<Gtype> ESBL019 Coliform </Gtype> 
<Gtype> ESBL019 Filamented </Gtype> 
<Gtype> ESBL019 Transition </Gtype> 
<Gtype> Expose Bacillus VOC-12h rep3 </Gtype> 
<Gtype> Expose Bacillus VOC-12h rep4 </Gtype> 
<Gtype> expose Bacillus VOC24h </Gtype> 
<Gtype> Expose Bacillus VOC-24h rep3 </Gtype> 
<Gtype> Expose Bacillus VOC-24h rep4 </Gtype> 
<Gtype> Expose Bacillus VOC-6h rep3 </Gtype> 
<Gtype> Expose Bacillus VOC-6h rep4 </Gtype> 
<Gtype> flhD-glucose </Gtype>
<Gtype> flhD-mannose </Gtype>
<Gtype> ∆ fnr </Gtype> - <Air> Anaeroibc 
<Gtype> ∆ fnr </Gtype> ChIP DNA from <Gtype> PK4854 
<Gtype> furanone-free control </Gtype> 
<Gtype> ∆ fur </Gtype> <Air> Aerobic A </O> 
<Gtype> ∆ fur </Gtype> <Air> Aerobic B </O> 
<Gtype> ∆ fur </Gtype> <Air> Anaerobic A </O> 
<Gtype> ∆ fur </Gtype> <Air> Anaerobic B </O> 
<Gtype> ∆ fur </Gtype> <Air> Anaerobic -LSB- IP vs nput -RSB- </O> 
<Gtype> fur mutant pBAD-ryhB </Gtype> <Supp> # 2 + arabinose </Supp> 
<Gtype> fur mutant pNM12 </Gtype> <Supp> # 2 + arabinose </Supp> 
<Gtype> ∆ fur ∆ ryhB </Gtype> <Air> Aerobic A </O> 
<Gtype> ∆ fur ∆ ryhB </Gtype> <Air> Aerobic B </O> 
<Gtype> ∆ fur ∆ ryhB </Gtype> <Air> Anaerobic A </O> 
<Gtype> ∆ fur ∆ ryhB </Gtype> <Air> Anaerobic B </O> 
<Gtype> gDNA B02 </Gtype> 
<Gtype> gDNA B05 </Gtype> 
<Gtype> gDNA C01 </Gtype> 
<Gtype> gDNA C02 </Gtype> 
<Gtype> gDNA F01 </Gtype> 
<Gtype> gDNA F02 </Gtype> 
<Gtype> gDNA H01 </Gtype> 
<Gtype> gDNA H02 </Gtype> 
<Gtype> gDNA H03 </Gtype> 
<Gtype> gDNA H04 </Gtype> 
<Gtype> gDNA H05 </Gtype> 
<Gtype> gDNA H12 </Gtype> 
<Gtype> gDNA H23 </Gtype> 
<Gtype> gDNA H27 </Gtype> 
<Gtype> gDNA K12 </Gtype> 
<Gtype> gDNA S04 </Gtype> 
<Gtype> gDNA S05 </Gtype> 
<Gtype> gDNA S13 </Gtype> 
<Gtype> Glutamate addition </Gtype> 
<Gtype> growth type </Gtype> : <Phase> amino acid starvation </Phase> 
<Gtype> growth type </Gtype> : <Phase> log phase </Phase> 
<Gtype> IA-log </Gtype>
<Gtype> IA-starve </Gtype>
<Gtype> IE-log </Gtype>
<Gtype> IE-starve </Gtype>
<Gtype> IFNB Multi SeV0 Rep1 Plasmid </Gtype> 
<Gtype> IFNB Multi SeV10 Rep1 Plasmid </Gtype> 
<Gtype> IFNB Single SeV10 Rep1 Plasmid </Gtype> 
<Gtype> Incubation temperature = 37C </Gtype> 
<Gtype> Input ParE-flag S20min </Gtype> 
<Gtype> Input ParE-flag S40min </Gtype> 
<Gtype> lacZ _ MG1063 _ 60 _ </O> <Phase> r1 
<Gtype> lacZ _ MG1063 _ 60 _ </O> <Phase> r2 
<Gtype> lacZ _ MG1063 _ 90 _ </O> <Phase> r1 
<Gtype> lacZ _ MG1063 _ 90 _ </O> <Phase> r2 
<Gtype> lacZ _ MG1063 _ </O> <Supp> 30 _ r1 </Supp> 
<Gtype> lacZ _ MG1063 _ </O> <Supp> 30 _ r2 </Supp> 
<Gtype> lacZ _ </O> <Supp> 10 min </Supp> 
<Gtype> lacZ _ </O> <Supp> 15 min </Supp> 
<Gtype> lacZ _ </O> <Supp> 6 min </Supp> 
<Gtype> lacZ _ </O> <Supp> 8 min </Supp> 
<Gtype> lacZ _ W1863 _ 60 _ </O> <Phase> r1 
<Gtype> lacZ _ W1863 _ 90 _ </O> <Phase> r1 
<Gtype> lacZ _ W1863 _ </O> <Supp> 30 _ r1 </Supp> 
<Gtype> LA-starve </Gtype>
<Gtype> LE-log </Gtype>
<Gtype> LE-log-tr </Gtype>
<Gtype> LE-starve </Gtype>
<Gtype> LJ110 MMAcetat </Gtype> 
<Gtype> LJ110 MMPyruvat </Gtype> 
<Gtype> LJ110 pTM30 LBo </Gtype> 
<Gtype> LJ110 pTM30 MMAcetat </Gtype> 
<Gtype> LJ110 pTM30 MMPyruvat </Gtype> 
<Gtype> LJ110 pTM30pdhr LBo </Gtype> 
<Gtype> LJ110 pTM30pdhr MMAcetat </Gtype> 
<Gtype> LJ110 pTM30pdhr MMPyruvat </Gtype> 
<Gtype> M1655 wild type </Gtype> at t0 , rep1 
<Gtype> M1655 wild type </Gtype> at t0 , rep2 
<Gtype> M1655 wild type </Gtype> at t10 , rep1 
<Gtype> M1655 wild type </Gtype> at t10 , rep2 
<Gtype> M1655 wild type </Gtype> at t2 , rep1 
<Gtype> M1655 wild type </Gtype> at t2 , rep2 
<Gtype> M1655 wild type </Gtype> at t4 , rep1 
<Gtype> M1655 wild type </Gtype> at t4 , rep2 
<Gtype> M1655 wild type </Gtype> at t6 , rep1 
<Gtype> M1655 wild type </Gtype> at t6 , rep2 
<Gtype> M1655 wild type </Gtype> at t8 , rep1 
<Gtype> M1655 wild type </Gtype> at t8 , rep2 
<Gtype> MasterPure RNA purification Kit </Gtype> 
<Gtype> material type </Gtype> : <Gtype> whole _ organism </O> 
<Gtype> ∆ mazEF </Gtype> 0 μg/ml NA rep1 
<Gtype> ∆ mazEF </Gtype> 0 μg/ml NA rep2 
<Gtype> ∆ mazEF </Gtype> 100 μg/ml NA rep1 
<Gtype> ∆ mazEF </Gtype> 100 μg/ml NA rep2 
<Gtype> ∆ mazEF </Gtype> 100 μg/ml NA rep3 
<Gtype> ∆ mazEF </Gtype> 10 μg/ml NA rep1 
<Gtype> ∆ mazEF </Gtype> 10 μg/ml NA rep2 
<Gtype> ∆ mazEFlexA3 </Gtype> 0 μg/ml NA rep1 
<Gtype> ∆ mazEFlexA3 </Gtype> 0 μg/ml NA rep2 
<Gtype> ∆ mazEFlexA3 </Gtype> 100 μg/ml NA rep1 
<Gtype> ∆ mazEFlexA3 </Gtype> 100 μg/ml NA rep2 
<Gtype> ∆ mazEFlexA3 </Gtype> 10 μg/ml NA rep1 
<Gtype> ∆ mazEFlexA3 </Gtype> 10 μg/ml NA rep2 
<Gtype> MDS42 ΔnusA * </Gtype> 
<Gtype> MDS42 ΔnusG </Gtype> 
<Gtype> MG1655star-glucose </Gtype>
<Gtype> MG1655star-mannose </Gtype>
<Gtype> MG1655 wild type </Gtype> 
<Gtype> mntR KO </Gtype> 
<Gtype> mRNA-seq WT t10 </Gtype> 
<Gtype> mRNA-seq WT t4 </Gtype> 
<Gtype> Mutant B8 </Gtype> _ <Gtype> 0.8 % Bu </Gtype> _ 1.5 h _ <Phase> rep3 
<Gtype> Mutant B8 </Gtype> _ <Gtype> 0.8 % Bu </Gtype> _ 1.5 h _ rep1 
<Gtype> Mutant B8 </Gtype> _ <Gtype> 0.8 % Bu </Gtype> _ 1.5 h _ rep2 
<Gtype> mutant SdiA1E11 </Gtype> 
<Gtype> Non-treatment </Gtype>
<Gtype> NsrR _ Flagtag </Gtype> _ <Phase> rep3 
<Gtype> NsrR _ Flagtag </Gtype> _ rep1 
<Gtype> NsrR _ Flagtag </Gtype> _ rep2 
<Gtype> NsrR _ input </Gtype> 
<Gtype> NsrR _ </O> <Technique> ChIPSeq _ </O> <Phase> rep3 
<Gtype> NsrR _ </O> <Technique> ChIPSeq _ rep1 </O> 
<Gtype> NsrR _ </O> <Technique> ChIPSeq _ rep2 </O> 
<Gtype> ∆ nusG UvsW </Gtype> _ <Phase> replicate1 
<Gtype> ∆ nusG UvsW </Gtype> _ <Phase> replicate2 
<Gtype> ∆ nusG UvsW </Gtype> _ <Phase> replicate3 
<Gtype> ∆ ompR pH 5.6 C </Gtype> 
<Gtype> ∆ ompR pH 5.6 </Gtype> A 
<Gtype> ∆ ompR pH 5.6 </Gtype> B 
<Gtype> ∆ ompR pH 7.2 +15 % </Gtype> sucrose A 
<Gtype> ∆ ompR pH 7.2 +15 % </Gtype> sucrose B 
<Gtype> optA1 _ gpt _ 15 ( Low Dilution ) Rep1 </O> 
<Gtype> optA1 _ gpt _ 15 ( Low Dilution ) Rep2 </O> 
<Gtype> optA1 _ gpt _ 15 ( Low Dilution ) Rep3 </O> 
<Gtype> optA1 _ gpt _ 45 ( Low Dilution ) Rep1 </O> 
<Gtype> optA1 _ gpt _ 45 ( Low Dilution ) Rep2 </O> 
<Gtype> optA1 _ gpt _ 45 ( Low Dilution ) Rep3 </O> 
<Gtype> optA1 _ gpt _ 60 ( Low Dilution ) Rep1 </O> 
<Gtype> optA1 _ gpt _ 60 ( Low Dilution ) Rep2 </O> 
<Gtype> optA1 _ gpt _ 60 ( Low Dilution ) Rep3 </O> 
<Gtype> optA1 _ gpt _ </O> <Gtype> 30 ( Low Dilution ) Rep1 </Gtype> 
<Gtype> optA1 _ gpt _ </O> <Gtype> 30 ( Low Dilution ) Rep2 </Gtype> 
<Gtype> optA1 _ gpt _ </O> <Gtype> 30 ( Low Dilution ) Rep3 </Gtype> 
<Gtype> pGIT1 .1 </Gtype> 
<Gtype> pGIT1 .4 </Gtype> 
<Gtype> pH = 5.3 </Gtype> 
<Gtype> pH = 5.7 </Gtype> 
<Gtype> ∆ pnp </Gtype> _ <Technique> RNA-Seq 
<Gtype> ∆ ppk parent Sample </Gtype> <Temp> 24 
<Gtype> ∆ ppk parent Sample </Gtype> <Temp> 43 
<Gtype> ∆ ppk parent Sample </Gtype> <Temp> 5 
<Gtype> Ptac : : fnr </Gtype> - A - <Supp> 16 µM IPTG </Supp> 
<Gtype> Ptac : : fnr </Gtype> - A - <Supp> 4 µM IPTG </Supp> 
<Gtype> Ptac : : fnr </Gtype> - A - <Supp> 8 µM IPTG </Supp> 
<Gtype> Ptac : : fnr </Gtype> - B - <Supp> 16 µM IPTG </Supp> 
<Gtype> Ptac : : fnr </Gtype> - B - <Supp> 4 µM IPTG </Supp> 
<Gtype> Ptac : : fnr </Gtype> - B - <Supp> 8 µM IPTG </Supp> 
<Gtype> Ptac : : fnr </Gtype> - C - <Supp> 16 µM IPTG </Supp> 
<Gtype> RF2 * ∆ RF3 </Gtype> _ exp2 _ <Gtype> repA _ </O> <Gtype> mRNA 
<Gtype> RF2 * ∆ RF3 </Gtype> _ exp2 _ <Gtype> repA _ </O> <Phase> ribosome 
<Gtype> RF2 * ∆ RF3 </Gtype> _ exp2 _ <Supp> repB _ </O> <Gtype> mRNA 
<Gtype> RF2 * ∆ RF3 </Gtype> _ exp2 _ <Supp> repB _ </O> <Phase> ribosome 
<Gtype> RF2 * ∆ RF3 </Gtype> _ exp3 _ <Gtype> mRNA 
<Gtype> RF2 * ∆ RF3 </Gtype> _ exp3 _ <Phase> ribosome 
<Gtype> RF2 * ∆ RF3 </Gtype> _ exp4 _ <Gtype> repA _ </O> <Gtype> mRNA 
<Gtype> RF2 * ∆ RF3 </Gtype> _ exp4 _ <Gtype> repA _ </O> <Phase> ribosome 
<Gtype> RF2 * ∆ RF3 </Gtype> _ exp4 _ <Supp> repB _ </O> <Gtype> mRNA 
<Gtype> RF2 * ∆ RF3 </Gtype> _ exp4 _ <Supp> repB _ </O> <Phase> ribosome 
<Gtype> ∆ RF3 </Gtype> _ exp1 _ <Gtype> mRNA 
<Gtype> ∆ RF3 </Gtype> _ exp1 _ <Phase> ribosome 
<Gtype> ∆ RF3 </Gtype> _ exp3 _ <Gtype> mRNA 
<Gtype> ∆ RF3 </Gtype> _ exp3 _ <Phase> ribosome 
<Gtype> ∆ RF3 </Gtype> _ minimal _ <Gtype> mRNA 
<Gtype> ∆ RF3 </Gtype> _ minimal _ <Phase> ribosome 
<Gtype> RhIB wild type </Gtype> 
<Gtype> RhlBP238L mutant </Gtype> 
<Gtype> ∆ rho UvsW </Gtype> _ <Phase> replicate1 
<Gtype> ∆ rho UvsW </Gtype> _ <Phase> replicate2 
<Gtype> ∆ rho UvsW </Gtype> _ <Phase> replicate3 
<Gtype> RIP-Seq </Gtype>
<Gtype> ∆ rnb </Gtype> _ <Technique> RNA-Seq 
<Gtype> rne wild-type </Gtype> 
<Gtype> rng wild-type </Gtype> 
<Gtype> ∆ rnr </Gtype> _ <Technique> RNA-Seq 
<Gtype> rpoS _ 04 _ </O> <Supp> TEX 
<Gtype> rpoS mutant </Gtype> 
<Gtype> ∆ ryhB </Gtype> <Air> Aerobic 
<Gtype> ∆ ryhB </Gtype> <Air> Anaerobic 
<Gtype> sample type : control </Gtype> 
<Gtype> sample type </Gtype> : <Anti> no RNA treatment </Anti> 
<Gtype> sample type </Gtype> : cDNA produced by RT of RNA deriving from vitro transcription , with RNA polymerase E σ70 , of 2 ug of genomic DNA from E. coli MG1655 digested with <Supp> EcoRI 
<Gtype> sample type </Gtype> : cDNA produced by RT of RNA deriving from vitro transcription , with RNA polymerase E σS , of 2 ug of genomic DNA from E. coli MG1655 digested with <Supp> EcoRI 
<Gtype> sample type </Gtype> : E. coli strain MC4100relA + in mid log phase incubated at 37ºC for 4 hours with 100 μg/ml NA 
<Gtype> sample type </Gtype> : E. coli strain MC4100relA + in mid log phase incubated at 37ºC for 4 hours with 10 μg/ml NA 
<Gtype> sample type </Gtype> : E. coli strain MC4100relA + in mid log phase incubated at 37ºC for 4 hours without treatment . 
<Gtype> sample type </Gtype> : E. coli strain MC4100relA + ∆ mazEF in mid log phase incubated at 37ºC for 4 hours with 100 μg/ml NA 
<Gtype> sample type </Gtype> : E. coli strain MC4100relA + ∆ mazEF in mid log phase incubated at 37ºC for 4 hours with 10 μg/ml NA 
<Gtype> sample type </Gtype> : E. coli strain MC4100relA + ∆ mazEF in mid log phase incubated at 37ºC for 4 hours without treatment 
<Gtype> sample type </Gtype> : E. coli strain MC4100relA + ∆ mazEFlexA3 in mid log phase incubated at 37ºC for 4 hours with 100 μg/ml NA 
<Gtype> sample type </Gtype> : E. coli strain MC4100relA + ∆ mazEFlexA3 in mid log phase incubated at 37ºC for 4 hours with 10 μg/ml NA 
<Gtype> sample type </Gtype> : E. coli strain MC4100relA + ∆ mazEFlexA3 in mid log phase incubated at 37ºC for 4 hours without treatment 
<Gtype> sample type </Gtype> : <Gtype> AT1 digested total RNA </Gtype> 
<Gtype> sample type </Gtype> : <Gtype> input control </Gtype> 
<Gtype> sample type </Gtype> : <Gtype> input DNA </Gtype> 
<Gtype> sample type </Gtype> : <Gtype> mock community -LSB- artificial bacterial DNA mix -RSB- </O> 
<Gtype> sample type </Gtype> : <Gtype> V1 digested total RNA </Gtype> 
<Gtype> sample type </Gtype> : <Phase> plasmid pool </Phase> 
<Gtype> sample type </Gtype> : <Supp> ribosome protected </Supp> 
<Gtype> sample type </Gtype> : <Supp> test 
<Gtype> See the paper Variation in the Genomic </Gtype> islands of porcine enteropathogenic Escherichia coli strains of serogroup O45 revealed by comparative genomic hybridization and PCR by Bruant and Zhang et al. 2009 
<Gtype> SeqA new deltaSeqA </Gtype> 
<Gtype> SHX-treated Delta dksA Cells </Gtype> 
<Gtype> SHX-treated Wild-type Cells </Gtype> 
<Gtype> SHX-treated Wild-type </Gtype> Cells Replicate 1 
<Gtype> SHX-treated Wild-type </Gtype> Cells Replicate 2 
<Gtype> SHX-treated Wild-type </Gtype> Cells Replicate 3 
<Gtype> Sigma70 LB-1 </Gtype> 
<Gtype> Sigma70 LB-2 </Gtype> 
<Gtype> Sigma70 LB-3 </Gtype> 
<Gtype> Sigma70 LP-1 </Gtype> 
<Gtype> Sigma70 LP-2 </Gtype> 
<Gtype> Sigma70 LP-3 </Gtype> 
<Gtype> Sigma70 LP </Gtype> 
<Gtype> ssRNA-seq </Gtype>
<Gtype> Strain EM1453 wild-type pBAD-ryhB </Gtype> <Supp> # 1 + arabinose </Supp> 
<Gtype> Strain W3110 </Gtype> 
<Gtype> transcription factor : CsiR </Gtype> 
<Gtype> transcription factor : NtrC </Gtype> 
<Gtype> transcription factor : OmpR </Gtype> 
<Gtype> Truseq Small RNA </Gtype> 
<Gtype> untreated control </Gtype> 
<Gtype> Untreated </Gtype>
<Gtype> Untreated wild type </Gtype> versus untreated yajL mutant . 
<Gtype> W3110 wild type </Gtype> 
<Gtype> W3110 wild type </Gtype> , biological rep1 
<Gtype> W3110 wild type </Gtype> , biological rep2 
<Gtype> \ W3110 wt </Gtype> <Med> in MOPS </Med> ( ile , val , thi ) at OD420 ~ 0.3 , 20 ug total ,10 ug pdN6 \ 
<Gtype> wild-type 1.0 ug/ml norfloxacin </Gtype> 
<Gtype> wild-type 1 hour ( 1 ) slide 1 </O> 
<Gtype> wild-type 1 hour ( 1 ) slide 2 </O> 
<Gtype> wild-type 1 hour ( 2 ) slide 2 </O> 
<Gtype> wild-type 1 hour ( 3 ) slide 1 </O> 
<Gtype> wild-type 1 hour ( 3 ) slide 2 </O> 
<Gtype> wild-type 2 hour ( 1 ) slide 1 </O> 
<Gtype> wild-type 2 hour ( 1 ) slide 2 </O> 
<Gtype> wild-type 2 hour ( 3 ) slide 1 </O> 
<Gtype> wild-type 2 hour ( 3 ) slide 2 </O> 
<Gtype> Wild-type <Air> Aerobic A </O> 
<Gtype> Wild-type <Air> Aerobic B </O> 
<Gtype> Wild-type <Air> Anaerobic A </O> 
<Gtype> Wild-type <Air> Anaerobic B </O> 
<Gtype> Wild-type _ cDNA _ </O> <Air> Aerobic 
<Gtype> Wild-type _ cDNA _ </O> <Air> Anaerobic 
<Gtype> Wild-type Cells </Gtype> 
<Gtype> Wild-type E. coli ATCC 25922 replicate 1 </O> 
<Gtype> Wild-type E. coli ATCC 25922 replicate 2 </O> 
<Gtype> wild type </Gtype> 
<Gtype> wild-type </Gtype>
<Gtype> wild type </Gtype> , 10 % H2O2 
<Gtype> Wild type </Gtype> and the mutant were grown on minimal M9 media with 4 g/L glucose as a sole carbon source at 37C with aeration ( + O2 ) or nitrogen sparging ( - <Air> O2 ) </Air> 
<Gtype> wild type </Gtype> _ anoxic ( NO3 ) _ glycerol 
<Gtype> wild type </Gtype> _ anoxic ( NO3 ) _ glycerol + <Supp> propionate 
<Gtype> Wild type </Gtype> control 
<Gtype> Wild type </Gtype> control ( 0 min ) 
<Gtype> Wild type </Gtype> control ( 10 min ) 
<Gtype> Wild type </Gtype> control ( 15 min ) 
<Gtype> Wild type </Gtype> control ( 20 min ) 
<Gtype> Wild type </Gtype> control ( 2.5 min ) 
<Gtype> Wild type </Gtype> control ( 5 min ) 
<Gtype> Wild type </Gtype> control ( 60 min ) 
<Gtype> Wild type </Gtype> control ( <Supp> 30 min ) </Supp> 
<Gtype> wild type </Gtype> E0 , biological rep1 
<Gtype> wild type </Gtype> E0 , biological rep2 
<Gtype> wild type </Gtype> E0 , biological rep3 
<Gtype> Wild type </Gtype> E. coli K-12 ( strain BW38038 ) and BW39452 ( ΔrpoS ) cultures were grown on <Med> MOPS glucose minimal medium </Med> with <Supp> 0.2 % glucose </Supp> as sole carbon source at <Temp> 37 °C </Temp> , pH was initially 7.4 , and the agitation speed was 500 rpm . Culture samples were harvested during logarithmic growth and following entry into stationary phase for the WT and rpoS mutant . OD600 measurements were made on a Beckman Coulter DU 800 spectrophotometer . Samples were harvested directly into ice-cold RNAlater at a 1:1 dilution to protect RNA from degradation and cells then were pelleted by centrifugation at 8000rpm for 10 minutes . Cell pellets were stored at -80 °C in an equal volume of RNAlater prior to RNA extraction . 
<Gtype> Wild type </Gtype> E. coli K-12 ( strain BW38038 ) and BW39452 ( ΔrpoS ) cultures were grown on <Med> MOPS glucose minimal medium </Med> with <Supp> 0.2 % glucose </Supp> as sole carbon source in a 2L B. Braun Biostat ® B fermenter with working volume of 1 <Technique> L <Med> MOPS minimal medium </Med> with <Supp> 0.2 % glucose </Supp> , at <Temp> 37 °C </Temp> , pH was kept constant at 7.4 by the addition of 1 M NaOH , and dissolved oxygen was maintained above 40 % of saturation by adjusting the agitation speeds in the range of 270 -- 500 rpm with fixed 1.5 liter/min air flow . Culture samples were harvested by using a homemade sampling device seven times during logarithmic growth and three times following entry into stationary phase for the WT and two times during logarithmic phase and three times during stationary phase for the rpoS mutant . OD600 measurements were made on a Beckman Coulter DU 800 spectrophotometer . Samples were harvested directly into ice-cold RNAlater at a 1:1 dilution to protect RNA from degradation and cells then were pelleted by centrifugation at 8000rpm for 10 minutes . Cell pellets were stored at -80 °C in an equal volume of RNAlater prior to RNA extraction . 
<Gtype> Wild type </Gtype> E.coli SE15 vs. LuxS mutant E.coli SE15 
<Gtype> wild type </Gtype> grown to logarithmic phase 
<Gtype> wild type </Gtype> grown to <Phase> transition phase </Phase> 
<Gtype> Wild Type </Gtype> ( K10 ) M9 + 0.2 % Glycerol , 0.2 % Tryptone , 40 mM Suc . at 30 C Mid Log 
<Gtype> Wild Type </Gtype> ( K10 ) M9 0.2 % Glycerol 0.2 % Tryptone 40 mM Suc . at 30 C Mid Log 
<Gtype> Wild Type </Gtype> ( K10 ) M9 + 0.2 % Glycerol , 0.2 % Tryptone , 40 mM Suc . at <Supp> 30 CMid Log </Supp> 
<Gtype> Wild Type </Gtype> ( N3433 ) in M9 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log 
<Gtype> Wild Type </Gtype> ( N3433 ) M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log 
<Gtype> Wild Type </Gtype> ( N3433 ) M9 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log 
<Gtype> wild type </Gtype> _ oxic _ glycerol + <Supp> propionate 
<Gtype> wild type </Gtype> _ oxic _ <Phase> glycerol 
<Gtype> wild type </Gtype> rep 1 
<Gtype> wild type </Gtype> rep 2 
<Gtype> wild type </Gtype> <Substrain> MG1655 
<Gtype> wild type </Gtype> , <Supp> 30 % H2O2 </Supp> 
<Gtype> wild type </Gtype> , without <Supp> H2O2 
<Gtype> Wild-type IrrE , biological rep1 </O> 
<Gtype> Wild-type IrrE , biological rep2 </O> 
<Gtype> Wild-type IrrE , biological rep3 </Gtype> 
<Gtype> wild-type MG1655 </Gtype> 
<Gtype> Wild-type ( MG1655 ) T0 RNA rep 2 </O> 
<Gtype> Wild-type ( MG1655 ) T0 RP rep 1 </O> 
<Gtype> Wild-type ( MG1655 ) T0 RP rep 2 </O> 
<Gtype> Wild-type ( MG1655 ) T1 RNA rep 1 </O> 
<Gtype> Wild-type ( MG1655 ) T1 RNA rep 2 </O> 
<Gtype> Wild-type ( MG1655 ) T1 RP rep 1 </O> 
<Gtype> Wild-type ( MG1655 ) T1 RP rep 2 </O> 
<Gtype> Wild-type ( MG1655 ) T2 RNA rep 1 </O> 
<Gtype> Wild-type ( MG1655 ) T2 RNA rep 2 </O> 
<Gtype> Wild-type ( MG1655 ) T2 RP rep 1 </O> 
<Gtype> Wild-type ( MG1655 ) T2 RP rep 2 </O> 
<Gtype> wild-type pBAD-ryhB </Gtype> <Supp> # 1 + arabinose </Supp> 
<Gtype> wild-type pBAD-ryhB </Gtype> <Supp> # 1 + FeSO4 + arabinose </Supp> 
<Gtype> wild-type pBAD-ryhB </Gtype> <Supp> # 2 + arabinose </Supp> 
<Gtype> wild-type pBAD-ryhB </Gtype> <Supp> # 2 + FeSO4 + arabinose </Supp> 
<Gtype> wild-type pNM12 </Gtype> <Supp> # 1 + arabinose </Supp> 
<Gtype> wild-type pNM12 </Gtype> <Supp> # 1 + FeSO4 + arabinose </Supp> 
<Gtype> wild-type pNM12 </Gtype> <Supp> # 2 + arabinose </Supp> 
<Gtype> wild-type pNM12 </Gtype> <Supp> # 2 + FeSO4 + arabinose </Supp> 
<Gtype> wild type SdiA </Gtype> 
<Gtype> with/without 2.5 mM Fumaric acid </Gtype> 
<Gtype> WT _ 01 _ rep1 </O> 
<Gtype> WT _ 02 _ rep1 </O> 
<Gtype> WT _ 03 _ rep1 </O> 
<Gtype> WT _ 04 _ </O> <Supp> TEX 
<Gtype> WT _ 04 _ rep1 </O> 
<Gtype> WT _ 04 _ rep2 </O> 
<Gtype> WT _ 04-R _ rep1 </O> 
<Gtype> WT _ 08 _ rep1 </O> 
<Gtype> WT _ 0 _ </O> <Gtype> Hx Rep1 </Gtype> 
<Gtype> WT _ 0 _ </O> <Gtype> Hx Rep2 </Gtype> 
<Gtype> WT _ 0 _ </O> <Gtype> Hx Rep3 </Gtype> 
<Gtype> WT 0 μg/ml NA rep1 </O> 
<Gtype> WT 0 μg/ml NA rep2 </O> 
<Gtype> WT 100 μg/ml NA rep1 </O> 
<Gtype> WT 100 μg/ml NA rep2 </O> 
<Gtype> WT 100 μg/ml NA rep3 </O> 
<Gtype> WT _ 120 ( Low Dilution ) Rep1 </O> 
<Gtype> WT _ 120 ( Low Dilution ) Rep2 </O> 
<Gtype> WT _ 120 ( Low Dilution ) Rep3 </O> 
<Gtype> WT _ 12h _ rep1 </O> 
<Gtype> WT _ 12h _ rep2 </O> 
<Gtype> WT _ 14 _ rep1 </O> 
<Gtype> WT _ 15 ( Low Dilution ) Rep1 </O> 
<Gtype> WT _ 15 ( Low Dilution ) Rep2 </O> 
<Gtype> WT _ 15 ( Low Dilution ) Rep3 </O> 
<Gtype> WT _ 16 _ rep1 </O> 
<Gtype> WT _ 16-R _ rep1 </O> 
<Gtype> wt _ 1 _ input </O> 
<Gtype> WT 1 min rep7 </O> 
<Gtype> wt _ 1 </O> 
<Gtype> WT _ 1 </O> 
<Gtype> wt _ 1 _ </O> <Supp> IP 
<Gtype> wt 240 minutes growth rep1 </O> 
<Gtype> wt 240 minutes growth rep2 </O> 
<Gtype> wt 240 minutes growth rep3 </O> 
<Gtype> WT _ 24h _ rep1 </O> 
<Gtype> WT _ 24h _ rep2 </O> 
<Gtype> wt _ 2 _ input </O> 
<Gtype> wt _ 2 </O> 
<Gtype> WT _ 2 </O> 
<Gtype> wt _ 2 _ </O> <Supp> IP 
<Gtype> WT _ 30 ( Low Dilution ) Rep1 </O> 
<Gtype> WT _ 30 ( Low Dilution ) Rep2 </O> 
<Gtype> WT _ 30min-R _ rep1 </O> 
<Gtype> wt 360 minutes growth rep1 </O> 
<Gtype> wt 360 minutes growth rep2 </O> 
<Gtype> wt 360 minutes growth rep3 </O> 
<Gtype> WT _ 37C </O> 
<Gtype> WT _ 3 </O> 
<Gtype> WT _ 45 ( Low Dilution ) Rep1 </O> 
<Gtype> WT _ 45 ( Low Dilution ) Rep2 </O> 
<Gtype> WT _ 45 ( Low Dilution ) Rep3 </O> 
<Gtype> WT _ 48h _ rep1 </O> 
<Gtype> WT _ 48h _ rep2 </O> 
<Gtype> wt +50 ug/ml Trp , 30 ug total RNA </O> 
<Gtype> WT _ 60 ( Low Dilution ) Rep1 </O> 
<Gtype> WT _ 60 ( Low Dilution ) Rep2 </O> 
<Gtype> WT _ 60 ( Low Dilution ) Rep3 </O> 
<Gtype> WT _ 6h _ rep1 </O> 
<Gtype> WT _ 6h _ rep2 </O> 
<Gtype> wt 90 minutes growth rep1 </O> 
<Gtype> wt 90 minutes growth rep2 </O> 
<Gtype> wt 90 minutes growth rep3 </O> 
<Gtype> WT 9 min rep7 </O> 
<Gtype> WT 9 min rep8 </O> 
<Gtype> wt aerobic AN rep 1 </O> 
<Gtype> wt aerobic AN rep 2 </O> 
<Gtype> wt aerobic AN rep 3 </O> 
<Gtype> wt aerobic </Gtype> 
<Gtype> wt aerobic rep 1 </O> 
<Gtype> wt aerobic rep 2 </O> 
<Gtype> wt aerobic rep 3 </O> 
<Gtype> wt <Air> anaerobic AN rep 1 </O> 
<Gtype> wt <Air> anaerobic AN rep 2 </O> 
<Gtype> wt <Air> anaerobic AN rep 3 </O> 
<Gtype> wt <Air> anaerobic rep 1 </O> 
<Gtype> wt <Air> anaerobic rep 2 </O> 
<Gtype> wt <Air> anaerobic rep 3 </O> 
<Gtype> wt anaerobic plus NO2 AN rep 1 </O> 
<Gtype> wt anaerobic plus NO2 AN rep 2 </O> 
<Gtype> wt anaerobic plus NO2 AN rep 3 </O> 
<Gtype> wt anaerobic plus NO2 </O> 
<Gtype> wt anaerobic plus NO2 rep 1 </O> 
<Gtype> wt anaerobic plus NO2 rep 2 </O> 
<Gtype> wt anaerobic plus NO2 rep 3 </O> 
<Gtype> wt anaerobic plus NO3 AN rep 1 </O> 
<Gtype> wt anaerobic plus NO3 AN rep 2 </O> 
<Gtype> wt anaerobic plus NO3 AN rep 3 </O> 
<Gtype> wt anaerobic plus NO3 rep 1 </O> 
<Gtype> wt anaerobic plus NO3 rep 2 </O> 
<Gtype> wt anaerobic plus NO3 rep 3 </O> 
<Gtype> wt at T0 </O> 
<Gtype> wt at T1h </O> 
<Gtype> wt at T4h </O> 
<Gtype> WT cells were treated with 10 mM Glycolaldehyde for </O> <Supp> 30 min </Supp> whenever the culture OD600nm reached ~ 1 . 
<Gtype> WT _ CPR _ 1 </O> 
<Gtype> WT _ CPR _ 2 </O> 
<Gtype> WT _ D _ </O> <Supp> N1000 _ </O> <Phase> r1 
<Gtype> WT _ D _ </O> <Supp> N1000 _ </O> <Phase> r2 
<Gtype> wt E. coli , after butanol treatment </O> 
<Gtype> wt E. coli , before butanol treatment </O> 
<Gtype> wt _ EE _ 1 </O> 
<Gtype> wt _ EE _ 2 </O> 
<Gtype> WT _ exp1 _ </O> <Gtype> mRNA 
<Gtype> WT _ exp1 _ </O> <Phase> ribosome 
<Gtype> WT _ exp2 _ </O> <Gtype> mRNA 
<Gtype> WT _ exp2 _ </O> <Phase> ribosome 
<Gtype> WT _ exp3 _ </O> <Gtype> mRNA 
<Gtype> WT _ exp3 _ </O> <Phase> ribosome 
<Gtype> WT _ exp4 _ </O> <Gtype> mRNA 
<Gtype> WT _ exp4 _ </O> <Phase> ribosome 
<Gtype> WT exp mRNA </Gtype> 
<Gtype> WT _ glycerol _ </O> <Phase> replicate1 
<Gtype> WT _ glycerol _ </O> <Phase> replicate2 
<Gtype> WT _ glycerol _ </O> <Phase> replicate3 
<Gtype> wt </Gtype>
<Gtype> WT </Gtype>
<Gtype> Wt -- </Gtype> <Supp> 120 min </Supp> 
<Gtype> Wt -- </Gtype> <Supp> 180 min </Supp> 
<Gtype> Wt -- </Gtype> <Supp> 300 min </Supp> 
<Gtype> Wt -- </Gtype> <Supp> 420 min </Supp> 
<Gtype> Wt -- </Gtype> <Supp> 60 min </Supp> 
<Gtype> WT + </Gtype> <Supp> L-trp 
<Gtype> WT + </Gtype> <Supp> O2 1 </Supp> 
<Gtype> WT + </Gtype> <Supp> O2 2 </Supp> 
<Gtype> WT ( K10 ) in M9 0.2 % Glycerol 0.2 % Tryptone 40 mM Suc . at 30 0C Mid Log 6.0 ' post rif </O> 
<Gtype> WT ( K10 ) in M9 0.2 % Glycerol 0.2 % Tryptone 40 mM Suc . at 30 C Mid Log 1.5 ' post rif </O> 
<Gtype> WT ( K10 ) in M9 0.2 % Glycerol 0.2 % Tryptone 40 mM Suc . at 30 C Mid Log 3 ' post rif </O> 
<Gtype> WT ( K10 ) in M9 0.2 % Glycerol 0.2 % Tryptone 40 mM Suc . at 30 C Mid Log 4.5 ' post rif </O> 
<Gtype> WT ( K10 ) in M9 0.2 % Glycerol 0.2 % Tryptone 40 mM Suc . at 30 C Mid Log 6.0 ' post rif </O> 
<Gtype> WT ( K10 ) M9 0.2 % Glycerol 0.2 % Tryptone 40 mM Suc . at 30 C Mid Log </O> 
<Gtype> WT ( K10 ) M9 0.2 % Glycerol 0.2 % Tryptone 40 mM Succinate at 30 C Mid Log </O> 
<Gtype> WT ( K10 ) vs Eno - ( DF261 ) M9 + 0.2 % Glycerol , 0.2 % Tryptone , 40 mM Suc . at 30 C Mid Log Trial B1 </O> 
<Gtype> WT - Keio Sample 1 </O> 
<Gtype> WT - Keio Sample 20 </O> 
<Gtype> WT - Keio Sample 39 </O> 
<Gtype> wt + Leu vs. wt - Leu </O> 
<Gtype> wt _ LS _ 1 </O> 
<Gtype> wt _ LS _ 2 </O> 
<Gtype> WT _ minimal _ </O> <Gtype> mRNA 
<Gtype> WT _ minimal _ </O> <Phase> ribosome 
<Gtype> WT _ minus _ 2DG _ 1 </O> 
<Gtype> WT _ minus _ 2DG _ 2 </O> 
<Gtype> WT _ minus _ 2DG _ 3 </O> 
<Gtype> WT _ N0000 _ </O> <Phase> r1 
<Gtype> WT _ N0000 _ </O> <Phase> r2 
<Gtype> WT _ N0025 _ </O> <Phase> r1 
<Gtype> WT _ N0025 _ </O> <Phase> r2 
<Gtype> WT _ N0050 _ </O> <Phase> r1 
<Gtype> WT _ N0050 _ </O> <Phase> r2 
<Gtype> WT _ N0075 _ </O> <Phase> r1 
<Gtype> WT _ N0075 _ </O> <Phase> r2 
<Gtype> WT ( N3433 ) in M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log 1.5 ' post rif </O> 
<Gtype> WT ( N3433 ) in M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log 3.0 ' post rif </O> 
<Gtype> WT ( N3433 ) in M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log 3 ' post rif </O> 
<Gtype> WT ( N3433 ) in M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log 4.5 ' post rif </O> 
<Gtype> WT ( N3433 ) in M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log 6 ' post rif </O> 
<Gtype> WT ( N3433 ) M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log 6 ' post rif </O> 
<Gtype> WT ( N3433 ) M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log </O> 
<Gtype> WT _ noCPR _ 1 </O> 
<Gtype> WT _ noCPR _ 2 </O> 
<Gtype> WT _ N _ </O> <Phase> strv 
<Gtype> WT - O2 1 </O> 
<Gtype> WT - O2 2 </O> 
<Gtype> WT - O2 3 </O> 
<Gtype> WT - O2 </O> 
<Gtype> WT _ </O> <Air> Anaerobic _ </O> <Technique> RNAseq _ A _ Tag _ Count.txt : </O> <Gversion> U00096 .2 </Gversion> 
<Gtype> WT _ </O> <Air> Anaerobic _ </O> <Technique> RNAseq _ A _ WIG.wig : </O> <Gversion> U00096 .2 </Gversion> 
<Gtype> WT _ </O> <Air> Anaerobic _ </O> <Technique> RNAseq _ B _ </O> <Supp> Tag _ Count.txt : </O> <Gversion> U00096 .2 </Gversion> 
<Gtype> WT _ </O> <Air> Anaerobic _ </O> <Technique> RNAseq _ B _ WIG.wig : </O> <Gversion> U00096 .2 </Gversion> 
<Gtype> WT _ </O> <Gtype> 30 ( Low Dilution ) Rep3 </Gtype> 
<Gtype> WT _ </O> <Supp> 04-R _ rep1 </O> 
<Gtype> WT _ </O> <Supp> 15 min </Supp> _ rep1 
<Gtype> WT _ </O> <Supp> 180 min </Supp> _ rep1 
<Gtype> WT _ </O> <Supp> 30 min </Supp> _ rep1 
<Gtype> WT _ </O> <Supp> 30 min </Supp> _ rep2 
<Gtype> WT _ </O> <Supp> 30 min </Supp> _ <Supp> TEX 
<Gtype> WT _ </O> <Supp> acetate 
<Gtype> WT _ </O> <Supp> fructose 
<Gtype> WT _ </O> <Supp> glucose 
<Gtype> WT _ </O> <Supp> glucose _ log _ </O> <Supp> TEX 
<Gtype> WT _ </O> <Supp> glucose _ </O> <Phase> log 
<Gtype> WT _ </O> <Supp> glucose _ </O> <Phase> stat 
<Gtype> WT _ </O> <Supp> glucose _ stat _ </O> <Supp> TEX 
<Gtype> wt _ </O> <Supp> ME _ 1 </O> 
<Gtype> wt _ </O> <Supp> ME _ 2 </O> 
<Gtype> WT _ </O> <Supp> N _ strv _ </O> <Supp> TEX 
<Gtype> WT _ </O> <Technique> RNA-Seq 
<Gtype> WT pH 5.6 C </Gtype> 
<Gtype> WT pH 5.6 </Gtype> A 
<Gtype> WT pH 7.2 +15 % </Gtype> sucrose A 
<Gtype> WT pH 7.2 +15 % </Gtype> sucrose B 
<Gtype> WT pH 7.2 +15 % sucrose C </Gtype> 
<Gtype> WT <pH> pH5 .5 </pH> 
<Gtype> WT <pH> pH5 .5 </pH> 1 
<Gtype> WT <pH> pH5 .5 </pH> 2 
<Gtype> WT _ plus _ 2DG _ 1 </O> 
<Gtype> WT _ plus _ 2DG _ 2 </O> 
<Gtype> WT _ plus _ 2DG _ 3 </O> 
<Gtype> WT rep1 </O> 
<Gtype> WT rep2 </O> 
<Gtype> WT rep3 </Gtype> 
<Gtype> WT rep 3 </O> 
<Gtype> wt _ S _ 1 </O> 
<Gtype> wt _ S _ 2 </O> 
<Gtype> WT ( SH3208 ) in M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log 1.5 ' post rif </O> 
<Gtype> WT ( SH3208 ) in M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log 3 ' post rif </O> 
<Gtype> WT ( SH3208 ) in M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log 4.5 ' post rif </O> 
<Gtype> WT ( SH3208 ) in M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log 6 ' post rif </O> 
<Gtype> WT ( SH3208 ) in M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log </O> 
<Gtype> WT ( SH3208 ) M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log </O> 
<Gtype> WT <Supp> acetate 1 </O> 
<Gtype> WT <Supp> acetate 2 </O> 
<Gtype> wt <Supp> anaerobic plus NO3 </Supp> 
<Gtype> WT <Supp> fructose 1 </O> 
<Gtype> WT <Supp> fructose 2 </O> 
<Gtype> WT <Supp> glucose 1 </O> 
<Gtype> WT <Supp> glucose 2 </O> 
<Gtype> WT <Supp> glucose _ </O> <Phase> replicate1 
<Gtype> WT <Supp> glucose _ </O> <Phase> replicate2 
<Gtype> WT <Supp> glucose _ </O> <Phase> replicate3 
<Gtype> WT <Supp> NaCl 1 </O> 
<Gtype> WT <Supp> NaCl 2 </O> 
<Gtype> WT <Supp> NO3 1 </O> 
<Gtype> WT <Supp> NO3 2 </O> 
<Gtype> WT <Supp> NO3 w/propionate 1 </Supp> 
<Gtype> WT <Supp> NO3 w/propionate </Supp> 2 
<Gtype> WT <Supp> O2 1 </Supp> 
<Gtype> WT <Supp> O2 2 </Supp> 
<Gtype> WT <Supp> O2 w/propionate 1 </Supp> 
<Gtype> WT <Supp> O2 w/propionate </Supp> 2 
<Gtype> WT <Supp> PQ 1 </O> 
<Gtype> WT <Supp> PQ 2 </O> 
<Gtype> WT <Supp> rep 1 </Supp> 
<Gtype> WT <Supp> rep 2 </O> 
<Gtype> wt _ T _ 1 </O> 
<Gtype> wt _ T _ 2 </O> 
<Gtype> wt _ T _ 3 </O> 
<Gtype> WT <Temp> 22 °C </Temp> 
<Gtype> WT <Temp> 37 °C </Temp> 
<Gtype> wt + trp vs. - trp , min +.2 % glucose , W3110 </O> 
<Gtype> wt _ TS _ 1 </O> 
<Gtype> wt _ TS _ 2 </O> 
<Gtype> wt _ un _ 1 </O> 
<Gtype> wt _ un _ 2 </O> 
<Gtype> wt _ un _ 3 </O> 
<Gtype> WT UvsW </Gtype> _ replicate1 
<Gtype> WT UvsW </Gtype> _ replicate2 
<Gtype> WT UvsW </Gtype> _ replicate3 
<Gtype> WT _ vs _ dcd </O> 
<Gtype> WT _ vs _ ndk </O> 
<Gtype> WT _ vs _ </O> <Gtype> recA730 
<Gtype> WT with </O> <Supp> DPD 1 </O> <Technique> ( RNA-seq ) </Technique> 
<Gtype> WT with </O> <Supp> DPD 2 </O> <Technique> ( RNA-seq ) </Technique> 
<Gtype> WT with </O> <Supp> Fe 1 </O> <Technique> ( RNA-seq ) </Technique> 
<Gtype> WT with </O> <Supp> Fe 2 </O> <Technique> ( RNA-seq ) </Technique> 
<Gtype> ∆ zwf </Gtype> parent Sample 40 
<Gtype> ∆ zwf parent Sample </Gtype> 2 
<Gtype> ∆ zwf parent Sample </Gtype> <Temp> 21 
<Gtype> Δcra _ </O> <Supp> acetate 
<Gtype> Δcra _ </O> <Supp> fructose 
<Gtype> Δcra _ </O> <Supp> glucose 
<Gtype> Δcra <Supp> acetate 1 </O> 
<Gtype> Δcra <Supp> acetate 2 </O> 
<Gtype> Δcra <Supp> fructose 1 </O> 
<Gtype> Δcra <Supp> fructose 2 </O> 
<Gtype> Δcra <Supp> glucose 1 </O> 
<Gtype> Δcra <Supp> glucose 2 </O> 
<Gtype> Δfur with </O> <Supp> DPD 1 </O> <Technique> ( RNA-seq ) </Technique> 
<Gtype> Δfur with </O> <Supp> DPD 2 </O> <Technique> ( RNA-seq ) </Technique> 
<Gtype> Δfur with </O> <Supp> Fe 1 </O> <Technique> ( RNA-seq ) </Technique> 
<Gtype> Δfur with </O> <Supp> Fe 2 </O> <Technique> ( RNA-seq ) </Technique> 
<Gtype> ΔgadE <pH> pH5 .5 </pH> 
<Gtype> ΔgadE <pH> pH5 .5 </pH> 1 
<Gtype> ΔgadE <pH> pH5 .5 </pH> 2 
<Gtype> ΔgadW <pH> pH5 .5 </pH> 
<Gtype> ΔgadW <pH> pH5 .5 </pH> 1 
<Gtype> ΔgadW <pH> pH5 .5 </pH> 2 
<Gtype> ΔgadX <pH> pH5 .5 </pH> 
<Gtype> ΔgadX <pH> pH5 .5 </pH> 1 
<Gtype> ΔgadX <pH> pH5 .5 </pH> 2 
<Gtype> ΔompR <Supp> NaCl 1 </O> 
<Gtype> ΔompR <Supp> NaCl 2 </O> 
<Gtype> ΔoxyR <Supp> PQ 1 </O> 
<Gtype> ΔoxyR <Supp> PQ 2 </O> 
<Gtype> Δrac </Gtype>
<Gtype> ΔsoxR <Supp> PQ 1 </O> 
<Gtype> ΔsoxR <Supp> PQ 2 </O> 
<Gtype> ΔsoxS <Supp> PQ 1 </O> 
<Gtype> ΔsoxS <Supp> PQ 2 </O> 
gut origin : <Gtype> Human colon </Gtype> 
<Gversion> NC </Gversion>
<Gversion> pGIT1 .2 </Gversion> 
<Gversion> pGIT1 .2 </Gversion> + <Supp> NO2 
<Gversion> pGIT8 .2 </Gversion> + <Supp> NO2 
Gyrase Cleavage Sites ( GCSs ) were called using custom script ( GCSs_calling.py , github : <Gtype> https://github.com/sutormin94/Gyrase_Topo-seq ) that takes 4 files ( tetrade ) as input : + A+IP , + A-IP , - A+IP , - A-IP </O> 
heat shock time : <Supp> 0 min </Supp> 
heat shock time : <Supp> 10 min </Supp> 
heat shock time : <Supp> 20 min </Supp> 
hfq + <Gtype> Wild type </Gtype> control ( 20 min ) 
High succinic acid tolerance E.coli _ <Gtype> rep Dn </Gtype> 
High succinic acid tolerance E.coli _ <Gtype> rep Up </Gtype> 
Hiseq 2500 Illumina short reads ( 50 bp ) were mapped back to the Caulobacter NA1000 reference genome ( NCBI Reference Sequence : <Gtype> NC-011916.1 ) using Bowtie 1 ( Langmead et al. , 2009 ) and the following command : bowtie - m 1 - n 1 -- best -- strata - p 4 -- chunkmbs 512 NA1000-bowtie -- sam * . fastq > output.sam . Subsequently , the sequencing coverage for each nucleotide position was computed using BEDTools ( Quinlan & Hall , 2010 ) and the following command : bedtools genomecov - d - ibam output.sorted.bam - g NA1000.fna > coverage_output.txt . Finally , the ratio between the number of reads of libraries generated from pMCS1-Tn5-ME-R6Kγ-kanR-ME or pMCS1-Tn5-ME-R6Kγ-kanR-parS456-ME were calculated . Results were binned over 1 kb and represented as a log10 scale . </O> 
His-tagged DNA extracted from biofilm cells of E. coli K-12 <Gtype> wild type </Gtype> BW25113/pCA24N ( empty vector ) after 24 hours of growth in LB with glasswool at <Supp> 37oC under 2 mM IPTG </Supp> 
His-tagged DNA extracted from biofilm cells of E. coli K-12 <Gtype> wild type </Gtype> BW25113/pCA24N-mqsR after 24 hours of growth in LB with glasswool at <Supp> 37oC under 2 mM IPTG </Supp> 
His-tagged DNA extracted from planktonic cells of E. coli K-12 <Gtype> wild type </Gtype> BW25113 / / pBAD-Myc-His C ( empty vector ) after 24 hours of growth in LB at 37oC with induction of 0.5 % L-arabinose suspension cell 
His-tagged DNA extracted from planktonic cells of E. coli K-12 <Gtype> wild type </Gtype> BW25113/pBAD-Myc-His C-mqsA after 24 hours of growth in LB at 37oC with induction of 0.5 % L-arabinose suspension cell 
HNCE4 is an isogenic mutant derived from drug sensitive AG102MB ( marR1 , AcrB : <Gtype> : kan </Gtype> ) . It contains an additional mutation at the emrAB locus ( marR1 , acrB : <Gtype> : kan , emrAB : : cat </Gtype> ) resulting in a multidrug efflux negative phenotype . 
HNS - <Air> Aerobic A </O> 
HNS - <Air> Aerobic B </O> 
HNS - <Air> Anaerobic A </O> 
HNS - <Air> Anaerobic B </O> 
hybridization buffer ( formamide content ) : <Gtype> 32.5 % formamide </Gtype> 
hybridization buffer ( formamide content ) : <Supp> 0 % formamide </Supp> 
hybridization buffer ( formamide content ) : <Supp> 10 % formamide </Supp> 
hybridization buffer ( formamide content ) : <Supp> 15 % formamide </Supp> 
hybridization buffer ( formamide content ) : <Supp> 20 % formamide </Supp> 
hybridization buffer ( formamide content ) : <Supp> 25 % formamide </Supp> 
hybridization buffer ( formamide content ) : <Supp> 45 % formamide </Supp> 
hybridization buffer ( formamide content ) : <Supp> 5 % formamide </Supp> 
hybridization buffer ( total rna ) : <Supp> 50 ng </Supp> 
hybridization buffer ( total rna ) : <Supp> 5 ng </Supp> 
IHF - <Air> Anaerobic A </O> 
IHF - <Air> Anaerobic B </O> 
ik _ H2 _ <Supp> T3 _ </O> <Phase> r1 
ik _ H2 _ <Supp> T4 _ </O> <Phase> r1 
ik _ H2 _ <Supp> T5 _ </O> <Phase> r1 
ik _ H2 _ <Supp> T6 _ </O> <Phase> r1 
ik _ H2 _ <Supp> T8 _ </O> <Phase> r1 
ik _ L2 _ <Supp> T3 _ </O> <Phase> r1 
ik _ L2 _ <Supp> T4 _ </O> <Phase> r1 
ik _ L2 _ <Supp> T5 _ </O> <Phase> r1 
ik _ L2 _ <Supp> T6 _ </O> <Phase> r1 
ik _ L2 _ <Supp> T8 _ </O> <Phase> r1 
incubated with : <Anti> Drosophila immune proteins </Anti> 
incubation condition : <Gtype> In the dark , 5h , 20 °C , </O> <Agit> 150 rpm </Agit> 
incubation duration : <Supp> 10 min </Supp> 
incubation medium : <Supp> 10 mM NaCl </Supp> 
incubation medium : <Supp> 10 mM NaCl </Supp> + 100mg/l TiO2 nanoparticles 
incubation time : <Supp> 0 min </Supp> 
incubation time : <Supp> 10 min </Supp> 
incubation time : <Supp> 5 hr </Supp> 
Individual clones of E. coli DH1 were grown in <Med> M9 MOPS media </Med> in 300 mL media in 1 L baffled flasks 
Individual colonies were inoculated into MOPS EZ Rich Defined Medium ( Teknova , CA , M2105 ) with 0.2 % glycerol carbon source and 50 μg/mL kanamycin ( Gold Biotechnology , MO , K-120-5 ) and grown overnight for <Supp> 16 hours </Supp> at <Temp> 37 °C </Temp> and 1000 RPM in V-bottom 96-well plates ( Nunc , Roskilde , Denmark , 249952 ) in an ELMI Digital Thermos Microplates shaker incubator ( Elmi Ltd , Riga , Latvia ) . The following day , cultures were diluted 178-fold ( two serial dilutions of 15 µL into 185 µL ) into EZ Rich glycerol with kanamycin , and grown under the same ELMI shaker incubator conditions for three hours . Cells were diluted 658-fold ( 4.56 µL into 3 mL ) into culture tubes ( Falcon 14 mL round-bottom polypropylene tubes ; Corning , MA , 352059 ) containing EZ Rich glycerol with kanamycin and inducers . For Erlenmeyer flask assays ( Pyrex 250 mL ; Cole-Palmer , IL , 4980-250 ) , cells were diluted 658-fold ( 76 µL into 50 mL ) into EZ Rich glycerol with kanamycin and inducers . Eight inducer combinations were used that cover the presence or absence of 0.5 mM IPTG , 10 ng/mL aTc , and 5 mM L-arabinose . Culture tubes were then grown in an Innova 44 shaker ( Eppendorf , CT ) at <Temp> 37 °C </Temp> and <Agit> 250 rpm </Agit> for five hours . 
Individual colonies were inoculated into MOPS EZ Rich Defined Medium ( Teknova , CA , M2105 ) with 0.2 % glycerol carbon source and 50 μg/mL kanamycin ( Gold Biotechnology , MO , K-120-5 ) and grown overnight for <Supp> 16 hours </Supp> at <Temp> 37 °C </Temp> and 1000 RPM in V-bottom 96-well plates ( Nunc , Roskilde , Denmark , 249952 ) in an ELMI Digital Thermos Microplates shaker incubator ( Elmi Ltd , Riga , Latvia ) . The following day , cultures were diluted 178-fold ( two serial dilutions of 15 µL into 185 µL ) into EZ Rich glycerol with kanamycin , and grown under the same ELMI shaker incubator conditions for three hours . For culture tube assays ( Falcon 14 mL round-bottom polypropylene tubes ; Corning , MA , 352059 ) , cells were diluted 658-fold ( 4.56 µL into 3 mL ) into EZ Rich glycerol with kanamycin and inducers . For Erlenmeyer flask assays ( Pyrex 250 mL ; Cole-Palmer , IL , 4980-250 ) , cells were diluted 658-fold ( 76 µL into 50 mL ) into EZ Rich glycerol with kanamycin and inducers . Eight inducer combinations were used that cover the presence or absence of 0.5 mM IPTG , 10 ng/mL aTc , and 5 mM L-arabinose . Culture tubes and Erlenmeyer flasks were then grown in an Innova 44 shaker ( Eppendorf , CT ) at <Temp> 37 °C </Temp> and <Agit> 250 rpm </Agit> for five hours . 
individual : <Gtype> CF patient </Gtype> 
individual : <Gtype> healthy child </Gtype> 
induction : <Supp> 0.2 % arabinose </Supp> 
induction : <Supp> induced 50 µM IPTG </Supp> 
Infected kidney solutions were centrifuged at 5000xg for 10 min to separate bacteria ( pellet ) from kidney ( surface of RNA-later solution ) cells . The kidney cells were evacuated from the top of the solution , and the remaining solution was spun once more at 12000xg for 10 min , followed by disposal of the supernatant . Pelleted cells were resuspended in TE buffer and treated with lysozyme ( Sigma ) at 1mg/ml final concentration for 5 min , and samples of 3-5 infected mice were pooled together for each infection group . Nucleic acids were extracted via the RNA extraction protocol and products of the RNAeasy kit ( Qiagen ) . Following column purification , RNA samples were treated with DNAse Turbo ( Ambion ) for <Supp> 30 min </Supp> at 37C , followed by quantification of RNA using a spectrophotometer . Remaining polyadenylated eukaryotic RNA was depleted from the samples following the MicroEnrich ( Ambion ) protocol and resuspended in 20 l of TE buffer . RNA was quantified spectrophotometrically and equal amounts ( ~ 300-500ng ) of KMD and PC1012 RNA samples were subjected to the MessageAmp ( Ambion ) RNA amplification protocol . Resultant amplified RNA was quantified and equal amounts were used in the Affymetrix protocol for prokaryotic cDNA synthesis and biotin labeling . 
inhibitor : <Gtype> 20uM ME0052 </Gtype> 
inhibitor : <Gtype> 20uM ME0053 </Gtype> 
inhibitor : <Gtype> 20uM ME0054 </Gtype> 
inhibitor : <Gtype> 20uM ME0055 </Gtype> 
Initial data analysis was performed using the GeneChip ® Operating Software . Microarray quality control parameters were as follow : <Anti> noise ( RawQ ) less than 5 , background signal less than 40 ( 100 target intensity for array scaling ) , consistent numbers of genes detected as present across arrays . </O> 
INPUT ChIP DNA from <Gtype> ∆ hns / ∆ stpA </Gtype> , no antibody control 
Input DNA from heat-shocked condition without <Supp> rifampicin treatment </Supp> 
Input DNA from mid-exponential condition without <Supp> rifampicin treatment </Supp> 
Input DNA from mid-exponential condition with <Supp> rifampicin treatment </Supp> 
Input DNA from nitrogen-limiting condition without <Supp> rifampicin treatment </Supp> 
Input DNA from stationary condition without <Supp> rifampicin treatment </Supp> 
Input <Gtype> ∆ fur </Gtype> <Air> Anaerobic 
Input _ <Gtype> hns-F _ bcm - # 1 </O> 
Input _ <Gtype> hns-F _ bcm - # 2 </O> 
Input _ <Gtype> hns-F _ bcm + </O> <Supp> # 1 </Supp> 
Input _ <Gtype> hns-F _ bcm + </O> <Supp> # 2 </Supp> 
input signal frequency : <Gtype> 1/1200 Hz </Gtype> 
input signal frequency : <Gtype> 1/2400 Hz </Gtype> 
input signal frequency : <Gtype> 1/3600 Hz </Gtype> 
input signal frequency : <Gtype> 1/600 Hz </Gtype> 
input signal frequency : <Gtype> 1/900 Hz </Gtype> 
INPUT _ <Supp> ChIP-seq _ </O> <Air> Anaerobic _ WIG.wig : </O> <Gversion> U00096 .2 </Gversion> 
Intensity measures in <Gtype> wild type </Gtype> strain , replicate 1 
Intensity measures in <Gtype> wild type </Gtype> strain , replicate 2 
In the 15 ml centrifuge tube ( Corning , 430791 ) , the overnight culture was diluted to 2 ml <Med> in fresh LB medium </Med> containing Ampicillin ( 50 ng/μl ) , Chloramphenicol ( 170 ng/μl ) and IPTG ( 0.5 mM ) to reach OD600 = 0.01 . The LED tube was screwed into the centrifuge tube and connected with the control box . Then the power of the control box was turned on and the LED frequency input was generated . At last , the 15 ml centrifuge tube with LED tube was put into the Thermomixer comfort ( Eppendorf ) and shaken at 650 rpm and <Temp> 37 °C </Temp> for 10 hours . 
In vitro RNA preparation : <Gtype> The 5.7 </Gtype> kb RNA was purified from the digested DNA , NTPs , abortive oligo-RNA products , and proteins by Acidic phenol extraction , G50 spin column , followed by EtOH precipitation . 
In vitro transcription reactions were performed in a final volume of 50 µl . Each reaction contained 2 µl E. coli RNA Polymerase Holoenzyme ( NEB , cat . M0551S ) , 5 µl E. coli RNA Polymerase Buffer ( 10X ) , 1 µl SUPERase • In ™ RNase Inhibitor ( Ambion , cat . AM2696 ) , and 500 ng template DNA . Reactions were incubated at <Temp> 37 °C </Temp> for 5 minutes to allow formation of the RNA Polymerase-DNA binary complex . Transcription was started by addition of 1 µl NTPs ( 25 mM each ) , and incubated at <Temp> 37 °C </Temp> for 5 minutes . Transcription was stopped by addition of 1 µl DNase I ( 50 U/µl ) and Actinomycin D ( Sigma Aldrich , cat . A1410 , dissolved in DMSO to 5 μg/μl ) to a final concentration of 25 ng/μl . Reactions were diluted by addition of 50 μl E. coli RNA Polymerase Buffer 1X . DMS ( Sigma Aldrich , cat . D186309 ) was diluted 1:6 in 100 % Ethanol to a final concentration of 1.76 M. Diluted DMS was added to reactions to a final concentration of 100 mM . For control samples , an equal volume of a 1:6 dilution of nuclease-free water in 100 % Ethanol was added . Samples were incubated with moderate shaking ( 800 RPM ) at 25 °C for 2 minutes , after which reactions were immediately transferred to ice . Two volumes of ice-cold RNA Binding Buffer from RNA Clean & Concentrator ™ -5 kit ( Zymo Research , cat . R1014 ) supplemented with DTT ( Sigma Aldrich , cat . 43815 ) to a final concentration of 0.7 M , were added to quench DMS , and samples were vigorously vortexed for 10 seconds . 
In vivo RNA preparation : The cells in 200 ml culture were harvested and resuspended with a solution containing 0.5 % SDS , 20 mM sodium acetate ( <pH> pH 5.5 </pH> ) , and 10 mM EDTA . The suspended cells were mixed with an equal volume of pre-warmed saturated phenol ( 20 mM sodium acetate , 10 mM EDTA <pH> pH 5.5 </pH> ) and incubated for 5 min at 60 C . The mixture was centrifuged , and RNA and DNA were precipitated with ethanol from the supernatant . The pellet was dissolved in DNase I buffer with 10U of DNaseI and incubated for <Supp> 30 min </Supp> . RNA was separated from the digested DNA by acidic phenol extraction followed by G-50 Micro column ( GE Healthcare ) purification , and then precipitated with ethanol . The pellet was dissolved in diethylpyrocarbonate-treated water and used for cDNA synthesis . 
Ionic silver stock solutions were prepared from AgNO3 powder ( Fisher Scientific Bioblock ) as previously described ( Saulou , Jamme et al. , 2013 ) and stored in darkness . The final tested concentrations ( 5.0 , 6.5 , and 8.5 µM ) were obtained by diluting the corresponding AgNO3 stock solution directly into the M9 growth medium . Control experiment was simultaneously performed by adding deionised water into the M9 broth . In both cases , a stabilization period of 24 h ( at <Temp> 37 °C </Temp> and 120 rpm ) was carried out before cell inoculation . 
ip antibody : <Anti> affinity purified anti-Fur antibody </Anti> 
IP <Gtype> ∆ fur </Gtype> <Air> Anaerobic 
isolate : <Gtype> bovine isolate of e coli o157 : </O> <Gtype> H7 FRIK2000 lineage II </Gtype> 
isolate : <Gtype> bovine isolate of e coli o157 : </O> <Gtype> H7 FRIK966 lineage II </Gtype> 
isolate : <Gtype> clinical isolate </Gtype> e coli o157 : <Gtype> H7 lineage I </Gtype> 
isolation source : <Gtype> Mixed culture </Gtype> 
isolation source : <Gtype> Pure culture </Gtype> 
JO2057 ( <Gtype> WT ) </Gtype> 
JO2057 ( WT ) , Min Glucose , <Phase> exponential phase </Phase> 
JO2057 WT , Min Glucose , <Phase> exponential phase </Phase> 
JO2057 ( WT ) , Min Glucose , <Phase> stationary phase </Phase> 
JO2057 WT , Min Glucose , <Phase> stationary phase </Phase> 
JO2057 ( WT ) , Min Glycerol , <Phase> exponential phase </Phase> 
JO2057 WT , Min Glycerol , <Phase> exponential phase </Phase> 
JO2057 ( WT ) , Min Glycerol , <Phase> stationary phase </Phase> 
JO2057 WT , Min Glycerol , <Phase> stationary phase </Phase> 
JO2081 hupA , LB , <Phase> exponential phase </Phase> 
JO2081 hupA , LB , <Phase> stationary phase </Phase> 
JO2083 hupB , LB , <Phase> exponential phase </Phase> 
JO2083 hupB , LB , <Phase> stationary phase </Phase> 
JO3020 ( hupAB ) , Min Glucose , <Phase> exponential phase </Phase> 
JO3020 hupAB , Min Glucose , <Phase> exponential phase </Phase> 
JO3020 ( hupAB ) , Min Glucose , <Phase> stationary phase </Phase> 
JO3020 hupAB , Min Glucose , <Phase> stationary phase </Phase> 
JO3020 ( hupAB ) , Min Glycerol <Phase> exponential phase </Phase> 
JO3020 hupAB , Min Glycerol <Phase> exponential phase </Phase> 
JO3020 ( hupAB ) , Min Glycerol <Phase> stationary phase </Phase> 
JO3020 hupAB , Min Glycerol <Phase> stationary phase </Phase> 
K12 MG1655 with <Supp> 10 mM of heptanoic acid </Supp> 
K-12 strain _ <Gtype> wild type </Gtype> 
K-12 strain , <Gtype> wild type </Gtype> 
K12 strain MG1655 , 100 mcg/ml bicyclomycin 20 min , <Phase> exponential phase </Phase> 
K12 strain MG1655 , 10 mcg/ml bicyclomycin 20 min , <Phase> exponential phase </Phase> 
K12 strain MG1655 , 25 mcg/ml bicyclomycin 20 min , <Phase> exponential phase </Phase> 
K12 strain MG1655 , control sample <Temp> , <Phase> exponential phase </Phase> 
lactate _ growth : <Supp> MURI _ 085 </O> 
lactate _ growth : <Supp> MURI _ 086 </O> 
lactate _ growth : <Supp> MURI _ 087 </O> 
lactate _ growth : <Supp> MURI _ 088 </O> 
lactate _ growth : <Supp> MURI _ 089 </O> 
lactate _ growth : <Supp> MURI _ 090 </O> 
lacZ _ <Supp> 0 min </Supp> 
LB-grown overnight cultures were pelleted by centrifugation , washed , and resuspended in M9-glutamine of M9-alanine media . Cultures were shaken at <Agit> 250 rpm </Agit> at 37C . Samples were taken in mid-exponential phase ( OD600 = 0.15 for glutamine and OD600 = 0.2 for alanine on an Ultraspec 3100 pro ) after ~ 5 generations of growth in the media . 
LB medium , 180 rpm shaking , at <Temp> 37 °C </Temp> , between exponential and <Phase> stationary phase </Phase> 
LB medium , <Temp> 37 °C </Temp> , airated , constant pH 7.5 
LBTMP50 _ <Supp> 120 min </Supp> 
Library construction was based on the method described by Rhee et al. ( doi : <Gtype> 10.1016 / j.cell .2011.11.013 </Gtype> ) . 
Library construction was performed as described in Oh et al. 2011 , Cell 147 ( 6 ) : <Gtype> 1295-1308 ( PMCID : PMC3277850 </Gtype> ) . Briefly , fragments of total mRNA or ribosome protected mRNA fragments were size selected via gel purification , and ligated to a 5 ' adenylated DNA oligo . After reverse transcription , the single stranded DNA was circularized and amplified by PCR . 
Library construction was performed as described in Parkhomchuk et al. 2009 , Nucleic Acids Res 37 : <Supp> e123 . Briefly , ribosome-depleted RNA was fragmented and used as template for cDNA synhtesis . dUTP was included in the second strand synthesis reaction in addition to dTTP to chemically mark the second strand . cDNAs were size-selected and ligated to sequencing adapters followed by dUTP cleavage to generate adapter-ligated single-stranded cDNAs . </O> 
Library preparation was performed by vertis Biotechnologie AG , according to the following protocol : <Gtype> RNA samples were first treated with rDNase . From the total RNA samples , ribosomal RNA molecules were depleted using the Ribo-Zero rRNA Removal Kit ( Bacteria , Epicentre ) . the rRNA depleted RNA samples were fragmented with ultrasound ( 2 pulses of </O> <Supp> 30 sec </Supp> at 4 °C ) . Firststrand cDNA synthesis was primed with a N6 randomized primer . Then , Illumina TruSeq sequencing adapters were ligated to the 5 ' and 3 ' ends of the cDNA . The cDNA was finally amplified with PCR ( 16-18 cycles , depending on sample ) using a proof reading enzyme . Aliquots of each library were analyzed by capillary electrophoresis . 
Library preparation was performed by vertis Biotechnologie AG , according to the following protocol : the DNA samples were treated with ultrasound ( 3-5 pulses of <Supp> 30 sec </Supp> at 4 °C ) . After end-repair , TruSeq sequencing adapters were ligated to the DNA fragments . Finally , the DNA was PCR-amplified to about 20-30 ng/μl using a high fidelity DNA polymerase ( 9-11 cycles , depending on the <Temp> sample ) </Temp> . Aliquots of the PCR amplified libraries were examined by capillary electrophoresis . 
library strategy : 3 ' - <Technique> end RNA-seq </Technique> 
library strategy : <Gtype> Ribosome profiling </O> 
library strategy : <Gtype> Selective ribosome profiling </O> 
library strategy : <Technique> ChIP-seq ( ChIP-exo </Technique> ) 
LOWESS normalized data obtained from log2 of processed Red signal ( treated ) / processed Green signal ( control ) are given in the data table below . All microarray data were analyzed using R software and Limma package ( part of Bioconductor ) . All the probes encoding for positive and negative controls were not used and have been removed . Only raw data superior to background values and with homogeneous fluorescent signals were considered ( H < 0.2 ) . Red and green signal heterogeneity was estimated as followed : <Gtype> H =  </Gtype> ( trimmed mean of raw intensity - median of raw intensity )  /  ( 0.5 * ( trimmed mean of raw intensity + median of raw intensity ) ) . After LOWESS normalization , the differences between the four heat-treatments were tested by Analysis of Variance ( ANOVA ) followed by a priori tests ( P-value < 0.0001 and P-value FDR after Benjamini Yekutieli adjustment < 0.01 ) . Six contrasts ( Contrast1 : T1 vs T2 , Contrast2 : T1 vs T3 , Contrast3 : T1 vs T4 , Contrast4 : T2 vs T3 , Contrast5 : T2 vs T4 , Contrast6 : T3 vs T4 ) were performed . Normalized Log2 ratio between treatments and the results of the statistical analysis have been linked as a supplementary file on the Series record . 
Lrp _ <Supp> Leu _ 1 </O> 
Lrp _ <Supp> Leu _ 2 </O> 
Lrp _ <Supp> Leu _ 3 </O> 
lrp - + <Supp> Leu vs. lrp - - Leu </O> 
lrp - + <Supp> Leu vs. wt - Leu </O> 
Lrp _ <Supp> NH4Cl _ 1 </O> 
Lrp _ <Supp> NH4Cl _ 2 </O> 
Lrp _ <Supp> NH4Cl _ 3 </O> 
luxS mutants , <Supp> 30 % H2O2 </Supp> 
Lysates were diluted with 1 ml of TES buffer and 100 μl of ANTI-FLAG ® M2 affinity gel ( Sigma-Aldrich ) was added . Immunoprecipitation was performed for <Supp> 1.5-2 hours </Supp> at room temperature with moderate mixing , then affinity gel was washed 4 times by repeating steps of centrifugation ( 1.5 minute , 1000xg at room temperature ) and resuspention ( x2 with 1 ml of TESS buffer , x1 with 1 ml of TES buffer , x1 with 1 ml of TE buffer ) . 
M9 defined medium ( 0.6 % Na2HPO4 , 0.3 % KH2PO4 , 0.05 % NaCl , 0.01 % NH4Cl , 0.1 mM CaCl2 , 1 mM MgSO4 , 5 x 10 − 4 % Thiamin ) supplemented with <Supp> 0.5 % glucose </Supp> and 0.1 % amino acids was used for RNA-seq experiments . 
M9 mineral medium containing ( D ) - xylose as the only carbon source ( 100 ml in 500 ml shake flasks ) was inoculated from exponentially growing wild-type cells or synthetic cells ( cultivated on xylose M9 medium ) to adjust an OD of ~ 0.1 . Cultures were incubated at <Temp> 37 °C </Temp> under shaking until OD reached ~ 1 . Then they were split into two 50 ml aliquots and further cultivated in 250 ml shake flasks in the presence or absence of 10 mM glycolaldehyde . After <Supp> 30 min </Supp> of incubation , 1 ml of the cell suspension was withdrawn and centrifuged at 1500 x g ( Eppendorf 5415D ) for 5 min . The supernatant was removed and the cell pellets were directly subject to RNA extraction . Experiment were repeated three times . 
M9TMP5 _ <Supp> 120 min </Supp> 
mapping : <Anti> bowtie ( Galaxy Version 1.1.2 ) ; 28 nt seed length , maximal two mismatches in the seed , a maximal threshold of 70 for the sum of the quality values at mismatched positions . </O> 
mapping of non-rRNA and tRNA reads to E. coli O104 : <Gtype> H4 chromosome and plasmids using READemption 0.3.7 and segemehl 0.2.0 </O> 
mapping of reads to E. coli O104 : <Gtype> H4 rRNAs and tRNAs using READemption 0.3.7 and segemehl 0.2.0 </O> 
MazF _ <Gtype> mRNA _ 5m _ rep1 </O> 
MazF _ <Gtype> mRNA _ 5m _ rep2 </O> 
MDS42 exponentially grown in <Med> the minimal medium </Med> 
MDS42 + <Supp> 20 ug/ml bicyclomycin 1 </Supp> 
MDS42 + <Supp> 20 ug/ml bicyclomycin </Supp> 
MDS42 + <Supp> 20 ug/ml bicyclomycin </Supp> 2 
<Med> 0 ' in minimal medium </Med> +0.2 % glu , 25 ug total RNA 
<Med> 0 ' minimal medium </Med> + 0.2 % glu , 25 ug total 
<Med> 15 ' in minimal medium </Med> +0.2 % glu , 25 ug total RNA 
<Med> 1A T0 </Med> 
<Med> 1-HT873-PA1 </Med>
<Med> 23A1 </Med>
<Med> 23B1 </Med>
<Med> 23C3 </Med>
<Med> 2-HT873-PA2 </Med>
<Med> 30 ' in minimal medium </Med> +0.2 % glu , 25 ug total RNA 
<Med> 39A1 </Med>
<Med> 39B1 </Med>
<Med> 39C1 </Med>
<Med> 3-HT873-PA3 </Med>
<Med> 5 ' in minimal medium </Med> +0.2 % glu , 25 ug total RNA 
<Med> 60 ' in minimal medium </Med> +0.2 % glu , 25 ug total RNA 
<Med> 7-HT874-PA1 </Med>
<Med> 8-HT874-PA2 </Med>
<Med> 9A T0 </Med> 
<Med> 9-HT874-PA3 </Med>
<Med> AT1 </Med>
<Med> ATCACG-D1 </Med>
<Med> ATCC2 </Med>
<Med> ATCC3 </Med>
<Med> Bacteria </Med>
<Med> BL21 ( DE3 ) , adhE mutant </Med> 
<Med> BL21 ( DE3 ) HPA 0mM </Med> 
<Med> BL21 ( DE3 ) HPA 3mM </Med> 
<Med> BL21 ( DE3 ) </Med> _ <Gtype> adhE mutant </Gtype> 
<Med> BL21 ( DE3 ) without heptanoic acid </Med> 
<Med> BL21 ( mu = 0.20 ) ( 1 ) </Med> 
<Med> BL21 ( mu = 0.20 ) ( 2 ) </Med> 
<Med> BL21 ( mu = 0.20 ) ( 3 ) </Med> 
<Med> BL21 ( mu = 0.20 ) ( 4 ) </Med> 
<Med> BL21 ( mu = 0.46 ) ( 1 ) </Med> 
<Med> BL21 ( mu = 0.46 ) ( 2 ) </Med> 
<Med> BL21 ( mu = 0.46 ) ( 3 ) </Med> 
<Med> BL21 ( mu = 0.46 ) ( 4 ) </Med> 
<Med> BL21/pOri1 ( mu = 0.20 ) ( 1 ) </Med> 
<Med> BL21/pOri1 ( mu = 0.20 ) ( 2 ) </Med> 
<Med> BL21/pOri1 ( mu = 0.20 ) ( 3 ) </Med> 
<Med> BL21/pOri1 ( mu = 0.20 ) ( 4 ) </Med> 
<Med> BL21/pOri1 ( mu = 0.39 ) ( 1 ) </Med> 
<Med> BL21/pOri1 ( mu = 0.39 ) ( 2 ) </Med> 
<Med> BL21/pOri1 ( mu = 0.39 ) ( 3 ) </Med> 
<Med> BL21/pOri1 ( mu = 0.39 ) ( 4 ) </Med> 
<Med> BL21/pOri2 ( mu = 0.20 ) ( 1 ) </Med> 
<Med> BL21/pOri2 ( mu = 0.20 ) ( 2 ) </Med> 
<Med> BL21/pOri2 ( mu = 0.20 ) ( 3 ) </Med> 
<Med> BL21/pOri2 ( mu = 0.20 ) ( 4 ) </Med> 
<Med> BL21/pOri2 ( mu = 0.29 ) ( 1 ) </Med> 
<Med> BL21/pOri2 ( mu = 0.29 ) ( 2 ) </Med> 
<Med> BL21/pOri2 ( mu = 0.29 ) ( 3 ) </Med> 
<Med> BL21/pOri2 ( mu = 0.29 ) ( 4 ) </Med> 
<Med> BW25113 </Med>
<Med> BZNT </Med>
<Med> C1 </Med>
<Med> C2 </Med>
<Med> CAR005 </Med>
<Med> CGATGT-D2 </Med>
<Med> control ( additional ) </Med> 
<Med> cpxA mutant in Gln media </Med> 
<Med> CSH50 control ( mock igG ) E-minimal medium </Med> replicate 1 
<Med> CSH50 control ( mock igG ) E-minimal medium </Med> replicate 2 
<Med> cysQ mutantin Ala media </Med> 
<Med> cysQ mutantin Gln media </Med> 
<Med> D1-AN4 </Med>
<Med> D1-AN5 </Med>
<Med> D1-AN6 </Med>
<Med> D3-AN16 </Med>
<Med> D3-AN17 </Med>
<Med> D3-AN18 </Med>
<Med> DL4899 </Med>
<Med> DL4900 </Med>
<Med> DL5215 </Med>
<Med> DL5322 </Med>
<Med> DL5324 </Med>
<Med> DL5326 </Med>
<Med> DL5328 </Med>
<Med> DL5330 </Med>
<Med> DMS-seq ( Total RNA ) </Med> 
<Med> dnaJ mutant in Gln media </Med> 
<Med> DNeasy ( Qiagen ) </Med> 
<Med> double mutant ( PPK1 and PPX ) </Med> 
<Med> E22 </Med>
<Med> E. coli Frag1 ( biological replicate 2 ) </Med> 
<Med> Ecoli ko-furgrown in MOPS </Med> , 10 minutes after 1 % isobutanol treatment 
<Med> EDL933 in RPMI medium </Med> 
<Med> EGS084 </Med>
<Med> EGS212 </Med>
<Med> EHEC in LB Experiment 2 -LSB- RIBO-Seq -RSB- </Med> 
<Med> EHEC in LB Experiment </Med> 1 -LSB- RIBO-Seq -RSB- 
<Med> EHEC in LB Experiment </Med> 1 <Technique> -LSB- RNA-Seq -RSB- </Technique> 
<Med> EHEC in LB Experiment </Med> 2 <Technique> -LSB- RNA-Seq -RSB- </Technique> 
<Med> EHEC </Med>
<Med> error-prone in vitro ( Mn2 + ) </Med> 
<Med> error-proof in vitro 2 ( GreAB/Mn2 + ) </Med> 
<Med> exopolyphosphatase ( PPX ) mutant </Med> 
<Med> Exponential cells ( DO600 = 0,4 ) </Med> 
<Med> F1 </Med>
<Med> F2 </Med>
<Med> fepA KO LB </Med> rep1 
<Med> fepA KO LB </Med> rep2 
<Med> G4H14 </Med>
<Med> GATC </Med>
<Med> gcvT mutant in Gln media </Med> 
<Med> GHA507 </Med>
<Med> graphics.off ( ) </Med> 
<Med> H2O2 </Med>
<Med> heat shock response in the minimal medium </Med> 
<Med> HP1 </Med>
<Med> HP2 </Med>
<Med> HP3 </Med>
<Med> HP4 </Med>
<Med> HT873-PA1 </Med>
<Med> HT873-PA2 </Med>
<Med> HT873-PA3 </Med>
<Med> HT875-PA1 </Med>
<Med> HT875-PA2 </Med>
<Med> HT875-PA3 </Med>
media : <Gtype> LB broth </O> 
Media : <Gtype> Minimal salts + </O> <Supp> 20 mM trimethylamine-N-oxide +2.5 mM sodium nitrite </Supp> 
Media : <Gtype> Minimal salts + </O> <Supp> 20 mM trimethylamine-N-oxide </Supp> 
media : <Gtype> Tryptone broth buffered to pH 7 supplemented with </O> <Supp> 22 mM glucose </Supp> 
media : <Med> Defined MOPS </Med> Rich + <Supp> 0.2 % Glucose </Supp> 
media : <Med> Defined MOPS Minimal + </Med> <Supp> 0.4 % Glycerol +0.5 % 2-DG </Supp> 
media : <Med> Defined MOPS Minimal + </Med> <Supp> 0.4 % Glycerol +0.5 % aMG </Supp> 
media : <Med> Defined MOPS Minimal + </Med> <Supp> 0.4 % Glycerol </Supp> 
media : <Med> Defined MOPS Rich + </Med> <Supp> 0.4 % Glycerol +0.5 % aMG </Supp> 
media : <Med> Defined MOPS Rich + </Med> <Supp> 0.4 % Glycerol </Supp> 
media : <Med> fully supplemented MOPS glucose media </Med> 
media : <Med> MOPS EZ Rich Defined Media </Med> 
media : MEM-HEPES supplemented with <Supp> 0.1 % Glucose </Supp> and 250nM Fe ( NO3 ) 2 
media : <Supp> LB + 0.5 % aMG </Supp> 
<Med> Irp mutant in Gln media </Med> 
medium : defined mineral medium with <Supp> 1 g/l glucose </Supp> 
medium : <Gtype> M9 medium supplemented with </O> <Supp> 0.2 % glucose </Supp> and 5 % LB 
medium : <Gtype> Neidhardt 's EZ Rich Defined Medium ( Teknova , USA ) </O> 
medium : <Gtype> SB broth </Gtype> 
medium : <Gtype> SynH _ Acids _ </O> <Gtype> Amides 
medium : <Gtype> SynH w/o osmoprotectants </Gtype> 
medium : <Gtype> SynH w/o osmoprotectants + </O> <Supp> LTs 
medium : <Supp> SynH + LTs </Supp> 
medium : <Supp> SynH _ </O> <Supp> LT 
<Med> JCB570 </Med>
<Med> JO2081 ( hupA ) </Med> 
<Med> JO2081 ( hupA ) , </Med> <Phase> exponential phase </Phase> 
<Med> JO2081 ( hupA ) , </Med> <Phase> stationary phase </Phase> 
<Med> JO2083 ( hupB ) </Med> 
<Med> JO2083 ( hupB ) , </Med> <Phase> exponential phase </Phase> 
<Med> JO2083 ( hupB ) , </Med> <Phase> stationary phase </Phase> 
<Med> JO3020 ( hupAB ) </Med> 
<Med> JQ004 ( rraA ) </Med> 
<Med> K100Q </Med>
<Med> K100R </Med>
<Med> KCN </Med>
<Med> LB 0.4 B1 TEX neg L1 GA </O> 
<Med> LB 0.4 B1 TEX pos L1 GA </O> 
<Med> LB 0.4 B2 TEX neg L1 HS1 </O> 
<Med> LB 0.4 B2 TEX neg L1 HS2 </O> 
<Med> LB 0.4 B2 TEX pos L1 HS1 </O> 
<Med> LB 0.4 B2 TEX pos L1 HS2 </O> 
<Med> LB 2.0 B1 TEX neg L1 GA </O> 
<Med> LB 2.0 B1 TEX neg L2 HS2 </O> 
<Med> LB 2.0 B1 TEX pos L1 GA </O> 
<Med> LB 2.0 B1 TEX pos L2 HS2 </O> 
<Med> LB 2.0 B2 TEX neg L1 HS1 </O> 
<Med> LB 2.0 B2 TEX neg L1 HS2 </O> 
<Med> LB 2.0 B2 TEX neg L2 HS2 </O> 
<Med> LB 2.0 B2 TEX pos L1 HS1 </O> 
<Med> LB 2.0 B2 TEX pos L1 HS2 </O> 
<Med> LB 2.0 B2 TEX pos L2 HS2 </O> 
<Med> LB ( 5 ml ) was inoculated by a frozen stock of WT or perC-mutant strain and incubated at </O> <Temp> 37 °C </Temp> with 225 rpm shaking . Flasks containing low-glucose DMEM were inoculated 1:100 with the overnight culture and incubated at <Temp> 37 °C </Temp> with 225 rpm shaking to mid-exponential phase ( OD600 0.3-0.5 ) . 
<Med> LB agar plates , </O> <Temp> 37 °C </Temp> for 18 h 
<Med> LB </Med>
<Med> LB media </Med> 
<Med> LB medium </Med> at 37ºC with 200rpm agitation . 
<Med> LB , </Med> <Temp> 37 °C </Temp> , 220 rpm , OD600 = 0.5 , 2.0 , 2.0 +6 h 
<Med> LB ( OD = 0.87 ) </Med> 
<Med> LBO </Med>
<Med> LC1 </Med>
<Med> LJ110 del pdhr LBo </Med> 
<Med> LP1 </Med>
<Med> LP2 </Med>
<Med> LP3 </Med>
<Med> LP4 </Med>
<Med> -LSB- E-MTAB-332 -RSB- H-NS early-exponential </Med> 
<Med> -LSB- E-MTAB-332 -RSB- H-NS </Med> <Phase> stationary 
<Med> -LSB- E-MTAB-332 -RSB- H-NS mid-exponential </Med> 
<Med> -LSB- E-MTAB-332 -RSB- H-NS transition-to-stationary </Med> 
<Med> M63 0.4 B1 TEX neg L1 GA </O> 
<Med> M63 0.4 B1 TEX pos L1 GA </O> 
<Med> M63 0.4 B2 TEX neg L1 HS1 </O> 
<Med> M63 0.4 B2 TEX neg L1 HS2 </O> 
<Med> M63 0.4 B2 TEX pos L1 HS1 </O> 
<Med> M63 0.4 B2 TEX pos L1 HS2 </O> 
<Med> M9 minimal complete media </Med> , cultures grown aerobically at 30 degrees C in a gyratory water bath shaking at <Agit> 240 rpm </Agit> 
<Med> MDS42 </Med>
<Med> ME0052 </Med>
<Med> ME0053 </Med>
<Med> ME0054 </Med>
<Med> ME0055 </Med>
<Med> mRNA-seq in rich defined media </Med> 
<Med> Mutant ( EP61 ) T0 RNA rep </Med> 1 
<Med> Mutant ( EP61 ) T0 RNA rep </Med> 2 
<Med> Mutant ( EP61 ) T0 RP rep </Med> 1 
<Med> Mutant ( EP61 ) T0 RP rep </Med> 2 
<Med> Mutant ( EP61 ) T1 RNA rep </Med> 1 
<Med> Mutant ( EP61 ) T1 RNA rep </Med> 2 
<Med> Mutant ( EP61 ) T1 RP rep </Med> 1 
<Med> Mutant ( EP61 ) T1 RP rep </Med> 2 
<Med> Mutant ( EP61 ) T2 RNA rep </Med> 1 
<Med> Mutant ( EP61 ) T2 RNA rep </Med> 2 
<Med> Mutant ( EP61 ) T2 RP rep </Med> 1 
<Med> Mutant ( EP61 ) T2 RP rep </Med> 2 
<Med> Mutant ( RL2325 </Med> <Technique> ) RNA-seq </Technique> 
<Med> MW30 ( rpoS ) </Med> 
<Med> N172-1 </Med>
<Med> N172-2 </Med>
<Med> N30-1 </Med>
<Med> N30-2 </Med>
<Med> N30-3 </Med>
<Med> N30-4 </Med>
<Med> N/A </Med>
<Med> NA </Med>
<Med> NFNT </Med>
<Med> OTHER </Med>
<Med> overnight in Luria-Bertani ( LB </Med> ) broth with continuous agitation 
<Med> overnight in Lurie-Bertani ( LB </Med> ) broth with continuous agitation 
<Med> P2-08 </Med>
<Med> P2-51 </Med>
<Med> P2-58 </Med>
<Med> P2-66 </Med>
<Med> P2-77 </Med>
<Med> P4XB2 Mutant ( 1992 ) in Arginine </Med> 
<Med> P4XB2 Mutant ( 1993 ) in Arginine </Med> 
<Med> P4XB2 Mutant ( 1994 ) in Arginine </Med> 
<Med> Parent LB </Med> rep1 
<Med> Parent LB </Med> rep2 
<Med> PEN205 </Med>
<Med> PF2-04 </Med>
<Med> PF2-08 </Med>
<Med> PF2-12 </Med>
<Med> phoU gene mutant ; minimal medium </Med> 
<Med> PPK1-PPX double mutant </Med> 
<Med> RNA was pelleted ( </Med> <Agit> 14,000 rpm </Agit> , 5 min , 4 °C ) and air dried before suspension in 80 µL RNAse free water ( Invitrogen ) and treatment with TURBO DNAse ( Ambion ) according to the manufacturer 's instructions . Briefly , 0.1 V of 10 X Turbo DNAse buffer ( Ambion ) was added to the RNA solution . 1 µL of TURBO DNAse was added to the solution , which was then incubated ( 30 min , <Temp> 37 °C </Temp> ) . Following incubation , 0.1 V of DNase Inactivation Reagent ( Ambion ) was added and then incubated ( 5 min , RT ) with occasional mixing . RNA was isolated and transferred into a fresh microfuge tube . RNA quality tested using the the Agilent RNA 6000 Nano Kit ( Agilent Technologies ) and quality analysed using the Agilent 2100 Bioanalyzer ( Agilent Technologies ) . 
<Med> rnpB SPET-seq ( in vitro ) </Med> 
<Med> Samples ( 200-ml ) of the above cultures for each strain were split into two aliquots ( each 100 ml ) , and the aliquots were then incubated at 30 °C or 42 °C for another 60 min . </O> 
<Med> Samples ( 30 ml ) were harvested directly into cold phenol ethanol ( 187 µl phenol , 3.56 ml ethanol ) to stabilize RNA , and total RNA was purified using Qiagen 's RNeasy Mini kit as recommended by suppliers . RNA was quantified using a BioPhotometer ( Eppendorf ) . </O> 
<Med> ScriptSeq v2 Complete Kit ( EpiCentre ) </Med> 
<Med> SF5 </Med>
<Med> Sigma70 LB </Med> 
<Med> SPET-seq ( Total RNA ) </Med> 
<Med> standard in vitro ( Mg2 + ) </Med> 
<Med> STEC EC472/01 , conditioned medium </Med> 
<Med> STEC EC472/01 , fresh medium </Med> 
<Med> STEC EH41 , conditioned medium </Med> 
<Med> STEC EH41 , fresh medium </Med> 
<Med> TG1/pBS ( Kan ) / pMMB277 2nd </Med> 
<Med> The conditioned medium </Med> ( C ) was the DMEM medium containing 10 % FBS without antibiotics recovered after 24 hrs incubation with differentiated Caco-2 cells . 400 µL of STEC culture were inoculated in 4 mL of C medium and incubated for 3 hrs at <Temp> 37 °C </Temp> . After this period the bacteria were recovered by centrifugation for 10 min at 5000 xg and the pellet was ressuspended in 600 µL of RNAprotect Bacteria Reagent ( Qiagen cat . no. 76506 , Valencia , CA ) for RNA extraction . 
<Med> The fresh medium </Med> ( F ) was the DMEM medium containing 10 % FBS without antibiotics . 400 µL of STEC culture were inoculated in 4 mL of F medium and incubated for 3 hrs at <Temp> 37 °C </Temp> . After this period the bacteria were recovered by centrifugation for 10 min at 5000 xg and the pellet was ressuspended in 600 µL of RNAprotect Bacteria Reagent ( Qiagen cat . no. 76506 , Valencia , CA ) for RNA extraction . 
<Med> time 7 ( OD = 1.7 ) </Med> 
<Med> time 8 ( OD = 2.7 ) </Med> 
<Med> TLM-15 </Med>
<Med> TLM-30 </Med>
<Med> TLM-45 </Med>
<Med> TLM-60 </Med>
<Med> TLM-90 </Med>
<Med> TTAGGC-D3 </Med>
<Med> V1 </Med>
<Med> VALUE = log2 ( Cy3 </Med> _ <Supp> signal/Cy5 _ signal ) = log2 ( SIGNAL _ </O> <Supp> GREEN/SIGNAL _ RED ) </O> 
<Med> VALUE = log2 ( Cy5 </Med> _ <Supp> signal/Cy3 _ signal ) = log2 ( SIGNAL _ </O> <Supp> RED/SIGNAL _ GREEN ) </O> 
<Med> W3110 ( KCTC 2223 ) </Med> 
<Med> \ W3110 wt in MOPS </Med> ( ile , val , thi ) at OD420 ~ 0.3 , 20 ug total ,10 ug pdN6 \ 
<Med> Wild-type ( MG1655 </Med> <Technique> ) RNA-seq </Technique> 
<Med> wildtype strain ; minimal medium </Med> 
<Med> WT-1 </Med>
<Med> WT-2 </Med>
<Med> WT-3 </Med>
<Med> WTA1 </Med>
<Med> WTB1 </Med>
<Med> WTC3 </Med>
<Med> WT ( K10 ) M9 0.2 % Glycerol 0.2 % Tryptone 40 mM Suc . at 30 C Mid Log </O> 
<Med> WT ( K10 ) M9 0.2 % Glycerol 0.2 % Tryptone 40 mM Succinate at 30 C Mid Log </O> 
<Med> WT ( K10 ) vs Eno - ( DF261 ) in M9 + 0.2 % Glycerol , 0.2 % Tryptone , 40 mM Suc . at 30 C Mid Log Trial A </O> 
<Med> WT ( K10 ) vs Eno - ( DF261 ) in M9 0.2 % Glycerol , 0.2 % Tryptone , 40 mM Suc . at 30 C Mid Log Trial B </O> 
<Med> WT ( K10 ) vs Eno - ( DF261 ) M9 + 0.2 % Glycerol , 0.2 % Tryptone , 40 mM Suc . at 30 C Mid Log Trial A1 </O> 
<Med> WT ( N3433 ) M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log </O> 
<Med> WT ( N3433 ) vs Pnp - ( YHC012 ) in M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log Trial A2 </O> 
<Med> WT ( N3433 ) vs Pnp - ( YHC012 ) in M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log Trial B2 </O> 
<Med> WT ( N3433 ) vs Pnp - ( YHC012 ) in M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log Trial C2 </O> 
<Med> WT ( N3433 ) vs RhlB - ( SU02 ) in M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log Trial A1 </O> 
<Med> WT ( N3433 ) vs RhlB - ( SU02 ) in M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log Trial A </O> 
<Med> WT ( N3433 ) vs RhlB - ( SU02 ) in M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log Trial B1 </O> 
<Med> WT ( N3433 ) vs RhlB - ( SU02 ) in M9 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log Trial B </O> 
<Med> WT ( N3433 ) vs RhlB - ( SU02 ) in M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log Trial C1 </O> 
<Med> WT ( N3433 ) vs RhlB - ( SU02 ) in M9 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log Trial C </O> 
<Med> WT ( SH3208 ) in M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log </O> 
<Med> WT ( SH3208 ) M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log </O> 
<Med> WT ( SH3208 ) vs N-RNaseE ( BZ453 ) </Med> in M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log 
<Med> WT ( SH3208 ) vs N-RNaseE ( BZ453 ) </Med> in M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log Trial A 
<Med> WT ( SH3208 ) vs N-RNaseE ( BZ453 ) </Med> in M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log Trial B 
<Med> WT ( SH3208 ) vs N-RNaseE ( BZ453 ) </Med> in M9 + 0.2 % Glycerol , 0.2 % Tryptone at 30 C Mid Log Trial C 
<Med> zi = ( Ri -- mean ( R ) ) / sd </Med> ( R ) , where zi is the z-score for each element , Ri is the log-ratio for each element , and sd ( R ) is the standard deviation of the log-ratio . With this criterion , the elements with a z-score > 2 standard deviations would be the significantly differentially expressed genes . 
metabolic response : <Anti> BL21 ( DE3 ) is very susceptible to heptanoic acid , because several acid resistance systems stay inactive under this stress condition </O> 
metabolic response : <Gtype> K12 MG1655 activates various acid resistance systems under heptanoic acid stress </O> 
MG1655 at <Supp> 30 Degrees </Supp> 
MG1655 exponentially grown in <Med> the minimal medium </Med> 
MG1655 pCA24N and MG1655 pCA24N-Mfd cells were grown to an OD560 of approximately 0.25 and treated with <Supp> 100 μM IPTG </Supp> for 1 hour . 
MG1655 _ plus _ <Supp> aMG _ 1 </O> 
MG1655 _ plus _ <Supp> aMG _ 2 </O> 
MG1655 _ plus _ <Supp> aMG _ 3 </O> 
MG1655 ( Repaired MCM 3416 ) in M9 + <Supp> 0.2 % Glucose </Supp> 
MG1655 ( Repaired MCM 3416 ) in M9 + <Supp> 0.2 % Glucose </Supp> 8 ' post rif 
MG1655 ( Repaired NCM 3416 ) in M9 + <Supp> 0.2 % Glucose </Supp> 
MG1655 ( Repaired NCM 3416 ) in M9 + <Supp> 0.2 % Glucose </Supp> 2 ' post rif 
MG1655 ( Repaired NCM 3416 ) in M9 + <Supp> 0.2 % Glucose </Supp> 4 ' post rif 
MG1655 ( Repaired NCM 3416 ) in M9 + <Supp> 0.2 % Glucose </Supp> 6 ' post rif 
MG1655 ( Repaired NCM 3416 ) in M9 + <Supp> 0.2 % Glucose </Supp> 8 ' post rif 
MG1655 rpoHp3 : <Gtype> : lacZ delta lacX74 </Gtype> 
MG1655 rpoHp3 : <Gtype> : lacZ delta lacX74 hfq1 : : omega ( Km ; BclI </Gtype> ) ( hfq - ) 
MG1655 rpoHp3 : <Gtype> : lacZ delta lacX74 hfq1 : : omega ( Km ; BclI </Gtype> ) ( hfq - ) / pLC245 ( vector carrying inducible Ptrc : <Gtype> : rpoE ) </Gtype> 
MG1655 rpoHp3 : <Gtype> : lacZ delta lacX74 hfq2 : : omega ( Km ; KpnI </Gtype> ) ( hfq + ) / pLC245 ( vector carrying inducible Ptrc : <Gtype> : rpoE ) </Gtype> 
MG1655 rpoHp3 : <Gtype> : lacZ delta lacX74 hfq2 : : omega ( Km ; KpnI </Gtype> ) ( hfq + ) / ptrc99A ( control vector ) 
MG1655 rpoHp3 : <Gtype> : lacZ delta lacX74 hfq2 : : omega ( Km ; KpnI </Gtype> ) ( hfq + <Supp> ) 
MG1655 rpoHp3 : <Gtype> : lacZ delta lacX74 nadB : : Tn10 drseA </Gtype> 
MG1655 rpoHp3 : <Gtype> : lacZ delta lacX74/pLC245 ( vector carrying inducible Ptrc : : rpoE ) </Gtype> 
MG1655 rpoHp3 : <Gtype> : lacZ delta lacX74/ptrc99A ( control vector ) </Gtype> 
MG1655 + <Supp> 20 ug/ml bicyclomycin 1 </Supp> 
MG1655 + <Supp> 20 ug/ml bicyclomycin </Supp> 
MG1655 + <Supp> 20 ug/ml bicyclomycin </Supp> 2 
MG1655 + <Supp> aMG _ 1 </O> 
MG1655 + <Supp> aMG _ 2 </O> 
MG1655 + <Supp> aMG _ 3 </O> 
MG1655 _ under _ minimal _ <Supp> N _ source _ rep1 </O> 
MG1655 _ under _ minimal _ <Supp> N _ source _ rep2 </O> 
MG1655 _ under _ <Supp> ColdShock _ rep1 </O> 
MG1655 _ under _ <Supp> ColdShock _ rep2 </O> 
Microarray analysis including pre-processing , normalisation anmd statistical analysis were performed using R ( R , 2007 ) version 2.6 and Bioconductor ( Gentleman et al. 2004 , Genome Biol . 5 : <Gtype> R80 ) version 2.1 as previously described by Morris et al. ( 2009 , Physiol . Genomics 39:28-37 ) . Propagating uncertainty in microarray analysis ( puma ) method was used to estimate fold changes and P-like values of differential gene expression analysis ( Pearson et al. 2009 , BMC Bioinformatics 10:211 ) . </O> 
Microarray data were processed using custom scripts written in R based on the finite hybridisation ( FH ) model ( Ono et al ( 2008 ) An improved physico-chemical model of hybridization on high-density oligonucleotide microarrays . Bioinformatics 24 : <Temp> 1278-1285 . ) and the thermodynamic model of non-specific binding ( NSB ) on short nucleotide microarrays ( Furusawa et al , 2009 ) . </O> 
Microcin B17 Rep 2 <Supp> + A-IP </Supp> 
Microcin _ IP _ Mu _ <Gtype> 10mkM _ 2 </O> 
Mid log _ cra KO _ <Med> glc minimal media </Med> _ <Air> aerobic 
Mid log _ cra KO _ <Med> glc minimal media </Med> + L-tryptophan _ <Air> aerobic 
Mid log _ <Gtype> wildtype _ </O> <Med> glc minimal media </Med> + adenine _ <Air> aerobic 
Mid log _ <Gtype> wildtype _ </O> <Med> glc minimal media </Med> _ aerobic rep1 
Mid log _ <Gtype> wildtype _ </O> <Med> glc minimal media </Med> _ aerobic rep2 
Mid log _ <Gtype> wildtype _ </O> <Med> glc minimal media </Med> _ aerobic rep3 
Mid log _ <Gtype> wildtype _ </O> <Med> glc minimal media </Med> _ <Air> anaerobic rep1 </O> 
Mid log _ <Gtype> wildtype _ </O> <Med> glc minimal media </Med> _ <Air> anaerobic rep2 </O> 
Mid log _ <Gtype> wildtype _ </O> <Med> glc minimal media </Med> _ <Air> anaerobic rep3 </Air> 
Mid log _ <Gtype> wildtype _ </O> <Med> glc minimal media </Med> + L-tryptophan _ <Air> aerobic 
Mid log _ mntR KO _ <Med> glc minimal media </Med> _ <Air> aerobic 
Mid log _ mntR KO _ <Med> glc minimal media </Med> _ <Air> anaerobic 
Mid log _ nac KO _ <Med> glc minimal media </Med> + adenine _ <Air> aerobic 
Mid log _ nac KO _ <Med> glc minimal media </Med> _ <Air> aerobic 
mMaple3 _ <Supp> 0 min </Supp> 
molecule subtype : <Gtype> DMS-modified mRNA </Gtype> 
molecule subtype : <Gtype> In vitro synthesized RNase P ( rnpB ) RNA </O> 
molecule subtype : <Gtype> ribosome-depeleted RNA </Gtype> 
molecule subtype : <Gtype> ribosome protected mRNA </Gtype> 
molecule subtype : <Gtype> Ribosome protected mRNA </Gtype> 
molecule subtype : <Gtype> rRNA-depleted total RNA </Gtype> 
molecule subtype : <Gtype> Total <Med> RNA ( Cytosolic fraction ) </Med> 
molecule subtype : <Gtype> total RNA </Gtype> 
molecule subtype : <Gtype> Total RNA </Gtype> 
molecule subtype : <Gtype> Total RNA ( Nucleoid fraction ) </Gtype> 
molecule subtype : <Gtype> total RNA , rRNA depleted </O> 
molecule subtype : <Med> total RNA ( ribosome-depleted ) </Med> 
morphology : <Anti> Reverted ( reverted back from a Filamented shape into a coli shape ) </O> 
morphology : <Anti> Transition ( from Coli into Filamented ) </O> 
mRNA-seq 8 hr after shift to 10 °C in <Gtype> ∆ cspABEG cells </Gtype> 
mRNA-seq at <Temp> 37 °C </Temp> in <Gtype> ∆ cspABCEG cells </Gtype> 
mRNA-seq at <Temp> 37 °C </Temp> in WT cells _ 1 
mRNA-seq at <Temp> 37 °C </Temp> in WT cells _ 2 
mrna synthesis : <Anti> in vitro MgCl2 </Anti> 
mrna synthesis : <Anti> in vitro MnCl2 </Anti> 
mrna synthesis : <Anti> in vivo </Anti> 
mrna synthesis : <Supp> in vitro MgCl2 + GreAB </Supp> 
mrna synthesis : <Supp> in vitro MnCl2 + GreAB </Supp> 
MT _ <Gtype> 12h _ rep1 </O> 
MT _ <Gtype> 12h _ rep2 </O> 
MT _ <Gtype> 24h _ rep1 </O> 
MT _ <Gtype> 24h _ rep2 </O> 
MT _ <Gtype> 48h _ rep1 </O> 
MT _ <Gtype> 48h _ rep2 </O> 
MT _ <Gtype> 6h _ rep1 </O> 
MT _ <Gtype> 6h _ rep2 </O> 
MutRep1 _ <Supp> 0 min </Supp> 
MutRep2 _ <Supp> 0 min </Supp> 
MW30 ( rpoS ) , LB , <Phase> exponential phase </Phase> 
MW30 rpoS , LB , <Phase> exponential phase </Phase> 
MW30 ( rpoS ) , LB , <Phase> stationary phase </Phase> 
MW30 rpoS , LB , <Phase> stationary phase </Phase> 
N3433 ( wt ) pRNG3 in LB at <Supp> 30 degrees </Supp> 
neo _ <Supp> 0 min </Supp> 
neo _ <Supp> 10 min </Supp> 
neo _ <Supp> 15 min </Supp> 
neo _ <Supp> 6 min </Supp> 
neo _ <Supp> 8 min </Supp> 
ngs platform : <Gtype> Illumina HiSeq </Gtype> 
ngs platform : <Gtype> Illumina MiSeq </Gtype> 
no inhibitor : <Gtype> equivalent volume of DMSO added </O> 
Non-treated , <Gtype> WT control at T0 , biological rep 1 </O> 
Non-treated , <Gtype> WT control at T0 , biological rep 2 </O> 
No treatment , just comparison of RNAs from <Gtype> wild type </Gtype> and mutant . 
nucleic _ acid _ extraction  ChIP was performed as previously described ( Grainger et al , 2004 ) with some modifications to the protdegree Col. Cells were grown aerobically at 37degree C to the desired OD600 and formaldehyde was added to a final concentration of 1 % . After 20 min of incubation , glycine was added to a final concentration of 0.5 M to quench the reaction and incubated for a further 5 min . Cross-linked cells were harvested by centrifugation and washed twice with ice-cold TBS ( pH 7.5 ) . Cells were resuspended in 1 ml of lysis buffer ( 10 mM Tris -LSB- pH 8.0 -RSB- , 20 % sucrose , 50 mM NaCl , 10 mM EDTA , 20 mg/ml lysozyme and 0.1 mg/ml RNase A ) and incubated at 37degree C for <Supp> 30 min </Supp> . Following lysis , 3 ml immunoprecipitation ( IP ) buffer ( 50 mM HEPES-KOH -LSB- pH 7.5 -RSB- , 150 mM NaCl , 1 mM EDTA , 1 % Triton X-100 , 0.1 % sodium deoxycholate , 0.1 % sodium dodecyl sulfate -LSB- SDS -RSB- and PMSF -LSB- final concentration 1 mM -RSB- ) was added and the lysate passed through a French pressure cell twice . 2 ml aliquots were removed and the DNA sheared to an average size of ~ 200 bp using a Bioruptor ( Diagenode ) with <Supp> 30 cycles of 30 sec on/off </Supp> at high setting . Insoluble cellular matter was removed by centrifugation for 10 min at 4degree C , and the supernatant was split into two 800 microl aliquots . The remaining 400 microl was kept to check the size of the DNA fragments . <br> <br> Each 800 microl aliquot was incubated with 20 microl Protein A/G UltraLink Resin ( Pierce ) on a rotary shaker for 45 min at room temperature to get rid of complexes binding to the resin non-specifically . The supernatant was then removed and incubated with either no antibody ( mdegree Ck-IP ) , FLAG mouse mondegree Clonal antibody ( Sigma-Aldrich ) or RNAP Beta subunit mouse mondegree Clonal ( Nedegree Clone ) and 30 microl Protein A/G UltraLink Resin , pre-incubated with 1mg/ml bovine serum albumin ( BSA ) in TBS , on a rotary shaker at 4degree C overnight ( FLAG antibody ) or at room temperature for 90 min ( RNAP Beta subunit antibody ) . Samples were washed once with IP buffer , twice with IP buffer + 500 mM NaCl , once with wash buffer ( 10 mM Tris -LSB- pH 8.0 -RSB- , 250 mM LiCl , 1 mM EDTA , 0.5 % Nonidet P-40 and 0.5 % sodium deoxycholate ) and once with TE ( pH 7.5 ) . Immunoprecipitated complexes were eluted in 100 microl elution buffer ( 10 mM Tris -LSB- pH 7.5 -RSB- , 10 mM EDTA and 1 % SDS ) at 65degree C for 20 min . 
NusG ChIP-chip in E. coli K-12 MG1655 HA3 : <Gtype> : nusG </Gtype> cells ( Dataset 62261 ) 
NusG ChIP-chip in E. coli K-12 MG1655 HA3 : <Gtype> : nusG </Gtype> cells ( Dataset 62263 ) 
NusG ChIP in E. coli K-12 MG1655 HA3 : <Gtype> : nusG cells </Gtype> 
O157 : <Gtype> H7 EDL933 sdhA </Gtype> in LB 
O157 : <Gtype> H7 EDL933 sdhA </Gtype> in LB with <Supp> FA 
O157 : <Gtype> H7 EDL933 sdhA </Gtype> in <Med> LB 
O157 : <Gtype> H7 strain EDL933 , 100 mcg/ml bicyclomycin 20 min , </O> <Phase> exponential phase </Phase> 
O157 : <Gtype> H7 strain EDL933 , control </Gtype> <Temp> sample , </Temp> <Phase> exponential phase </Phase> 
O157 : H7 cells were grown to <Phase> mid-log phase </Phase> in Luria broth with or without 0.8 % bile salts . 
O157 : <Med> H7 EDL933 in LB </Med> 
O55 : <Supp> H6 ICC219 replicate 1 </Supp> 
O55 : <Supp> H6 ICC219 replicate 2 </Supp> 
O55 : <Supp> H6 ICC221 replicate 1 </Supp> 
O55 : <Supp> H6 ICC221 replicate 2 </Supp> 
O55 : <Supp> H6 ICC222 replicate 1 </Supp> 
O55 : <Supp> H6 ICC222 replicate 2 </Supp> 
O55 : <Supp> H7 st58 replicate 1 </Supp> 
O55 : <Supp> H7 st58 replicate 2 </Supp> 
O55 : <Supp> H7 st957 replicate 1 </Supp> 
O55 : <Supp> H7 st957 replicate 2 </Supp> 
O55 : <Supp> H7 TB182A replicate 1 </Supp> 
O55 : <Supp> H7 TB182A replicate 2 </Supp> 
O55 : <Supp> H7 WC211 replicate 1 </Supp> 
O55 : <Supp> H7 WC211 replicate 2 </Supp> 
O55 : <Supp> H7 WC416 replicate 1 </Supp> 
O55 : <Supp> H7 WC416 replicate 2 </Supp> 
<OD> 11K .60 </OD> 
<OD> 23S </OD>
<OD> 32D </OD>
<OD> 33D </OD>
<OD> 35B </OD>
OD600 15 units of cells were harvested for each ChIP procedure . Cells were harvested by centrifugation at 4,000 rpm for 8 min at room temperature and resuspended in 50 ml <Med> of pre-warmed PBS ( </Med> <Temp> 37 °C </Temp> ) in a 250 ml flask . DNA-protein and protein-protein interactions were cross-linked by adding 1,351 µl of formaldehyde drop-wise to a final concentration of 1 % . Samples were cross-linked at room temperature with stirring for <Supp> 30 min </Supp> . Glycine was added to a final concentration of 0.125 M with stirring for 5 min at room temperature . Cells were centrifuged at 4,000 rpm for 8 min at 4 °C and the supernatant removed . The pellet was re-suspended in 0.6 ml of lysis buffer containing 50 mM Tris-HCl , 10 mM EDTA , 1 % SDS and incubated on ice for 10 min . 1.4 ml of IP dilution buffer ( 20 mM Tris-HCl pH 8.1 , 150 mM NaCl , 2 mM EDTA , 1 % Triton X-100 , 0.01 % SDS , Roche protease inhibitor cocktail ) was added and the chromatin was sonicated on ice in a 5 ml tube to reduce the DNA length to an average size of approximately 500 bp using the Sanyo/MES Soniprep sonicator ( 8 bursts at an amplitude 10 microns for 30 seconds , with 1 minute cooling between bursts ) . This was transferred to a 2 ml microfuge tube and spun at 13,200 rpm for 10 min at 4 °C . Supernatant was removed and 1 ml dilution buffer added.The chromatin material was precleared by adding 50 µl of normal rabbit immunoglobulin G ( IgG , 1 mg/ml , Millipore ) . Samples were incubated for 1 h at 4 °C on a rotating wheel . 100 µl of homogenous protein G-agarose ( Roche ) was added to the precleared chromatin and the samples were incubated for 3-5 h at 4 °C on a rotating wheel . Samples were centrifuged at 4,000 rpm for 2 min at 4 °C and this supernatant was used to set up immunoprecipitation reactions . 200 µl chromatin was removed and used as an input sample . Experimental immunoprecipitation were set up using 1,350 µl chromatin and 3.3 µg/µl of anti-FLAG antibody ( Sigma ) . Mock immunoprecipitation 1,350 µl chromatin and 10 µg of normal mouse IgG ( Millipore ) . Samples were incubated overnight on a rotating wheel at 4 °C . Samples were centrifuged at 13,000 rpm for 5 min at 4 °C and the supernatant was transferred to 2 ml microfuge tubes . 50 µl of protein G-agarose was added to each sample and incubated at 4 °C for 3 h . The samples were centrifuged at 7,500 rpm for 2 min at 4 °C to pellet the protein G-agarose beads . The supernatant was removed and the protein G-agarose beads were carefully washed . 91 For each wash , the wash buffer was added ; the samples were vortexed briefly and were centrifuged at 7,500 rpm for 2 min at 4 °C . The samples were left to stand on ice for 1 min before removing the supernatant . The washes were carried out in the following sequence : <Gtype> The beads were washed twice with 750 µl of cold IP wash buffer 1 containing 20 mM Tris-HCl ( pH 8.1 ) , 50 mM NaCl , 2mM EDTA , 1 % Triton X-100 , 0.1 % SDS . The beads were transferred to a 1.5 ml microfuge tube after the first wash . The beads were washed once with 750 µl of cold IP wash buffer 2 containing 10 mM Tris-HCl ( pH 8.1 ) , 250 mM LiCl , 1 mM EDTA , 1 % NP-40 , 1 % deoxycholic acid . The beads were washed twice with 750 µl of ice-cold TE buffer containing 10 mM Tris base ( pH 8 ) and 1 mM EDTA . DNA-protein-antibody complexes were eluted from the protein G-agarose beads by adding 225 µl of IP elution buffer containing 100 mM NaHCO3 and 1 % SDS . The beads were resuspended in IP elution buffer , briefly vortexed and centrifuged at 7,500 rpm for 2 min at room temperature . The supernatant was collected in fresh 1.5 ml microfuge tubes . The bead pellets in the original tubes were resuspended in 225 µl of IP elution buffer again and briefly vortexed and centrifuged at 7,500 rpm for 2 min . IP and input samples were thawed on ice . 0.1 µl of RNase A ( 10 mg/ml , ICN Biochemicals ) and 16 µl of 5 M NaCl ( to a final concentration of 0.3 M ) was added to the input sample . Similarly , 0.2 µl of RNase A and 27 µl of 5 M NaCl ( to a final concentration of 0.3 M ) was added to each IP sample . All samples including the input DNA were incubated at 65 °C for 6 h to reverse cross-links . 9 µl of Proteinase K ( 10 mg/ml , GibcoBRL ) was added to each sample and incubated overnight at 45 °C . 2 µl of yeast tRNA ( 5mg/ml , Invitrogen ) was added to each sample followed by 250 µl of phenol ( pH 8 , Sigma ) and 250 µl of chloroform . Samples were centrifuged at 13,000 rpm for 5 min at room temperature . The aqueous layer was collected in fresh 1.5 ml centrifuge tubes and 500 µl of chloroform was added . The samples were vortexed and centrifuged at 13,000 rpm for 5 min and room temperature . The aqueous layer was transferred to a 2 ml microfuge tube . 5 µg of glycogen ( 5 mg/ml , Roche ) , 1 µl of tRNA ( 5 mg/ml , Invitrogen ) and 50 µl of 3 M NaAc ( pH 5.2 ) was added to each sample and mixed well . The DNA was precipitated with 1,375 µl of 95 % ethanol and incubated at -80 °C for 1 h . The samples were centrifuged at 13,000 rpm for </O> <Supp> 20 min </Supp> at 4 °C . The DNA pellets were washed with 500 µl of ice-cold 70 % ethanol and centrifuged at 13,000 rpm for 5 min at 4 °C . The supernatant was removed and the samples were air-dried for 10-15 min . DNA pellets of IP samples were resuspended in 50 µl nuclease-free H2O . Input DNA samples were resuspended in 100 µl of nuclease-free H2O . Samples were incubated at <Temp> 37 °C </Temp> for 1 h. 
<OD> 81-4420 </OD>
<OD> 83-2315 </OD>
<OD> 86-1390 </OD>
<OD> 86-4220 </OD>
<OD> 87-4725 </OD>
<OD> 88-1861 </OD>
<OD> 88-4299 </OD>
<OD> 89-56-196 </OD>
<OD> 91-19-172 </OD>
OD : <Gtype> OD 0.1 </Gtype> 
<OD> Ratio of median </OD> 
of ( F _ <Supp> r-B _ r ) / ( F _ </O> <Supp> g-B _ g ) , where F _ r , B _ r , F _ g and B _ </O> <Gtype> g represent the median Cy5 ( red ) </Gtype> 
OmpR <Supp> NaCl 1 </O> 
OmpR <Supp> NaCl 2 </O> 
One conditions : <Air> 5 % </Air> ( v/v ) isooctane , 37 Ceilsus degree , 250rpm 
One set of fermentations were exposed to <Supp> 5 mM IPTG </Supp> and one set was not exposed to IPTG . Samples were taken 0 , 1 , and 4 hours post-synchronization ( Time S0 , S1 , and S4 ) . 
optA1 _ 0 _ <Gtype> Hx Rep2 </Gtype> 
optA1 _ 0 _ <Gtype> Hx Rep3 </Gtype> 
optA1 gpt strain w/o hypoxanthine <Supp> 30 min </Supp> at low dilution protocol 
optA1 strain w/o hypoxanthine <Supp> 30 min </Supp> at low dilution protocol 
origin of isolation : <Gtype> patient with hemolytic uremic syndrome ( HUS ) </O> 
OSU11 , histidine supplied <Supp> , 1 mM </Supp> 
OSU12-hisA , histidine supplied <Supp> , 1 mM </Supp> 
OSU12-hisB , histidine supplied <Supp> , 1 mM </Supp> 
OSU12-hisC , histidine supplied <Supp> , 1 mM </Supp> 
OSU12-hisD , histidine supplied <Supp> , 1 mM </Supp> 
OSU12-hisF , histidine supplied <Supp> , 1 mM </Supp> 
OSU12-hisG , histidine supplied <Supp> , 1 mM </Supp> 
OSU12-hisI , histidine supplied <Supp> , 1 mM </Supp> 
overexpression of arT ( pCA24N _ <Gtype> arT ) </Gtype> 
overexpression of dosP ( pCA24N _ <Gtype> dosP ) </Gtype> 
Overnight culture in LB medium was innoculated from a single colony . The overnight culture was diluted 1/200 into <Med> MOPS minimal medium </Med> ( Neidhardt , J. Bacteriol. , 1974 ) and incubated with shaking at 37 C until OD600 = 0.5 or OD600 = 0.3 . Total culture volume 10 ml . 
Overnight culture of E. coli BW25113 in LB was diluted in <Med> M9 minimal medium </Med> with supplements to OD600 = 0.02 and was incubated at 37 Ceilsus degree with shaking at 250rpm until its OD600 reached 0.1 . 
Overnight culture of E. coli W3110 in LB was diluted in <Med> M9 minimal medium </Med> with supplements to OD600 = 0.01 and was incubated at 37 Ceilsus degree witouth shaking until its OD600 reached 0.1 . 
Overnight cultures from isolated colonies were diluted in fresh medium to an initial OD600 ~ 0.03 and grown to exponential phase ( OD600 ~ 0.3 ) at 37ºC , with shaking at 200 rpm in <Med> Luria-Bertani ( LB ) medium </Med> supplemented with thymine ( 50 mg ml-1 ) . When required , antibiotics were present at the following concentrations : kanamycin , 50 mg ml-1 ; tetracycline , 20 mg ml-1 ; streptomycin/spectinomycin 20 µg ml-1 . 
Overnight cultures in M9 glucose were inoculated into 100 mL fresh M9 glucose to a final OD600 of 0.02 . The flasks were incubated at <Temp> 37 °C </Temp> with shaking at 200 rpm . Cells were collected by centrifugation at the early <Phase> exponential ( OD600 ~ 0.3 ) , mid-exponential ( OD600 ~ 0.8 ) , transition to stationary ( OD600 ~ 1.6 ) , stationary ( 16 hrs , OD600 ~ 2 ) , and late stationary ( 48 hrs , OD600 ~ 1.6 ) phases of growth . </O> 
Overnight cultures of bacteria were diluted 1:100 in fresh LB broth and grown to logarithmic phase at an <OD> OD600 of about 0.8 </OD> . 
Overnight cultures of E. coli MG1655 grown at <Temp> 37 °C </Temp> with shaking at 200 rpm were diluted 1:625 into 50 ml of LB broth ( Roth ) , and incubated at <Temp> 37 °C </Temp> with shaking at 200 rpm . 
Overnight cultures of ESBL7 from the original isolate , or isolates pre-exposed 20 times to CORM-2 or vehicle , were used to inoculate MS-medium , ( OD620 ) of 0.1 , followed by exposure to CORM-2 ( 250 µM ) or vehicle for <Supp> 30 min </Supp> at <Temp> 37 °C </Temp> . 
Overnight cultures of the dnaB-Ts single mutant ( strain 2429 ) and the dnaB-Ts ΔahpC double mutant ( strain 3780 ) were diluted 100-fold into fresh <Med> SB medium </Med> ( 3.2 % peptone , 2 % yeast extract and 1 % NaCl ) , and they were then grown at 30 °C to early-log phase ( OD600 = 0.15 ) . Next these log-phase cultures were diluted 20-fold into 200 ml pre-warmed , fresh SB medium , and they were grown at 30 °C for another 60 min . 
Overnight cultures were inoculated 1:100 into 20 ml <Med> of EZ Rich Defined Medium </Med> ( Neidhardt et al. , 1974 ) in 125 ml Erlenmeyer flasks and grown at 37oC and <Agit> 250 rpm </Agit> in a reciprocating water bath . 
oxic/anoxic : <Med> anoxic ( NO3 ) </Med> 
Oxidative stress 200 ug/ml of <Supp> 30 % </Supp> pre-warmed hydrogen peroxide ( Fluka ) was added to 150 ml <Med> constantly stirred ( </Med> <Agit> 330 rpm </Agit> ) cultures kept in 1000 ml flasks . Cold stress Cultures were transferred from 37oC into an ice cold water bath in order to lower the temperature , while stirring , to 16oC in less than 2 min , heat stress Cultures were transferred from 37oC to a 50oC water bath . While stirring , the temperature of each culture was raised to 45oC in less than 2 min . The constantly stirring ( 330rpm ) cultures were then transferred to a 45oC water bath to maintain this temperature glucose lactose shift Carbon source concentrations of 0.15 % lactose and 0.05 % glucose were used ( 150 ml culture in 1000 ml flasks , 330 rpm stirring ) . 
Oxo _ IN _ Mu _ <Gtype> 120mkM _ 1 </O> 
Oxo _ IN _ Mu _ <Gtype> 120mkM _ 2 </O> 
Oxo _ IN _ <Supp> 120mkM _ 3 </O> 
Oxo _ IP _ Mu _ <Gtype> 120mkM _ 1 </O> 
Oxo _ IP _ Mu _ <Gtype> 120mkM _ 2 </O> 
Oxolinic acid Rep 2 <Supp> + A-IP </Supp> 
oxygen down shift , <Supp> 20 min </Supp> 
oxygen _ down _ <Supp> 0 min </Supp> 
oxygen _ down _ <Supp> 12 min </Supp> 
oxygen _ down _ <Supp> 20 min </Supp> 
oxygen _ down _ <Supp> 28 min </Supp> 
oxygen _ down _ <Supp> 44 min </Supp> 
oxygen _ down _ <Supp> 4 min </Supp> 
oxygen _ down _ <Supp> 8 min </Supp> 
oxygen regime : <Anti> transfers in constant static conditions </O> 
oxygen regime : <Gtype> daily shift between shaking and static ( no shaking ) conditions </O> 
oxygen up shift , <Supp> 20 min </Supp> 
oxygen _ Up _ <Supp> 0 min </Supp> 
oxygen _ Up _ <Supp> 12 min </Supp> 
oxygen _ Up _ <Supp> 20 min </Supp> 
oxygen _ Up _ <Supp> 28 min </Supp> 
oxygen _ Up _ <Supp> 44 min </Supp> 
oxygen _ Up _ <Supp> 4 min </Supp> 
oxygen _ Up _ <Supp> 8 min </Supp> 
OxyR <Supp> PQ 1 </O> 
OxyR <Supp> PQ 2 </O> 
parental _ temperature _ <Gtype> Up _ </O> <Supp> 16 min </Supp> 
parental _ temperature _ <Gtype> Up _ </O> <Supp> 44 min </Supp> 
parental _ temperature _ Up _ <Supp> 0 min </Supp> 
Peak-calls were done using GPS within the GEMS software package ( v2 .3 ) adapted for <Technique> ChIP-exo data </O> 
<Phase> 0min-1 </Phase>
<Phase> 0min-2 </Phase>
<Phase> 0min-3 </Phase>
<Phase> 10-HT874-PS-60min1 </Phase>
<Phase> 11-HT874-PS-60min2 </Phase>
<Phase> 12-HT874-PS-60min3 </Phase>
<Phase> 2xOriT </Phase>
<Phase> 4-HT873-PS-60min1 </Phase>
<Phase> 5-HT873-PS-60min2 </Phase>
<Phase> 6-HT873-PS-60min3 </Phase>
<Phase> acetonitrile </Phase>
<Phase> Adenosine addition </Phase> 
phase : <Anti> early <Phase> stationary phase </Phase> 
<Phase> Archaea </Phase>
<Phase> Aspartate addition </Phase> 
<Phase> Bio1 1m </Phase> 
<Phase> Bio1 1y </Phase> 
<Phase> Bio2 1m </Phase> 
<Phase> Bio2 1y </Phase> 
<Phase> Bio3 1m </Phase> 
<Phase> Bio3 1y </Phase> 
<Phase> Bio4 1m </Phase> 
<Phase> Bio4 1y </Phase> 
<Phase> Bio-6 </Phase>
<Phase> Blood culture </Phase> 
<Phase> BW25113-pCA24N </Phase>
<Phase> Column purification </Phase> 
<Phase> CompA </Phase>
<Phase> CompB </Phase>
<Phase> control </Phase>
<Phase> control strain </Phase> 
<Phase> cpxA-ala-1 </Phase>
<Phase> cpxA-ala-2 </Phase>
<Phase> crp.ee.chipseq </Phase>
<Phase> crpfis.rep1.ee </Phase>
<Phase> crpfis.rep1.me </Phase>
<Phase> crpfis.rep2.ee </Phase>
<Phase> crpfis.rep2.me </Phase>
<Phase> crp.me.chipseq </Phase>
<Phase> crpmutant.fis.ee.chipseq </Phase>
<Phase> crpmutant.fis.me.chipseq </Phase>
<Phase> crp.rep1.ee </Phase>
<Phase> crp.rep1.me </Phase>
<Phase> crp.rep2.ee </Phase>
<Phase> crp.rep2.me </Phase>
<Phase> ctrl1 </Phase>
<Phase> ctrl2 </Phase>
<Phase> ctrl3 </Phase>
<Phase> cya.rep1.ee </Phase>
<Phase> cya.rep1.me </Phase>
<Phase> cya.rep2.ee </Phase>
<Phase> cya.rep2.me </Phase>
<Phase> cyc1 </Phase>
<Phase> cyc2 </Phase>
<Phase> cyc3 </Phase>
<Phase> cyc4 </Phase>
<Phase> cyd1 </Phase>
<Phase> cyd2 </Phase>
<Phase> cyd3 </Phase>
<Phase> cyd4 </Phase>
<Phase> cysQ-gln-1 </Phase>
<Phase> cysQ-gln-2 </Phase>
<Phase> Cysteine addition </Phase> 
<Phase> Cytidine addition </Phase> 
<Phase> D1-ae10 </Phase>
<Phase> D1-ae11 </Phase>
<Phase> D1-ae12 </Phase>
<Phase> D3-ae22 </Phase>
<Phase> D3-ae23 </Phase>
<Phase> D3-ae24 </Phase>
<Phase> dgk suppressor </Phase> <Temp> 2-1 Sample 37 </Temp> 
<Phase> DicF rep3 </Phase> 
<Phase> dnaJ-ala-1 </Phase>
<Phase> dnaJ-ala-2 </Phase>
<Phase> dnaJ-gln-1 </Phase>
<Phase> dnaJ-gln-2 </Phase>
<Phase> dpiAoverexpressor </Phase>
<Phase> E.coli-1x CORM2-rep1 </Phase> 
<Phase> E.coli-1x CORM2-rep2 </Phase> 
<Phase> E.coli-1x CORM2-rep3 </Phase> 
<Phase> E.coli-1x CORM2-rep4 </Phase> 
<Phase> E.coli-1x vehicle-rep1 </Phase> 
<Phase> E.coli-1x vehicle-rep2 </Phase> 
<Phase> E.coli-1x vehicle-rep3 </Phase> 
<Phase> E.coli-1x vehicle-rep4 </Phase> 
<Phase> E.coli-20x CORM2-rep1 </Phase> 
<Phase> E.coli-20x CORM2-rep2 </Phase> 
<Phase> E.coli-20x CORM2-rep3 </Phase> 
<Phase> E.coli-20x CORM2-rep4 </Phase> 
<Phase> E.coli-20x vehicle-rep1 </Phase> 
<Phase> E.coli-20x vehicle-rep2 </Phase> 
<Phase> E.coli-20x vehicle-rep3 </Phase> 
<Phase> E.coli-20x vehicle-rep4 </Phase> 
<Phase> E.coli ， </Phase> <Temp> 37 °C </Temp> ， 60 min 
<Phase> E.coli strain </Phase> <Substrain> MG1655 
<Phase> envzM1200 </Phase>
<Phase> envzM2400 </Phase>
<Phase> envzM3600 </Phase>
<Phase> envzM600 </Phase>
<Phase> envzM900 </Phase>
<Phase> Estradiol Treatment </Phase> 
<Phase> exponential culture </Phase> 
<Phase> exponential phase </Phase> 
<Phase> Exp-rpoS-rep1 </Phase>
<Phase> Exp-rpoS-Rep1 </Phase>
<Phase> Exp-rpoS-rep2 </Phase>
<Phase> Exp-rpoS-Rep2 </Phase>
<Phase> Exp-rpoS-rep3 </Phase>
<Phase> Exp-rpoS-Rep3 </Phase>
<Phase> Exp-WT-rep1 </Phase>
<Phase> Exp-WT-Rep1 </Phase>
<Phase> Exp-WT-rep2 </Phase>
<Phase> Exp-WT-Rep2 </Phase>
<Phase> Exp-WT-rep3 </Phase>
<Phase> Exp-WT-Rep3 </Phase>
<Phase> fis.ee.chipseq </Phase>
<Phase> fis.me.chipseq </Phase>
<Phase> fismutant.crp.ee.chipseq </Phase>
<Phase> fismutant.crp.me.chipseq </Phase>
<Phase> fis.rep1.ee </Phase>
<Phase> fis.rep2.ee </Phase>
<Phase> flhD-mucus-P1 </Phase>
<Phase> flhD-mucus-P2 </Phase>
<Phase> gcvT-ala-1 </Phase>
<Phase> gcvT-ala-2 </Phase>
<Phase> Glutamine addition </Phase> 
<Phase> Glycine addition </Phase> 
<Phase> GSH-sepharose 4b purification </Phase> 
<Phase> gss-1 </Phase>
<Phase> gss-2 </Phase>
<Phase> gss-3 </Phase>
phase : <Gtype> logarithmic phase </Gtype> 
<Phase> hfq-gln-1 </Phase>
<Phase> hfq-gln-2 </Phase>
<Phase> Hfq mut exp mRNA </Phase> 
<Phase> Histidine addition </Phase> 
<Phase> HT873-Con1 </Phase>
<Phase> HT873-Con2 </Phase>
<Phase> HT873-Con3 </Phase>
<Phase> HT875-Con1 </Phase>
<Phase> HT875-Con2 </Phase>
<Phase> HT875-Con3 </Phase>
<Phase> Hydrocortisone Treatment </Phase> 
<Phase> IA-co1 </Phase>
<Phase> IA-co2 </Phase>
<Phase> IE-co1 </Phase>
<Phase> IE-co2 </Phase>
<Phase> Isoleucine addition </Phase> 
<Phase> IspG1 </Phase>
<Phase> IspG1 strain </Phase> 
<Phase> KSL2000-Rne depletion </Phase> 
<Phase> KSL2000-RraA overexpression </Phase> 
<Phase> KSL2009-N-Rne depletion </Phase> 
<Phase> KSL2009-RraA overexpression </Phase> 
<Phase> LA-co1 </Phase>
<Phase> LA-co2 </Phase>
<Phase> Lactobacillus acidophilus </Phase> 
<Phase> LA-log </Phase>
<Phase> LA-log-tr </Phase>
<Phase> LE-co1 </Phase>
<Phase> LE-co2 </Phase>
<Phase> lrp-gln-1 </Phase>
<Phase> lrp-gln-2 </Phase>
<Phase> Lysine addition </Phase> 
<Phase> mg1655 </Phase>
<Phase> MG1655star-mucus-P1 </Phase>
<Phase> MG1655star-mucus-P2 </Phase>
<Phase> MMAcetat </Phase>
<Phase> MMPyruvat </Phase>
<Phase> mRNA </Phase>
<Phase> mRNA-seq MicL-S t0 </Phase> 
<Phase> mRNA-seq MicL-S t10 </Phase> 
<Phase> mRNA-seq MicL-S t20 </Phase> 
<Phase> mRNA-seq MicL-S t4 </Phase> 
<Phase> mRNA-seq MicL t0 </Phase> 
<Phase> mRNA-seq MicL t10 </Phase> 
<Phase> mRNA-seq MicL t20 </Phase> 
<Phase> mRNA-seq MicL t4 </Phase> 
<Phase> MukB deltamatP </Phase> <Temp> 22 °C </Temp> 
<Phase> MukBEQ deltamatP </Phase> <Temp> 22 °C </Temp> 
<Phase> None </Phase>
phase of growth : <Gtype> Late log phase OD 1.6 </Gtype> 
phase of growth : <Gtype> Log phase OD 0.1 </Gtype> 
phase of growth : <Gtype> Log phase OD 0.2 </Gtype> 
phase of growth : <Gtype> Log phase OD 0.3 </Gtype> 
phase of growth : <Gtype> Log phase OD 0.4 </Gtype> 
phase of growth : <Gtype> Log phase OD 0.8 </Gtype> 
phase of growth : <Gtype> Log phase OD 1.4 </Gtype> 
phase of growth : <Supp> 15 min </Supp> <Phase> post stationary </Phase> 
phase of growth : <Supp> 180 min </Supp> <Phase> post stationary </Phase> 
phase of growth : <Supp> 30 min </Supp> <Phase> post stationary </Phase> 
<Phase> pCA24N-hnsK57N biofilm </Phase> 
<Phase> pFlag-only control </Phase> 
<Phase> pgi-ala-1 </Phase>
<Phase> pgi-ala-2 </Phase>
<Phase> pgi mutantin Ala media </Phase> 
<Phase> pgi mutantin Gln media </Phase> 
<Phase> pGIT1 .3 </Phase> 
<Phase> pGIT1 </Phase>
<Phase> pGIT8 </Phase>
phase : <Phase> log phase </Phase> 
<Phase> Plasmid pool </Phase> 
<Phase> ppk suppressor </Phase> <Temp> 1-1 Sample 25 </Temp> 
<Phase> ppk suppressor </Phase> <Temp> 1-1 Sample 44 </Temp> 
<Phase> ppk suppressor </Phase> <Temp> 1-1 Sample 6 </Temp> 
<Phase> ppk suppressor </Phase> <Temp> 2-1 Sample 26 </Temp> 
<Phase> ppk suppressor </Phase> <Temp> 2-1 Sample 45 </Temp> 
<Phase> ppk suppressor </Phase> <Temp> 2-1 Sample 7 </Temp> 
<Phase> ppk suppressor </Phase> <Temp> 3-1 Sample 27 </Temp> 
<Phase> ppk suppressor </Phase> <Temp> 3-1 Sample 46 </Temp> 
<Phase> ppk suppressor </Phase> <Temp> 3-1 Sample 8 </Temp> 
<Phase> Progesterone Treatment </Phase> 
<Phase> RNAeasy </Phase>
<Phase> RNAsnap </Phase>
<Phase> RyhB-minus_cDNA_Aerobic_WIG.txt </Phase>
<Phase> RyhB-minus_cDNA_Anaerobic_WIG.txt </Phase>
<Phase> Sample </Phase>
<Phase> Serine addition </Phase> 
<Phase> Shigella boydii </Phase> 
<Phase> Shigella boydii serotype2 </Phase> 
<Phase> Shigella boydii serotype3 </Phase> 
<Phase> Shigella dysenteriae </Phase> 
<Phase> Shigella flexneri 1a </Phase> 
<Phase> Shigella flexneri 1b </Phase> 
<Phase> Shigella flexneri 4a </Phase> 
<Phase> Shigella flexneri 4b </Phase> 
<Phase> Shigella flexneri </Phase> 
<Phase> sp1 </Phase>
<Phase> sp2 </Phase>
<Phase> stationary culture </Phase> 
<Phase> stationary phase </Phase> 
<Phase> Stat-rpoS-rep1 </Phase>
<Phase> Stat-rpoS-Rep1 </Phase>
<Phase> Stat-rpoS-rep2 </Phase>
<Phase> Stat-rpoS-Rep2 </Phase>
<Phase> Stat-rpoS-rep3 </Phase>
<Phase> Stat-rpoS-Rep3 </Phase>
<Phase> Stat-WT-rep1 </Phase>
<Phase> Stat-WT-Rep1 </Phase>
<Phase> Stat-WT-rep2 </Phase>
<Phase> Stat-WT-Rep2 </Phase>
<Phase> Stat-WT-rep3 </Phase>
<Phase> Stat-WT-Rep3 </Phase>
<Phase> Threonine addition </Phase> 
<Phase> TLD-15-rep1 </Phase>
<Phase> TLD-15-rep2 </Phase>
<Phase> TLD-30-rep1 </Phase>
<Phase> TLD-30-rep2 </Phase>
<Phase> TLD-45-rep1 </Phase>
<Phase> TLD-45-rep2 </Phase>
<Phase> TLD-60-rep1 </Phase>
<Phase> TLD-60-rep2 </Phase>
<Phase> TLD-90-rep1 </Phase>
<Phase> TLD-90-rep2 </Phase>
<Phase> transition phase </Phase> 
<Phase> Transition phase sample </Phase> <Temp> 1 
<Phase> Transition phase sample </Phase> <Temp> 2 
<Phase> Transition phase sample </Phase> <Temp> 3 
<Phase> Transition phase sample </Phase> <Temp> 4 
<Phase> TruSeq </Phase>
<Phase> WT-glucose-Rep1 </Phase>
<Phase> WT-glucose-Rep2 </Phase>
<Phase> WT-mannose </Phase>
<Phase> WT-mucus-P1 </Phase>
<Phase> WT-mucus-P2 </Phase>
<Phase> wt.rep1.ee </Phase>
<Phase> wt.rep1.me </Phase>
<Phase> wt.rep2.ee </Phase>
<Phase> wt.rep2.me </Phase>
<Phase> zwf suppressor </Phase> <Temp> 1-1 Sample 22 </Temp> 
<Phase> zwf suppressor </Phase> <Temp> 1-1 Sample 41 </Temp> 
<Phase> zwf suppressor </Phase> <Temp> 1-2 Sample 23 </Temp> 
<Phase> zwf suppressor </Phase> <Temp> 1-2 Sample 42 </Temp> 
<Phase> ΔbolA </Phase>
<Phase> Δrac ΔnusG </Phase> 
phenotype : <Gtype> 0.6 % n-butanol tolerance </Gtype> 
phenotype : <Gtype> small improvement </Gtype> in methyl ketone production 
phenotype : <Med> Blue colony-color ( prion-containing ) </Med> 
phenotype : <Med> Pale colony-color ( prion-lacking ) </Med> 
phenotype : <Supp> 2 % n-butanol tolerance </Supp> 
phoA _ <Supp> 0 min </Supp> 
plasmid : <Gtype> Donor Library </Gtype> 
plasmid : <Gtype> empty vector </Gtype> 
plasmid : <Gtype> G181D NusA </Gtype> 
plasmid : <Gtype> G324D Rho mutant </Gtype> 
plasmid : <Gtype> N340S Rho mutant </Gtype> 
plasmid : <Gtype> pLCenvZM , pPCB ( mutation ) </Gtype> 
plasmid : <Gtype> pLCenvZ , pPCB ( wild type ) </Gtype> 
plasmid : <Gtype> R258C NusA </Gtype> 
plasmid : <Gtype> R258C NuSA </Gtype> 
plasmid : <Gtype> wild type NusA </Gtype> 
plasmid : <Gtype> WT Rho </Gtype> 
plasmid : <Med> Initial Recipient Library ( BWG ) </Med> 
plasmid : <Med> Initial Recipient Library ( BWY ) </Med> 
Plasmid pLCenvZ or pLCenvZM was co-transformed with pPCB into the competent cells of E. coli JW3367 and spread on LB agar plates containing Ampicillin ( 50 ng/μl ) and Chloramphenicol ( 170 ng/μl ) at <Temp> 37 °C </Temp> overnight . A single colony was diluted in 2.5 ml LB medium containing Ampicillin ( 50 ng/μl ) and Chloramphenicol ( 170 ng/μl ) and was shaken at 250 rpm and <Temp> 37 °C </Temp> overnight . 
plasmid source : <Gtype> Initial Recipient Library </Gtype> 
plasmid source : <Gtype> Post Selection Library </Gtype> 
platform _ id design : <Gtype> EcFS _ 1 </O> 
platform _ id design : <Gtype> EcFS _ 2 </O> 
platform _ id _ id design : <Gtype> EcFS _ 1 </O> 
platform _ id _ id design : <Gtype> EcFS _ 2 </O> 
platform _ id _ id design : <Gtype> EcFS _ 3 </O> 
Post-processing of the sequencing reads from RNA-seq experiments for each sample was performed using HudsonAlpha 's unique in-house RNA-seq data analysis pipeline . Briefly , quality control checks on raw sequence data for each sample were performed using FastQC ( Babraham Bioinformatics , Cambridge , UK ) . Data-analysis was performed using the CLC Genomics Workbench ( Version 7.5.1 , CLC Bio , Aarhus , Denmark ) . The reference genome Escherichia coli ( DH10B ) sequence was downloaded from the UCSC genome browser . For read mapping , the following parameters were used : <Gtype> mismatch cost = </Gtype> 2 , insertion and deletion cost = 3 , length fraction : 0.8 , similarity fraction = 0.8 , global alignment = no , auto-detect paired distances = yes . Samples were grouped and differential expression of genes was calculated on the basis of fold changes ( using the default cut-off ≥ ± 2.0 ) observed in comparisons between defined conditions . 
preprocessed RNA-Seq reads were mapped to the reference Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 </Gversion> ) by BWA toolkit version 0.5.9-r16 with the following options : bwa aln - q 20 
Protein DNA interactions were crosslinked for 10 min at 22.5 C with 1 % formaldehyde and quenched using glycine to a final concentration of <Supp> 0.5 M </Supp> 
protocol : <Gtype> late log phase , LB </O> 
protocol : <Gtype> late log phase , LB , </O> <Supp> 30 min </Supp> after butanol treatment 
protocol : <Gtype> small RNA DicF </Gtype> 
protocol : <Gtype> vector control </Gtype> 
protocol : M9 supplemented with <Supp> 0.6 M NaCl </Supp> 
purification : <Anti> Protein purified using GSH-sepharose 4b ( GE Life Sciences ) </O> 
PurR _ <Supp> Adenine _ 1 </O> 
PurR _ <Supp> Adenine _ 2 </O> 
PurR _ <Supp> glucose _ 1 </O> 
PurR _ <Supp> glucose _ 2 </O> 
qC : <Gtype> We checked the quality of </Gtype> the raw reads data for each sample using FastQC ( version 0.11.3 ) to identify features of the data that may indicate quality problems ( e.g. low quality scores , over-represented sequences , inappropriate GC content , etc. ) . 
Quantification of the scans were performed with ImaGene ( Version 6.0.1 ; BioDiscovery ; El Segundo , CA ; www.biodiscovery.com ) ; with the results presented in the associated text files . The normalized data VALUE was generated using LOWESS normalization with rank invariant selection , as implemented in lcDNA ( receptor.seas.ucla.edu/lcDNA ; Hyduke DR , Rohlin L , Kao KC , Liao JC . 2003 A software package for cDNA microarray data normalization and assessing confidence intervals . OMICS 7 ( 3 ) : <Temp> 227-234 . ) </O> 
R11 DH10BGFP _ <Supp> pLys _ 1 </O> 
R16 MG1655GFP _ <Supp> pLys _ M1 _ 1 </O> 
R19 MG1655GFP _ <Supp> Lux _ 1 </O> 
R26 MG1655GFP _ <Supp> Lux _ 1 </O> 
R27 MG1655GFP _ <Supp> pD864 _ </O> <Supp> LacZ _ 1 </O> 
R29 DH10BGFP _ <Supp> None _ 1 </O> 
R2 DH10BGFP _ <Supp> pLys _ M1 _ 1 </O> 
R3 DH10BGFP _ <Supp> pSB1C3 _ 1 </O> 
R6 DH10BGFP _ <Supp> pD864 _ </O> <Supp> LacZ _ 1 </O> 
Raw CEL files were analyzed using robust multi-array average for normalization and calculation of probe intensities . The processed probe signals derived from each microarray were averaged for both the <Gtype> wild type </Gtype> and deletion mutant strains . This was done using the GCRMA package ( version 2.13 ) from Bioconductor in R. 
Raw probe intensities ( . pair files three replicates for each growth condition with respectively 0 , 5.0 , 6.5 and <Supp> 8.5 µM of AgNO3 </Supp> in the medium ) was processed and analyzed with R computing environment using the affy and limma package of Bioconductor . Raw data were submitted to a RMA-base background correction -LSB- Irizarry et al , 2003 , Biostatistics 4 ( 2 ) : <Temp> 249-264 -RSB- </Temp> . After background correction , intra-replicate quantil normalization was performed for each growth condition . A set of probes in the background for which the ranks were roughly invariant across all the twelve arrays was selected . The median value of the invariant probeset intensities on each array was used as a scaling factor for normalization between growth conditions . 
Reads per kilobase of exon model per million mapped reads ( RPKM ) was used as a normalized metric to present the gene expression levels . ( Nature methods 2008 , 5 : <Gtype> 621-628 ) </Gtype> 
Reads were adapter removed and trimmed to 40Bp using trimmomatic 0.32 with parameters ILLUMINACLIP : <Gtype> / Trimmomatic-0.32 / adapters/TruSeq3-PE -2 </Gtype> . fa : <Gtype> 2:30:10 HEADCROP </Gtype> : 8 CROP : 40 SLIDINGWINDOW : 6:5 MINLEN : <Supp> 40 
Reads were aligned to GenBank ID <Gversion> U00096 .2 </Gversion> 
recA _ D _ <Supp> N0000 _ </O> <Phase> r1 
recA _ D _ <Supp> N0000 _ </O> <Phase> r2 
recA _ D _ <Supp> N0050 _ </O> <Phase> r1 
recA _ D _ <Supp> N0050 _ </O> <Phase> r2 
recA _ D _ <Supp> N1000 _ </O> <Phase> r1 
recA _ D _ <Supp> N1000 _ </O> <Phase> r2 
Recombinant , high cell density , Time 0 , <Supp> no IPTG </Supp> 
Recombinant , high cell density , Time 1 h , <Supp> 5 mM IPTG </Supp> 
Recombinant , high cell density , Time 1 h , <Supp> no IPTG </Supp> 
Recombinant , high cell density , Time 4 h , <Supp> no IPTG </Supp> 
Reduced genome strain MDS42 , 100 mcg/ml bicyclomycin 20 min , <Phase> exponential phase </Phase> 
Reduced genome strain MDS42 , control sample <Temp> , <Phase> exponential phase </Phase> 
Reduced genome strain MDS42 , deletion of nusA gene , <OD> OD600 = 0.3 </OD> 
referece : <Gtype> The three genomes contributing to the ORFs on the microarray . </O> 
Reference Design timecourse c _ <Gversion> t10 .2 </Gversion> 
Reference Design timecourse c _ <Gversion> t11 .2 </Gversion> 
Reference Design timecourse c _ <Gversion> t1 .2 </Gversion> 
Reference Design timecourse c _ <Gversion> t2 .2 </Gversion> 
Reference Design timecourse c _ <Gversion> t3 .2 </Gversion> 
Reference Design timecourse c _ <Gversion> t4 .2 </Gversion> 
Reference Design timecourse c _ <Gversion> t5 .2 </Gversion> 
Reference Design timecourse c _ <Gversion> t6 .2 </Gversion> 
Reference Design timecourse c _ <Gversion> t7 .2 </Gversion> 
Reference Design timecourse c _ <Gversion> t8 .2 </Gversion> 
Reference Design timecourse c _ <Gversion> t9 .2 </Gversion> 
reference genome : <Gversion> U00096 .2 </Gversion> 
reference : <Gtype> Input DNA </Gtype> 
reference : <Gtype> input Genomic DNA control </Gtype> 
replicates : <Gtype> WT replicate 1 / induced </O> 
replicates : <Gtype> WT replicate 2 / induced </O> 
replicates : <Supp> ORF1 replicate </Supp> 1 / induced 
replicates : <Supp> ORF1 replicate </Supp> 1 / not induced 
replicates : <Supp> ORF1 replicate </Supp> 2 / induced 
replicates : <Supp> ORF1 replicate </Supp> 2 / not induced 
replicates : <Supp> Svi3-3 replicate </Supp> 1 / induced 
replicates : <Supp> Svi3-3 replicate </Supp> 1 / not induced 
replicates : <Supp> Svi3-3 replicate </Supp> 2 / induced 
replicates : <Supp> Svi3-3 replicate </Supp> 2 / not induced 
reporter : <Gtype> CRE multi-hit </Gtype> 
reporter : <Gtype> CRE single-hit </Gtype> 
reporter : <Gtype> IFNB multi-hit </Gtype> 
reporter : <Gtype> IFNB single-hit </Gtype> 
Resulting reads were aligned to the published E. coli K-12 MG1655 genome ( <Gversion> U00096 .2 </Gversion> ) using the software package SOAP ( Li et al , 2009 ) , allowing no more than two mismatches ( Supplemental File ) . Reads aligning to repeated elements in the genome ( e.g. rRNA ) were removed from analysis . For reads that had no mapping locations for the first 36 bp , the 3-30 bp subsequences were used in the subsequent mapping to the reference genome . Reads that had unique mapping locations and did not match annotated rRNA genes were used for further analysis . For each gene , the tag density was estimated as the number of aligned sequencing tags divided by gene size in kb . Per-gene tag density was normalized using quantile normalization ( Supplemental Files ) . The tag density data were analyzed for statistically significant differential expression using BaySeq ( Hardcastle & Kelly , 2010 ) with a FDR of 0.01 , and genes were organized into operons using data from EcoCyc ( Keseler et al , 2011 ) . 
Resulting SAM files were processed with custom script ( SAM_to_coverage_and_N5E_N3E.py , github : <Gtype> https://github.com/sutormin94/Gyrase_Topo-seq ) , giving coverage depth of the genome and N3E values ( number of DNA fragments 3 ' - ends ) for every position </O> 
Ribosome profiling 8 hr after shift to 10 °C in <Gtype> ∆ cspABEG cells </Gtype> 
Ribosome profiling at <Temp> 37 °C </Temp> in <Gtype> ∆ cspABCEG cells </Gtype> 
Ribosome profiling at <Temp> 37 °C </Temp> in WT cells _ 1 
Ribosome profiling at <Temp> 37 °C </Temp> in WT cells _ 2 
Ribosome profiling <Supp> 30 min </Supp> after shift to 10 °C in WT cells 
Rifampicine Ciprofloxacin Rep 2 <Supp> + A-IP </Supp> 
RifCfx _ IP _ Mu _ <Supp> 122mkM _ </O> <Supp> 10mkM _ 1 </O> 
RifCfx _ IP _ Mu _ <Supp> 122mkM _ </O> <Supp> 10mkM _ 2 </O> 
RifCfx _ IP _ Mu _ <Supp> 122mkM _ </O> <Supp> 10mkM _ 3 </O> 
rip antibody : <Gtype> Monoclonal ANTI-FLAG ^ = AE </Gtype> M2 antibody produced in mouse , Sigma , F1804-200UG , SLBG5673V 
RMA with quartile normalization according to method of Irizarry et al , 2003 . The raw . cel files were processed in RMA using Bioconductor R package : <Gtype> affy Version : 1.8.1 Date : 2005-09-03 , </Gtype> with the option Filter.genes containing a subset of probesets corresponding to MG1655 genes and intergenic regions listed in the matrix data . Replicates were averaged for ratio calculations . 
RNA extracted from biofilm cells of E. coli K-12 <Gtype> wild type </Gtype> after 15 hours of growth at 37C in LB glu with <Supp> glasswool 
RNA extracted from biofilm cells of E. coli K-12 <Gtype> wild type </Gtype> after 24 hours of growth at 37C in LB glu with <Supp> glasswool 
RNA extracted from biofilm cells of E. coli K-12 <Gtype> wild type </Gtype> after 4 hours of growth at 37C in LB glu with glasswool . 
RNA extracted from biofilm cells of E. coli K-12 <Gtype> wild type </Gtype> after 4 hours of growth at 37C in LB with glasswool . 
RNA extracted from biofilm cells of <Gtype> BW25113 wild type </Gtype> after 24h of growth in LBglu with glass wool 
RNA extracted from biofilm cells of <Gtype> EHEC wild type </Gtype> after 7h of growth in LB and 0.1 % DMF with glass wool 
RNA extracted from biofilm cells of <Gtype> EHEC wild type </Gtype> after 7h of growth in LB and 1000 micro M 7-hydroxyindole with glass wool 
RNA extracted from biofilm cells of <Gtype> EHEC wild type </Gtype> after 7h of growth in LB and 250 micro M isatin with glass wool 
rna extracted from e. coli o157 : <Gtype> H7 EDL933 cells grown ( 7 hrs incubation ) in LB at 37ºC </O> 
rna extracted from e. coli o157 : <Gtype> H7 EDL933 cells grown ( 7 hrs incubation ) in LB at 37ºC with 0.05 mg/ml Phloretin </O> 
RNA extracted from e. coli o157 : <Gtype> H7 EDL933 cells grown ( 7 hrs incubation ) in LB at 37ºC with </O> <Supp> 0.1 mg/ml of IAAld </Supp> 
rna extracted from e. coli o157 : <Gtype> H7 EDL933 cells grown ( 7 hrs incubation ) in LB at 37ºC with </O> <Supp> 0.5 % honey </Supp> 
RNA extracted from e. coli o157 : <Gtype> H7 EDL933 cells grown ( 7 hrs incubation ) in LB at 37ºC with </O> <Supp> DMSO 
RNA extracted from free living cells of E. coli K-12 BW25113 <Gtype> wild type </Gtype> when growth to OD600 4.0 at 30ºC in <Med> LB 
RNA extracted from suspension cells of E. coli K-12 BW25113 <Gtype> wild type </Gtype> after OD600 = 0.5 of growth in LB at 37oC 
RNA extracted from suspension cells of E. coli K-12 BW25113/pCA24N ( empty vector ) after OD600 = 0.5 of growth , <Supp> then 2 mM IPTG </Supp> for 15 min short time in LB at 37oC 
RNA extracted from suspension cells of E. coli K-12 BW25113/pCA24N ( empty vector ) after OD600 = 0.5 of growth with <Supp> 2 mM IPTG </Supp> in LB at 37oC 
RNA extracted from suspension cells of E. coli K-12 BW25113/pCA24N-mqsR after OD600 = 0.5 of growth , <Supp> then 2 mM IPTG </Supp> for 15 min short time in LB at 37oC 
RNA extracted from suspension cells of E. coli K-12 BW25113/pCA24N-mqsR after OD600 = 0.5 of growth with <Supp> 2 mM IPTG </Supp> in LB at 37oC 
RNA extracted from suspension cells of <Gtype> EHEC wild type </Gtype> after 7 h of growth in LB and 0.1 % DMF with glass wool 
RNA from E. coli expressing synthetic protein DX for <Supp> 0.5 hours </Supp> 
RNA from E. coli expressing synthetic protein DX for <Supp> 1.5 hours </Supp> 
RNA from E. coli expressing synthetic protein DX for <Supp> 1 hours </Supp> 
RNA from E. coli expressing synthetic protein DX for <Supp> 2 hours </Supp> 
RNA from E. coli expressing synthetic protein DX for <Supp> 3.5 hours </Supp> 
RNA from E. coli expressing synthetic protein DX for <Supp> 4 hours </Supp> 
RNAP _ DdksA _ <Supp> SHX _ rep1 </O> 
RNAP _ DdksA _ <Supp> SHX _ rep2 </O> 
RNA-seq reads were mapped to the E. coli K-12 MG1655 genome ( GenBank ID <Gversion> U00096 .2 </Gversion> ) using short oligonucleotide alignment program ( SOAP ) 
RNA sequences were quality assessed and trimmed using FastQC version 0.10.1 ( www.bioinformatics.babraham.ac.uk/projects/fastqc/ ) . The identification of differentially expressed genes was performed using cufflinks version 2.0.2 to analyse the trimmed sequences as a time course . Briefly , trimmed reads were aligned to the E. coli MG1655 reference genome ( <Gversion> NC _ 000913 13-Feb-2011 </Gversion> ) using Tophat version 2.0.7 . Aligned reads were assembled for differential expression using cufflinks version and merged using cuffmerge with an ` assemblies ' file containing the transcript.gtf output files from culfflinks . Differential expression analysis was performed using the merged.gtf output file from cuffmerge . 
rna treatment : <Anti> no RNA treatment </Anti> 
rna treatment : <Gtype> rRNA depleted </Gtype> 
rna treatment : <Gtype> rRNA depleted ; Terminal Exonuclease </Gtype> 
RNA was extracted from two biological replicates ( 30 mL ) of each bacterial culture isolated at each time point . The 30 mL culture was aliquoted into three 15 mL tubes containing 5 mL of ice-cold EtOH/Phenol stop solution ( 5 % water-saturated phenol pH 4.2 -LSB- Invitrogen -RSB- in 100 % ethanol ) . Cells were collected by centrifugation ( 4,000 rpm , 5 min , 4 °C ) and the pellet suspended in 800 µL TE pH 8.0 supplemented with 0.5 mg/mL lysozyme . SDS ( 80 µL at 10 % ( w/v ) ) was added , samples mixed by inversion , and incubated ( 65 °C , 2 min ) , before the addition of <Supp> 88 µL 1 M </Supp> NaOAc ( pH 5.2 ) . Each sample was added to an equal volume ( 1mL ) of water-saturated phenol ( pH 4.2 , 65 °C ) and incubated ( 65 °C , 6 min ) . The solution was separated into layers by centrifugation ( 14,000 rpm , 10 min , 4 °C ) and the upper aqueous RNA containing layer removed and transferred into a fresh tube . RNA was cleaned by three extractions with phenol : <Gtype> CHCl3 : IAA </Gtype> ( 25:24:1 , pH 8.0 ) before being precipitated ( -80 °C , O/N ) following the addition of 1/10 volume of 3M NaOAc ( pH 5.2 ) and 2 volumes of ice cold 100 % EtOH . RNA was pelleted ( 14,000 rpm , 25 min , 4 °C ) , the supernatant removed and the pellet washed with 1 mL 75 % cold EtOH ( made with DEPC-treated water ) . 
RNA was extracted from two biological replicates ( 30 mL ) of each bacterial culture isolated at each time point . The 30 mL culture was aliquoted into three 15 mL tubes containing 5 mL of ice-cold EtOH/Phenol stop solution ( 5 % water-saturated phenol pH 4.2 -LSB- Invitrogen -RSB- in 100 % ethanol ) . Cells were collected by centrifugation ( 4,000 rpm , 5 min , 4 °C ) and the pellet suspended in 800 µL TE pH 8.0 supplemented with 0.5 mg/mL lysozyme . SDS ( 80 µL at 10 % ( w/v ) ) was added , samples mixed by inversion , and incubated ( 65 °C , 2 min ) , before the addition of <Supp> 88 µL 1 M </Supp> NaOAc ( pH 5.2 ) . Each sample was added to an equal volume ( 1mL ) of water-saturated phenol ( pH 4.2 , 65 °C ) and incubated ( 65 °C , 6 min ) . The solution was separated into layers by centrifugation ( 14,000 rpm , 10 min , 4 °C ) and the upper aqueous RNA containing layer removed and transferred into a fresh tube . RNA was cleaned by three extractions with phenol : <Gtype> CHCl3 : IAA </Gtype> ( 25:24:1 , pH 8.0 ) before being precipitated ( -80 °C , O/N ) following the addition of 1/10 volume of 3M NaOAc ( pH 5.2 ) and 2 volumes of ice cold 100 % EtOH . RNA was pelleted ( 14,000 rpm , 25 min , 4 °C ) , the supernatant removed and the pellet washed with 1 mL 75 % cold EtOH ( made with DEPC-treated water ) . RNA was pelleted ( 14,000 rpm , 5 min , 4 °C ) and air dried before suspension in 80 µL RNAse free water ( Invitrogen ) and treatment with TURBO DNAse ( Ambion ) according to the manufacturer 's instructions . Briefly , 0.1 V of 10 X Turbo DNAse buffer ( Ambion ) was added to the RNA solution . 1 µL of TURBO DNAse was added to the solution , which was then incubated ( 30 min , <Temp> 37 °C </Temp> ) . Following incubation , 0.1 V of DNase Inactivation Reagent ( Ambion ) was added and then incubated ( 5 min , RT ) with occasional mixing . RNA was isolated and transferred into a fresh microfuge tube . RNA quality tested using the the Agilent RNA 6000 Nano Kit ( Agilent Technologies ) and quality analysed using the Agilent 2100 Bioanalyzer ( Agilent Technologies ) . 
RNA was extracted using Trizol and chloroform in conjunction with Qiagen 's RNeasy Mini kit ( Qiagen , Valencia , CA ) following the A. Untergasser protocol ( http://www.molbi.de/protocols/rna_prep_comb_trizol_v1_0.htm ) with one modification : <Gtype> Phase Lock Gel </Gtype> tubes ( Eppendorf , Westbury , NY ) were used to better separate organic and aqueous phases after the addition of chloroform . DNA was digested with Ambion rDNAse I ( Life Technologies , Carlsbad , CA ) for <Supp> 30 min </Supp> at <Temp> 37 °C </Temp> . Total RNA was further cleaned using the RNeasy Mini kit and quality was assessed by the RNA ScreenTape Assay on the TapeStation 2200 ( Agilent Technologies , Santa Clara , CA ) . Samples with RIN values greater than 8.0 were treated with the Ambion MICROBExpress Bacterial mRNA Enrichment Kit ( Life Technologies , Carlsbad , CA ) and were used for library construction . 
RNA was isolated from samples using the RNeasy Mini Kit ( Qiagen ) . Prior to lysis all samples were incubated for <Supp> 30 min </Supp> on ice in RNA stop solution ( 0.1 % SDS , 1 % Acidic phenol , 19 % ethanol , ice cold ) . The lysis and digestion protocol was followed with two 50 μl ddH20 elutions . Each sample was treated with 2 μl of DNase ( Ambion , Austin , TX ) at <Temp> 37 °C </Temp> for <Supp> 30 min </Supp> . Samples were purified and concentrated using Microcon YM-30 columns ( Millipore , Billerica , MA ) , and the quantity and purity were determined using an ND-1000 spectrophotometer ( Nanodrop , Wilmington , DE ) . Samples were determined to be free of contaminating genomic DNA by absence of a band on a DNA electrophoresis gel after 30 rounds of PCR . 
RNA was isolated from the pellet of E. coli cells using a well-established , published protocol ( Kime et al. 2008 . In RNA Turnover in Bacteria , Archaea and Organelles , Vol 447 ( ed . LE Maquat , CM Arraiano ) , pp. 215 ) . The cell pellet of S. coelicolor was resuspended in Kirby mix ( Kieser et al. 2000 . Practical Streptomyces Genetics . The John Innes Foundation , Norwich . ) , 100 µL per 1 O.D. 600nm unit , and transferred to Lysing Matrix B tubes containing fine silica beads ( MP Biomedical ) . Tubes were then placed in a high-speed benchtop homogenizer ( Fastprep-24 , MP Biomedical ; set at 6.5 M/s ) . Cells were lysed by three cycles of homogenisation for 1 min with cooling between each cycle in an ice-water bath for 1 min . The lysates were extracted using an equal volume of acidic phenol : <Gtype> chloroform : isoamyl </Gtype> alcohol ( 50 : <Supp> 50 : 1 ) </Supp> and then chloroform : isoamyl alcohol ( 49 : 1 ) . Nucleic acid in the aqueous phase was precipitated by adding NaCl to 150 mM and 2.5 x volumes of 100 % -LSB- v/v -RSB- ethanol , chilling at -20 °C for 1 h , and then harvested by centrifugation ( 13,000 x g for <Supp> 30 min </Supp> at 4 °C ) . The nucleic acid pellet was washed twice with 700 µL of 70 % -LSB- v/v -RSB- ethanol , air dried for 5 min and resuspended in RNase-free water . Contaminating DNA was removed from both E. coli and S. coelicolor by incubating with DNase as described by the vendor ( Ambion ) and extracted with phenol : chloroform as described above . The concentration and integrity of RNA samples were determined using a NanoDropTM 1000 spectrophotometer ( Thermo Fisher Scientific ) and agarose gel electrophoresis ( Kime et al. 2008 ) , respectively . Samples were enriched for mRNA using MICROBExpress-Bacteria beads , as described by the manufacturer ( Ambion ) . 
RNA were isolated from <Gtype> wild type </Gtype> and mutants . Trizol extraction of total RNA was performed according to standard affymetrix labeling protocols . 
rnc - _ <pH> time2 .5 </pH> 
rnc - _ <pH> time7 .5 </pH> 
Roemerine _ <Supp> 0 min </Supp> _ <Phase> rep3 
Roemerine _ <Supp> 0 min </Supp> _ rep1 
Roemerine _ <Supp> 0 min </Supp> _ rep2 
Roemerine _ <Supp> 60 min </Supp> _ <Phase> rep3 
Roemerine _ <Supp> 60 min </Supp> _ rep1 
Roemerine _ <Supp> 60 min </Supp> _ rep2 
RpoB <Gtype> ∆ cra </Gtype> 1 
RpoB <Gtype> ∆ cra </Gtype> 2 
RpoB <Gtype> ∆ crp </Gtype> 1 
RpoB <Gtype> ∆ crp </Gtype> 2 
RpoB <Gtype> WT 1 </O> 
RpoB <Gtype> WT 2 </O> 
RpoB with <Supp> DPD 1 </O> <Technique> ( ChIP-exo ) </Technique> 
RpoB with <Supp> DPD 2 </O> <Technique> ( ChIP-exo ) </Technique> 
RpoB with <Supp> DPD and rifampicin </Supp> 1 <Technique> ( ChIP-exo ) </Technique> 
RpoB with <Supp> DPD and rifampicin </Supp> 2 <Technique> ( ChIP-exo ) </Technique> 
RpoB with <Supp> Fe 1 </O> <Technique> ( ChIP-exo ) </Technique> 
RpoB with <Supp> Fe 2 </O> <Technique> ( ChIP-exo ) </Technique> 
RpoB with <Supp> Fe and </O> <Supp> rifampicin 1 </O> <Technique> ( ChIP-exo ) </Technique> 
RpoB with <Supp> Fe and </O> <Supp> rifampicin 2 </O> <Technique> ( ChIP-exo ) </Technique> 
RpoE induced ( <Supp> 30 min ) </Supp> 
rpoN mutant grown to <Phase> transition phase </Phase> 
rpos level : <Supp> 0 % </Supp> 
rpos level : <Supp> 100 % </Supp> 
rpos level : <Supp> 26 % </Supp> 
rpoS _ <Supp> 180 min </Supp> _ rep1 
rraA deletion , <OD> OD600 = 0.3 </OD> 
rRNA depletion : <Gtype> Genomic DNA was removed with TURBO DNAse ( Ambion ) , and then total RNA was run over two MEGAClear columns ( Ambion ) to deplete tRNAs and 5S rRNA . In between the two column purifications , a second DNAse digestion was performed ( Baseline-ZERO Epicenter ) . 16S and 23S rRNA were depleted using MICROBExpress ( Ambion ) and custom depletion oligos ( Rey et.al . 2010 ; JBC ) . </O> 
rsdssrS _ <Gtype> LS _ 1 </O> 
rsdssrS _ <Gtype> LS _ 2 </O> 
rsd _ <Supp> EE _ 1 </O> 
rsd _ <Supp> EE _ 2 </O> 
rsd _ <Supp> ME _ 1 </O> 
rsd _ <Supp> ME _ 2 </O> 
rsd _ <Supp> TS _ 1 </O> 
rsd _ <Supp> TS _ 2 </O> 
R. sphaeroides was phototrophically grown to <Phase> mid-log phase </Phase> ( 100-150 kletts ) in <Med> Sistrom 's minimal medium </Med> ( Sistrom , W. 1960 . Journal of General Microbiology . 22:778-785 ) amended with 33.9 mM succinate . 
s70 _ DdksA _ <Supp> SHX _ rep1 </O> 
s70 _ DdksA _ <Supp> SHX _ rep2 </O> 
s70 _ <Gtype> wt _ SHX _ rep1 </O> 
s70 _ <Gtype> wt _ SHX _ rep2 </O> 
s70 _ <Gtype> wt _ untreated _ rep1 </O> 
s70 _ <Gtype> wt _ untreated _ rep2 </O> 
s70 _ <Supp> DdksA _ untreated _ rep1 </O> 
s70 _ <Supp> DdksA _ untreated _ rep2 </O> 
Sakai ( O157 : <Gtype> H7 ) </Gtype> 
sample : <Gtype> Biopile control </Gtype> 
sample port : <Gtype> PFR P1 </Gtype> 
sample port : <Gtype> PFR P3 </Gtype> 
sample port : <Gtype> PFR P5 </Gtype> 
Samples for microarray analyses were taken before ciprofloxacin treatment ( t0 ) and then at 1 hour post-treatment ( t1 ) . Cell concentration was adjusted to 109 cells/ml and cultures were treated with ciprofloxacin in Erlenmeyer flasks using 20 ml <Med> fresh LB </Med> . ~ 109 cells were taken at each timepoint as samples for RNA isolation . In order to stabilize RNA , RNA Bacteria Protect Reagent ( Qiagen ) was added to the samples according to the instructions of the manufacturer and then samples were stored overnight at -80 °C . Total RNA was isolated by using RNeasy Mini Kit ( Qiagen ) according to the manufacturer 's instructions . Sample concentration was estimated using the NanoDrop 1000 ( Thermoscientific ) spectrophotometer . 
Samples of ~ 7.2 ml bacterial culture were mixed with 0.8 ml stop solution , pelleted and total RNA was purified using RNeasy Mini Kit ( Qiagen ) . DNase treatment was done twice with RQ1 DNase ( Promega ) to remove genomic DNA . cDNA synthesis was done according to the GeneChip ® Expression Analysis Technical Manual of Affymetrix using M-MLV reverse transcriptase ( Promega ) , without DTT addition . 13 µl of EB buffer were used for elution of cDNA after its clean-up with the MiniElute CR purification Kit ( Qiagen ) . cDNA fragmentation was done in a 20-µl reaction containing 3.5 µg cDNA , 2 µl 10x One Phor-All buffer , 2 µl DNase I ( diluted to 0.2 U / µl , Amersham Pharmacia Biotech ) in nuclease-free water . After incubation for 4 min at <Temp> 37 °C </Temp> , DNase I was heat inactivated at 98 °C for 10 min . 
sample source : <Gtype> Fecal pellet from a mouse ( c57Bl6 ) colonized with 10-gut bacteria . Mouse was fed Harlan Teklad Diet TD .09049 </O> 
sample source : <Gtype> Fecal pellet from a mouse ( c57Bl6 ) colonized with 10-gut bacteria . Mouse was fed Harlan Teklad Diet TD .09050 </O> 
sample source : <Gtype> Fecal pellet from a mouse ( c57Bl6 ) colonized with 10-gut bacteria . Mouse was fed Harlan Teklad Diet TD .09051 </O> 
sample source : <Gtype> Fecal pellet from a mouse ( c57Bl6 ) colonized with 10-gut bacteria . Mouse was fed Harlan Teklad Diet TD .09052 </O> 
sample source : <Gtype> Fecal pellet from a mouse ( c57Bl6 ) colonized with 10-gut bacteria . Mouse was fed Harlan Teklad Diet TD .09053 </O> 
sample source : <Gtype> Fecal pellet from a mouse ( c57Bl6 ) colonized with 10-gut bacteria . Mouse was fed Harlan Teklad Diet TD .09054 </O> 
sample source : <Gtype> Fecal pellet from a mouse ( c57Bl6 ) colonized with 10-gut bacteria . Mouse was fed Harlan Teklad Diet TD .09055 </O> 
sample source : <Gtype> Fecal pellet from a mouse ( c57Bl6 ) colonized with 10-gut bacteria . Mouse was fed Harlan Teklad Diet TD .09056 </O> 
sample source : <Gtype> Fecal pellet from a mouse ( c57Bl6 ) colonized with 10-gut bacteria . Mouse was fed Harlan Teklad Diet TD .09057 </O> 
sample source : <Gtype> Fecal pellet from a mouse ( c57Bl6 ) colonized with 10-gut bacteria . Mouse was fed Harlan Teklad Diet TD .09058 </O> 
sample source : <Gtype> Fecal pellet from a mouse ( c57Bl6 ) colonized with 10-gut bacteria . Mouse was fed Harlan Teklad Diet TD .09059 </O> 
sample source : <Gtype> Fecal pellet from a mouse ( c57Bl6 ) colonized with 10-gut bacteria . Mouse was fed Harlan Teklad Diet TD .09620 </O> 
sample source : <Gtype> Fecal pellet from a mouse ( c57Bl6 ) colonized with 10-gut bacteria . Mouse was fed Harlan Teklad Diet TD .09621 </O> 
sample source : <Gtype> Fecal pellet from a mouse ( c57Bl6 ) colonized with 10-gut bacteria . Mouse was fed Harlan Teklad Diet TD .09622 </O> 
sample source : <Gtype> Fecal pellet from a mouse ( c57Bl6 ) colonized with 10-gut bacteria . Mouse was fed Harlan Teklad Diet TD .09623 </O> 
sample source : <Gtype> Fecal pellet from a mouse ( c57Bl6 ) colonized with 10-gut bacteria . Mouse was fed Harlan Teklad Diet TD .09624 </O> 
sample source : <Gtype> Fecal pellet from a mouse ( c57Bl6 ) colonized with 10-gut bacteria . Mouse was fed Harlan Teklad Diet TD .09625 </O> 
sample source : <Gtype> Fecal pellet from a mouse ( c57Bl6 ) colonized with 10-gut bacteria </O> 
sample source : <Gtype> Fecal pellet from a mouse ( c57Bl6 ) colonized with 8-gut bacteria </O> 
sample source : <Gtype> Fecal pellet from a mouse ( c57Bl6 ) colonized with 9-gut bacteria </O> 
Samples were aligned to the E. coli K 12 MG1655 reference sequence ( version NC000913 .2 ) , using BWA ( version 0.5 ) WITH - q 30 parameter for trimming of reads below PHRED quality score of <Supp> 30 . </Supp> 
samples were grown <Air> aerobically <Med> in rich media </Med> 
Samples were grown anaerobically in <Med> MOPS minimal media </Med> supplemented with casamino acids using glucose as the carbon source . 20mM nitrate was added to ( + NO ) cultures for inducing nitrosative stress . 
Samples were used for on-bead enzymatic reactions of the <Technique> ChIP-exo procedure and Illumina Tru-seq sequencing libraries were construction as described in Rhee and Pugh , 2012 </O> 
Second biological repeat <Temp> 37 °C </Temp> 
Separate E. coli colonies were picked from LB agar plates for each replicate . Overnight cultures ( 12-16 hrs ) were grown at <Temp> 37 °C </Temp> in M9 media supplemented with 0.1 % casamino acids , 0.4 % glycerol , 0.4 % glucose , 2 mM MgSO4 , and 0.1 mM CaCl2 . Overnight cultures were back diluted into fresh <Med> media and grown 3-4 hours to an </O> <OD> OD600 of ~ 0.35 </OD> at <Temp> 37 °C </Temp> in an orbital shaker at 200 RPM . Cultures were centrifuged , washed , and back diluted into media lacking glucose . After at least 30 minutes of recovery Para was induced by adding arabinose to 0.2 % . Cells were harvested by centrifuging 1 mL of culture for 1 minute at maximum speed on a benchtop centrifuge . Pellets were immediately flash frozen in lN2 . 
Sequenced reads were trimmed for adaptor sequence , and masked for low-complexity or low-quality sequence , then mapped to Escherichia coli str . <Strain> K-12 substr . MG1655 , complete genome using bowtie2 version 2.0.5 with default parameters . </O> 
Sequenced reads were trimmed for adaptor sequence using Cutadapt v. 1.8.3 , then mapped to E. coli K12 substr . W3110 whole genome from NCBI ( GenBank : <Gtype> AP009048 .1 </Gtype> ) using the RNA-seq aligner STAR v. 2.4.2 a. 
Sequenced reads were trimmed , the mapped to the Escherichia coli K-12 MG1655 genome ( <Gversion> U00096 .2 </Gversion> ) using SOAP . 
Sequence reads were aligned to the published E. coli K-12 MG1655 genome ( <Gversion> U00096 .2 </Gversion> ) using the software packages SOAP ( Li et al , 2009 ) and ELAND ( within the Illumina Genome Analyzer Pipeline Software ) , allowing at most two mismatches . Sequence reads with sequences that did not align to the genome , aligned to multiple locations on the genome , or contained more than two mismatches were discarded from further analysis ( < 10 % of reads ) ( Supplemental Files ) . For visualization the raw tag density at each position was calculated using QuEST ( Valouev et al , 2008 ) and normalized as tag density per million uniquely mapped reads . 
sequencing mode : <Supp> paired-end 2 * 150 nt protocol </O> 
Sequential Design timecourse t10 _ <Gversion> t11 .2 </Gversion> 
Sequential Design timecourse t1 _ <Gversion> t2 .2 </Gversion> 
Sequential Design timecourse t2 _ <Gversion> t3 .2 </Gversion> 
Sequential Design timecourse t3 _ <Gversion> t4 .2 </Gversion> 
Sequential Design timecourse t4 _ <Gversion> t5 .2 </Gversion> 
Sequential Design timecourse t5 _ <Gversion> t6 .2 </Gversion> 
Sequential Design timecourse t6 _ <Gversion> t7 .2 </Gversion> 
Sequential Design timecourse t7 _ <Gversion> t8 .2 </Gversion> 
Sequential Design timecourse t8 _ <Gversion> t9 .2 </Gversion> 
Sequential Design timecourse t9 _ <Gversion> t10 .2 </Gversion> 
serotype : <Gtype> o157 : H7 clade </Gtype> 2 , stx 2 
serotype : <Gtype> o157 : H7 clade </Gtype> 2 <Supp> , stx 1 and 2 </Supp> 
serotype : <Gtype> O157 : H7 </Gtype> 
serotype : <Gtype> o157 : H7 </Gtype> clade 8 , stx 2 
serotype : <Gtype> o157 : H7 </Gtype> clade 8 , stx 2 and 2c 
serovar O157 : <Gtype> H7 strain EDL933 ; GenBank accession NC </Gtype> _ <Technique> 002655.2 
Seven mililiter of phenol/water were added before incubating 10 min at 67 °C with occasional stirring . The samples were cooled on ice and spun 10 min at 5000 rpm at 4 °C . The aqueous phase was separated and extracted again once the same way and then once with phenol/chloroform ( v/v 1:1 ) . One tenth of the volume of 4M NaCl and 2.5 volumes of cold ethanol were then added to the aqueous phase . The tubes were left at -20 °C for two hours then spun at 8500rpm at 4 °C . The pellet was washed with 70 % ethanol , dried under vacuum and resuspened in 300 l sterile water and transferred to an eppendord tube . An amount of 34.5 l Qiagen RDD buffer and 9.37 l of RNase free DNase I ( Qiagen ) were added . After 15 min at room temperature , the tubes were mixed by inversion and deproteinized as shown above with 300 l phenol/H2O at room temperature . The RNA was then precipitated with 37.5 µl NaCl 4M and 823µl cold ethanol . <Supp> After 2 hours </Supp> at -20 °C , the tubes were centrifuged <Supp> 30 min </Supp> at 10,000 G at 4 °C , the pellets were then washed with 70 % ethanol then dried under vacuum and resuspended in 60µl sterile water . The RNAs were stored at -20 °C . 
Sig70 in E. coli , exponential aerobic growth , no <Supp> rifampicin applied replicate </Supp> 2 ( run 299 ) 
Sig70 in E. coli , exponential aerobic growth , no <Supp> rifampicin applied replicate </Supp> 2 ( run 423 ) 
Sig70 in E. coli , static aerobic growth , no <Supp> rifampicin applied replicate </Supp> 2 ( run 299 ) 
Signal intensities with all probes are shown in Sample data table . The ` expressed_present_probes.txt ( available on Series records ) contains Signal intensities with present probes . Average signal intensities from 3 experiments were used to calculate fold increases in gene expression between treated and control groups , with signal intensity of 39 used as a minimum intensity , using the formula : <Gtype> average intensity </Gtype> in treated group/average intensity in control group ( the ` Avg ' columns ) . Transformed Ln ( signal intensity ) values , shown in columns ` Ln ' , were used for direct statistical comparisons of expression signals between treated and control groups by t-test ( columns ` t-test ' ) . The probes in the expressed_present_probes.txt are arranged in descending order from the highest to the lowest ratio of gene induction in PGRP/control ( column ` Ratio ' in ` expressed_present_probes.txt ' ) . 
Single colonies of P. putida strain DOT-T1E and E. coli MG1655 were grown overnight in Luria -- <Med> Bertani ( LB ) medium </Med> at <Temp> 30 °C </Temp> . Overnight cultures were diluted to a starting OD600 of 0.01 in the same medium and 50 ml aliquots were disposed in separate 250 ml Erlenmeyer flasks and incubated with shaking at 200 rpm . When cultures reached exponential phase ( 0.5 at OD600 ) , antibiotics were added at sub-lethal concentrations to the culture medium to reach a final concentration of 1 µg/ml kanamycin , 300 µg/ml ampicillin , 150 µg/ml chloramphenicol , 4 µg/ml tetracycline , 0.5 µg/ml ciprofloxacin , 300 µg/ml spectinomycin , 500 µg/ml <Supp> rifampicin and </Supp> 2 µg/ml gentamicin . Then cultures were incubated under the same conditions for one hour more . Cells were harvested by centrifugation at 8000 g for 10 min and suspended immediately in stop solution ( 95 % ( v/v ) ethanol , 5 % ( v/v ) phenol ) and pelleted by centrifugation . After that , total RNA was extracted with Trizol ( Invitrogen ) . Removal of DNA was carried out by treatment with DNase I ( Fermentas ) in combination with the RNase inhibitor RiboLock ( Fermentas ) . The integrity and quality of total RNA was assessed with an Agilent 2100 Bioanalyzer ( Agilent Technologies ) . 
Single colonies were inoculated into 15x100 mm tubes containing 4 ml LB , and grown at 30ºC and <Agit> 250 rpm </Agit> overnight . 100 μl seed culture was inoculated into a 100 ml flask containing 10 ml LB medium , and grown at 30ºC and <Agit> 250 rpm </Agit> for 5 h. 
Slide 10 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 1 _ Cy3 0 Cy5 10 </O> 
Slide 10 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 1 _ Cy3 0 Cy5 5 </O> 
Slide 10 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 2 _ Cy3 0 Cy5 10 </O> 
Slide 10 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 2 _ Cy3 0 Cy5 20 </O> 
Slide 10 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 2 _ Cy3 0 Cy5 2.5 </O> 
Slide 10 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 2 _ Cy3 0 Cy5 40 </O> 
Slide 10 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 2 _ Cy3 0 Cy5 5 </O> 
Slide 10 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 2 _ Cy3 0 Cy5 80 </O> 
Slide 11 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 1 _ Cy3 20 Cy5 0 </O> 
Slide 11 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 1 _ Cy3 5 Cy5 0 </O> 
Slide 11 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 2 _ Cy3 10 Cy5 0 </O> 
Slide 11 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 2 _ Cy3 20 Cy5 0 </O> 
Slide 11 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 2 _ Cy3 2.5 Cy5 0 </O> 
Slide 11 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 2 _ Cy3 40 Cy5 0 </O> 
Slide 11 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 2 _ Cy3 5 Cy5 0 </O> 
Slide 11 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 2 _ Cy3 80 Cy5 0 </O> 
Slide 12 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 1 _ Cy3 0 Cy5 20 </O> 
Slide 12 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 1 _ Cy3 0 Cy5 2.5 </O> 
Slide 12 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 1 _ Cy3 0 Cy5 40 </O> 
Slide 12 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 1 _ Cy3 0 Cy5 80 </O> 
Slide 12 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 1 _ Cy3 10 Cy5 0 </O> 
Slide 12 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 1 _ Cy3 2.5 Cy5 0 </O> 
Slide 12 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 1 _ Cy3 40 Cy5 0 </O> 
Slide 12 _ <Air> Anaerobic culture _ CORM-3 _ biol rep 1 _ Cy3 80 Cy5 0 </O> 
Slide 13 _ <Gtype> Wild type </Gtype> _ <Supp> CORM-3 _ biol rep 1 _ Cy3 0 Cy5 120 </O> 
Slide 13 _ <Gtype> Wild type </Gtype> _ <Supp> CORM-3 _ biol rep 1 _ Cy3 10 Cy5 0 </O> 
Slide 13 _ <Gtype> Wild type </Gtype> _ <Supp> CORM-3 _ biol rep 1 _ Cy3 120 Cy5 0 </O> 
Slide 13 _ <Gtype> Wild type </Gtype> _ <Supp> CORM-3 _ biol rep 1 _ Cy3 20 Cy5 0 </O> 
Slide 13 _ <Gtype> Wild type </Gtype> _ <Supp> CORM-3 _ biol rep 1 _ Cy3 40 Cy5 0 </O> 
Slide 13 _ <Gtype> Wild type </Gtype> _ <Supp> CORM-3 _ biol rep 1 _ Cy3 60 Cy5 0 </O> 
Slide 13 _ <Gtype> Wild type </Gtype> _ <Supp> CORM-3 _ biol rep 2 _ Cy3 0 Cy5 10 </O> 
Slide 13 _ <Gtype> Wild type </Gtype> _ <Supp> CORM-3 _ biol rep 2 _ Cy3 0 Cy5 20 </O> 
Slide 14 _ <Gtype> Wild type </Gtype> _ <Supp> CORM-3 _ biol rep 2 _ Cy3 0 Cy5 120 </O> 
Slide 14 _ <Gtype> Wild type </Gtype> _ <Supp> CORM-3 _ biol rep 2 _ Cy3 0 Cy5 40 </O> 
Slide 14 _ <Gtype> Wild type </Gtype> _ <Supp> CORM-3 _ biol rep 2 _ Cy3 0 Cy5 60 </O> 
Slide 14 _ <Gtype> Wild type </Gtype> _ <Supp> CORM-3 _ biol rep 2 _ Cy3 10 Cy5 0 </O> 
Slide 14 _ <Gtype> Wild type </Gtype> _ <Supp> CORM-3 _ biol rep 2 _ Cy3 120 Cy5 0 </O> 
Slide 14 _ <Gtype> Wild type </Gtype> _ <Supp> CORM-3 _ biol rep 2 _ Cy3 20 Cy5 0 </O> 
Slide 14 _ <Gtype> Wild type </Gtype> _ <Supp> CORM-3 _ biol rep 2 _ Cy3 40 Cy5 0 </O> 
Slide 14 _ <Gtype> Wild type </Gtype> _ <Supp> CORM-3 _ biol rep 2 _ Cy3 60 Cy5 0 </O> 
Slide 15 _ <Gtype> Wild type </Gtype> _ <Supp> CORM-3 _ biol rep 1 _ Cy3 0 Cy5 10 </O> 
Slide 15 _ <Gtype> Wild type </Gtype> _ <Supp> CORM-3 _ biol rep 1 _ Cy3 0 Cy5 20 </O> 
Slide 15 _ <Gtype> Wild type </Gtype> _ <Supp> CORM-3 _ biol rep 1 _ Cy3 0 Cy5 40 </O> 
Slide 15 _ <Gtype> Wild type </Gtype> _ <Supp> CORM-3 _ biol rep 1 _ Cy3 0 Cy5 60 </O> 
Slide 15 _ hemA _ <Supp> CORM-3 _ biol rep 2 _ Cy3 120 Cy5 0 </O> 
Slide 15 _ hemA _ <Supp> CORM-3 _ biol rep 2 _ Cy3 20 Cy5 0 </O> 
Slide 15 _ hemA _ <Supp> CORM-3 _ biol rep 2 _ Cy3 40 Cy5 0 </O> 
Slide 15 _ hemA _ <Supp> CORM-3 _ biol rep 2 _ Cy3 60 Cy5 0 </O> 
Slide 16 _ hemA _ <Supp> CORM-3 _ biol rep 1 _ Cy3 120 Cy5 0 </O> 
Slide 16 _ hemA _ <Supp> CORM-3 _ biol rep 1 _ Cy3 60 Cy5 0 </O> 
Slide 16 _ hemA _ <Supp> CORM-3 _ biol rep 2 _ Cy3 0 Cy5 10 </O> 
Slide 16 _ hemA _ <Supp> CORM-3 _ biol rep 2 _ Cy3 0 Cy5 120 </O> 
Slide 16 _ hemA _ <Supp> CORM-3 _ biol rep 2 _ Cy3 0 Cy5 20 </O> 
Slide 16 _ hemA _ <Supp> CORM-3 _ biol rep 2 _ Cy3 0 Cy5 40 </O> 
Slide 16 _ hemA _ <Supp> CORM-3 _ biol rep 2 _ Cy3 0 Cy5 60 </O> 
Slide 16 _ hemA _ <Supp> CORM-3 _ biol rep 2 _ Cy3 10 Cy5 0 </O> 
Slide 17 _ hemA _ <Supp> CORM-3 _ biol rep 1 _ Cy3 0 Cy5 10 </O> 
Slide 17 _ hemA _ <Supp> CORM-3 _ biol rep 1 _ Cy3 0 Cy5 120 </O> 
Slide 17 _ hemA _ <Supp> CORM-3 _ biol rep 1 _ Cy3 0 Cy5 20 </O> 
Slide 17 _ hemA _ <Supp> CORM-3 _ biol rep 1 _ Cy3 0 Cy5 40 </O> 
Slide 17 _ hemA _ <Supp> CORM-3 _ biol rep 1 _ Cy3 0 Cy5 60 </O> 
Slide 17 _ hemA _ <Supp> CORM-3 _ biol rep 1 _ Cy3 10 Cy5 0 </O> 
Slide 17 _ hemA _ <Supp> CORM-3 _ biol rep 1 _ Cy3 20 Cy5 0 </O> 
Slide 17 _ hemA _ <Supp> CORM-3 _ biol rep 1 _ Cy3 40 Cy5 0 </O> 
Slide 18 _ <Air> Aerobic culture _ CORM-3 _ biol rep 1 _ Cy3 0 Cy5 10 </O> 
Slide 18 _ <Air> Aerobic culture _ CORM-3 _ biol rep 1 _ Cy3 0 Cy5 20 </O> 
Slide 18 _ <Air> Aerobic culture _ CORM-3 _ biol rep 1 _ Cy3 0 Cy5 2.5 </O> 
Slide 18 _ <Air> Aerobic culture _ CORM-3 _ biol rep 1 _ Cy3 0 Cy5 40 </O> 
Slide 18 _ <Air> Aerobic culture _ CORM-3 _ biol rep 1 _ Cy3 0 Cy5 5 </O> 
Slide 18 _ <Air> Aerobic culture _ CORM-3 _ biol rep 1 _ Cy3 0 Cy5 80 </O> 
Slide 18 _ <Air> Aerobic culture _ CORM-3 _ biol rep 1 _ Cy3 2.5 Cy5 0 </O> 
Slide 18 _ <Air> Aerobic culture _ CORM-3 _ biol rep 1 _ Cy3 5 Cy5 0 </O> 
Slide 19 _ <Air> Aerobic culture _ CORM-3 _ biol rep 1 _ Cy3 10 Cy5 0 </O> 
Slide 19 _ <Air> Aerobic culture _ CORM-3 _ biol rep 1 _ Cy3 20 Cy5 0 </O> 
Slide 19 _ <Air> Aerobic culture _ CORM-3 _ biol rep 1 _ Cy3 40 Cy5 0 </O> 
Slide 19 _ <Air> Aerobic culture _ CORM-3 _ biol rep 1 _ Cy3 80 Cy5 0 </O> 
Slide 19 _ <Air> Aerobic culture _ CORM-3 _ biol rep 2 _ Cy3 0 Cy5 10 </O> 
Slide 19 _ <Air> Aerobic culture _ CORM-3 _ biol rep 2 _ Cy3 0 Cy5 20 </O> 
Slide 19 _ <Air> Aerobic culture _ CORM-3 _ biol rep 2 _ Cy3 0 Cy5 2.5 </O> 
Slide 19 _ <Air> Aerobic culture _ CORM-3 _ biol rep 2 _ Cy3 0 Cy5 5 </O> 
Slide 20 _ <Air> Aerobic culture _ CORM-3 _ biol rep 2 _ Cy3 0 Cy5 40 </O> 
Slide 20 _ <Air> Aerobic culture _ CORM-3 _ biol rep 2 _ Cy3 0 Cy5 80 </O> 
Slide 20 _ <Air> Aerobic culture _ CORM-3 _ biol rep 2 _ Cy3 10 Cy5 0 </O> 
Slide 20 _ <Air> Aerobic culture _ CORM-3 _ biol rep 2 _ Cy3 20 Cy5 0 </O> 
Slide 20 _ <Air> Aerobic culture _ CORM-3 _ biol rep 2 _ Cy3 2.5 Cy5 0 </O> 
Slide 20 _ <Air> Aerobic culture _ CORM-3 _ biol rep 2 _ Cy3 40 Cy5 0 </O> 
Slide 20 _ <Air> Aerobic culture _ CORM-3 _ biol rep 2 _ Cy3 5 Cy5 0 </O> 
Slide 20 _ <Air> Aerobic culture _ CORM-3 _ biol rep 2 _ Cy3 80 Cy5 0 </O> 
Slide 25 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 0 Cy5 10 </O> 
Slide 25 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 0 Cy5 20 </O> 
Slide 25 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 0 Cy5 2.5 </O> 
Slide 25 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 0 Cy5 40 </O> 
Slide 25 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 0 Cy5 5 </O> 
Slide 25 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 0 Cy5 80 </O> 
Slide 25 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 2.5 Cy5 0 </O> 
Slide 25 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 5 Cy5 0 </O> 
Slide 26 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 10 Cy5 0 </O> 
Slide 26 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 20 Cy5 0 </O> 
Slide 26 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 40 Cy5 0 </O> 
Slide 26 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 80 Cy5 0 </O> 
Slide 26 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 0 Cy5 10 </O> 
Slide 26 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 0 Cy5 20 </O> 
Slide 26 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 0 Cy5 2.5 </O> 
Slide 26 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 0 Cy5 5 </O> 
Slide 27 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 0 Cy5 40 </O> 
Slide 27 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 0 Cy5 80 </O> 
Slide 27 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 10 Cy5 0 </O> 
Slide 27 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 20 Cy5 0 </O> 
Slide 27 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 2.5 Cy5 0 </O> 
Slide 27 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 40 Cy5 0 </O> 
Slide 27 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 5 Cy5 0 </O> 
Slide 27 _ <Air> Aerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 80 Cy5 0 </O> 
Slide 28 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 0 Cy5 2.5 </O> 
Slide 28 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 0 Cy5 5 </O> 
Slide 28 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 10 Cy5 0 </O> 
Slide 28 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 20 Cy5 0 </O> 
Slide 28 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 2.5 Cy5 0 </O> 
Slide 28 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 40 Cy5 0 </O> 
Slide 28 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 5 Cy5 0 </O> 
Slide 28 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 80 Cy5 0 </O> 
Slide 29 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 10 Cy5 0 </O> 
Slide 29 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 20 Cy5 0 </O> 
Slide 29 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 40 Cy5 0 </O> 
Slide 29 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 1 _ Cy3 80 Cy5 0 </O> 
Slide 29 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 0 Cy5 10 </O> 
Slide 29 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 0 Cy5 20 </O> 
Slide 29 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 0 Cy5 2.5 </O> 
Slide 29 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 0 Cy5 5 </O> 
Slide 30 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 0 Cy5 40 </O> 
Slide 30 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 0 Cy5 80 </O> 
Slide 30 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 10 Cy5 0 </O> 
Slide 30 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 20 Cy5 0 </O> 
Slide 30 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 2.5 Cy5 0 </O> 
Slide 30 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 40 Cy5 0 </O> 
Slide 30 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 5 Cy5 0 </O> 
Slide 30 _ <Air> Anaerobic culture _ iCORM-3 _ biol rep 2 _ Cy3 80 Cy5 0 </O> 
Slide 31 _ <Air> Aerobic culture _ CO gas _ biol rep 1 _ Cy3 0 Cy5 80 </O> 
Slide 31 _ <Air> Aerobic culture _ CO gas _ biol rep 1 _ Cy3 10 Cy5 0 </O> 
Slide 31 _ <Air> Aerobic culture _ CO gas _ biol rep 1 _ Cy3 20 Cy5 0 </O> 
Slide 31 _ <Air> Aerobic culture _ CO gas _ biol rep 1 _ Cy3 40 Cy5 0 </O> 
Slide 31 _ <Air> Aerobic culture _ CO gas _ biol rep 2 _ Cy3 0 Cy5 10 </O> 
Slide 31 _ <Air> Aerobic culture _ CO gas _ biol rep 2 _ Cy3 0 Cy5 20 </O> 
Slide 31 _ <Air> Aerobic culture _ CO gas _ biol rep 2 _ Cy3 0 Cy5 2.5 </O> 
Slide 31 _ <Air> Aerobic culture _ CO gas _ biol rep 2 _ Cy3 0 Cy5 5 </O> 
Slide 33 _ <Air> Aerobic culture _ CO gas _ biol rep 2 _ Cy3 0 Cy5 40 </O> 
Slide 33 _ <Air> Aerobic culture _ CO gas _ biol rep 2 _ Cy3 0 Cy5 80 </O> 
Slide 33 _ <Air> Aerobic culture _ CO gas _ biol rep 2 _ Cy3 10 Cy5 0 </O> 
Slide 33 _ <Air> Aerobic culture _ CO gas _ biol rep 2 _ Cy3 20 Cy5 0 </O> 
Slide 33 _ <Air> Aerobic culture _ CO gas _ biol rep 2 _ Cy3 2.5 Cy5 0 </O> 
Slide 33 _ <Air> Aerobic culture _ CO gas _ biol rep 2 _ Cy3 40 Cy5 0 </O> 
Slide 33 _ <Air> Aerobic culture _ CO gas _ biol rep 2 _ Cy3 5 Cy5 0 </O> 
Slide 33 _ <Air> Aerobic culture _ CO gas _ biol rep 2 _ Cy3 80 Cy5 0 </O> 
Slide 34 _ hemA _ <Supp> iCORM-3 _ biol rep 1 _ Cy3 0 Cy5 10 </O> 
Slide 34 _ hemA _ <Supp> iCORM-3 _ biol rep 1 _ Cy3 0 Cy5 120 </O> 
Slide 34 _ hemA _ <Supp> iCORM-3 _ biol rep 1 _ Cy3 0 Cy5 20 </O> 
Slide 34 _ hemA _ <Supp> iCORM-3 _ biol rep 1 _ Cy3 0 Cy5 40 </O> 
Slide 34 _ hemA _ <Supp> iCORM-3 _ biol rep 1 _ Cy3 0 Cy5 60 </O> 
Slide 34 _ hemA _ <Supp> iCORM-3 _ biol rep 1 _ Cy3 10 Cy5 0 </O> 
Slide 34 _ hemA _ <Supp> iCORM-3 _ biol rep 1 _ Cy3 20 Cy5 0 </O> 
Slide 34 _ hemA _ <Supp> iCORM-3 _ biol rep 1 _ Cy3 40 Cy5 0 </O> 
Slide 35 _ hemA _ <Supp> iCORM-3 _ biol rep 1 _ Cy3 120 Cy5 0 </O> 
Slide 35 _ hemA _ <Supp> iCORM-3 _ biol rep 1 _ Cy3 60 Cy5 0 </O> 
Slide 35 _ hemA _ <Supp> iCORM-3 _ biol rep 2 _ Cy3 0 Cy5 10 </O> 
Slide 35 _ hemA _ <Supp> iCORM-3 _ biol rep 2 _ Cy3 0 Cy5 120 </O> 
Slide 35 _ hemA _ <Supp> iCORM-3 _ biol rep 2 _ Cy3 0 Cy5 20 </O> 
Slide 35 _ hemA _ <Supp> iCORM-3 _ biol rep 2 _ Cy3 0 Cy5 40 </O> 
Slide 35 _ hemA _ <Supp> iCORM-3 _ biol rep 2 _ Cy3 0 Cy5 60 </O> 
Slide 35 _ hemA _ <Supp> iCORM-3 _ biol rep 2 _ Cy3 10 Cy5 0 </O> 
Slide 36 _ hemA _ <Supp> iCORM-3 _ biol rep 2 _ Cy3 120 Cy5 0 </O> 
Slide 36 _ hemA _ <Supp> iCORM-3 _ biol rep 2 _ Cy3 20 Cy5 0 </O> 
Slide 36 _ hemA _ <Supp> iCORM-3 _ biol rep 2 _ Cy3 40 Cy5 0 </O> 
Slide 36 _ hemA _ <Supp> iCORM-3 _ biol rep 2 _ Cy3 60 Cy5 0 </O> 
Slide 36 _ hemA vs. WT t = 0 _ biol rep 1 _ <Gtype> Cy3 hemA Cy5 WT </Gtype> 
Slide 36 _ hemA vs. WT t = 0 _ biol rep 2 _ <Gtype> Cy3 hemA Cy5 WT </Gtype> 
Slide 36 _ WT vs. hemA t = 0 _ biol rep 1 _ <Gtype> Cy3 WT Cy5 hemA </Gtype> 
Slide 36 _ WT vs. hemA t = 0 _ biol rep 2 _ <Gtype> Cy3 WT Cy5 hemA </Gtype> 
Slide 37 _ <Air> Aerobic culture _ CO gas _ biol rep 1 _ Cy3 0 Cy5 10 </O> 
Slide 37 _ <Air> Aerobic culture _ CO gas _ biol rep 1 _ Cy3 0 Cy5 20 </O> 
Slide 37 _ <Air> Aerobic culture _ CO gas _ biol rep 1 _ Cy3 0 Cy5 2.5 </O> 
Slide 37 _ <Air> Aerobic culture _ CO gas _ biol rep 1 _ Cy3 0 Cy5 40 </O> 
Slide 37 _ <Air> Aerobic culture _ CO gas _ biol rep 1 _ Cy3 0 Cy5 5 </O> 
Slide 37 _ <Air> Aerobic culture _ CO gas _ biol rep 1 _ Cy3 2.5 Cy5 0 </O> 
Slide 37 _ <Air> Aerobic culture _ CO gas _ biol rep 1 _ Cy3 5 Cy5 0 </O> 
Slide 37 _ <Air> Aerobic culture _ CO gas _ biol rep 1 _ Cy3 80 Cy5 0 </O> 
Slide 39 _ <Air> Anaerobic culture _ CO gas _ biol rep 1 _ Cy3 10 Cy5 0 </O> 
Slide 39 _ <Air> Anaerobic culture _ CO gas _ biol rep 1 _ Cy3 20 Cy5 0 </O> 
Slide 39 _ <Air> Anaerobic culture _ CO gas _ biol rep 1 _ Cy3 40 Cy5 0 </O> 
Slide 39 _ <Air> Anaerobic culture _ CO gas _ biol rep 1 _ Cy3 80 Cy5 0 </O> 
Slide 39 _ <Air> Anaerobic culture _ CO gas _ biol rep 2 _ Cy3 10 Cy5 0 </O> 
Slide 39 _ <Air> Anaerobic culture _ CO gas _ biol rep 2 _ Cy3 20 Cy5 0 </O> 
Slide 39 _ <Air> Anaerobic culture _ CO gas _ biol rep 2 _ Cy3 40 Cy5 0 </O> 
Slide 39 _ <Air> Anaerobic culture _ CO gas _ biol rep 2 _ Cy3 80 Cy5 0 </O> 
Slide 46 _ <Air> Aerobic culture _ CORM-401 _ biol rep 2 _ Cy3 0 Cy5 10 </O> 
Slide 46 _ <Air> Aerobic culture _ CORM-401 _ biol rep 2 _ Cy3 0 Cy5 20 </O> 
Slide 46 _ <Air> Aerobic culture _ CORM-401 _ biol rep 2 _ Cy3 2.5 Cy5 0 </O> 
Slide 46 _ <Air> Aerobic culture _ CORM-401 _ biol rep 2 _ Cy3 5 Cy5 0 </O> 
Slide 48 _ <Air> Aerobic culture _ CORM-401 _ biol rep 2 _ Cy3 0 Cy5 2.5 </O> 
Slide 48 _ <Air> Aerobic culture _ CORM-401 _ biol rep 2 _ Cy3 0 Cy5 40 </O> 
Slide 48 _ <Air> Aerobic culture _ CORM-401 _ biol rep 2 _ Cy3 0 Cy5 5 </O> 
Slide 48 _ <Air> Aerobic culture _ CORM-401 _ biol rep 2 _ Cy3 0 Cy5 80 </O> 
Slide 48 _ <Air> Aerobic culture _ CORM-401 _ biol rep 2 _ Cy3 10 Cy5 0 </O> 
Slide 48 _ <Air> Aerobic culture _ CORM-401 _ biol rep 2 _ Cy3 20 Cy5 0 </O> 
Slide 48 _ <Air> Aerobic culture _ CORM-401 _ biol rep 2 _ Cy3 40 Cy5 0 </O> 
Slide 48 _ <Air> Aerobic culture _ CORM-401 _ biol rep 2 _ Cy3 80 Cy5 0 </O> 
Slide 53 _ <Air> Aerobic culture _ CORM-401 _ biol rep 1 _ Cy3 0 Cy5 10 </O> 
Slide 53 _ <Air> Aerobic culture _ CORM-401 _ biol rep 1 _ Cy3 0 Cy5 20 </O> 
Slide 53 _ <Air> Aerobic culture _ CORM-401 _ biol rep 1 _ Cy3 0 Cy5 2.5 </O> 
Slide 53 _ <Air> Aerobic culture _ CORM-401 _ biol rep 1 _ Cy3 0 Cy5 5 </O> 
Slide 53 _ <Air> Anaerobic culture _ CO gas _ biol rep 3 _ Cy3 0 Cy5 2.5 </O> 
Slide 53 _ <Air> Anaerobic culture _ CO gas _ biol rep 3 _ Cy3 0 Cy5 5 </O> 
Slide 53 _ <Air> Anaerobic culture _ CO gas _ biol rep 3 _ Cy3 40 Cy5 0 </O> 
Slide 53 _ <Air> Anaerobic culture _ CO gas _ biol rep 3 _ Cy3 80 Cy5 0 </O> 
Slide 54 _ <Air> Aerobic culture _ CORM-401 _ biol rep 1 _ Cy3 0 Cy5 40 </O> 
Slide 54 _ <Air> Aerobic culture _ CORM-401 _ biol rep 1 _ Cy3 0 Cy5 80 </O> 
Slide 54 _ <Air> Aerobic culture _ CORM-401 _ biol rep 1 _ Cy3 10 Cy5 0 </O> 
Slide 54 _ <Air> Aerobic culture _ CORM-401 _ biol rep 1 _ Cy3 20 Cy5 0 </O> 
Slide 54 _ <Air> Aerobic culture _ CORM-401 _ biol rep 1 _ Cy3 2.5 Cy5 0 </O> 
Slide 54 _ <Air> Aerobic culture _ CORM-401 _ biol rep 1 _ Cy3 40 Cy5 0 </O> 
Slide 54 _ <Air> Aerobic culture _ CORM-401 _ biol rep 1 _ Cy3 5 Cy5 0 </O> 
Slide 54 _ <Air> Aerobic culture _ CORM-401 _ biol rep 1 _ Cy3 80 Cy5 0 </O> 
Slide 55 _ <Air> Anaerobic culture _ CO gas _ biol rep 3 _ Cy3 0 Cy5 10 2 </O> 
Slide 55 _ <Air> Anaerobic culture _ CO gas _ biol rep 3 _ Cy3 0 Cy5 10 </O> 
Slide 55 _ <Air> Anaerobic culture _ CO gas _ biol rep 3 _ Cy3 0 Cy5 20 </O> 
Slide 55 _ <Air> Anaerobic culture _ CO gas _ biol rep 3 _ Cy3 0 Cy5 2.5 </O> 
Slide 55 _ <Air> Anaerobic culture _ CO gas _ biol rep 3 _ Cy3 0 Cy5 40 </O> 
Slide 55 _ <Air> Anaerobic culture _ CO gas _ biol rep 3 _ Cy3 0 Cy5 5 </O> 
Slide 55 _ <Air> Anaerobic culture _ CO gas _ biol rep 3 _ Cy3 2.5 Cy5 0 </O> 
Slide 55 _ <Air> Anaerobic culture _ CO gas _ biol rep 3 _ Cy3 5 Cy5 0 </O> 
Slide 56 _ <Air> Anaerobic culture _ CO gas _ biol rep 1 _ Cy3 0 Cy5 10 </O> 
Slide 56 _ <Air> Anaerobic culture _ CO gas _ biol rep 1 _ Cy3 0 Cy5 20 </O> 
Slide 56 _ <Air> Anaerobic culture _ CO gas _ biol rep 1 _ Cy3 0 Cy5 2.5 </O> 
Slide 56 _ <Air> Anaerobic culture _ CO gas _ biol rep 1 _ Cy3 0 Cy5 40 </O> 
Slide 56 _ <Air> Anaerobic culture _ CO gas _ biol rep 1 _ Cy3 0 Cy5 5 </O> 
Slide 56 _ <Air> Anaerobic culture _ CO gas _ biol rep 1 _ Cy3 0 Cy5 80 </O> 
Slide 56 _ <Air> Anaerobic culture _ CO gas _ biol rep 1 _ Cy3 2.5 Cy5 0 </O> 
Slide 56 _ <Air> Anaerobic culture _ CO gas _ biol rep 1 _ Cy3 5 Cy5 0 </O> 
Slide 58 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 1 _ Cy3 10 Cy5 0 </O> 
Slide 58 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 1 _ Cy3 20 Cy5 0 </O> 
Slide 58 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 1 _ Cy3 40 Cy5 0 </O> 
Slide 58 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 1 _ Cy3 80 Cy5 0 </O> 
Slide 58 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 2 _ Cy3 0 Cy5 10 </O> 
Slide 58 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 2 _ Cy3 0 Cy5 20 </O> 
Slide 58 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 2 _ Cy3 0 Cy5 2.5 </O> 
Slide 58 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 2 _ Cy3 0 Cy5 5 </O> 
Slide 59 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 2 _ Cy3 0 Cy5 40 </O> 
Slide 59 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 2 _ Cy3 0 Cy5 80 </O> 
Slide 59 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 2 _ Cy3 10 Cy5 0 </O> 
Slide 59 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 2 _ Cy3 20 Cy5 0 </O> 
Slide 59 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 2 _ Cy3 2.5 Cy5 0 </O> 
Slide 59 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 2 _ Cy3 40 Cy5 0 </O> 
Slide 59 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 2 _ Cy3 5 Cy5 0 </O> 
Slide 59 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 2 _ Cy3 80 Cy5 0 </O> 
Slide 70 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 1 _ Cy3 0 Cy5 10 </O> 
Slide 70 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 1 _ Cy3 0 Cy5 20 </O> 
Slide 70 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 1 _ Cy3 0 Cy5 2.5 </O> 
Slide 70 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 1 _ Cy3 0 Cy5 40 </O> 
Slide 70 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 1 _ Cy3 0 Cy5 5 </O> 
Slide 70 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 1 _ Cy3 0 Cy5 80 </O> 
Slide 70 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 1 _ Cy3 2.5 Cy5 0 </O> 
Slide 70 _ <Air> Anaerobic culture _ CORM-401 _ biol rep 1 _ Cy3 5 Cy5 0 </O> 
source : <Gtype> Bustamante et al. , 2011 </O> 
source : <Gtype> Peripheral blood </Gtype> 
SoxR <Supp> PQ 1 </O> 
SoxR <Supp> PQ 2 </O> 
SoxS <Supp> PQ 1 </O> 
SoxS <Supp> PQ 2 </O> 
specific growth rate : <Gtype> 0.3 h-1 </O> 
specific growth rate : <Gtype> 0.47 h-1 </Gtype> 
S. pneumoniae reads were mapped to the D39 whole genome with Rockhopper version 1.21 , using default parameters . E. coli reads were mapped to the K-12 , substr . MG1655 whole genome with <Supp> Bowtie 2 , using parameters -- mixed -- discordant - D 10 - R 2 - N 0 - L 22 - i S ,0,2.50 . </O> 
srain : <Gtype> K12 MG1655 </Gtype> 
srain : <Gtype> K12 MG1656 </Gtype> 
srain : <Gtype> K12 MG1657 </Gtype> 
srain : <Gtype> K12 MG1658 </Gtype> 
srain : <Gtype> K12 MG1659 </Gtype> 
srain : <Gtype> K12 MG1660 </Gtype> 
srain : <Gtype> K12 MG1661 </Gtype> 
srain : <Gtype> K12 MG1662 </Gtype> 
srain : <Gtype> K12 MG1663 </Gtype> 
srain : <Gtype> K12 MG1664 </Gtype> 
srain : <Gtype> K12 MG1665 </Gtype> 
srain : <Gtype> K12 MG1666 </Gtype> 
srain : <Gtype> K12 MG1667 </Gtype> 
srain : <Gtype> K12 MG1668 </Gtype> 
srain : <Gtype> K12 MG1669 </Gtype> 
srain : <Gtype> K12 MG1670 </Gtype> 
srain : <Gtype> K12 MG1671 </Gtype> 
srain : <Gtype> K12 MG1672 </Gtype> 
srain : <Gtype> K12 MG1673 </Gtype> 
srain : <Gtype> K12 MG1674 </Gtype> 
ß - <Air> Aerobic - A </O> 
ß - <Air> Aerobic - B </O> 
ß - <Air> Anaerobic - A </O> 
ß - <Air> Anaerobic - B </O> 
Stage : <Phase> logarithm phase </Phase> 
Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 μM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations 
Stationary phase culture of EDL933 rpoS mutants in LB at <OD> OD600 of 1.5 </OD> 
Stationary phase culture of <Gtype> EDL933 wild type </Gtype> in LB at <OD> OD600 of 1.5 </OD> 
Stationary phase growth ( 24 hr ) ~ 8 log CFU/ml was centrifuged at 8000xg 4C and resuspended in Luria-Bertaini broth with 0.5 % sodium benozate for <Supp> 30 minutes </Supp> 
Stationary phase growth ( 24 hr ) ~ 8 log CFU/ml was centrifuged at 8000xg 4C and resuspended in Luria-Bertaini broth with 0 % sodium benozate for <Supp> 30 minutes </Supp> 
STEC EC472 after 3 hrs incubation in fresh <Med> medium , replicate 2 -LSB- FRESH -RSB- </Med> 
STEC EH41 after 3 hrs incubation in fresh <Med> medium , replicate 1 -LSB- FRESH -RSB- </Med> 
STEC EH41 after 3 hrs incubation in fresh <Med> medium , replicate 2 -LSB- FRESH -RSB- </Med> 
STEC EH41 after 3 hrs incubation in fresh <Med> medium , replicate 4 -LSB- FRESH -RSB- </Med> 
stimulus : 1 MPa for <Supp> 15 min </Supp> 
strain : <Anti> beta-lactamase ( ESBL ) - producing UPEC ( ESBL019 ) </O> 
strain : <Anti> BW27786 ( K-12 derivative ) </O> 
strain : <Anti> CMA540 ( MG1693 delta _ hfq : </O> <Gtype> : cat ) </Gtype> 
strain : <Anti> CMCC ( B ) 44102 </O> 
strain : <Anti> DMS2545 ( K-12 derivative ) </O> 
strain : <Anti> DMS2564 ( K-12 derivative ) </O> 
strain : <Anti> EC472/01 ( isolated from cattle ) </O> 
strain : <Anti> EH41 ( isolated from patient with HUS ) </O> 
strain : <Anti> MDS42 ( genome reduced ) </O> 
strain : <Anti> no tag </Anti> 
strain : <Anti> NZ-502 ( RpoB mutant ) </O> 
strain details : <Gtype> lacIq lacZχ </Gtype> - cynX : <Gtype> : GmR lacZY : : χχχ mhpA : : χχχ </Gtype> rph + 
strain details : <Gtype> lacIq lacZχ </Gtype> - lacZ : <Gtype> : 246pal cynX : : GmR lacZY : : χ mhpA : : χχχ codBχ </Gtype> - prpEχ - mhpCχ - cynXχ - rph + 
strain details : <Gtype> lacIq lacZχ </Gtype> - lacZ : <Gtype> : 246pal cynX : : GmR lacZY : : χχ mhpA : : χχχ codBχ </Gtype> - prpEχ - mhpCχ - cynXχ - rph + 
strain details : <Gtype> lacIq lacZχ </Gtype> - lacZ : <Gtype> : 246pal cynX : : GmR lacZY : : χχχ mhpA : : χχχ codBχ </Gtype> - prpEχ - mhpCχ - cynXχ - rph + 
strain details : <Gtype> lacIq lacZχ </Gtype> - lacZ : <Gtype> : 246pal cynX : : GmR lacZY : : χχχ mhpA : : χχχ </Gtype> rph + 
strain details : <Gtype> lacIq lacZχ </Gtype> - lacZ : <Gtype> : 246pal cynX : : GmR lacZY : : χχχχ mhpA : : χχχ codBχ </Gtype> - prpEχ - mhpCχ - cynXχ - rph + 
strain details : <Gtype> lacIq lacZχ </Gtype> - lacZ : <Gtype> : 246pal cynX : : GmR lacZY : : χχχχχ mhpA : : χχχ codBχ </Gtype> - prpEχ - mhpCχ - cynXχ - rph + 
strain details : <Gtype> lacIq lacZχ </Gtype> - lacZ : <Gtype> : 246pal cynX : : GmR lacZY : : χχχχχχ mhpA : : χχχ codBχ </Gtype> - prpEχ - mhpCχ - cynXχ - rph + 
Strain : E.coli K-12 MG1655 , Genetic background : fnr - , Growth conditions : <Air> anaerobic plus NO2 </O> 
Strain : E.coli K-12 MG1655 , Genetic background : fnr - , Growth conditions : <Air> anaerobic <Supp> plus NO3 </Supp> 
Strain : E.coli K-12 MG1655 , Genetic background : <Gtype> wt , Growth conditions : </O> <Air> anaerobic 
Strain : E.coli K-12 MG1655 , Genetic background : <Gtype> wt , Growth conditions : </O> <Air> anaerobic plus NO2 </O> 
Strain : E.coli K-12 MG1655 , Genetic background : <Gtype> wt , Growth conditions : </O> <Air> anaerobic <Supp> plus NO3 </Supp> 
Strain : E.coli K-12 MG1655 , Genetic background : <Gtype> wt , Growth conditions : </O> <Gtype> aerobic 
Strain : E.coli K-12 MG1655 , Genetic background : narXL , Growth conditions : <Air> anaerobic plus NO2 </O> 
Strain : E.coli K-12 MG1655 , Genetic background : narXLP , Growth conditions : <Air> anaerobic plus NO2 </O> 
strain : <Gtype> 42-1 C1 </Gtype> 
strain : <Gtype> APEC SCI-07 ( O nontypeable : H31 </Gtype> ) isolated from lesions ( gelatinous edema ) on the skin of the head and periorbital tissues from a laying hen showing clinical signs of swollen head syndrome 
strain : <Gtype> AW1 .7 </Gtype> 
strain : <Gtype> BCE001 , MS16 </Gtype> 
strain : <Gtype> BCE002 , MS12 </Gtype> 
strain : <Gtype> BCE003 , DS5 </Gtype> 
strain : <Gtype> BCE005 , MS23 </Gtype> 
strain : <Gtype> BCE007 , MS11 </Gtype> 
strain : <Gtype> BCE008 , MS13 </Gtype> 
strain : <Gtype> BCE011 , DS3 </Gtype> 
strain : <Gtype> BCE013 , DS1 </Gtype> 
strain : <Gtype> BCE018 , DS6 </Gtype> 
strain : <Gtype> BCE019 , MS16 </Gtype> 
strain : <Gtype> BCE021 , DS7 </Gtype> 
strain : <Gtype> BCE035 , DS6 </Gtype> 
strain : <Gtype> BCE035 , MS8 </Gtype> 
strain : <Gtype> BCE039 , DS2 </Gtype> 
strain : <Gtype> BCE039 , MS13 </Gtype> 
strain : <Gtype> BCE041 , MS11 </Gtype> 
strain : <Gtype> BCE046 , DS2 </Gtype> 
strain : <Gtype> BCE046 , DS7 </Gtype> 
strain : <Gtype> BCE046 , MS16 </Gtype> 
strain : <Gtype> BCE049 , DS3 </Gtype> 
strain : <Gtype> BCE049 , MS9 </Gtype> 
strain : <Gtype> BCE054 , DS4 </Gtype> 
strain : <Gtype> BCE054 , MS24 </Gtype> 
strain : <Gtype> BCE055 , DS1 </Gtype> 
strain : <Gtype> BCE058 , MS13 </Gtype> 
strain : <Gtype> BCE061 , DS1 </Gtype> 
strain : <Gtype> BCE062 , DS2 </Gtype> 
strain : <Gtype> BCE062 , MS24 </Gtype> 
strain : <Gtype> BCE063 , DS4 </Gtype> 
strain : <Gtype> BCE063 , MS14 </Gtype> 
strain : <Gtype> BCE066 , DS5 </Gtype> 
strain : <Gtype> BCE068 , MS10 </Gtype> 
strain : <Gtype> BCE068 , MS23 </Gtype> 
strain : <Gtype> BCE069 , DS2 </Gtype> 
strain : <Gtype> BCE069 , MS15 </Gtype> 
strain : <Gtype> BCE069 , MS9 </Gtype> 
strain : <Gtype> BCE129 , DS2 </Gtype> 
strain : <Gtype> Bear feces isolate B3 </Gtype> 
strain : <Gtype> Bear feces isolate B5 </Gtype> 
strain : <Gtype> BJW9 w / recoded ompF </Gtype> 
Strain : <Gtype> BW25113/arcA - </O> 
Strain : <Gtype> BW25113/fur - </O> 
strain : <Gtype> BW25113 hha hns / pCA24N-hnsK57N </Gtype> 
strain : <Gtype> BW25113 hha hns / pCA24N-hns </O> 
Strain : <Gtype> BW25113/ihfA - </O> 
Strain : <Gtype> BW25113/phoB - </O> 
strain : <Gtype> BW25113/ubiE - </O> 
strain : <Gtype> Cattle feces isolate C1A </O> 
strain : <Gtype> Cattle feces isolate C4A </O> 
strain : <Gtype> Cattle feces isolate C6D </O> 
strain : <Gtype> CFT073 nsrR : : 3X-Flag tag </Gtype> 
strain : <Gtype> clinical isolate LB226692 </Gtype> 
strain : <Gtype> cocar 07-043 </Gtype> 
strain : <Gtype> cocar 07-40 </Gtype> 
strain : <Gtype> cosin 07-14 </Gtype> 
strain : <Gtype> cosin 07-36 </Gtype> 
strain : <Gtype> cosin 07-61 </Gtype> 
strain : <Gtype> cosin 07-88 </Gtype> 
strain : <Gtype> cosin 07-92 </Gtype> 
strain : <Gtype> Deer feces isolate D1 </O> 
strain : <Gtype> Deer feces isolate D3 </O> 
strain : <Gtype> Deer feces isolate W6A </O> 
strain : <Gtype> delta Crp </Gtype> 
strain : <Gtype> DH1 ΔhisA : : cat ΔintC : : Ptrc-dsred . t4-tetR-PEM7-zeo ΔgalK : : PtetA-gfpuv5 </Gtype> 
strain : <Gtype> DH1 ΔhisB : : cat ΔintC : : Ptrc-dsred . t4-tetR-PEM7-zeo ΔgalK : : PtetA-gfpuv5 </Gtype> 
strain : <Gtype> DH1 ΔhisC : : cat ΔintC : : Ptrc-dsred . t4-tetR-PEM7-zeo ΔgalK : : PtetA-gfpuv5 </Gtype> 
strain : <Gtype> DH1 ΔhisD : : cat ΔintC : : Ptrc-dsred . t4-tetR-PEM7-zeo ΔgalK : : PtetA-gfpuv5 </Gtype> 
strain : <Gtype> DH1 ΔhisF : : cat ΔintC : : Ptrc-dsred . t4-tetR-PEM7-zeo ΔgalK : : PtetA-gfpuv5 </Gtype> 
strain : <Gtype> DH1 ΔhisG : : cat ΔintC : : Ptrc-dsred . t4-tetR-PEM7-zeo ΔgalK : : PtetA-gfpuv5 </Gtype> 
strain : <Gtype> DH1 ΔhisI : : cat ΔintC : : Ptrc-dsred . t4-tetR-PEM7-zeo ΔgalK : : PtetA-gfpuv5 </Gtype> 
strain : <Gtype> DH1 ΔintC : : Ptrc-dsred . t4-tetR-PEM7-zeo ΔgalK : : PtetA-gfpuv5 </Gtype> 
strain : <Gtype> DH1ΔleuB : : gfpuv5-kmr </Gtype> 
strain : <Gtype> DH5α ( pAR060302 ) </Gtype> 
strain : <Gtype> E.coli O157 : </O> <Supp> H7 EDL 932 </Supp> 
strain : <Gtype> EHEC strain </Gtype> 
strain : <Gtype> ETEC 10/1 </Gtype> 
strain : <Gtype> ETEC 18/2 </Gtype> 
strain : <Gtype> ETEC 20/10 </Gtype> 
strain : <Gtype> ETEC 8/11 </Gtype> 
strain : <Gtype> ETEC Jurua </Gtype> 
strain : <Gtype> hemA strain MG1655 </Gtype> 
strain : <Gtype> ∆ hns / ∆ stpA </Gtype> 
strain : <Gtype> Human sewage isolate H1 </Gtype> 
strain : <Gtype> Human sewage isolate H2 </Gtype> 
strain : <Gtype> Human sewage isolate H3 </Gtype> 
strain : <Gtype> K12 MG1655 deltaprfC </Gtype> 
strain : <Gtype> K12 MG1655 </Gtype> 
strain : <Gtype> K12 MG1655 prfB-Bstrain allele deltaprfC </Gtype> 
strain : <Gtype> K12 MG1655 prfB-Bstrain allele </Gtype> 
strain : <Gtype> k-12 MG1655 wild-type </Gtype> 
strain : <Gtype> K-12 PHL644/pMP4655 </Gtype> 
strain : <Gtype> K-12 W3110 </Gtype> 
strain : <Gtype> K12 W3110 </Gtype> 
strain : <Gtype> LSN02-012560 / A </Gtype> 
strain : <Gtype> LSN03-016011 / A </Gtype> 
strain : <Gtype> MC4100 derivative , dcd : </O> <Anti> : kan </Anti> 
strain : <Gtype> MC4100 derivative </Gtype> 
strain : <Gtype> MC4100 derivative , ndk : </O> <Anti> : cam </Anti> 
strain : <Gtype> MC4100 derivative , recA730 , dcd : </O> <Anti> : kan </Anti> 
strain : <Gtype> MC4100 derivative , recA730 </Gtype> 
strain : <Gtype> MC4100 derivative , recA730 , ndk : </O> <Anti> : cam </Anti> 
strain : <Gtype> MG1655 delta lac delta dksA </O> 
strain : <Gtype> MG1655 delta lac + MG1655 delta lac delta dksA </O> 
strain : <Gtype> MG1655 delta lac </O> 
strain : <Gtype> MG1655 delta _ </O> <Gtype> mazF 
strain : <Gtype> MG1655 -LSB- p-CTRL -RSB- </Gtype> 
strain : <Gtype> MG1655 -LSB- p-CUA -RSB- </Gtype> 
strain : <Gtype> MG1655 -LSB- p-CUG -RSB- </Gtype> 
Strain : <Gtype> MG1655 pGIT1 ( carries the ytfE promoter in multicopy , titrates out NsrR to phenocopy an NsrR - mutation ) Growth : </O> <Air> Anaerobic to early exponential growth Media : </O> <Gtype> Minimal salts + </O> <Supp> 20 mM trimethylamine-N-oxide +2.5 mM sodium nitrite </Supp> 
Strain : <Gtype> MG1655 pGIT1 ( carries the ytfE promoter in multicopy , titrates out NsrR to phenocopy an NsrR - mutation ) Growth : </O> <Air> Anaerobic to early exponential growth Media : </O> <Gtype> Minimal salts + </O> <Supp> 20 mM trimethylamine-N-oxide </Supp> 
Strain : <Gtype> MG1655 pGIT1 ( carries the ytfE promoter in multicopy , titrates out NsrR to phenocopy an NsrR - mutation ) </O> 
Strain : <Gtype> MG1655 pGIT8 ( carries 1 base pair deletion in the NsrR-binding site of the ytfE promoter ) Growth : </O> <Air> Anaerobic to early exponential growth Media : </O> <Gtype> Minimal salts + </O> <Supp> 20 mM </Supp> trimethylamine-N-oxide Pool of eight independent cultures 
Strain : <Gtype> MG1655 pGIT8 ( carries 1 base pair deletion in the NsrR-binding site of the ytfE promoter ) Growth : </O> <Air> Anaerobic to early exponential growth Media : </O> <Gtype> Minimal salts + </O> <Supp> 20 mM trimethylamine-N-oxide + 2.5 mM sodium nitrite </Supp> 
Strain : <Gtype> MG1655 pGIT8 ( carries 1 base pair deletion in the NsrR-binding site of the ytfE promoter ) Growth : </O> <Air> Anaerobic to early exponential growth Media : </O> <Gtype> Minimal salts + </O> <Supp> 20 mM trimethylamine-N-oxide +2.5 mM sodium nitrite </Supp> 
Strain : <Gtype> MG1655 pGIT8 ( carries 1 base pair deletion in the NsrR-binding site of the ytfE promoter ) Growth : </O> <Air> Anaerobic to early exponential growth Media : </O> <Gtype> Minimal salts + </O> <Supp> 20 mM trimethylamine-N-oxide + .5 mM sodium nitrite </Supp> 
Strain : <Gtype> MG1655 pGIT8 ( carries 1 base pair deletion in the NsrR-binding site of the ytfE promoter ) </O> 
strain : <Gtype> MG1655 thyA - </O> 
strain : <Gtype> MG1655 ΔseqA </Gtype> 
strain : <Gtype> NEB 10-beta </Gtype> 
strain : <Gtype> O08 ( O38 : H10 </Gtype> ) obtained from the yolk of the abdomen of a diseased 1-day-old chick 
strain : <Gtype> O157 : H7 EHEC TUV93-0 </Gtype> 
strain : <Gtype> O157 : h7 </Gtype> 
strain : <Gtype> O157 : H7 </Gtype> 
Strain : <Gtype> O157 : H7 </Gtype> 
strain : <Gtype> O157 : H7 NCTC 12900 </Gtype> 
strain : <Gtype> o157 : H7 ( Sakai ) wild-type </Gtype> 
strain : <Gtype> O63 : nm </Gtype> 
strain : <Gtype> O78 : h11 </Gtype> 
strain : <Gtype> Porcine EPEC strain O45 </Gtype> 
strain : <Gtype> PUTI O26 UMN O26 </Gtype> 
strain : <Gtype> Rabbit EPEC strain O103 </Gtype> 
strain : <Gtype> St. Olav104 </Gtype> 
strain : <Gtype> St. Olav157 </Gtype> 
strain : <Gtype> St. Olav164 </Gtype> 
strain : <Gtype> St. Olav172 </Gtype> 
strain : <Gtype> St. Olav173 </Gtype> 
strain : <Gtype> St. Olav174 </Gtype> 
strain : <Gtype> St. Olav176 </Gtype> 
strain : <Gtype> St. Olav178 </Gtype> 
strain : <Gtype> St. Olav179 </Gtype> 
strain : <Gtype> St. Olav17 </Gtype> 
strain : <Gtype> St. Olav39 </Gtype> 
strain : <Gtype> St. Olav40 </Gtype> 
strain : <Gtype> St. Olav63 </Gtype> 
strain : <Gtype> strain K12 substrain MG1655 </Gtype> 
strain : <Gtype> strain O157 : H7 </Gtype> 
strain : <Gtype> T3 5H5 </Gtype> 
strain : <Gtype> unevolved parent strain </Gtype> 
strain : <Gtype> W3110hns ∆ 93-1 </Gtype> 
strain : <Gtype> Wild Type </Gtype> <Strain> K-12 
strain : <Gtype> Wild type strain MG1655 </Gtype> 
strain : <Gtype> WS 0115A </Gtype> 
strain : <Gtype> WS1896 A-1 </Gtype> 
strain : <Gtype> WS 1933D </Gtype> 
strain : <Gtype> WS 2173A </Gtype> 
strain : <Gtype> WS2741 A-1 </Gtype> 
strain : <Gtype> WS 3294A </Gtype> 
strain : <Gtype> WS4087 A-1 </Gtype> 
strain : <Gtype> WS4264 A-1 </Gtype> 
strain : <Gtype> WS5874 A-1 </Gtype> 
strain : <Gtype> WS6582 A-1 </Gtype> 
strain : <Gtype> WS 6866B-1 </Gtype> 
strain : <Gtype> WS7179 A-2 </Gtype> 
strain : <Gtype> wt 3xflag strain </Gtype> 
strain information : E. coli harboring pRADgro : <Anti> : dr1558 </Anti> 
strain : <Med> BL21 ( DE3 ) </Med> 
strain : <Med> BL21 ( DE3 ) rne131 DrhlB </Med> 
strain : <Med> DY330 ( W3110 ) </Med> 
strain : <Med> K12 ( MG1655 ) </Med> 
strain : <Med> MDS42 ( RL1961 ) </Med> 
strain : <Med> MG1655 ( parent ) </Med> 
strain : <Med> MG1655 ( RL1655 ) </Med> 
strain : <Med> RSW421 ( RL1962 ) </Med> 
strain : <Med> RSW421 ( RL1967 ) </Med> 
strain : <Med> RSW422 ( RL1963 ) </Med> 
strain : <Med> RSW472 ( RL1966 ) </Med> 
strain : <Med> Suc-T110 ( parental strain ) </Med> 
Strain MG1655 cells were grown in <Med> MOPS minimal medium </Med> supplemented with <Supp> 0.2 % glucose </Supp> ( www.genome.wisc.edu/resources/protocols/mopsminimal.htm ) . 
Strain MG1655 or isogenic strain MG1655 HA3 : <Gtype> : nusG </Gtype> cells were grown in <Med> MOPS minimal medium </Med> supplemented with <Supp> 0.2 % glucose </Supp> ( www.genome.wisc.edu/resources/protocols/mopsminimal.htm ) . 
strainorline : <Strain> K-12 substr . </O> <Substrain> MG1655 
strains : <Gtype> K-12 BW25113 </Gtype> 
Strain : <Strain> K-12 reduced genome </O> 
strain : <Strain> K-12 substr . DH10B </O> 
strain : <Strain> K-12 substr . </O> <Substrain> MG1655 
strain : <Supp> ATCC 4157 </Supp> 
strain : <Supp> BCE008 _ </O> <Supp> MS1 
strain : <Supp> Crp _ </O> <Gtype> delAr1 
strain : <Supp> Crp _ </O> <Gtype> delAr1delAr2 
strain : <Supp> Crp _ </O> <Gtype> delAr2 
strain : <Supp> EDL 933 </Supp> 
strain : <Supp> GLBRCE1 _ </O> <Gtype> pBBR 
strain : <Supp> KCTC 2571 </Supp> 
strain : <Supp> MG 1655 </Supp> 
strain : <Supp> T3 5H5 M </Supp> 
strain : <Supp> WS 3572 A-1 </Supp> 
strain : <Supp> WS 3596 A-4 </Supp> 
strain : <Supp> WS 7162 A-1 </Supp> 
Strains were grown in LB at <Temp> 37 °C </Temp> with shaking at <Agit> 250 rpm </Agit> . 16 h overnight cultures were diluted to OD600 = 0.05 in HEPES-glucose ( 0.4 % ) , grown to OD600 ~ 0.6 , and exposed to 4.5 % deoxycholate for <Supp> 30 min </Supp> . 
Strains were grown in LBCm30 at <Temp> 37 °C </Temp> with shaking at <Agit> 250 rpm </Agit> . 16 h overnight cultures were diluted at 1:1000 into fresh LBCm30 , grown to OD600 ~ 1.0 , and induced with <Supp> 1 mM IPTG </Supp> for 90 min . 
Strains were grown in LBCm30 at <Temp> 37 °C </Temp> with shaking at <Agit> 250 rpm </Agit> . Overnight cultures were diluted into fresh LBCm30 , grown for 2.5 h , and induced with <Supp> 1 mM IPTG </Supp> for 90 min ( final OD600 = 1.6 ) . 
Strains were grown overnight in LB broth and then equalised to 0.15 optical density ( OD600nm ) units . Cells were collected and washed in <Med> EG minimal medium </Med> ( pH 7.2 ) . This wash step was repeated twice more with centrifugation to collect the cells . The final pellet was resuspended in 1 ml <Med> of 1X EG minimal ( pH </Med> 7.2 ) . Cells were grown to OD600 ~ 0.5-0.6 in a 40 ml volume in a 250 ml flask at <Temp> 37 °C </Temp> and 200 rpm . 
Streptomycin _ treatment _ plasmidmappedreads _ <Gtype> statistical _ output.txt : </O> <Gversion> NC _ </O> <Technique> 012692.1 
Strep _ treatment _ genomemappedreads _ <Gtype> statistical _ output.txt : </O> <Gversion> NC _ </O> <Technique> 000913.2 
stress : <Anti> control ( before perturbation ) </O> 
stress : <Gtype> Adenosine addition </Gtype> 
stress : <Gtype> Alanine addition </Gtype> 
stress : <Gtype> Aspartate addition </Gtype> 
stress : <Gtype> Cysteine addition </Gtype> 
stress : <Gtype> Cytidine addition </Gtype> 
stress : <Gtype> Glutamate addition </Gtype> 
stress : <Gtype> Glutamine addition </Gtype> 
stress : <Gtype> Glycine addition </Gtype> 
stress : <Gtype> Guanosine addition </Gtype> 
stress : <Gtype> heptanoic acid </Gtype> 
stress : <Gtype> Histidine addition </Gtype> 
stress : <Gtype> Isoleucine addition </Gtype> 
stress : <Gtype> Lysine addition </Gtype> 
stress : <Gtype> Methionine addition </Gtype> 
stress : <Gtype> Minimal medium </Gtype> 
stress : <Gtype> Phenylalanine addition </Gtype> 
stress : <Gtype> Proline addition </Gtype> 
stress : <Gtype> Serine addition </Gtype> 
stress : <Gtype> Threonine addition </Gtype> 
stress : <Gtype> Thymidine addition </Gtype> 
stress : <Gtype> Tryptophan addition </Gtype> 
stress : <Gtype> Uridine addition </Gtype> 
stress : <Gtype> Valine addition </Gtype> 
stress : <Supp> Arginine addition </Supp> 
<Substrain> MG1655 <Gtype> ∆ cspABCEG </Gtype> 
<Substrain> MG1655 <Gtype> ∆ cspABEG </Gtype> 
<Substrain> MG1655 <Gtype> ∆ cspBG </Gtype> 
<Substrain> MG1655 <Gtype> PhtpG : : lacZ delta lacX74/pTG2 ( vector carrying inducible Ptrc : : rpoH ) </Gtype> 
<Substrain> MG1655 <Gtype> PhtpG : : lacZ delta lacX74/ptrc99A ( control vector ) </Gtype> 
<Substrain> MG1655 <Gtype> ∆ rnr </Gtype> 
<Substrain> mg1655 </Substrain>
<Substrain> MG1655 </Substrain>
substrain : <Supp> ATCC 25922 </Supp> 
sucrose status : <Anti> no sucrose </Anti> 
<Supp> 0.2 ppm deoxynivalenol </Supp> 
<Supp> 0.2 ppm nivalenol </Supp> 
<Supp> 0 min </Supp> 
<Supp> 0x58 replicate 2 state 2 ( IPTG </Supp> + / aTc - / Ara - ) 
<Supp> 0x58 replicate 2 state </Supp> 1 ( IPTG - / aTc - / Ara - ) 
<Supp> 10B _ </O> <Supp> MG+PMA _ </O> <Phase> t60 
<Supp> 10 min </Supp> 
<Supp> 10 mM of sodium phosphate </Supp> and formaldehyde to a final concentration of 1 % were then added . After 10 min of incubation at room temperature , the samples were incubated <Supp> 30 min </Supp> in ice 
<Supp> 15 min </Supp> 
<Supp> 1A _ </O> <Supp> MG _ </O> <Phase> t0 
<Supp> 1B _ </O> <Supp> MG _ </O> <Phase> t0 
<Supp> 1C _ </O> <Supp> MG _ </O> <Phase> t0 
<Supp> 20 _ HF _ </O> <Gtype> HP _ </O> <Gtype> noDP -LSB- COPRO-Seq -RSB- </Gtype> 
<Supp> 2A _ </O> <Supp> MG _ </O> <Phase> t10 
<Supp> 2B _ </O> <Supp> MG _ </O> <Phase> t10 
<Supp> 2C _ </O> <Supp> MG _ </O> <Phase> t10 
<Supp> 30 ' in min </Supp> med +0.2 % glu +50 ug/ml Trp ,25 ug tot RNA 
<Supp> 30 min , 0.8 % butanol </Supp> 
<Supp> 30 min </Supp> 
<Supp> 30 min </Supp> minus ciprofloxacin 
<Supp> 30 min </Supp> plus ciprofloxacin 
<Supp> 30 min </Supp> , unstressed 
<Supp> 30 ' </Supp> 10 ug/ml indole aa , minimal medium + 0.2 % glu , 25 ug total 
<Supp> 30 ' </Supp> 15 ug/ml indole aa , 25 ug total RNA 
<Supp> 30 ' </Supp> +50 ug/ml Trp vs 0 ' in min med +0.2 % glu 
<Supp> 30 ' </Supp> vs 0 ' in minimal medium +0.2 % glu 
<Supp> 3A _ </O> <Supp> MG _ </O> <Phase> t30 
<Supp> 3B _ </O> <Supp> MG _ </O> <Phase> t30 
<Supp> 3C _ </O> <Supp> MG _ </O> <Phase> t30 
<Supp> 40 hours </Supp> 1 
<Supp> 40 hours </Supp> 2 
<Supp> 4A _ </O> <Supp> MG _ </O> <Phase> t60 
<Supp> 4B _ </O> <Supp> MG _ </O> <Phase> t60 
<Supp> 4C _ </O> <Supp> MG _ </O> <Phase> t60 
<Supp> 500 hours </Supp> 1 
<Supp> 500 hours </Supp> 2 
<Supp> 5A _ MG+H g _ </O> <Phase> t10 
<Supp> 5B _ MG+H g _ </O> <Phase> t10 
<Supp> 5C _ MG+H g _ </O> <Phase> t10 
<Supp> 5 min </Supp> 
<Supp> 60 min </Supp> 
<Supp> 6A _ MG+H g _ </O> <Phase> t30 
<Supp> 6B _ MG+H g _ </O> <Phase> t30 
<Supp> 6C _ MG+H g _ </O> <Phase> t30 
<Supp> 7A _ MG+H g _ </O> <Phase> t60 
<Supp> 7B _ MG+H g _ </O> <Phase> t60 
<Supp> 7C _ MG+H g _ </O> <Phase> t60 
<Supp> 8A _ </O> <Supp> MG+PMA _ </O> <Phase> t10 
<Supp> 8B _ </O> <Supp> MG+PMA _ </O> <Phase> t10 
<Supp> 8C _ </O> <Supp> MG+PMA _ </O> <Phase> t10 
<Supp> 9A _ </O> <Supp> MG+PMA _ </O> <Phase> t30 
<Supp> A0-A1 _ </O> <Supp> rep3 _ a </O> 
<Supp> A0-A1 _ rep1 _ a </O> 
<Supp> A0-A1 _ rep1 _ b </O> 
<Supp> A0-A1 _ rep2 _ a </O> 
<Supp> A0-A1 _ rep2 _ b </O> 
<Supp> A0-A1 _ rep3 _ b </O> 
<Supp> A0-E0 _ </O> <Supp> rep3 _ a </O> 
<Supp> A0-E0 _ rep1 _ a </O> 
<Supp> A0-E0 _ rep1 _ b </O> 
<Supp> A0-E0 _ rep2 _ a </O> 
<Supp> A0-E0 _ rep2 _ b </O> 
<Supp> A0-E0 _ rep3 _ b </O> 
<Supp> A2 Replicate 1 </Supp> 
<Supp> A4 Replicate 1 </Supp> 
<Supp> acetate </Supp>
<Supp> ACSH _ Exp _ CIYS </O> 
<Supp> ACSH _ Exp _ CNFT </O> 
<Supp> ACSH _ </O> <Supp> Stat1 _ </O> <Supp> CNFW 
<Supp> ACSH _ </O> <Supp> Stat1 _ </O> <Supp> CNGG 
<Supp> ACSH _ Trans _ CIYT </O> 
<Supp> ACSH _ Trans _ CNFU </O> 
<Supp> Alert </Supp>
<Supp> Archaea </Supp>
<Supp> Arginine addition </Supp> 
<Supp> Bacterium </Supp>
<Supp> Beta _ ChIP _ control _ A _ </O> <Phase> cy3 
<Supp> Bexp _ </O> <Supp> Bstat _ dyeswap1 </O> 
<Supp> Bexp _ </O> <Supp> Bstat _ dyeswap2 </O> 
<Supp> Bexp _ </O> <Supp> Bstat _ rep1 </O> 
<Supp> Bexp _ </O> <Supp> Bstat _ rep2 </O> 
<Supp> Bexp _ </O> <Supp> Kexp _ dyeswap1 </O> 
<Supp> Bexp _ </O> <Supp> Kexp _ dyeswap2 </O> 
<Supp> Bexp _ </O> <Supp> Kexp _ rep1 </O> 
<Supp> Bexp _ </O> <Supp> Kexp _ rep2 </O> 
<Supp> Bexp _ </O> <Supp> Kstat _ dyeswap1 </O> 
<Supp> Bexp _ </O> <Supp> Kstat _ dyeswap2 </O> 
<Supp> Bexp _ </O> <Supp> Kstat _ rep1 </O> 
<Supp> Bexp _ </O> <Supp> Kstat _ rep2 </O> 
<Supp> bla _ 1 min </Supp> 
<Supp> bla _ 2 min </Supp> 
<Supp> BnTR1 _ 42 _ rep1 </O> 
<Supp> BnTR1 _ 42 _ rep3 </O> 
<Supp> Bowtie 2 ( Langmead B & Salzberg SL , 2012 ) was used with default parameters , to remove any sequence reads aligning to ribosomal RNA , transfer RNA and non-coding RNA sequences . </O> 
<Supp> BW25113 _ </O> <Gtype> adhE mutant </Gtype> 
<Supp> BW25113-pCA24N _ arT LB 90 </O> <Supp> min 1 mM IPTG </Supp> 
<Supp> BW25113-pCA24N _ </O> <Gtype> dosP 
<Supp> BWG _ butanol _ 3passages </O> 
<Supp> BWY _ butanol _ 3passages </O> 
<Supp> BWY _ replicated </O> 
<Supp> ccdB _ </O> <Supp> K12 _ 0 _ </O> <Phase> r1 
<Supp> ccdB _ </O> <Supp> K12 _ 120 _ </O> <Phase> r1 
<Supp> ccdB _ </O> <Supp> K12 _ 60 _ </O> <Phase> r1 
<Supp> ccdB _ </O> <Supp> K12 _ 90 _ </O> <Phase> r1 
<Supp> ccdB _ </O> <Supp> K12 _ </O> <Supp> 30 _ </O> <Phase> r1 
<Supp> ccdB _ </O> <Supp> MG1063 _ 0 _ </O> <Phase> r1 
<Supp> ccdB _ </O> <Supp> MG1063 _ 0 _ </O> <Phase> r2 
<Supp> ccdB _ </O> <Supp> MG1063 _ 120 _ </O> <Phase> r1 
<Supp> ccdB _ </O> <Supp> MG1063 _ 60 _ </O> <Phase> r1 
<Supp> ccdB _ </O> <Supp> MG1063 _ 60 _ </O> <Phase> r2 
<Supp> ccdB _ </O> <Supp> MG1063 _ 90 _ </O> <Phase> r1 
<Supp> ccdB _ </O> <Supp> MG1063 _ 90 _ </O> <Phase> r2 
<Supp> ccdB _ </O> <Supp> MG1063 _ </O> <Supp> 30 _ </O> <Phase> r1 
<Supp> ccdB _ </O> <Supp> MG1063 _ </O> <Supp> 30 _ </O> <Phase> r2 
<Supp> ccdB _ </O> <Supp> W1863 _ 0 _ </O> <Phase> r1 
<Supp> ccdB _ </O> <Supp> W1863 _ 60 _ </O> <Phase> r1 
<Supp> ccdB _ </O> <Supp> W1863 _ 90 _ </O> <Phase> r1 
<Supp> ccdB _ </O> <Supp> W1863 _ </O> <Supp> 30 _ </O> <Phase> r1 
<Supp> cDNA _ A _ </O> <Phase> cy3 
<Supp> CFT073 in NaCl </Supp> 
<Supp> CFT073 _ LB+PAC s _ </O> <Gtype> rep3 
<Supp> CFT073 _ LB+PAC s _ rep1 </O> 
<Supp> CFT073 _ LB+PAC s _ rep2 </O> 
<Supp> CFT073 _ </O> <Supp> LB _ </O> <Phase> rep3 
<Supp> CFT073 _ </O> <Supp> LB _ rep1 </O> 
<Supp> CFT073 _ </O> <Supp> LB _ rep2 </O> 
<Supp> Channel 1 </O> 
<Supp> Chemostat 1 h irradiated </O> 
<Supp> ChIPExo-ArcA _ </O> <Gtype> ArcA8myc _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ </O> <Air> anaerobic _ 1 _ </O> <Anti> anti-myc 
<Supp> ChIPExo-ArcA _ </O> <Gtype> ArcA8myc _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ </O> <Air> anaerobic _ 2 _ </O> <Anti> anti-myc 
<Supp> ChIPExo-ArcA _ </O> <Gtype> ArcA8myc _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ </O> <Air> anaerobic _ 3 _ </O> <Anti> anti-myc 
<Supp> ChIPExo-RpoD _ </O> <Gtype> wt _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 1 _ anti-rpod </O> 
<Supp> ChIPExo-RpoD _ </O> <Gtype> wt _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 2 _ anti-rpod </O> 
<Supp> ChIPExo-RpoD _ </O> <Gtype> wt _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 3 _ anti-rpod </O> 
<Supp> ChIPExo-RpoD _ </O> <Gtype> wt _ </O> <Supp> fructose _ </O> <Supp> NH4Cl _ O2 _ 1 _ anti-rpod </O> 
<Supp> ChIPExo-RpoD _ </O> <Gtype> wt _ </O> <Supp> fructose _ </O> <Supp> NH4Cl _ O2 _ 2 _ anti-rpod </O> 
<Supp> ChIPExo-RpoD _ </O> <Gtype> wt _ </O> <Supp> fructose _ </O> <Supp> NH4Cl _ O2 _ 3 _ anti-rpod </O> 
<Supp> ChIPExo-RpoD _ </O> <Gtype> wt _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ O2 _ 1 _ anti-rpod </O> 
<Supp> ChIPExo-RpoD _ </O> <Gtype> wt _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ O2 _ 2 _ anti-rpod </O> 
<Supp> ChIPExo-RpoD _ </O> <Gtype> wt _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ O2 _ 3 _ anti-rpod </O> 
<Supp> CIP2G _ 00000 </O> 
<Supp> CIP2G _ 00045 </O> 
<Supp> CIP2G _ 00090 </O> 
<Supp> CIP2G _ 00135 </O> 
<Supp> CIP2G _ 00180 </O> 
<Supp> CIP4G _ 00000 </O> 
<Supp> CIP4G _ 00045 </O> 
<Supp> CIP4G _ 00090 </O> 
<Supp> CIP4G _ 00135 </O> 
<Supp> CIP4G _ 00180 </O> 
<Supp> Ciprofloxacin Rep 2 + A-IP </Supp> 
<Supp> Ciprofloxacin Rep 2 + A+IP </Supp> 
<Supp> CIPSG _ 00000 </O> 
<Supp> CIPSG _ 00045 </O> 
<Supp> CIPSG _ 00090 </O> 
<Supp> CIPSG _ 00135 </O> 
<Supp> CIPSG _ 00180 </O> 
<Supp> Coli-MDS42 _ bcm-100mcg / ml _ rep1 </O> 
<Supp> Coli-MDS42 _ bcm-100mcg / ml _ rep2 </O> 
<Supp> Coli-MDS42 _ no-drug _ rep1 </O> 
<Supp> Coli-MDS42 _ no-drug _ rep2 </O> 
<Supp> Coli-MDS42 _ </O> <Supp> del-nusA _ rep1 </O> 
<Supp> Coli-MDS42 _ </O> <Supp> del-nusA _ rep2 </O> 
<Supp> Coli-MDS42 _ </O> <Supp> del-nusG _ rep1 </O> 
<Supp> Coli-MDS42 _ </O> <Supp> del-nusG _ rep2 </O> 
<Supp> Coli-MG1655 _ bcm-100mcg / ml _ rep1 </O> 
<Supp> Coli-MG1655 _ bcm-100mcg / ml _ rep2 </O> 
<Supp> Coli-MG1655 _ bcm-10mcg / ml _ rep1 </O> 
<Supp> Coli-MG1655 _ bcm-10mcg / ml _ rep2 </O> 
<Supp> Coli-MG1655 _ bcm-25mcg / ml _ rep1 </O> 
<Supp> Coli-MG1655 _ bcm-25mcg / ml _ rep2 </O> 
<Supp> Coli-MG1655 _ no-drug _ rep1 </O> 
<Supp> Coli-MG1655 _ no-drug _ rep2 </O> 
<Supp> Coli-O157H7 _ bcm-100mcg / ml _ rep1 </O> 
<Supp> Coli-O157H7 _ bcm-100mcg / ml _ rep2 </O> 
<Supp> Coli-O157H7 _ no-drug _ rep1 </O> 
<Supp> Coli-O157H7 _ no-drug _ rep2 </O> 
<Supp> Control109 _ </O> <Supp> 0.8 % Bu </Supp> _ 1.5 h _ <Phase> rep3 
<Supp> Control109 _ </O> <Supp> 0.8 % Bu </Supp> _ 1.5 h _ rep1 
<Supp> Control109 _ </O> <Supp> 0.8 % Bu </Supp> _ 1.5 h _ rep2 
<Supp> Control </Supp>
<Supp> Crosslink </Supp>
<Supp> CV108 _ minus _ </O> <Supp> aMG _ 1 </O> 
<Supp> CV108 _ minus _ </O> <Supp> aMG _ 2 </O> 
<Supp> CV108 _ minus _ </O> <Supp> aMG _ 3 </O> 
<Supp> D2 _ 14 _ m10 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D2 _ 14 _ m11 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D2 _ 14 _ m12 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D2 _ 14 _ m13 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D2 _ 14 _ m1 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D2 _ 14 _ m2 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D2 _ 14 _ m3 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D2 _ 14 _ m4 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D2 _ 14 _ m5 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D2 _ 14 _ m7 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D2 _ 14 _ m8 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D2 _ 14 _ m9 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D2 _ 4 _ m10 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D2 _ 4 _ m11 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D2 _ 4 _ m12 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D2 _ 4 _ m13 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D2 _ 4 _ m1 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D2 _ 4 _ m3 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D2 _ 4 _ m4 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D2 _ 4 _ m5 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D2 _ 4 _ m6 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D2 _ 4 _ m7 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D2 _ 4 _ m8 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 10 _ m1 </O> 
<Supp> D3 _ 10 _ </O> <Phase> m10 
<Supp> D3 _ 10 _ </O> <Phase> m11 
<Supp> D3 _ 10 _ </O> <Phase> m12 
<Supp> D3 _ 10 _ </O> <Phase> m13 
<Supp> D3 _ 10 _ </O> <Phase> m2 
<Supp> D3 _ 10 _ </O> <Phase> m3 
<Supp> D3 _ 10 _ </O> <Phase> m4 
<Supp> D3 _ 10 _ </O> <Phase> m5 
<Supp> D3 _ 10 _ </O> <Phase> m6 
<Supp> D3 _ 10 _ </O> <Phase> m7 
<Supp> D3 _ 10 _ </O> <Phase> m8 
<Supp> D3 _ 10 _ </O> <Phase> m9 
<Supp> D3 _ 14 _ m10 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 14 _ m11 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 14 _ m12 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 14 _ m13 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 14 _ m2 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 14 _ m3 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 14 _ m4 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 14 _ m5 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 14 _ m6 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 14 _ m7 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 14 _ m8 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 14 _ m9 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 4 _ m10 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 4 _ m11 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 4 _ m12 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 4 _ m13 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 4 _ m1 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 4 _ m2 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 4 _ m3 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 4 _ m4 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 4 _ m5 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 4 _ m6 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 4 _ m7 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D3 _ 4 _ m8 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D4 _ 10 _ m1 </O> 
<Supp> D4 _ 10 _ </O> <Phase> m10 
<Supp> D4 _ 10 _ </O> <Phase> m11 
<Supp> D4 _ 10 _ </O> <Phase> m12 
<Supp> D4 _ 10 _ </O> <Phase> m13 
<Supp> D4 _ 10 _ </O> <Phase> m2 
<Supp> D4 _ 10 _ </O> <Phase> m3 
<Supp> D4 _ 10 _ </O> <Phase> m4 
<Supp> D4 _ 10 _ </O> <Phase> m5 
<Supp> D4 _ 10 _ </O> <Phase> m6 
<Supp> D4 _ 10 _ </O> <Phase> m7 
<Supp> D4 _ 10 _ </O> <Phase> m8 
<Supp> D4 _ 10 _ </O> <Phase> m9 
<Supp> D4 _ 14 _ m10 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D4 _ 14 _ m11 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D4 _ 14 _ m12 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D4 _ 14 _ m13 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D4 _ 14 _ m1 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D4 _ 14 _ m2 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D4 _ 14 _ m3 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D4 _ 14 _ m5 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D4 _ 14 _ m6 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D4 _ 14 _ m7 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D4 _ 14 _ m8 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D4 _ 14 _ m9 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D4 _ 4 _ m10 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D4 _ 4 _ m12 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D4 _ 4 _ m13 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D4 _ 4 _ m2 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D4 _ 4 _ m4 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D4 _ 4 _ m5 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D4 _ 4 _ m6 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D4 _ 4 _ m7 -LSB- COPRO-Seq -RSB- </O> 
<Supp> D4 _ 4 _ m8 -LSB- COPRO-Seq -RSB- </O> 
<Supp> DksA _ </O> <Gtype> wt _ untreated _ rep1 </O> 
<Supp> DksA _ </O> <Gtype> wt _ untreated _ rep2 </O> 
<Supp> DL4184C _ </O> <Technique> ChIP-seq 
<Supp> DL4201C _ </O> <Technique> ChIP-seq 
<Supp> DL4311C _ </O> <Technique> ChIP-seq 
<Supp> DL4312C _ </O> <Technique> ChIP-seq 
<Supp> DMSO _ </O> <Supp> 0 min </Supp> _ <Phase> rep3 
<Supp> DMSO _ </O> <Supp> 0 min </Supp> _ rep1 
<Supp> DMSO _ </O> <Supp> 0 min </Supp> _ rep2 
<Supp> DMSO _ </O> <Supp> 60 min </Supp> _ <Phase> rep3 
<Supp> DMSO _ </O> <Supp> 60 min </Supp> _ <Phase> rep4 
<Supp> DMSO _ </O> <Supp> 60 min </Supp> _ rep1 
<Supp> DMSO _ </O> <Supp> 60 min </Supp> _ rep2 
<Supp> DMS-seq 30 min </Supp> after shift to 10 °C in WT cells 
<Supp> DSP1 _ </O> <Gtype> Total 
<Supp> DSP1 _ </O> <Supp> AP 
<Supp> DSP2 _ </O> <Gtype> Total 
<Supp> DSP2 _ </O> <Supp> AP 
<Supp> DSP3 _ </O> <Gtype> Total 
<Supp> DSP3 _ </O> <Supp> AP 
<Supp> E0-E1 _ </O> <Supp> rep3 _ a </O> 
<Supp> E0-E1 _ rep1 _ a </O> 
<Supp> E0-E1 _ rep1 _ b </O> 
<Supp> E0-E1 _ rep2 _ a </O> 
<Supp> E0-E1 _ rep2 _ b </O> 
<Supp> E0-E1 _ rep3 _ b </O> 
<Supp> E1 _ 14 _ m1 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E11 _ 4 _ m1 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E1 _ 14 _ m1 </O> 
<Supp> E1 _ 14 _ m2 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E1 _ 14 _ m3 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E1 _ 14 _ m4 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E11 _ 4 _ m4 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E1 _ 14 _ m5 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E11 _ 4 _ m5 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E1 _ 14 _ m6 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E1 _ 14 _ m7 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E11 _ 4 _ m7 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E1 _ 14 _ m8 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E11 _ 4 _ m8 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E1 _ 14 _ m8 </O> 
<Supp> E1 _ 14 _ </O> <Phase> m2 
<Supp> E1 _ 14 _ </O> <Phase> m3 
<Supp> E1 _ 14 _ </O> <Phase> m4 
<Supp> E11 _ 6 _ m2 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E11 _ 6 _ m3 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E11 _ 6 _ m4 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E11 _ 6 _ m5 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E1 _ 1 _ m1 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E1 _ 1 _ m2 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E1 _ 1 _ m4 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E1 _ 1 _ m5 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E1 _ 1 _ m7 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E1 _ 1 _ m8 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E13 _ 4 _ m1 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E13 _ 4 _ m3 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E13 _ 4 _ m4 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E13 _ 4 _ m5 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E13 _ 4 _ m6 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E13 _ 4 _ m7 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E13 _ 4 _ m8 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E13 _ 6 _ m1 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E13 _ 6 _ m4 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E13 _ 6 _ m5 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E1 _ 4 _ m1 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E1 _ 4 _ m2 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E1 _ 4 _ m3 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E1 _ 4 _ m4 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E1 _ 4 _ m5 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E1 _ 4 _ m6 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E1 _ 4 _ m7 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E1 _ 4 _ m8 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E17 _ 4 _ m1 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E17 _ 4 _ m2 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E17 _ 4 _ m3 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E17 _ 4 _ m4 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E17 _ 4 _ m5 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E17 _ 4 _ m6 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E17 _ 4 _ m7 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E17 _ 4 _ m8 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E17 _ 6 _ m1 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E17 _ 6 _ m3 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E17 _ 6 _ m4 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E17 _ 6 _ m5 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E17 _ 6 _ m6 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E17 _ 6 _ m7 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E17 _ 6 _ m8 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E19 _ 4 _ m2 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E19 _ 4 _ m3 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E19 _ 4 _ m4 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E19 _ 4 _ m5 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E19 _ 4 _ m6 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E19 _ 4 _ m7 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E19 _ 4 _ m8 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E19 _ 6 _ m1 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E19 _ 6 _ m2 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E19 _ 6 _ m3 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E19 _ 6 _ m4 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E19 _ 6 _ m5 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E19 _ 6 _ m6 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E19 _ 6 _ m7 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E19 _ 6 _ m8 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E2 _ 14 _ m1 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E2 _ 14 _ m1 </O> 
<Supp> E2 _ 14 _ m2 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E2 _ 14 _ m3 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E2 _ 14 _ m4 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E2 _ 14 _ m5 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E2 _ 14 _ m6 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E2 _ 14 _ m7 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E2 _ 14 _ m8 </O> 
<Supp> E2 _ 14 _ </O> <Phase> m3 
<Supp> E2 _ 14 _ </O> <Phase> m4 
<Supp> E2 _ 14 _ </O> <Phase> m6 
<Supp> E2 _ 4 _ m1 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E2 _ 4 _ m2 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E2 _ 4 _ m3 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E2 _ 4 _ m4 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E2 _ 4 _ m5 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E2 _ 4 _ m6 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E2 _ 4 _ m7 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E2 _ 4 _ m8 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E3 _ 14 _ m1 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E3 _ 14 _ m2 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E3 _ 14 _ m3 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E3 _ 14 _ m4 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E3 _ 14 _ m6 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E3 _ 14 _ m7 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E3 _ 14 _ m8 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E3 _ 4 _ m2 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E3 _ 4 _ m3 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E3 _ 4 _ m4 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E3 _ 4 _ m5 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E3 _ 4 _ m6 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E3 _ 4 _ m7 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E3 _ 4 _ m8 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E4 + O2 1 </Supp> 
<Supp> E4 + O2 2 </Supp> 
<Supp> E9 _ 4 _ m1 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E9 _ 4 _ m2 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E9 _ 4 _ m3 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E9 _ 4 _ m4 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E9 _ 4 _ m5 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E9 _ 4 _ m6 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E9 _ 4 _ m7 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E9 _ 4 _ m8 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E9 _ 6 _ m2 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E9 _ 6 _ m3 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E9 _ 6 _ m4 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E9 _ 6 _ m5 -LSB- COPRO-Seq -RSB- </O> 
<Supp> E9 _ 6 _ m7 -LSB- COPRO-Seq -RSB- </O> 
<Supp> EC _ Cont1 _ </O> <Gtype> RNA 
<Supp> EC _ Cont2 _ DNA </O> 
<Supp> EC _ Cont2 _ </O> <Gtype> RNA 
<Supp> ECDH5 _ </O> <Supp> GD _ </O> <Supp> RP1 
<Supp> EC _ </O> <Gtype> Cont1 _ DNA </O> 
<Supp> EC _ </O> <Gtype> Trim2 _ </O> <Gtype> RNA 
<Supp> E.coli 2 minutes after BRP induction </O> 
<Supp> E _ coli _ negativ _ control _ left _ chamber _ </O> <Phase> rep3 
<Supp> E _ coli _ negativ _ control _ left _ chamber _ rep1 </O> 
<Supp> E _ coli _ negativ _ control _ left _ chamber _ rep2 </O> 
<Supp> E _ coli _ negativ _ control _ right _ chamber _ </O> <Phase> rep3 
<Supp> E _ coli _ negativ _ control _ right _ chamber _ rep1 </O> 
<Supp> E _ coli _ negativ _ control _ right _ chamber _ rep2 </O> 
<Supp> E.coliO157 _ 0.5 % ( w/v ) sodiumbenzoate _ </O> <Supp> 0 min </Supp> _ rep1 
<Supp> E.coliO157 _ 0.5 % ( w/v ) sodiumbenzoate _ </O> <Supp> 0 min </Supp> _ rep2 
<Supp> E.coliO157 _ 0.5 % ( w/v ) sodiumbenzoate _ </O> <Supp> 15 min </Supp> _ rep1 
<Supp> E.coliO157 _ 0.5 % ( w/v ) sodiumbenzoate _ </O> <Supp> 15 min </Supp> _ rep2 
<Supp> E.coliO157 _ 0.5 % ( w/v ) sodiumbenzoate _ </O> <Supp> 30 min </Supp> _ rep1 
<Supp> E.coliO157 _ 0.5 % ( w/v ) sodiumbenzoate _ </O> <Supp> 30 min </Supp> _ rep2 
<Supp> E.coliO157 _ 0.5 % ( w/v ) sodiumbenzoate _ </O> <Supp> 5 min </Supp> _ rep1 
<Supp> E.coliO157 _ 0.5 % ( w/v ) sodiumbenzoate _ </O> <Supp> 5 min </Supp> _ rep2 
<Supp> E.coliO157 _ 0.5 % ( w/v ) sodiumbenzoate _ </O> <Supp> 60 min </Supp> _ rep1 
<Supp> E.coliO157 _ 0.5 % ( w/v ) sodiumbenzoate _ </O> <Supp> 60 min </Supp> _ rep2 
<Supp> E.coliO157 _ 0 % sodiumbenzoate _ </O> <Supp> 0 min </Supp> _ rep1 
<Supp> E.coliO157 _ 0 % sodiumbenzoate _ </O> <Supp> 0 min </Supp> _ rep2 
<Supp> E.coliO157 _ 0 % sodiumbenzoate _ </O> <Supp> 15 min </Supp> _ rep1 
<Supp> E.coliO157 _ 0 % sodiumbenzoate _ </O> <Supp> 15 min </Supp> _ rep2 
<Supp> E.coliO157 _ 0 % sodiumbenzoate _ </O> <Supp> 30 min </Supp> _ rep1 
<Supp> E.coliO157 _ 0 % sodiumbenzoate _ </O> <Supp> 30 min </Supp> _ rep2 
<Supp> E.coliO157 _ 0 % sodiumbenzoate _ </O> <Supp> 5 min </Supp> _ rep1 
<Supp> E.coliO157 _ 0 % sodiumbenzoate _ </O> <Supp> 5 min </Supp> _ rep2 
<Supp> E.coliO157 _ 0 % sodiumbenzoate _ </O> <Supp> 60 min </Supp> _ rep1 
<Supp> E.coliO157 _ 0 % sodiumbenzoate _ </O> <Supp> 60 min </Supp> _ rep2 
<Supp> E _ coli _ response _ control _ </O> <Supp> 1mM _ </O> <Supp> H2O2 _ added _ </O> <Phase> rep3 
<Supp> E _ coli _ response _ control _ </O> <Supp> 1mM _ </O> <Supp> H2O2 _ added _ rep1 </O> 
<Supp> E _ coli _ response _ control _ </O> <Supp> 1mM _ </O> <Supp> H2O2 _ added _ rep2 </O> 
<Supp> E _ coli _ response _ control _ water _ added _ </O> <Phase> rep3 
<Supp> E _ coli _ response _ control _ water _ added _ rep1 </O> 
<Supp> E _ coli _ response _ control _ water _ added _ rep2 </O> 
<Supp> E _ coli _ transcriptome _ 1 </O> 
<Supp> E _ coli _ transcriptome _ 2 </O> 
<Supp> E _ coli _ treated _ powerline _ interm _ 15h _ </O> <Phase> rep3 
<Supp> E _ coli _ treated _ powerline _ interm _ 15h _ rep1 </O> 
<Supp> E _ coli _ treated _ powerline _ interm _ 15h _ rep2 </O> 
<Supp> E _ coli _ treated _ powerline _ interm _ 15h _ rep3 </O> 
<Supp> E _ coli _ treated _ powerline _ interm _ 2.5 h _ </O> <Phase> rep3 
<Supp> E _ coli _ treated _ powerline _ interm _ 2.5 h _ rep1 </O> 
<Supp> E _ coli _ treated _ powerline _ interm _ 2.5 h _ rep2 </O> 
<Supp> E _ coli _ treated _ powerline _ interm _ 2.5 h _ rep3 </O> 
<Supp> E _ coli _ treated _ powerline _ interm _ </O> <Supp> 8 min </Supp> _ <Phase> rep3 
<Supp> E _ coli _ treated _ powerline _ interm _ </O> <Supp> 8 min </Supp> _ rep1 
<Supp> E _ coli _ treated _ powerline _ interm _ </O> <Supp> 8 min </Supp> _ rep2 
<Supp> E _ coli _ treated _ sinusoidal _ cont _ 15h _ </O> <Phase> rep3 
<Supp> E _ coli _ treated _ sinusoidal _ cont _ 15h _ rep1 </O> 
<Supp> E _ coli _ treated _ sinusoidal _ cont _ 15h _ rep2 </O> 
<Supp> E _ coli _ treated _ sinusoidal _ cont _ 15h _ rep3 </O> 
<Supp> E _ coli _ treated _ sinusoidal _ cont _ 2.5 h _ </O> <Phase> rep3 
<Supp> E _ coli _ treated _ sinusoidal _ cont _ 2.5 h _ rep1 </O> 
<Supp> E _ coli _ treated _ sinusoidal _ cont _ 2.5 h _ rep2 </O> 
<Supp> E _ coli _ treated _ sinusoidal _ cont _ 2.5 h _ rep3 </O> 
<Supp> E _ coli _ treated _ sinusoidal _ cont _ </O> <Supp> 8 min </Supp> _ <Phase> rep3 
<Supp> E _ coli _ treated _ sinusoidal _ cont _ </O> <Supp> 8 min </Supp> _ rep1 
<Supp> E _ coli _ treated _ sinusoidal _ cont _ </O> <Supp> 8 min </Supp> _ rep2 
<Supp> E _ coli _ treated _ sinusoidal _ interm _ 15h _ </O> <Phase> rep3 
<Supp> E _ coli _ treated _ sinusoidal _ interm _ 15h _ rep1 </O> 
<Supp> E _ coli _ treated _ sinusoidal _ interm _ 15h _ rep2 </O> 
<Supp> E _ coli _ treated _ sinusoidal _ interm _ 15h _ rep3 </O> 
<Supp> E _ coli _ treated _ sinusoidal _ interm _ 2.5 h _ </O> <Phase> rep3 
<Supp> E _ coli _ treated _ sinusoidal _ interm _ 2.5 h _ rep1 </O> 
<Supp> E _ coli _ treated _ sinusoidal _ interm _ 2.5 h _ rep2 </O> 
<Supp> E _ coli _ treated _ sinusoidal _ interm _ 2.5 h _ rep3 </O> 
<Supp> Eco _ </O> <Supp> TolC _ </O> <Supp> 15 min </Supp> _ control _ A 
<Supp> Eco _ </O> <Supp> TolC _ </O> <Supp> 15 min </Supp> _ control _ B 
<Supp> Eco _ </O> <Supp> TolC _ </O> <Supp> 15 min </Supp> _ <Supp> Carolacton _ A </O> 
<Supp> Eco _ </O> <Supp> TolC _ </O> <Supp> 15 min </Supp> _ <Supp> Carolacton _ B </O> 
<Supp> Eco _ </O> <Supp> TolC _ </O> <Supp> 30 min </Supp> _ control _ A 
<Supp> Eco _ </O> <Supp> TolC _ </O> <Supp> 30 min </Supp> _ control _ B 
<Supp> Eco _ </O> <Supp> TolC _ </O> <Supp> 30 min </Supp> _ <Supp> Carolacton _ A </O> 
<Supp> Eco _ </O> <Supp> TolC _ </O> <Supp> 30 min </Supp> _ <Supp> Carolacton _ B </O> 
<Supp> Eco _ </O> <Supp> TolC _ </O> <Supp> 5 min </Supp> _ control _ A 
<Supp> Eco _ </O> <Supp> TolC _ </O> <Supp> 5 min </Supp> _ control _ B 
<Supp> Eco _ </O> <Supp> TolC _ </O> <Supp> 5 min </Supp> _ <Supp> Carolacton _ A </O> 
<Supp> Eco _ </O> <Supp> TolC _ </O> <Supp> 5 min </Supp> _ <Supp> Carolacton _ B </O> 
<Supp> Eco _ TolC _ </O> <Supp> 0 min </Supp> _ A 
<Supp> Eco _ TolC _ </O> <Supp> 0 min </Supp> _ B 
<Supp> EC _ Trim1 _ DNA </O> 
<Supp> EC _ Trim1 _ </O> <Gtype> RNA 
<Supp> EC _ Trim2 _ DNA </O> 
<Supp> EDC1 _ </O> <Gtype> Total 
<Supp> EDC1 _ </O> <Supp> AP 
<Supp> EDL933 _ </O> <Supp> LB _ II </O> 
<Supp> EDL933 _ </O> <Supp> LB _ </O> <Technique> I 
<Supp> EGS212 _ </O> <Supp> MlfabH _ rep _ 1 </O> 
<Supp> EGS212 _ </O> <Supp> MlfabH _ rep _ 2 </O> 
<Supp> EGS212 _ </O> <Supp> MlfabH _ rep _ 3 </O> 
<Supp> EGS212 _ </O> <Supp> MlfabH _ rep _ 4 </O> 
<Supp> EGS212 _ </O> <Supp> MlfabH _ rep _ 5 </O> 
<Supp> EmptyVector _ 42 _ rep1 </O> 
<Supp> EmptyVector _ 42 _ rep2 </O> 
<Supp> EmptyVector _ 42 _ rep3 </O> 
<Supp> EmptyVector _ </O> <Supp> 37 _ rep1 </O> 
<Supp> EmptyVector _ </O> <Supp> 37 _ rep3 </O> 
<Supp> EvgSc _ ompR _ 1 </O> 
<Supp> EvgSc _ ompR _ 2 </O> 
<Supp> Exp 1 _ </O> <Phase> control 
<Supp> Exp 1 </Supp> _ IP sample 
<Supp> Exp 2 _ IP sample </O> 
<Supp> Exp 2 _ </O> <Phase> control 
<Supp> Flask state 2 ( IPTG </Supp> + / aTc - / Ara - ) 
<Supp> FNR _ </O> <Supp> IP _ </O> <Supp> ChIP-seq _ </O> <Air> Anaerobic _ A _ WIG.wig : </O> <Gversion> U00096 .2 </Gversion> 
<Supp> FNR _ </O> <Supp> IP _ </O> <Supp> ChIP-seq _ </O> <Air> Anaerobic _ B _ WIG.wig : </O> <Gversion> U00096 .2 </Gversion> 
<Supp> Fur-minus _ </O> <Supp> cDNA _ </O> <Air> Aerobic 
<Supp> Fur-minus _ </O> <Supp> cDNA _ </O> <Air> Anaerobic 
<Supp> Fur-minus _ RyhB-minus _ cDNA _ </O> <Air> Aerobic 
<Supp> Fur-minus _ RyhB-minus _ cDNA _ </O> <Air> Anaerobic 
<Supp> FUR _ </O> <Supp> CPR _ 1 </O> 
<Supp> FUR _ </O> <Supp> CPR _ 2 </O> 
<Supp> FUR _ </O> <Supp> noCPR _ 1 </O> 
<Supp> FUR _ </O> <Supp> noCPR _ 2 </O> 
<Supp> G2 Replicate 1 </Supp> 
<Supp> G3 Replicate 1 </Supp> 
<Supp> G5 Replicate 1 </Supp> 
<Supp> G6 Replicate 1 </Supp> 
<Supp> gDNA _ A _ </O> <Phase> cy5 
<Supp> gDNA _ EColi _ 520 </O> 
<Supp> gDNA _ EColi _ 521 </O> 
<Supp> gDNA _ EColi _ </O> <Gtype> B02 
<Supp> gDNA _ EColi _ </O> <Gtype> B05 
<Supp> gDNA _ EColi _ </O> <Gtype> C01 
<Supp> gDNA _ EColi _ </O> <Gtype> C02 
<Supp> gDNA _ EColi _ </O> <Gtype> F01 
<Supp> gDNA _ EColi _ </O> <Gtype> F02 
<Supp> gDNA _ EColi _ </O> <Gtype> H01 
<Supp> gDNA _ EColi _ </O> <Gtype> H02 
<Supp> gDNA _ EColi _ </O> <Gtype> H03 
<Supp> gDNA _ EColi _ </O> <Gtype> H04 
<Supp> gDNA _ EColi _ </O> <Gtype> H05 
<Supp> gDNA _ EColi _ </O> <Gtype> H12 
<Supp> gDNA _ EColi _ </O> <Gtype> H23 
<Supp> gDNA _ EColi _ </O> <Gtype> H27 
<Supp> gDNA _ Ecoli _ </O> <Gtype> K12 
<Supp> gDNA _ EColi _ </O> <Gtype> S04 
<Supp> gDNA _ EColi _ </O> <Gtype> S05 
<Supp> gDNA _ EColi _ </O> <Gtype> S13 
<Supp> GLBRCE1 _ ACSH _ Exp _ rep318 _ 1 </O> 
<Supp> GLBRCE1 _ ACSH _ Exp _ rep320 _ 1 </O> 
<Supp> GLBRCE1 _ ACSH _ Exp _ rep327 _ 1 </O> 
<Supp> GLBRCE1 _ ACSH _ </O> <Gtype> Stat 
<Supp> GLBRCE1 _ ACSH _ </O> <Technique> Exp 
<Supp> GLBRCE1 _ ACSH _ </O> <Technique> Trans 
<Supp> GLBRCE1 _ </O> <Supp> ACSH _ </O> <Supp> Stat1 _ rep318 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> ACSH _ </O> <Supp> Stat1 _ rep320 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> ACSH _ </O> <Supp> Stat1 _ rep327 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> ACSH _ </O> <Supp> Stat2 _ rep318 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> ACSH _ </O> <Supp> Stat2 _ rep320 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> ACSH _ </O> <Supp> Stat2 _ rep327 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> ACSH _ </O> <Supp> Trans _ rep318 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> ACSH _ </O> <Supp> Trans _ rep318 _ 2 </O> 
<Supp> GLBRCE1 _ </O> <Supp> ACSH _ </O> <Supp> Trans _ rep320 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> ACSH _ </O> <Supp> Trans _ rep327 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> pBBR _ ACSH _ </O> <Gtype> Stat 
<Supp> GLBRCE1 _ </O> <Supp> pBBR _ ACSH _ </O> <Technique> Exp 
<Supp> GLBRCE1 _ </O> <Supp> pBBR _ ACSH _ </O> <Technique> Trans 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> Exp _ rep318 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> Exp _ rep318 _ 2 </O> 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> Exp _ rep320 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> Exp _ rep327 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> LT _ </O> <Supp> Exp _ rep318 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> LT _ </O> <Supp> Exp _ rep320 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> LT _ </O> <Supp> Exp _ rep327 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> LT _ </O> <Supp> Stat1 _ rep318 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> LT _ </O> <Supp> Stat1 _ rep320 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> LT _ </O> <Supp> Stat1 _ rep327 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> LT _ </O> <Supp> Stat2 _ rep318 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> LT _ </O> <Supp> Stat2 _ rep320 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> LT _ </O> <Supp> Stat2 _ rep327 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> LT _ </O> <Supp> Trans _ rep318 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> LT _ </O> <Supp> Trans _ rep320 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> LT _ </O> <Supp> Trans _ rep327 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> Stat1 _ rep318 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> Stat1 _ rep320 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> Stat1 _ rep327 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> Stat2 _ rep327 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> Trans _ rep318 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> Trans _ rep320 _ 1 </O> 
<Supp> GLBRCE1 _ </O> <Supp> SynH _ </O> <Supp> Trans _ rep327 _ 1 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 016 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 017 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 018 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 019 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 020 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 021 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 022 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 023 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 024 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 025 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 026 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 027 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 028 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 029 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 030 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 031 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 032 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 033 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 097 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 098 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 099 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 100 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 101 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 102 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 103 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 104 </O> 
<Supp> glucose _ time _ course : </O> <Supp> MURI _ 105 </O> 
<Supp> Hns -180 min </Supp> 
<Supp> HS15min _ r1 _ </O> <Gtype> HiSeq 
<Supp> HS15min _ r2 _ </O> <Gtype> HiSeq 
<Supp> HS15min _ r3 _ GAII </O> 
<Supp> HS30min _ r1 _ </O> <Gtype> HiSeq 
<Supp> HS30min _ r2 _ </O> <Gtype> HiSeq 
<Supp> HS60min _ r1 _ </O> <Gtype> HiSeq 
<Supp> HS60min _ r2 _ </O> <Gtype> HiSeq 
<Supp> Human </Supp>
<Supp> INPUT _ ChIP-seq _ </O> <Air> Aerobic _ WIG.wig : </O> <Gversion> U00096 .2 </Gversion> 
<Supp> Jaguar </Supp>
<Supp> KMD 1 </Supp> 
<Supp> KMD 2 </O> 
<Supp> lacZ _ 1 min </Supp> 
<Supp> lacZ _ 2 min </Supp> 
<Supp> lacZ _ </O> <Supp> 4 min </Supp> 
<Supp> lacZ _ </O> <Supp> K12 _ 0 _ </O> <Phase> r1 
<Supp> lacZ _ </O> <Supp> K12 _ 120 _ </O> <Phase> r1 
<Supp> lacZ _ </O> <Supp> K12 _ 60 _ </O> <Phase> r1 
<Supp> lacZ _ </O> <Supp> K12 _ 90 _ </O> <Phase> r1 
<Supp> lacZ _ </O> <Supp> K12 _ </O> <Supp> 30 _ </O> <Phase> r1 
<Supp> lacZ _ </O> <Supp> MG1063 _ 0 _ </O> <Phase> r1 
<Supp> lacZ _ </O> <Supp> MG1063 _ 0 _ </O> <Phase> r2 
<Supp> lacZ _ </O> <Supp> MG1063 _ 120 _ </O> <Phase> r1 
<Supp> lacZ _ </O> <Supp> W1863 _ 0 _ </O> <Phase> r1 
<Supp> LA _ </O> <Supp> TP2 _ </O> <Phase> repl1 
<Supp> LA _ </O> <Supp> TP2 _ </O> <Phase> repl2 
<Supp> LA _ </O> <Supp> TP2 _ </O> <Phase> repl3 
<Supp> LA _ </O> <Supp> TP2 _ </O> <Phase> repl4 
<Supp> LA _ </O> <Supp> TP2 _ </O> <Phase> repl5 
<Supp> LA _ </O> <Supp> TP3 _ </O> <Phase> repl1 
<Supp> LA _ </O> <Supp> TP3 _ </O> <Phase> repl2 
<Supp> LA _ </O> <Supp> TP3 _ </O> <Phase> repl3 
<Supp> LA _ </O> <Supp> TP3 _ </O> <Phase> repl4 
<Supp> LA _ </O> <Supp> TP3 _ </O> <Phase> repl5 
<Supp> LA _ </O> <Supp> TP4 _ </O> <Phase> repl1 
<Supp> LA _ </O> <Supp> TP4 _ </O> <Phase> repl2 
<Supp> LA _ </O> <Supp> TP4 _ </O> <Phase> repl3 
<Supp> LA _ </O> <Supp> TP4 _ </O> <Phase> repl4 
<Supp> LA _ </O> <Supp> TP4 _ </O> <Phase> repl5 
<Supp> LBTMP50 _ </O> <Supp> 10 min </Supp> 
<Supp> LBTMP50 _ </O> <Supp> 30 min </Supp> 
<Supp> LBTMP50 _ </O> <Supp> 60 min </Supp> 
<Supp> LELab _ ChIP _ seq _ TLS1637 _ anti _ </O> <Supp> FLAG 
<Supp> LELab _ ChIP _ seq _ TLS1638 _ anti _ </O> <Supp> FLAG 
<Supp> LELab _ ChIP _ seq _ TLS1639 _ anti _ </O> <Supp> FLAG 
<Supp> LELab _ ChIP _ seq _ TLS1640 _ anti _ </O> <Supp> FLAG 
<Supp> LELab _ ChIP _ seq _ TLS1641 _ anti _ </O> <Supp> FLAG 
<Supp> LELab _ ChIP _ seq _ TLS1642 _ anti _ </O> <Supp> FLAG 
<Supp> LELAb _ ChIP _ seq _ TLS1643 _ anti _ </O> <Supp> FLAG 
<Supp> LELab _ ChIP _ seq _ TLS1644 _ anti _ </O> <Supp> FLAG 
<Supp> LELab _ ChIP _ seq _ TLS1645 _ anti _ </O> <Supp> FLAG 
<Supp> LELab _ ChIP _ seq _ TLS1646 _ anti _ </O> <Supp> FLAG 
<Supp> LELab _ ChIP _ seq _ TLS1647 _ anti _ </O> <Supp> FLAG 
<Supp> LELab _ ChIP _ seq _ TLS1648 _ anti _ </O> <Supp> FLAG 
<Supp> LELab _ ChIP _ seq _ TLS1649 _ anti _ </O> <Supp> FLAG 
<Supp> LELab _ ChIP _ seq _ TLS1650 _ anti _ </O> <Supp> FLAG 
Supplementary files contain the following : <Gtype> Raw Signal Values : The term `` raw '' </Gtype> signal values refer to the linear data after thresholding and summarization Summarization is performed by computing the geometric mean . Raw data filtered on Expression ( 20.0 - 343943.344 ) • Normalized Signal Values : `` Normalized '' value is the value generated after log transformation and normalization ( Shift to 75 percentile ) and baseline transformation . 
Supplementary _ files _ format _ and _ content : <Anti> Enrichement ( IP/input ) wig files were generated using homemade matlab code </O> 
Supplementary _ files _ format _ and _ content : Each wig file contains the alignd reads of each <Technique> ChIP-exo sample . </O> 
Supplementary _ files _ format _ and _ content : <Gtype> All in tab-delimited ASCII format . raw_count.txt ( pre-normalized read count ) , normalized_count.txt , panGeneMap.txt ( geneID map between the strains and pangene ID ) , Gene_annotations.txt ( annotation of genes ) </O> 
Supplementary _ files _ format _ and _ content : <Gtype> Bedgraphs files representing the extracted peak data </O> 
Supplementary _ files _ format _ and _ content : <Gtype> Bedgraph wiggle files were created for each sample and replicate for all reads aligned to the genome after computational rRNA and tRNA subtraction </O> 
Supplementary _ files _ format _ and _ content : <Gtype> BIGWIG file containing coverage tracks from 3 ' RACE data </O> 
Supplementary _ files _ format _ and _ content : <Gtype> BigWIG files are provided showing uniquely mapped sequence reads . </O> 
Supplementary _ files _ format _ and _ content : <Gtype> chromosome chromosomeStartPosition chromosomeStopPosition readCoverage </Gtype> ( positive values on + strand , negative on - strand ) 
Supplementary _ files _ format _ and _ content : <Gtype> Comma-delimited text file includes RPKM values for each Sample . </O> 
Supplementary _ files _ format _ and _ content : <Gtype> comma-delimited text files include FPKM values for each Sample . </O> 
Supplementary _ files _ format _ and _ content : <Gtype> comma-delimited text files include RPKM values for each Sample </O> 
Supplementary _ files _ format _ and _ content : <Gtype> Comma separated value files include log-fold changes and associated p-values for each comparison made </O> 
Supplementary _ files _ format _ and _ content : <Gtype> DMS-seq data ( pooled Total and Ribo - RNA ) is provided in the form of RNA Framework 's ( http://www.rnaframework.com ) RNA Count ( RC ) files . For a detailed description of the RC format , please refer to : </O> <Gtype> http://rnaframework.readthedocs.io/en/latest/rf-count/#rc-rna-count-format 
Supplementary _ files _ format _ and _ content : <Gtype> Excel file include FPKM values of different genes for each sample </O> 
Supplementary _ files _ format _ and _ content : <Gtype> Excel files include FPKM values for each sample . </O> 
Supplementary _ files _ format _ and _ content : <Gtype> Excel formatted matrix table containing transcript coordinates , normalized abundance estimates across the biological replicates and fold-changes in gene expression between cells expressing Vector and DicF . </O> 
Supplementary _ files _ format _ and _ content : <Gtype> GFF file containing 3 ' end annotations </O> 
Supplementary _ files _ format _ and _ content : <Gtype> htcount : expression </Gtype> count for each gene and its name . 
Supplementary _ files _ format _ and _ content : <Gtype> In the . txt files the first column is the coordinate of the base corresponding to NC _ 000913.3 and the second column is the number of normalized reads at that position . All 0 values were given a pseudocount of 0.01 . Counts are normalized so that the averages of ssrA , ssrS , and rnpB are stable throughout the decay from 0 to 20 minutes </O> 
Supplementary _ files _ format _ and _ content : <Gtype> Microsoft excel spreadsheet files include RPKM values for each gene of sample </O> 
Supplementary _ files _ format _ and _ content : <Gtype> rna-seq : genomic </Gtype> position ( middle of the 5kb-bin ) to each count . 3C seq : contact maps ( 2D array of 928 5kb-bins x 928 5kb-bins ) . 
Supplementary _ files _ format _ and _ content : <Gtype> SPET-seq data ( pooled Total and Ribo - RNA from both replicates ) is provided in the form of RNA Framework 's ( http://www.rnaframework.com ) RNA Count ( RC ) files . For each analyzed transcript , 10 files corresponding to SPET-seq data for the 10 transcription deciles are provided . For a detailed description of the RC format , please refer to : </O> <Gtype> http://rnaframework.readthedocs.io/en/latest/rf-count/#rc-rna-count-format 
Supplementary _ files _ format _ and _ content : <Gtype> Strain-expression . xlsx archive contains expression values in RPKM ( Reads Per Kb exon ( contig ) per Million mapped reads ( see Mortazavi et al. 2008 , Nat Methods . 5 ( 7 ) : </O> <Gtype> 621-8 ) and can be directly compared to each other ) tab-delimited text files include RPKM values for each Sample . </O> 
Supplementary _ files _ format _ and _ content : <Gtype> Tab-delimited text file ; genes in rows and samples in columns ; each entry corresponds to the number of reads mapping to the given gene in the given sample . </O> 
Supplementary _ files _ format _ and _ content : <Gtype> tab-delimited text file of transition error rate per position . The position is corresponding to the position of \ Sequenced region of pPR9 plasmid \ ( one of the attached txt file ) . </O> 
Supplementary _ files _ format _ and _ content : <Gtype> tab-delimited text files include count values for each Sample . </O> 
Supplementary _ files _ format _ and _ content : <Gtype> tab-delimited text files include CPM values for each Sample </O> 
Supplementary _ files _ format _ and _ content : <Gtype> tab-delimited text files include gene expresion values for each Sample </O> 
Supplementary _ files _ format _ and _ content : <Gtype> tab-delimited text files include RPKM values for each Sample </O> 
Supplementary _ files _ format _ and _ content : <Gtype> tab-delimited text files include RPKM values for each Sample . </O> 
Supplementary _ files _ format _ and _ content : <Gtype> tab-delimited text files include RPKM values for each Sample ... </O> 
Supplementary _ files _ format _ and _ content : <Gtype> Tab-delimited text files include RPKM values for each sample </O> 
Supplementary _ files _ format _ and _ content : <Gtype> tab-delimited text files include the average of the expression values obtained in Rockhopper for the replicates of each condition </O> 
Supplementary _ files _ format _ and _ content : <Gtype> tab-delimited text files include TPM values for each Sample ; column1 : </O> <Gtype> transcript id ; column2 : TPM value </Gtype> 
Supplementary _ files _ format _ and _ content : <Gtype> Tab-delimited text files in gff format which has 8 columns : sequence id , source ( empty ) , feature ( + / - strand ) , start position , end position , intensity score , strand ( + / - ) , frame ( . ) , attribute ( . ) . </O> 
Supplementary _ files _ format _ and _ content : <Gtype> Txt files are processed data for DMS-MaPseq with two columns : </O> <Gtype> first column containing chromosome positions ( relative to transcription start site ( 1 ) of cspA ) and second column containing the mutation rate . </O> 
Supplementary _ files _ format _ and _ content : <Gtype> txt : tab-delimited </Gtype> text files include RPKM values for each Sample 
Supplementary _ files _ format _ and _ content : <Gtype> WIG files are provided showing uniquely mapped sequence reads ( normalized ) . </O> 
Supplementary _ files _ format _ and _ content : <OD> BedGraphs of the reads before and after TAP treatment for each of the samples . Separate files are provided for the forward and reverse strands . </O> 
Supplementary _ files _ format _ and _ content : <OD> Table of read counts with genes as rows and samples as columns . </O> 
Supplementary _ files _ format _ and _ content : <Supp> CoK12 _ LB.xlsx : </O> <Gtype> Average expression values of reads related with MG1655 strain in samples Co-culture _ LB1 and LB2 </O> 
Supplementary _ files _ format _ and _ content : <Supp> Column 1 names the nucleotide in the genome , column 2 gives counts for the forward strand , column 3 for the reverse strand , columns are tab separated </O> 
Supplementary _ files _ format _ and _ content : <Supp> CoT1E _ LB.xlsx : </O> <Gtype> Average expression values of reads related with DOT-T1E strain in samples Co-culture _ LB1 and LB2 </O> 
Supplementary _ files _ format _ and _ content : <Supp> Gene _ lists _ GEO.xls ; The supplementary file contains gene lists used in data analysis . </O> 
Supplementary _ files _ format _ and _ content : <Supp> K12 _ </O> <Gtype> LB.xlsx : Average </Gtype> of expression values of samples MG1655 _ LB1 and LB2 
Supplementary _ files _ format _ and _ content : <Supp> T1E _ </O> <Gtype> LB.xlsx : Average </Gtype> of expression values of samples DOT-T1E _ LB1 and LB2 
Supplementary _ files _ format _ and _ content : <Temp> -LSB- . txt -RSB- tab-delimited text file includes RPKM values </O> 
Supplementary _ files _ format _ and _ content : <Temp> Processed-VectorvsDicF-transcripts . txt : . txt raw output file from Rockhopper </O> 
Supplementary _ files _ format _ and _ content : wiggle files with two columns : <Gtype> first column containing chromosome positions and second column containing the number of reads mapped to the position ( see publication for details ) . </O> 
Supplementary _ files _ format _ and _ content : Wiggle files with two columns : <Gtype> first column containing chromosome positions and second column containing the number of reads mapped to the position ( see publication for details ) . </O> 
Supplementary _ files _ format _ and _ <Gtype> content : The </Gtype> columns in the processed files are the following in order : <Gtype> GeneID , Length , ORF1 </Gtype> _ 1 _ mapped _ reads ( 7655775 ) , ORF1 _ 1 _ <Supp> IPTG _ mapped _ reads ( 7178582 ) , ORF1 _ 2 _ mapped _ reads ( 7706927 ) , ORF1 _ 2 _ </O> <Supp> IPTG _ mapped _ reads ( 7070827 ) , Svi3 _ 3 _ 1 _ mapped _ reads ( 8018710 ) , Svi3 _ 3 _ 1 _ </O> <Supp> IPTG _ mapped _ reads ( 8299205 ) , Svi3 _ 3 _ 2 _ mapped _ reads ( 7313736 ) , Svi3 _ 3 _ 2 _ </O> <Supp> IPTG _ mapped _ reads ( 8344539 ) , WT1 _ </O> <Supp> IPTG _ mapped _ reads ( 8074159 ) , WT2 _ </O> <Supp> IPTG _ mapped _ reads ( 8103887 ) , ORF1 _ 1 _ coverage , ORF1 _ 1 _ </O> <Supp> IPTG _ coverage , ORF1 _ 2 _ coverage , ORF1 _ 2 _ </O> <Supp> IPTG _ coverage , Svi3 _ 3 _ 1 _ coverage , Svi3 _ 3 _ 1 _ </O> <Supp> IPTG _ coverage , Svi3 _ 3 _ 2 _ coverage , Svi3 _ 3 _ 2 _ </O> <Supp> IPTG _ coverage , WT1 _ </O> <Supp> IPTG _ coverage , WT2 _ </O> <Supp> IPTG _ coverage , ORF1 _ 1 _ rpkm , ORF1 _ 1 _ </O> <Supp> IPTG _ rpkm , ORF1 _ 2 _ rpkm , ORF1 _ 2 _ </O> <Supp> IPTG _ rpkm , Svi3 _ 3 _ 1 _ rpkm , Svi3 _ 3 _ 1 _ </O> <Supp> IPTG _ rpkm , Svi3 _ 3 _ 2 _ rpkm , Svi3 _ 3 _ 2 _ </O> <Supp> IPTG _ rpkm , WT1 _ </O> <Supp> IPTG _ rpkm , WT2 _ </O> <Supp> IPTG _ rpkm , Symbol ( gene name ) , Description , KEGG Orthology , GO Component , GO Function , and GO Process </O> 
Supplementary _ files _ format _ and _ <Gtype> content : The </Gtype> file format is . xlsx . The file contains the raw gene counts of all samples . 
Supplementary _ files _ format _ and _ <Gtype> content : The </Gtype> text file contains sense and antisense raw base read counts for each of the 4091 ORFs for all the 15 samples , and the explanation key is included in the file . 
Supplementary _ files _ format _ and _ <Gtype> content : The </Gtype> txt file includes the gene expression profiles of all the samples . The xlsx file contains the PC1 and PC2 values of all the samples . 
supplementation : <Anti> adenine ( 10 mM ) </O> 
supplementation : <Anti> L-tryptophan ( 20 mg/L ) </O> 
<Supp> LIMS477 _ </O> <Supp> S1 _ </O> <Supp> T10 
<Supp> LIMS477 _ </O> <Supp> S1 _ </O> <Supp> T3 
<Supp> LIMS477 _ </O> <Supp> S1 _ </O> <Supp> T6 
<Supp> LIMS477 _ </O> <Supp> S2 _ </O> <Supp> T4 
<Supp> LIMS477 _ </O> <Supp> S2 _ </O> <Supp> T6 
<Supp> LIMS477 _ </O> <Supp> S2 _ </O> <Supp> T8 
<Supp> LIMS477 _ </O> <Supp> S3 _ </O> <Supp> T11 
<Supp> LIMS477 _ </O> <Supp> S3 _ </O> <Supp> T3 
<Supp> LIMS477 _ </O> <Supp> S3 _ </O> <Supp> T6 
<Supp> LIMS477 _ </O> <Supp> S5 _ </O> <Supp> T4 
<Supp> LIMS477 _ </O> <Supp> S5 _ </O> <Supp> T6 
<Supp> LIMS477 _ </O> <Supp> S5 _ </O> <Supp> T8 
<Supp> LIMS484 _ </O> <Supp> S1 _ </O> <Supp> T3 
<Supp> LIMS484 _ </O> <Supp> S1 _ </O> <Supp> T6 
<Supp> LIMS484 _ </O> <Supp> S1 _ </O> <Supp> T8 
<Supp> LIMS484 _ </O> <Supp> S2 _ </O> <Supp> T2 
<Supp> LIMS484 _ </O> <Supp> S2 _ </O> <Supp> T6 
<Supp> LIMS484 _ </O> <Supp> S2 _ </O> <Supp> T8 
<Supp> LIMS484 _ </O> <Supp> S5 _ </O> <Supp> T2 
<Supp> LIMS484 _ </O> <Supp> S5 _ </O> <Supp> T6 
<Supp> LIMS484 _ </O> <Supp> S5 _ </O> <Supp> T8 
<Supp> LIMS484 _ </O> <Supp> S6 _ </O> <Supp> T4 
<Supp> LIMS484 _ </O> <Supp> S6 _ </O> <Supp> T6 
<Supp> LIMS484 _ </O> <Supp> S6 _ </O> <Supp> T8 
<Supp> M9 _ </O> <Supp> TMP5 _ </O> <Supp> THY _ Ad _ AA _ </O> <Supp> 120 min </Supp> 
<Supp> M9 _ </O> <Supp> TMP5 _ </O> <Supp> THY _ Ad _ AA _ </O> <Supp> 30 min </Supp> 
<Supp> M9 _ </O> <Supp> TMP5 _ </O> <Supp> THY _ Ad _ AA _ </O> <Supp> 60 min </Supp> 
<Supp> M9 _ </O> <Supp> TMP5 _ THY _ </O> <Gtype> Ad _ AA _ </O> <Supp> 10 min </Supp> 
<Supp> M9TMP5 _ </O> <Supp> 10 min </Supp> 
<Supp> M9TMP5 _ </O> <Supp> 30 min </Supp> 
<Supp> M9TMP5 _ </O> <Supp> 60 min </Supp> 
<Supp> M9TMP5 _ </O> <Supp> 90 min </Supp> 
<Supp> M9TMP5 _ </O> <Supp> AdAA _ </O> <Supp> 10 min </Supp> 
<Supp> M9TMP5 _ </O> <Supp> AdAA _ </O> <Supp> 120 min </Supp> 
<Supp> M9TMP5 _ </O> <Supp> AdAA _ </O> <Supp> 30 min </Supp> 
<Supp> M9TMP5 _ </O> <Supp> AdAA _ </O> <Supp> 60 min </Supp> 
<Supp> M9TMP5 _ </O> <Supp> AdAA _ </O> <Supp> 90 min </Supp> 
<Supp> M9TMP _ </O> <Gtype> Ad _ </O> <Supp> 10 min </Supp> 
<Supp> M9TMP _ </O> <Gtype> Ad _ </O> <Supp> 30 min </Supp> 
<Supp> M9TMP _ </O> <Gtype> Ad _ </O> <Supp> 60 min </Supp> 
<Supp> M9TMP _ </O> <Supp> AA _ </O> <Supp> 10 min </Supp> 
<Supp> M9TMP _ </O> <Supp> AA _ </O> <Supp> 120 min </Supp> 
<Supp> M9TMP _ </O> <Supp> AA _ </O> <Supp> 30 min </Supp> 
<Supp> M9TMP _ </O> <Supp> AA _ </O> <Supp> 60 min </Supp> 
<Supp> M9TMP _ </O> <Supp> Ad _ </O> <Supp> 120 min </Supp> 
<Supp> mazF _ chpA upregulation , amp 50ug/ml , 0.0125 % arabinose , 0.025 ug/ml norfloxacin OD ~ </O> <OD> 0.3 
<Supp> MazF _ </O> <Gtype> totalRNA _ 30m _ rep1 </O> 
<Supp> MazF _ </O> <Gtype> totalRNA _ 30m _ rep2 </O> 
<Supp> MazF _ </O> <Gtype> totalRNA _ 5m _ rep1 </O> 
<Supp> MazF _ </O> <Gtype> totalRNA _ 5m _ rep2 </O> 
<Supp> MazF _ </O> <Gtype> totalRNA _ 60m _ rep1 </O> 
<Supp> MazF _ </O> <Gtype> totalRNA _ 60m _ rep2 </O> 
<Supp> MDS42 1 </Supp> 
<Supp> MDS42 2 </O> 
<Supp> MFD + + _ 1 </Supp> 
<Supp> MFD + + _ 2 </Supp> 
<Supp> MG1655 1 </O> 
<Supp> MG1655 2 </O> 
<Supp> MG1655 2 ' post rif </O> 
<Supp> MG1655 _ 3 </O> 
<Supp> MG1655-aMG _ 3 </O> 
<Supp> MG1655 _ minus _ </O> <Supp> aMG _ 1 </O> 
<Supp> MG1655 _ minus _ </O> <Supp> aMG _ 2 </O> 
<Supp> MG1655 _ minus _ </O> <Supp> aMG _ 3 </O> 
<Supp> MG1655 _ </O> <Supp> LB 
<Supp> MG1655 _ </O> <Supp> LB1 
<Supp> MG1655 _ </O> <Supp> LB2 
<Supp> MG1655 _ </O> <Supp> UV _ Treatment _ rep1 </O> 
<Supp> MG1655 _ </O> <Supp> UV _ Treatment _ rep2 </O> 
<Supp> MG1655 _ standard _ condition _ rep1 </O> 
<Supp> MG1655 _ standard _ condition _ rep2 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 106 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 107 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 108 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 109 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 110 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 111 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 112 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 113 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 114 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 115 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 116 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 117 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 118 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 119 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 120 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 121 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 122 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 123 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 124 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 125 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 126 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 127 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 128 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 129 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 130 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 131 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 132 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 133 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 134 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 135 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 136 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 137 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 138 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 139 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 140 </O> 
<Supp> MgSO4 _ stress _ high : </O> <Supp> MURI _ 141 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 142 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 143 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 144 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 145 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 146 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 147 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 148 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 149 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 151 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 152 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 153 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 154 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 155 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 156 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 157 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 158 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 159 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 160 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 161 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 162 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 163 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 164 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 165 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 166 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 167 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 168 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 169 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 170 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ 171 </O> 
<Supp> MgSO4 _ stress _ low : </O> <Supp> MURI _ </O> <Supp> 150 
<Supp> Microcin _ IN _ </O> <Supp> 50mkM _ 3 </O> 
<Supp> Microcin _ IN _ </O> <Supp> Mu _ 10mkM _ 2 </O> 
<Supp> Microcin _ IN _ </O> <Supp> Mu _ </O> <Supp> 10mkM _ 1 </O> 
<Supp> MIcrocin _ </O> <Supp> IP _ Mu _ </O> <Gtype> 10mkM _ 1 </O> 
<Supp> mMaple3 _ 1 min </Supp> 
<Supp> mMaple3 _ 2 min </Supp> 
<Supp> mMaple3 _ </O> <Supp> 10 min </Supp> 
<Supp> mMaple3 _ </O> <Supp> 15 min </Supp> 
<Supp> mMaple3 _ </O> <Supp> 4 min </Supp> 
<Supp> mMaple3 _ </O> <Supp> 6 min </Supp> 
<Supp> mMaple3 _ </O> <Supp> 8 min </Supp> 
<Supp> M-P0h _ r1 _ </O> <Gtype> HiSeq 
<Supp> M-P0h _ r2 _ </O> <Gtype> HiSeq 
<Supp> M-P2h _ r1 _ </O> <Gtype> HiSeq 
<Supp> M-P2h _ r2 _ </O> <Gtype> HiSeq 
<Supp> M-P4h _ r1 _ </O> <Gtype> HiSeq 
<Supp> M-P4h _ r2 _ </O> <Gtype> HiSeq 
<Supp> M-P4h _ r3 _ </O> <Gtype> HiSeq 
<Supp> mRNA-seq 2 hr after shift to 10 °C in WT cells </O> 
<Supp> mRNA-seq 30 min </Supp> after shift to 10 °C in WT cells 
<Supp> MutRep1 _ 2 min </Supp> 
<Supp> MutRep1 _ </O> <Supp> 10 min </Supp> 
<Supp> MutRep1 _ </O> <Supp> 15 min </Supp> 
<Supp> MutRep1 _ </O> <Supp> 20 min </Supp> 
<Supp> MutRep1 _ </O> <Supp> 4 min </Supp> 
<Supp> MutRep1 _ </O> <Supp> 6 min </Supp> 
<Supp> MutRep1 _ </O> <Supp> 8 min </Supp> 
<Supp> MutRep2 _ 2 min </Supp> 
<Supp> MutRep2 _ </O> <Supp> 10 min </Supp> 
<Supp> MutRep2 _ </O> <Supp> 15 min </Supp> 
<Supp> MutRep2 _ </O> <Supp> 20 min </Supp> 
<Supp> MutRep2 _ </O> <Supp> 4 min </Supp> 
<Supp> MutRep2 _ </O> <Supp> 6 min </Supp> 
<Supp> MutRep2 _ </O> <Supp> 8 min </Supp> 
<Supp> NaCl _ stress : </O> <Supp> MURI _ 061 </O> 
<Supp> NaCl _ stress : </O> <Supp> MURI _ 063 </O> 
<Supp> NaCl _ stress : </O> <Supp> MURI _ 064 </O> 
<Supp> NaCl _ stress : </O> <Supp> MURI _ 065 </O> 
<Supp> NaCl _ stress : </O> <Supp> MURI _ 066 </O> 
<Supp> NaCl _ stress : </O> <Supp> MURI _ 067 </O> 
<Supp> NaCl _ stress : </O> <Supp> MURI _ 068 </O> 
<Supp> NaCl _ stress : </O> <Supp> MURI _ 069 </O> 
<Supp> NaCl _ stress : </O> <Supp> MURI _ 070 </O> 
<Supp> NaCl _ stress : </O> <Supp> MURI _ 071 </O> 
<Supp> NaCl _ stress : </O> <Supp> MURI _ 072 </O> 
<Supp> NaCl _ stress : </O> <Supp> MURI _ 073 </O> 
<Supp> NaCl _ stress : </O> <Supp> MURI _ 074 </O> 
<Supp> NaCl _ stress : </O> <Supp> MURI _ 075 </O> 
<Supp> NaCl _ stress : </O> <Supp> MURI _ 076 </O> 
<Supp> NaCl _ stress : </O> <Supp> MURI _ 077 </O> 
<Supp> NaCl _ stress : </O> <Supp> MURI _ 079 </O> 
<Supp> NaCl _ stress : </O> <Supp> MURI _ 080 </O> 
<Supp> NaCl _ stress : </O> <Supp> MURI _ 081 </O> 
<Supp> NaCl _ stress : </O> <Supp> MURI _ 082 </O> 
<Supp> NaCl _ stress : </O> <Supp> MURI _ 083 </O> 
<Supp> NaCl _ stress : </O> <Supp> MURI _ 084 </O> 
<Supp> neo _ 1 min </Supp> 
<Supp> neo _ 2 min </Supp> 
<Supp> Nineteen hours </Supp> after experiment start , antibiotic ( Gentamicin Sulfate ( MP Biomedical , Cat No. 1676045 , Santa Ana , CA , USA ) ) was introducing into the cultures . Antibiotic concentration varied from one sample to the next from 0 to 150 ug/mL in 25 ug/mL steps . Thirty hours later , samples were fixed in RNA Later II ( ( ACROS , Cat . No. 41678 , New Jersey , USA ) ) . Samples were stored at -75 C until return to Earth for analyses . 
<Supp> NN2 _ 0018 _ 1 </O> 
<Supp> NN2 _ 0018 _ 2 </O> 
<Supp> None </Supp>
( + <Supp> NO ) </Supp> 2 
<Supp> NZ502 _ 12 % Glu </O> 
<Supp> NZ502 _ 5 % Glu </O> 
<Supp> O157 _ CL MC fraction vs control </O> 
<Supp> OmpFrecode _ f.wig : </O> <Gversion> NC _ </O> <Technique> 000913.2 
<Supp> OmpFrecode _ r.wig : </O> <Supp> NC _ 000913.2 </O> 
<Supp> optA1 _ 15 ( Low Dilution ) Rep1 </O> 
<Supp> optA1 _ 15 ( Low Dilution ) Rep2 </O> 
<Supp> optA1 _ 15 ( Low Dilution ) Rep3 </O> 
<Supp> optA1 _ 45 ( Low Dilution ) Rep1 </O> 
<Supp> optA1 _ 45 ( Low Dilution ) Rep2 </O> 
<Supp> optA1 _ 45 ( Low Dilution ) Rep3 </O> 
<Supp> optA1 _ 60 ( Low Dilution ) Rep1 </O> 
<Supp> optA1 _ 60 ( Low Dilution ) Rep2 </O> 
<Supp> optA1 _ 60 ( Low Dilution ) Rep3 </O> 
<Supp> optA1 _ gpt _ 0 _ Hx Rep1 </O> 
<Supp> optA1 _ gpt _ 0 _ </O> <Gtype> Hx Rep2 </Gtype> 
<Supp> optA1 _ gpt _ 0 _ </O> <Gtype> Hx Rep3 </Gtype> 
<Supp> optA1 _ gpt _ 120 ( High Dilution ) Rep1 </O> 
<Supp> optA1 _ gpt _ 120 ( High Dilution ) Rep2 </O> 
<Supp> optA1 _ gpt _ 120 ( High Dilution ) Rep3 </O> 
<Supp> optA1 _ gpt _ 120 ( Low Dilution ) Rep1 </O> 
<Supp> optA1 _ gpt _ 120 ( Low Dilution ) Rep2 </O> 
<Supp> optA1 _ gpt _ 120 ( Low Dilution ) Rep3 </O> 
<Supp> optA1 _ gpt _ 180 ( High Dilution ) Rep1 </O> 
<Supp> optA1 _ gpt _ 180 ( High Dilution ) Rep2 </O> 
<Supp> optA1 _ gpt _ 180 ( High Dilution ) Rep3 </O> 
<Supp> optA1 _ gpt _ 240 ( High Dilution ) Rep1 </O> 
<Supp> optA1 _ gpt _ 240 ( High Dilution ) Rep2 </O> 
<Supp> optA1 _ gpt _ 240 ( High Dilution ) Rep3 </O> 
<Supp> optA1 _ gpt _ 300 ( High Dilution ) Rep1 </O> 
<Supp> optA1 _ gpt _ 300 ( High Dilution ) Rep2 </O> 
<Supp> optA1 _ gpt _ 300 ( High Dilution ) Rep3 </O> 
<Supp> optA1 _ gpt _ 360 ( High Dilution ) Rep1 </O> 
<Supp> optA1 _ gpt _ 360 ( High Dilution ) Rep2 </O> 
<Supp> optA1 _ gpt _ 360 ( High Dilution ) Rep3 </O> 
<Supp> optA1 _ gpt _ 360 ( Low Dilution ) Rep1 </O> 
<Supp> optA1 _ gpt _ 360 ( Low Dilution ) Rep2 </O> 
<Supp> optA1 _ gpt _ 360 ( Low Dilution ) Rep3 </O> 
<Supp> optA1 _ </O> <Air> 30 ( Low Dilution ) Rep1 </Air> 
<Supp> optA1 _ </O> <Air> 30 ( Low Dilution ) Rep2 </Air> 
<Supp> optA1 _ </O> <Air> 30 ( Low Dilution ) Rep3 </Air> 
<Supp> ORF1 _ 1 _ IPTG </Supp> 
<Supp> ORF1 _ 2 _ IPTG </Supp> 
<Supp> P2-08 _ </O> <Supp> R1 
<Supp> P2-08 _ </O> <Supp> R2 
<Supp> P2-08 _ </O> <Supp> R3 
<Supp> P2-51 _ </O> <Supp> R1 
<Supp> P2-51 _ </O> <Supp> R2 
<Supp> P2-51 _ </O> <Supp> R3 
<Supp> P2-58 _ </O> <Supp> R1 
<Supp> P2-58 _ </O> <Supp> R2 
<Supp> P2-58 _ </O> <Supp> R3 
<Supp> P2-66 _ </O> <Supp> R1 
<Supp> P2-66 _ </O> <Supp> R2 
<Supp> P2-66 _ </O> <Supp> R3 
<Supp> P2-77 _ </O> <Supp> R1 
<Supp> P2-77 _ </O> <Supp> R2 
<Supp> P2-77 _ </O> <Supp> R3 
<Supp> Pale _ 1 </O> 
<Supp> Pale _ 3 </O> 
<Supp> PC 1 </O> 
<Supp> PC 2 </O> 
<Supp> PCK _ glucose-minimal medium _ early log phase </O> 
<Supp> PCK _ </O> <Gtype> LB-GlC medium </Gtype> _ <Gtype> D = 0.1 h-1 </Gtype> 
<Supp> pControl _ exponential growth phase _ 1 ml cell pellet </O> 
<Supp> pControl _ stationary growth phase _ 1 ml cell pellet </O> 
<Supp> pControl _ transition growth phase _ 1 ml cell pellet </O> 
<Supp> PF2-04 _ </O> <Supp> R1 
<Supp> PF2-04 _ </O> <Supp> R2 
<Supp> PF2-04 _ </O> <Supp> R3 
<Supp> PF2-08 _ </O> <Supp> R1 
<Supp> PF2-08 _ </O> <Supp> R2 
<Supp> PF2-08 _ </O> <Supp> R3 
<Supp> PF2-12 _ </O> <Supp> R1 
<Supp> PF2-12 _ </O> <Supp> R2 
<Supp> PF2-12 _ </O> <Supp> R3 
<Supp> pHDB3 _ 3 </O> 
<Supp> phoA _ 1 min </Supp> 
<Supp> phoA _ 2 min </Supp> 
<Supp> phoA _ </O> <Supp> 10 min </Supp> 
<Supp> phoA _ </O> <Supp> 15 min </Supp> 
<Supp> phoA _ </O> <Supp> 4 min </Supp> 
<Supp> phoA _ </O> <Supp> 6 min </Supp> 
<Supp> phoA _ </O> <Supp> 8 min </Supp> 
<Supp> PhoB _ ChIP , rep1 </O> 
<Supp> PhoB _ ChIP , rep2 </O> 
<Supp> PhoB _ ChIP , rep3 </O> 
<Supp> phoU _ 3 </O> 
<Supp> pLCV1 _ 3 </O> 
<Supp> pLPLσ _ exponential growth phase _ 1 ml cell pellet </O> 
<Supp> pLPLσ _ stationary growth phase _ 1 ml cell pellet </O> 
<Supp> pLPLσ _ transition growth phase _ 1 ml cell pellet </O> 
<Supp> Poly </Supp>
<Supp> PPC _ glucose-minimal medium _ early log phase </O> 
<Supp> PPC _ </O> <Gtype> LB-GlC medium </Gtype> _ <Gtype> D = 0.1 h-1 </Gtype> 
<Supp> ppsA mutant 2 hour ( 2 ) slide 1 </Supp> 
<Supp> ppsA mutant 2 hour ( 2 ) slide </Supp> 2 
<Supp> recA730 _ vs _ recA730 , dcd </O> 
<Supp> recA730 _ vs _ recA730 , ndk </O> 
<Supp> REL606 _ </O> <Med> glucose-limited minimal medium </Med> _ 168 hr 
<Supp> REL606 _ </O> <Med> glucose-limited minimal medium </Med> _ 168 hr _ rRNA not depleted 
<Supp> REL606 _ </O> <Med> glucose-limited minimal medium </Med> _ 24 hr 
<Supp> REL606 _ </O> <Med> glucose-limited minimal medium </Med> _ 24 hr _ rRNA not depleted 
<Supp> REL606 _ </O> <Med> glucose-limited minimal medium </Med> _ 336 hr 
<Supp> REL606 _ </O> <Med> glucose-limited minimal medium </Med> _ 336 hr _ rRNA not depleted 
<Supp> REL606 _ </O> <Med> glucose-limited minimal medium </Med> _ 3 hr 
<Supp> REL606 _ </O> <Med> glucose-limited minimal medium </Med> _ 3 hr _ rRNA not depleted 
<Supp> REL606 _ </O> <Med> glucose-limited minimal medium </Med> _ 48 hr 
<Supp> REL606 _ </O> <Med> glucose-limited minimal medium </Med> _ 48 hr _ rRNA not depleted 
<Supp> REL606 _ </O> <Med> glucose-limited minimal medium </Med> _ 4 hr 
<Supp> REL606 _ </O> <Med> glucose-limited minimal medium </Med> _ 4 hr _ rRNA not depleted 
<Supp> REL606 _ </O> <Med> glucose-limited minimal medium </Med> _ 5 hr 
<Supp> REL606 _ </O> <Med> glucose-limited minimal medium </Med> _ 5 hr _ rRNA not depleted 
<Supp> REL606 _ </O> <Med> glucose-limited minimal medium </Med> _ 6 hr 
<Supp> REL606 _ </O> <Med> glucose-limited minimal medium </Med> _ 6 hr _ rRNA not depleted 
<Supp> REL606 _ </O> <Med> glucose-limited minimal medium </Med> _ 8 hr 
<Supp> REL606 _ </O> <Med> glucose-limited minimal medium </Med> _ 8 hr _ rRNA not depleted 
<Supp> Replicate 2 - timepoint 1 ( 4.5 h ) - dye swap </O> 
<Supp> Replicate 2 - timepoint 1 ( 4.5 h ) </O> 
<Supp> Replicate 2 - timepoint 2 ( 6h ) - dye swap </O> 
<Supp> Replicate 2 - timepoint 2 ( 6h ) </O> 
<Supp> Replicate 2 - timepoint 3 ( 9h ) - dye swap </O> 
<Supp> Replicate 2 - timepoint 3 ( 9h ) </O> 
<Supp> RifCfx _ IN _ </O> <Supp> Mu _ 122mkM _ </O> <Supp> 10mkM _ 1 </O> 
<Supp> RifCfx _ IN _ </O> <Supp> Mu _ 122mkM _ </O> <Supp> 10mkM _ 2 </O> 
<Supp> RifCfx _ IN _ </O> <Supp> Mu _ 122mkM _ </O> <Supp> 10mkM _ 3 </O> 
<Supp> Rif _ IN _ </O> <Supp> Mu _ </O> <Supp> 122mkM _ 1 </O> 
<Supp> RNAeasy </Supp>
<Supp> RNAP _ </O> <Gtype> wt _ SHX _ rep1 </O> 
<Supp> RNAP _ </O> <Gtype> wt _ SHX _ rep2 </O> 
<Supp> RNAP _ </O> <Gtype> wt _ untreated _ rep1 </O> 
<Supp> RNAP _ </O> <Gtype> wt _ untreated _ rep2 </O> 
<Supp> RNAseq _ delta-crp _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 1 </O> 
<Supp> RNAseq _ delta-crp _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 2 </O> 
<Supp> RNAseq _ delta-crp _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 3 </O> 
<Supp> RNAseq _ delta-crp _ </O> <Supp> fructose _ </O> <Supp> NH4Cl _ O2 _ 1 </O> 
<Supp> RNAseq _ delta-crp _ </O> <Supp> fructose _ </O> <Supp> NH4Cl _ O2 _ 2 </O> 
<Supp> RNAseq _ delta-crp _ </O> <Supp> fructose _ </O> <Supp> NH4Cl _ O2 _ 3 </O> 
<Supp> RNAseq _ delta-crp _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ O2 _ 1 </O> 
<Supp> RNAseq _ delta-crp _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ O2 _ 2 </O> 
<Supp> RNAseq _ delta-crp _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ O2 _ 3 </O> 
<Supp> RNAseq _ </O> <Gtype> wt _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 1 </O> 
<Supp> RNAseq _ </O> <Gtype> wt _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 2 </O> 
<Supp> RNAseq _ </O> <Gtype> wt _ </O> <Supp> fructose _ </O> <Supp> NH4Cl _ O2 _ 1 </O> 
<Supp> RNAseq _ </O> <Gtype> wt _ </O> <Supp> fructose _ </O> <Supp> NH4Cl _ O2 _ 2 </O> 
<Supp> RNAseq _ </O> <Gtype> wt _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ O2 _ 1 </O> 
<Supp> RNAseq _ </O> <Gtype> wt _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ O2 _ 2 </O> 
<Supp> RNAseq _ </O> <Gtype> wt _ </O> <Supp> glucose _ </O> <Supp> NH4Cl _ O2 _ 3 </O> 
<Supp> RNAseq _ </O> <Supp> delAr1delAr2 _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 1 </O> 
<Supp> RNAseq _ </O> <Supp> delAr1delAr2 _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 2 </O> 
<Supp> RNAseq _ </O> <Supp> delAr1delAr2 _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 3 </O> 
<Supp> RNAseq _ </O> <Supp> delAr1 _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 1 </O> 
<Supp> RNAseq _ </O> <Supp> delAr1 _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 2 </O> 
<Supp> RNAseq _ </O> <Supp> delAr1 _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 3 </O> 
<Supp> RNAseq _ </O> <Supp> delAr2 _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 1 </O> 
<Supp> RNAseq _ </O> <Supp> delAr2 _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 2 </O> 
<Supp> RNAseq _ </O> <Supp> delAr2 _ glycerol _ </O> <Supp> NH4Cl _ O2 _ 3 </O> 
<Supp> Rodrigue _ </O> <Gtype> 10-WT-Ni-3 
<Supp> Rodrigue _ </O> <Gtype> 1-WT-phiNi-1 
<Supp> Rodrigue _ </O> <Gtype> 2-WT-Ni-1 
<Supp> Rodrigue _ </O> <Gtype> 5-WT-Ni-2 
<Supp> Rodrigue _ </O> <Gtype> 6-WT-phiNi-2 
<Supp> Rodrigue _ </O> <Gtype> 9-WT-phiNi-3 
<Supp> rpoS _ 04 _ </O> <Supp> TEX 
<Supp> rpoS _ 04 _ rep1 </O> 
<Supp> rpoS _ 04 _ rep2 </O> 
<Supp> rpoS _ 16 _ rep1 </O> 
<Supp> rpoS _ </O> <Supp> 15 min </Supp> _ rep1 
<Supp> rpoS _ </O> <Supp> 30 min </Supp> _ rep1 
<Supp> rpoS _ </O> <Supp> 30 min </Supp> _ rep2 
<Supp> rpoS _ </O> <Supp> 30 min </Supp> _ <Supp> TEX 
<Supp> rpoS _ </O> <Supp> EE _ 1 </O> 
<Supp> rpoS _ </O> <Supp> EE _ 2 </O> 
<Supp> rpoS _ </O> <Supp> ME _ 1 </O> 
<Supp> rpoS _ </O> <Supp> ME _ 2 </O> 
<Supp> rpoS _ </O> <Supp> N _ </O> <Phase> strv 
<Supp> rpoS _ </O> <Supp> N _ strv _ </O> <Gtype> TEX 
<Supp> rpoS _ </O> <Supp> TS _ 1 </O> 
<Supp> rpoS _ </O> <Supp> TS _ 2 </O> 
<Supp> rpoS _ S _ 1 </O> 
<Supp> rpoS _ S _ 2 </O> 
<Supp> rsdssrS _ </O> <Supp> EE _ 1 </O> 
<Supp> rsdssrS _ </O> <Supp> EE _ 2 </O> 
<Supp> rsdssrS _ </O> <Supp> ME _ 1 </O> 
<Supp> rsdssrS _ </O> <Supp> ME _ 2 </O> 
<Supp> rsdssrS _ </O> <Supp> TS _ 1 </O> 
<Supp> rsdssrS _ </O> <Supp> TS _ 2 </O> 
<Supp> rsdssrS _ S _ 1 </O> 
<Supp> rsdssrS _ S _ 2 </O> 
<Supp> Sample 1 </Supp> 
<Supp> Sample 2 </Supp> 
<Supp> SA _ </O> <Supp> TP2 _ </O> <Phase> repl1 
<Supp> SA _ </O> <Supp> TP2 _ </O> <Phase> repl2 
<Supp> SA _ </O> <Supp> TP2 _ </O> <Phase> repl3 
<Supp> SA _ </O> <Supp> TP2 _ </O> <Phase> repl4 
<Supp> SA _ </O> <Supp> TP3 _ </O> <Phase> repl1 
<Supp> SA _ </O> <Supp> TP3 _ </O> <Phase> repl2 
<Supp> SA _ </O> <Supp> TP3 _ </O> <Phase> repl3 
<Supp> SA _ </O> <Supp> TP3 _ </O> <Phase> repl4 
<Supp> SA _ </O> <Supp> TP4 _ </O> <Phase> repl1 
<Supp> SA _ </O> <Supp> TP4 _ </O> <Phase> repl2 
<Supp> SA _ </O> <Supp> TP4 _ </O> <Phase> repl3 
<Supp> SA _ </O> <Supp> TP4 _ </O> <Phase> repl4 
<Supp> SA _ TP2 _ repl5 </O> 
<Supp> SA _ TP3 _ repl5 </O> 
<Supp> SA _ TP4 _ repl5 </O> 
<Supp> SB10 _ 3 </O> 
<Supp> SB11 _ 3 </O> 
<Supp> SB12 _ 3 </O> 
<Supp> SB13 _ 3 </O> 
<Supp> SB1 _ 3 </O> 
<Supp> SB14 _ 3 </O> 
<Supp> SB15 _ 3 </O> 
<Supp> SB16 _ 3 </O> 
<Supp> SB17 _ 3 </O> 
<Supp> SB18 _ 3 </O> 
<Supp> SB2 _ 3 </O> 
<Supp> SB3 _ 3 </O> 
<Supp> SB5 _ 3 </O> 
<Supp> SB6 _ 3 </O> 
<Supp> SB7 _ 3 </O> 
<Supp> SB8 _ 3 </O> 
<Supp> SD10 _ 3 </O> 
<Supp> SD11 _ 3 </O> 
<Supp> SD12 _ 3 </O> 
<Supp> SD13 _ 3 </O> 
<Supp> SD2 _ 3 </O> 
<Supp> SD3 _ 3 </O> 
<Supp> SD4 _ 3 </O> 
<Supp> SD5 _ 3 </O> 
<Supp> SD6 _ 3 </O> 
<Supp> SD7 _ 3 </O> 
<Supp> SD8 _ 3 </O> 
<Supp> SD9 _ 3 </O> 
<Supp> sdhA _ FA _ II </O> 
<Supp> sdhA _ </O> <Supp> FA _ III </O> 
<Supp> sdhA _ </O> <Supp> FA _ </O> <Technique> I 
<Supp> sdhA _ </O> <Supp> LB _ III </O> 
<Supp> sdhA _ </O> <Supp> LB _ </O> <Technique> I 
<Supp> SF1a _ 3 </O> 
<Supp> SF1b _ 3 </O> 
<Supp> SF2b _ 3 </O> 
<Supp> SF3 _ 3 </O> 
<Supp> SF4a _ 3 </O> 
<Supp> SF4b _ 3 </O> 
<Supp> SF5 _ 3 </O> 
<Supp> SF6 _ 3 </O> 
<Supp> SFx _ 3 </O> 
<Supp> SFx </Supp>
<Supp> SFy _ 3 </O> 
<Supp> SgrR _ 3 </O> 
<Supp> sgrS _ </O> <Supp> T _ 1 </O> 
<Supp> sgrS _ </O> <Supp> T _ 2 </O> 
<Supp> sgrS _ </O> <Supp> T _ 3 </O> 
<Supp> sgrS _ un _ 1 </O> 
<Supp> sgrS _ un _ 2 </O> 
<Supp> sgrS _ un _ 3 </O> 
<Supp> Sigma70 _ ChIP _ A _ </O> <Phase> cy5 
<Supp> Sigma70 _ ChIP _ B _ </O> <Phase> cy5 
<Supp> Sigma70 _ ChIP _ control _ A _ </O> <Phase> cy3 
<Supp> Sigma70 _ ChIP _ control _ B _ </O> <Phase> cy3 
<Supp> Sigma70 _ </O> <Supp> IP _ ChIP-seq _ </O> <Air> Aerobic _ A _ </O> <Supp> SET _ WIG.wig : </O> <Gversion> U00096 .2 </Gversion> 
<Supp> Sigma70 _ </O> <Supp> IP _ </O> <Supp> ChIP-seq _ </O> <Air> Anaerobic _ A _ </O> <Supp> SET _ WIG.wig : </O> <Gversion> U00096 .2 </Gversion> 
<Supp> Sodium phosphate ( 1/100 vol . of 1M , pH 7.6 ; 10 mM final ) </Supp> was added to the mid-log cultures followed by formaldehyde to 1 % final , and aerobic or anaerobic sparging was continued for 10 min . Cold 2.5 M glycine was added to 100mM and the mixture was incubated at 4 °C with aerobic or anaerobic sparging for 30 minutes to stop the crosslinking . Cells were spun at 3500 x g , and washed repeatedly with phosphate buffered saline before being frozen at -80 °C . 
<Supp> Sodium phosphate ( 1/100 vol . of 1M , pH 7.6 ; 10 mM final ) </Supp> was added to the mid-log cultures followed by formaldehyde to 1 % final and anaerobic sparging was continued for 10 min . Cold 2.5 M glycine was added to 100mM and the mixture was incubated at 4 °C with anaerobic sparging for 30 minutes to stop the crosslinking . Cells were spun at 3500 x g , and washed repeatedly with phosphate buffered saline before being frozen at -80 °C . Cell pellets ( from initial 250 mL of culture ) were thawed and resuspended in 250 μL of IP buffer ( 100 mM Tris pH 8 , 300 mM NaCl , 1 % TritonX-100 ) and sonicated using a microtip sonicator set at 10 % output for 20 second intervals with periods of cooling in between . Cells were then treated for one hour at 4 °C with RNase A ( 2 ng/ml ) , micrococcal nuclease ( 50 units ) , 20 μM CaCl2 ,1.2 mM KCl , 0.3 mM NaCl , 6 mM sucrose , and 10 μM DTT . EDTA was added to 10 mM to stop the micrococcal nuclease and the samples were spun down to remove cell debris . The lysate was then precleared through incubation with a 50/50 slurry of sepharose protein A beads in IP buffer for 2-3 hours at 4 °C . The beads were removed by centrifugation and antibody was added to the pre-cleared lysate for an overnight incubation . The next day , 30 μl of a 50/50 slurry of sepharose protein A beads in IP buffer was added to the lysate to capture antibody-protein-DNA complex for one hour at 4 °C . Beads were then washed once with 1 ml of LiCl wash buffer ( 100 mM Tris pH 8 , 250 mM LiCl , 2 % TritonX-100 ) , twice with 600 mM NaCl wash buffer ( 100 mM Tris pH 8 , 600 mM NaCl , 2 % TritonX-100 ) , twice with 300 mM NaCl wash buffer ( 100 mM Tris pH 8 , 300 mM NaCl , 2 % TritonX-100 ) , and twice with TE . Elution buffer ( 50 mM Tris pH 8 , 10 mM EDTA , 1 % SDS ) was added after the final wash step , and beads were incubated at 65 °C for 30 minutes to remove the crosslinked protein-DNA complexes from the beads . After centrifugation to remove the beads , the samples were incubated overnight at 65 °C to reverse the protein-DNA formaldehyde crosslinks . DNA was purified using Qiagen 's PCR Purification kit and eluted to a final volume of 50 μl with EB . 
<Supp> ssrS _ </O> <Supp> EE _ 1 </O> 
<Supp> ssrS _ </O> <Supp> EE _ 2 </O> 
<Supp> ssrS _ </O> <Supp> ME _ 1 </O> 
<Supp> ssrS _ </O> <Supp> ME _ 2 </O> 
<Supp> ssrS _ </O> <Supp> TS _ 1 </O> 
<Supp> ssrS _ </O> <Supp> TS _ 2 </O> 
<Supp> ssrS _ S _ 1 </O> 
<Supp> ssrS _ S _ 2 </O> 
<Supp> SucT110 _ 12 % Glu </O> 
<Supp> SucT110 _ 5 % Glu </O> 
<Supp> Supplementary _ files _ format _ and _ content : CSV files of raw read counts and normalized gene expression in FPKM units . </O> 
<Supp> Supplementary _ files _ format _ and _ content : excel file include RPKM values for each Sample </O> 
<Supp> Supplementary _ files _ format _ and _ content : expression level files are tab-delimited text with columns as follows : index , hits , RPKM , RPM , start _ position , end _ position , strand , feature _ type , reference _ </O> <Gtype> replicon ( type </Gtype> ) , locus _ tag , gene _ name , product 
<Supp> Supplementary _ files _ format _ and _ content : . narrowPeak files output by macs2 , giving peak start and end positions , as well as fold-change , - log10pvalue , - log10qvalue , and relative summit position to peak start </O> 
<Supp> Supplementary _ files _ format _ and _ content : . narrowPeak files output by MACS , giving peak start and end positions , as well as fold-change , - log10pvalue , - log10qvalue , and relative summit position to peak start </O> 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Anti> Enrichement ( IP/input ) wig files were generated using homemade matlab code </O> 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Anti> peaks.bed 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Anti> RPG ( reads per gene ) files were created using HTSeq , mapping raw reads ( fastq format ) against the E. coli K12 genome and using a GFF file derived from the annotation of NC _ 000913.3 available from NCBI . </O> 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Gtype> bedgraph : Data </Gtype> presented in a 4 column BED format , of which the first column is the chromosome , the second column is the start position of the chromosome , the third column is the end position , and the fourth column is the fragments per kilobase mapped ( FPKM ) for that sample . Chromosome positions are specified as 0-relative . The first chromosome position is 0 . The last position in a chromosome of length N would be N - 1 . Only positions specified have data . Positions not specified do not have data and will not be graphed . All positions specified in the input data are in numerical order . 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Gtype> Bedgraph wiggle files were created for each sample and replicate for all reads aligned to the genome after computational rRNA and tRNA subtraction </O> 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Gtype> Files ending with _ coverage.txt : </O> <Gtype> tab-delimited text file of nucleotide-resolution coverage from RNA-seq data ( column 1 : genome ID , column 2 : nucleotide position , column 3 : </O> <Gtype> coverage ) </Gtype> 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Gtype> format : bed format </Gtype> 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Gtype> MACS v2 .0.10.20131216 peaks file </O> 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Gtype> Read counts were normalized by the length of the unique CDS per kilobase ( RPKM ) and the total mapped reads per million ( RPM ) </O> 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Gtype> rna-seq : genomic </Gtype> position ( middle of the 5kb-bin ) to each count . 3C seq : contact maps ( 2D array of 928 5kb-bins x 928 5kb-bins ) . 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Gtype> SPET-seq data is provided in the form of RNA Framework 's ( http://www.rnaframework.com ) RNA Count ( RC ) files . A file corresponding to each transcription intermediate is provided . For a detailed description of the RC format , please refer to : </O> <Gtype> http://rnaframework.readthedocs.io/en/latest/rf-count/#rc-rna-count-format 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Gtype> SPET-seq data is provided in the form of RNA Framework 's ( http://www.rnaframework.com ) RNA Count ( RC ) files . A file corresponding to each transcription intermediate is provided . For a detailed description of the RC format , please refer to : </O> <Supp> http://rnaframework.readthedocs.io/en/latest/rf-count/#rc-rna-count-format . For rRNA 23S ( rrlB gene ) , SPET-seq data is provided in the form of RC files , each one corresponding to individual transcription intermediates . </O> 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Gtype> SPET-seq data ( pooled Total and Ribo - RNA from both replicates ) is provided in the form of RNA Framework 's ( http://www.rnaframework.com ) RNA Count ( RC ) files . For each analyzed transcript , 10 files corresponding to SPET-seq data for the 10 transcription deciles are provided . For a detailed description of the RC format , please refer to : </O> <Gtype> http://rnaframework.readthedocs.io/en/latest/rf-count/#rc-rna-count-format 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Gtype> Tab-delimited text file ; genes in rows and samples in columns ; each entry corresponds to the number of reads mapping to the given gene in the given sample . </O> 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Gtype> Tab-delimited text file includes Rockhopper ( McClure et al. , 2013 ) normalized transcript abundance measurements ( Expression ) , transcript abundance ratios ( Expression Ratio ) , and qValues ( qValue ) for raw data that were treated as two experiments constituting either two ( lue \ cell transcriptomes ; Blue _ 1 . fastq , Blue _ 2 . fastq ) or three ( \ pale \ cell transcriptomes ; Pale _ 1 . fastq , Pale _ 2 . fastq , Pale _ 3 . fastq ) biological replicates . Gene annotation , gene product description , and strand information is also included . </O> 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Gtype> tab-delimited text files include normalized FPKM values and raw fragment counts for each Sample </O> 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Gtype> tab-delimited text files include RPKM values for each Sample . </O> 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Gtype> Tab-delimited text files include RPKM values for each sample . </O> 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Gtype> Tab-delimited text files in gff format which has 8 columns : sequence id , source ( empty ) , feature ( + / - strand ) , start position , end position , intensity score , strand ( + / - ) , frame ( . ) , attribute ( . ) . </O> 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Gtype> tab-delimitted text files contain TPM ( transcripts per million ) values for each sample </O> 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Gtype> tabular : Tabular </Gtype> data that informs the excel spreadsheet . The data are averaged across the three samples per strain . Both averaged strain data are presented for each gene on the same line . Data contain gene ID , gene number , locus , fragments per kilobase mapped ( FPKM ) for WT and mutant strains , log2 ( fold-change ) relative epxression of WT over mutant strains , test-statistic , p-value , q-value , and significance analyzed via the cummeRbund package in R whereby a q-value of < 0.05 is considered significant . 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Gtype> xls : The </Gtype> data are averaged across the three samples per strain . Both averaged strain data are presented for each gene on the same line . Excel spreadsheet containing gene ID , gene number , locus , fragments per kilobase mapped ( FPKM ) for WT and mutant strains , log2 ( fold-change ) relative epxression of WT over mutant strains , test-statistic , p-value , q-value , and significance analyzed via the cummeRbund package in R whereby a q-value of < 0.05 is considered significant . 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Gtype> xlsx : logFC </Gtype> and p-value 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Supp> ecoli _ </O> <Gtype> heatshock _ normalizedcounts.txt : </O> <Gtype> Tab-delimited text file has EdgeR-normalized counts per kilobase million for each E. coli gene ( EcoCyc gene names ) . </O> 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Supp> ecoli _ </O> <Gtype> heatshock _ rawcounts.txt : </O> <Gtype> Tab-delimited text file has raw read counts per kilobase million for each E. coli gene ( EcoCyc gene names ) . </O> 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Temp> Processed-VectorvsDicF-operon . txt : . txt tab delimited file with operons expressed differently between vector and DicF </O> 
<Supp> Supplementary _ files _ format _ and _ content : </O> <Temp> Processed-VectorvsDicF-transcripts . xlsx : </O> <Gtype> Excel file </Gtype> with transcription start and stop , expression values of all genes in the E. coli genome in vector and DicF 
<Supp> Supplementary _ files _ format _ and _ content : Processed data files are WIG files with non-coding RNAs removed , normalized to reads per million per position . Those with a \ - \ as the final character in the file name cover the minus strand of the genome ; those with a \ + \ as the final character in the file name cover the plus strand of the genome . </O> 
<Supp> Supplementary _ files _ format _ and _ content : Processed data files contain raw counts for CDS genomic features , locations of genomic features are provided in associated . gtf files </O> 
<Supp> Supplementary _ files _ format _ and _ content : Processed data files contain the number of reads mapped to each base pair after the total number of reads were scaled to 20 million reads per experiment </O> 
<Supp> Supplementary _ files _ format _ and _ content : Processed data include read pileups obtained in two ChIP-seq experiments by two different approaches ( files 1-4 ) , the set of regions bound by Dps in both experiments ( file 5 ) and the set of regions unbound by Dps in both experiments ( file 6 ) . All processed data are provided as tab-delimited . txt files . </O> 
<Supp> Supplementary _ files _ format _ and _ content : Processed data is presented in a cuff diff analysis format </O> 
<Supp> Supplementary _ files _ format _ and _ content : Processed data is presented in gff files containing a pileup of 5 ' tags . GFF column headers \ Genbank fna ID , file name , left genomic position , right genomic position , value , strand , extra value , information \ </O> 
<Supp> Supplementary _ files _ format _ and _ content : Tab delimited text file ; includes : gene differential expression levels relative to the G500 strain with corresponding p-values and processed counts for each biological replicate ( each normolized and averaged between 2 technical replicates ) . Linked as supplementary file on Series record . </O> 
<Supp> Supplementary _ files _ format _ and _ content : text files containing gene counts output by htseq-count </O> 
<Supp> Supplementary _ files _ format _ and _ content : . txt file file with raw and normalized counts of coverage </O> 
<Supp> Supplementary _ files _ format _ and _ content : txt files including count numbers of RNA 's and quality control were generated </O> 
<Supp> Supplementary _ files _ format _ and _ content : Wiggle files with two columns : </O> <Gtype> first column containing chromosome positions and second column containing the number of reads mapped to the position ( see publication for details ) . </O> 
<Supp> Supplementary _ files _ format _ and _ </O> <Gtype> content : The tab-delimited </Gtype> text files include raw read values for each time-point for both biol . replicates of control and Carolacton-treated samples as obtained from Rockhopper . A FASTA file on the series record contains the transcript sequences . 
<Supp> SynH _ </O> <Gtype> Exp _ CBYS </O> 
<Supp> SynH _ </O> <Supp> Exp _ </O> <Supp> BXHU 
<Supp> SynH _ </O> <Supp> LT _ </O> <Supp> Exp _ </O> <Supp> BXNX 
<Supp> SynH _ </O> <Supp> LT _ </O> <Supp> Exp _ </O> <Supp> CBYU 
<Supp> SynH _ </O> <Supp> LT _ </O> <Supp> Exp _ </O> <Supp> CCOG 
<Supp> SynH _ </O> <Supp> LT _ </O> <Supp> Stat1 _ </O> <Supp> BXNB 
<Supp> SynH _ </O> <Supp> LT _ </O> <Supp> Stat1 _ </O> <Supp> BXNZ 
<Supp> SynH _ </O> <Supp> LT _ </O> <Supp> Stat1 _ </O> <Supp> CHBW 
<Supp> SynH _ </O> <Supp> LT _ </O> <Supp> Trans _ </O> <Supp> BXNC 
<Supp> SynH _ </O> <Supp> LT _ </O> <Supp> Trans _ </O> <Supp> BXXC 
<Supp> SynH _ </O> <Supp> LT _ </O> <Supp> Trans _ </O> <Supp> CBYW 
<Supp> SynH _ </O> <Supp> Stat1 _ </O> <Supp> CBYN 
<Supp> SynH _ </O> <Supp> Stat1 _ </O> <Supp> CUOC 
<Supp> SynH _ Trans _ CUNZ </O> 
<Supp> SynH _ Trans _ CUOB </O> 
<Supp> T170V 0 min </Supp> 
<Supp> T170V 10 min </Supp> 
<Supp> T24 _ </O> <Supp> N0000 _ </O> <Phase> r1 
<Supp> T24 _ </O> <Supp> N0000 _ </O> <Phase> r2 
<Supp> T24 _ </O> <Supp> N0000 _ </O> <Phase> r3 
<Supp> T60 _ </O> <Supp> N0000 _ </O> <Phase> r1 
<Supp> T60 _ </O> <Supp> N0000 _ </O> <Phase> r2 
<Supp> T60 _ </O> <Supp> N0000 _ </O> <Phase> r3 
<Supp> time 2 ( </O> <OD> OD600 = 0.3 </OD> ) 
<Supp> Treatment 2 : </O> <Anti> AA30 ( EHEC 86-24 pH 5.0 , followed by </O> <Supp> 30 min pH 3.0 ) </Supp> 
<Supp> Un _ IN _ 3 </O> 
<Supp> Un _ IN _ </O> <Supp> Mu _ 1 </O> 
<Supp> Un _ IN _ </O> <Supp> Mu _ 2 </O> 
<Supp> Un _ </O> <Supp> IP _ 3 </O> 
<Supp> Un _ </O> <Supp> IP _ Mu _ 1 </O> 
<Supp> Un _ </O> <Supp> IP _ Mu _ 2 </O> 
<Supp> Veg </Supp>
<Supp> wild-type 2 hour ( 2 ) slide 1 </Supp> 
<Supp> wild-type 2 hour ( 2 ) slide </Supp> 2 
<Supp> WT1 _ IPTG </Supp> 
<Supp> WT2 _ IPTG </Supp> 
<Supp> WT3110 _ 3 </O> 
<Supp> WTA _ </O> <pH> time2 .5 </pH> 
<Supp> WTA _ </O> <pH> time7 .5 </pH> 
<Supp> WTA _ time0 </O> 
<Supp> WTA _ time10 </O> 
<Supp> WTA _ time20 </O> 
<Supp> WTA _ time5 </O> 
<Supp> WTB _ </O> <Phase> time0 
<Supp> WTB _ </O> <pH> time2 .5 </pH> 
<Supp> WTKasRep1 _ 2 min </Supp> 
<Supp> WTKasRep1 _ </O> <Supp> 15 min </Supp> 
<Supp> WTKasRep1 _ </O> <Supp> 20 min </Supp> 
<Supp> WTKasRep1 _ </O> <Supp> 4 min </Supp> 
<Supp> WTKasRep1 _ </O> <Supp> 6 min </Supp> 
<Supp> WTKasRep1 _ </O> <Supp> 8 min </Supp> 
<Supp> WTKasRep2 _ 2 min </Supp> 
<Supp> WTKasRep2 _ </O> <Supp> 10 min </Supp> 
<Supp> WTKasRep2 _ </O> <Supp> 15 min </Supp> 
<Supp> WTKasRep2 _ </O> <Supp> 20 min </Supp> 
<Supp> WTKasRep2 _ </O> <Supp> 4 min </Supp> 
<Supp> WTKasRep2 _ </O> <Supp> 6 min </Supp> 
<Supp> WTKasRep2 _ </O> <Supp> 8 min </Supp> 
<Supp> WTRep1 _ 2 min </Supp> 
<Supp> WTRep1 _ </O> <Supp> 10 min </Supp> 
<Supp> WTRep1 _ </O> <Supp> 15 min </Supp> 
<Supp> WTRep1 _ </O> <Supp> 20 min </Supp> 
<Supp> WTRep1 _ </O> <Supp> 4 min </Supp> 
<Supp> WTRep1 _ </O> <Supp> 6 min </Supp> 
<Supp> WTRep1 _ </O> <Supp> 8 min </Supp> 
<Supp> WTRep2 _ 2 min </Supp> 
<Supp> WTRep2 _ </O> <Supp> 10 min </Supp> 
<Supp> WTRep2 _ </O> <Supp> 15 min </Supp> 
<Supp> WTRep2 _ </O> <Supp> 20 min </Supp> 
<Supp> WTRep2 _ </O> <Supp> 4 min </Supp> 
<Supp> WTRep2 _ </O> <Supp> 6 min </Supp> 
<Supp> WTRep2 _ </O> <Supp> 8 min </Supp> 
<Supp> X515 _ </O> <Supp> V1 _ </O> <Supp> T4 _ </O> <Supp> 424287A03 
<Supp> X515 _ </O> <Supp> V1 _ </O> <Supp> T4 _ </O> <Supp> 475655A02 
<Supp> X515 _ </O> <Supp> V1 _ </O> <Supp> T6 _ </O> <Technique> 475649A04s 
<Supp> X515 _ </O> <Supp> V1 _ </O> <Supp> T7 _ </O> <Supp> 475654A02 
<Supp> X515 _ </O> <Supp> V1 _ </O> <Supp> T8 _ </O> <Supp> 475585A04 
<Supp> X515 _ </O> <Supp> V2 _ </O> <Supp> T4 _ </O> <Supp> 424219A04 
<Supp> X515 _ </O> <Supp> V2 _ </O> <Supp> T4 _ </O> <Supp> 475655A03 
<Supp> X515 _ </O> <Supp> V2 _ </O> <Supp> T6 _ </O> <Supp> 475644A04 
<Supp> X515 _ </O> <Supp> V2 _ </O> <Supp> T7 _ </O> <Supp> 475649A01 
<Supp> X515 _ </O> <Supp> V2 _ </O> <Supp> T8 _ </O> <Technique> 424219A01s 
<Supp> X515 _ </O> <Supp> V3 _ </O> <Supp> T4 _ </O> <Technique> 475585A02s 
<Supp> X515 _ </O> <Supp> V3 _ </O> <Supp> T6 _ </O> <Supp> 424221A04 
<Supp> X515 _ </O> <Supp> V3 _ </O> <Supp> T7 _ </O> <Supp> 475649A02 
<Supp> X515 _ </O> <Supp> V3 _ </O> <Supp> T8 _ </O> <Supp> 475641A04 
<Supp> X515 _ </O> <Supp> V4 _ </O> <Supp> T4 _ </O> <Supp> 475585A03 
<Supp> X515 _ </O> <Supp> V4 _ </O> <Supp> T4 _ </O> <Supp> 475644A01 
<Supp> X515 _ </O> <Supp> V4 _ </O> <Supp> T6 _ </O> <Supp> 424221A03 
<Supp> X515 _ </O> <Supp> V4 _ </O> <Supp> T7 _ </O> <Supp> 424287A04 
<Supp> X515 _ </O> <Supp> V4 _ </O> <Supp> T8 _ </O> <Supp> 475655A04 
<Supp> X520 _ </O> <Supp> V1 _ </O> <Supp> T4 _ </O> <Supp> 424221A01 
<Supp> X520 _ </O> <Supp> V1 _ </O> <Supp> T6 _ </O> <Supp> 475649A03 
<Supp> X520 _ </O> <Supp> V1 _ </O> <Supp> T7 _ </O> <Supp> 475655A01 
<Supp> X520 _ </O> <Supp> V1 _ </O> <Supp> T8 _ </O> <Supp> 475641A01 
<Supp> X520 _ </O> <Supp> V2 _ </O> <Supp> T3 _ </O> <Supp> 424221A02 
<Supp> X520 _ </O> <Supp> V2 _ </O> <Supp> T4 _ </O> <Supp> 475641A03 
<Supp> X520 _ </O> <Supp> V2 _ </O> <Supp> T6 _ </O> <Supp> 424287A02 
<Supp> X520 _ </O> <Supp> V2 _ </O> <Supp> T7 _ </O> <Supp> 475654A01 
<Supp> X520 _ </O> <Supp> V2 _ </O> <Supp> T8 _ </O> <Supp> 424219A02 
<Supp> X520 _ </O> <Supp> V3 _ </O> <Supp> T4 _ </O> <Supp> 475654A04 
<Supp> X520 _ </O> <Supp> V3 _ </O> <Supp> T6 _ </O> <Supp> 475641A02 
<Supp> X520 _ </O> <Supp> V3 _ </O> <Supp> T7 _ </O> <Technique> 475644A02s 
<Supp> X520 _ </O> <Supp> V3 _ </O> <Supp> T8 _ </O> <Supp> 424219A03 
<Supp> X520 _ </O> <Supp> V4 _ </O> <Supp> T4 _ </O> <Supp> 475654A03 
<Supp> X520 _ </O> <Supp> V4 _ </O> <Supp> T6 _ </O> <Supp> 424287A01 
<Supp> X520 _ </O> <Supp> V4 _ </O> <Supp> T7 _ </O> <Supp> 475644A03 
<Supp> X520 _ </O> <Supp> V4 _ </O> <Supp> T8 _ </O> <Supp> 475585A01 
<Supp> Δrac 1 </Supp> 
<Supp> Δrac 2 </O> 
symbioflor status : <Supp> without Symbioflor </Supp> 
Synchronization was achieved by passaging cells through one or two rounds of stationary phase according to Cutler and Evans 1966 . Briefly : <Gtype> Individual colonies ( LB plate , </O> <Temp> 37 °C </Temp> , 24 h ) were inoculated into M9 media and grown O/N ( <Temp> 37 °C </Temp> , 200 rpm ) . M9 media was inoculated to a final OD600 = 0.25 ( early-logarithmic phase ) . Cultures were grown ( <Temp> 37 °C </Temp> , 200 rpm ) and maintained in stationary phase ( OD600 1.8 ) for <Supp> approximately 2 hours </Supp> . An appropriate amount of each culture was used to inoculate pre-warmed ( <Temp> 37 °C </Temp> ) M9 media to a final OD600 = 0.25 ( approximate 7-fold dilution ) . Released cultures were grown ( <Temp> 37 °C </Temp> , 200 rpm ) and harvested ( time = 0 , 1 hr , or 2 hr ) for GCC and RNA isolation . Samples ( 1 mL ) were also taken for FACS analysis and fluorescence microscopy ( t = 0 , 1 hr , and 2 hr ) . 
T18-ParB ( G101S ) were produced by addition of <Supp> 0.5 mM IPTG </Supp> for an hour before formadehyde to 1 % ( final concentration ) was added to fix cells for ChIP-seq 
T18-ParB ( WT ) were produced by addition of <Supp> 0.5 mM IPTG </Supp> for an hour before formadehyde to 1 % ( final concentration ) was added to fix cells for ChIP-seq 
t7 genotype : <Gtype> wild-type gene 10 </O> 
t7 strain : <Gtype> wild type </Gtype> 
<Technique> ChIP-exo GadE </O> <pH> pH5 .5 </pH> 1 
<Technique> ChIP-exo GadE </O> <pH> pH5 .5 </pH> 2 
<Technique> ChIP-exo GadX </O> <pH> pH5 .5 </pH> 1 
<Technique> ChIP-exo GadX </O> <pH> pH5 .5 </pH> 2 
<Technique> ChIP-exo reads were aligned to the </O> <Gversion> ASM584v2 genome reference sequence using using bowtie v1 .0.0 with parameters - S </O> 
<Technique> ChIP-Seq </Technique>
<Technique> NEXTflexRapid Directional RNA-Seq </Technique> <Phase> library kit </Phase> 
<Technique> RNA-Seq of E. coli were done using blind and fit-only parameter in DE-Seq pakage </O> 
<Technique> RNA-Seq </Technique>
<Technique> RNA-Seq was performed by the DOE Joint Genome Institute using the dUTP method . Briefly , ribosome-depleted RNA was fragmented in a buffered zinc solution , then purified using AMPure SPRI beads . First-strand cDNAs were then synthesized from the fragmented RNA using Superscript II reverse transcriptase , followed by a second bead purification . dUTP was included in the second strand synthesis reaction in addition to dTTP to chemically mark the second strand . Two further bead purification steps using different ratios of beads to cDNA ( 85/100 , then 140/100 ) selected cDNAs in a range between 150-350 bp . cDNAs were then A-tailed using Exo - Klenow , followed by ligation of sequencing adapter oligos . Following bead purification , dUTP was cleaved from the second strand using AmpErase Uracil N-glycosylase , resulting in adaptor ligated single stranded cDNAs . </O> 
<Technique> Strand-specific RNA-Seq </Technique> data were generated , following rRNA depletion with a Ribo-Zero kit , with the aid of the di-tagged cDNA strategy ( ScriptSeq ) on an Illumina NextSeq platform 
<Technique> The ChIP-exo </Technique> experiments were generated by following the steps presented by Rhee and Pugh , 2011 . 
<Technique> The RNA-Seq </Technique> library was constructed with TruSeq RNA Preparation Kit . 
<Technique> Total RNA-seq </Technique> 8 hr after shift to 10 °C in ∆ rnr cells 
<Technique> Total RNA-seq </Technique> 8 hr after shift to 10 °C in WT cells 
<Technique> Total RNA-seq </Technique> after rifampicin treatment -- 4 hr after shift to 10 °C in ∆ rnr cells 
<Technique> Total RNA-seq </Technique> after rifampicin treatment -- 4 hr after shift to 10 °C in WT cells 
<Technique> Total RNA-seq </Technique> before rifampicin treatment -- 2 hr after shift to 10 °C in ∆ rnr cells 
<Technique> Total RNA-seq </Technique> before rifampicin treatment -- 2 hr after shift to 10 °C in WT cells 
<Temp> 37 . St. Olav174.nIND.nHUS </O> 
<Temp> 43 . FHI63.nIND.HUS </Temp> 
<Temp> deltamatP 22 °C </Temp> 
temperature down shift , <Supp> 20 min </Supp> 
temperature _ down _ <Supp> 0 min </Supp> 
temperature _ down _ <Supp> 12 min </Supp> 
temperature _ down _ <Supp> 20 min </Supp> 
temperature _ down _ <Supp> 28 min </Supp> 
temperature _ down _ <Supp> 44 min </Supp> 
temperature _ down _ <Supp> 4 min </Supp> 
temperature _ down _ <Supp> 8 min </Supp> 
temperature _ <Gtype> Up _ </O> <Supp> 12 min </Supp> 
temperature _ <Gtype> Up _ </O> <Supp> 20 min </Supp> 
temperature _ <Gtype> Up _ </O> <Supp> 28 min </Supp> 
temperature _ <Gtype> Up _ </O> <Supp> 44 min </Supp> 
temperature _ <Gtype> Up _ </O> <Supp> 4 min </Supp> 
temperature _ <Gtype> Up _ </O> <Supp> 8 min </Supp> 
temperature : <Temp> 10 °C </Temp> 
temperature : <Temp> 37 °C </Temp> 
temperature up shift , <Supp> 20 min </Supp> 
temperature _ Up _ <Supp> 0 min </Supp> 
<Temp> Logarithmic phase sample 4 </Temp> 
<Temp> MatP 37 °C </Temp> 
<Temp> mRNA-seq 37 °C </Temp> in <Gtype> WT with control plasmid </O> 
<Temp> mRNA-seq 37 °C </Temp> in <Gtype> WT with plasmid expressing mini-ORF CUA </O> 
<Temp> mRNA-seq 37 °C </Temp> in <Gtype> WT with plasmid expressing mini-ORF CUG </O> 
<Temp> MukB 22 °C </Temp> 
<Temp> MukB 37 °C </Temp> 
<Temp> MukBDA 22 °C </Temp> 
<Temp> MukBEQ 22 °C </Temp> 
<Temp> sample : # 6 </Temp> 
<Temp> Sample 79 </Temp> 
The average fluorescence intensity for each spot was calculated and local background was subtracted . All data normalization and selection of fold-changed genes were performed using GeneSpringGX 7.3.1 ( Agilent Technology , USA ) . Normalization for Agilent one-color method was performed , which is Data transformation : <Gtype> Set measurements less than 5.0 to 5.0 and Per Chip : Normalize to 50th percentage . </O> 
The bacterial cells were grown at 37 ℃ for 17 hours on Luria-Bertani ( LB ) agar plate . An isolated colony was picked and inoculated into 100 ml of sterilized LB broth ( 10g of tryptone , 5g of yeast extract and 10g of sodium chloride per liter ) and incubated overnight for <Supp> 17 hours </Supp> at 37 ℃ with shaking at <Agit> 250 rpm </Agit> . A 1:100 dilution of the culture was performed using pre-warmed LB broth . The diluted culture was incubated at 37 ℃ with shaking at 250rpm until a final optical density ( OD600 ) of 0.8 ( early logarithmic phase ) was attained . A further 1:10 dilution was performed using LB broth and incubated at 37 ℃ with shaking at <Agit> 250 rpm </Agit> . 
The cells culture were harvested and resuspended with a solution containing 0.5 % SDS , 20 mM sodium acetate ( <pH> pH 5.5 </pH> ) , and 10 mM EDTA . The suspended cells were mixed with an equal volume of pre-warmed saturated phenol ( 20 mM sodium acetate , 10 mM EDTA <pH> pH 5.5 </pH> ) and incubated for 5 min at 60 ˚C . 
The cells were untreated , or treated with ( 100µg/mL Erythromycin or 50 µg/mL Clindamycin in 70 % Ethanol ) . After 10 minutes at <Temp> 37 °C </Temp> , 1 mL samples were subjected to hot phenol-chloroform extraction . Ref : <Gtype> Chuang SE , Daniels DL , and Blattner FR ( 1993 ) Global regulation of gene expression in Escherichia coli . J. Bacteriol . 175:2026-2036 . </O> 
The ChIP experiment was performed essentially as described previously ( Herring , Raffaelle et al. 2005 ) . Briefly , the cell cultures were fixed by a 1 % formaldehyde and 10 mM sodium phosphate ( pH 7.6 ) solution for <Supp> 20 min </Supp> at room temperature . After cell lysis , RNase A treatment and sonication , the chromosome was fragmented to 100-1200 bp . RNAP binding DNA ( IP DNA ) was immunoprecipitated with RNAP using an antibody against the RNAP β ' subunit and pan mouse magnetic beads . The same sample without the β ' antibody was used as mock immunoprecipitation DNA ( mock IP DNA ) . After washing and de-crosslinking , DNA was purified using the PCR purification kit ( Qiagen ) . 
The clean reads obtained were aligned to the genome sequence of E. coli O157 : <Gtype> H7 EDL933 using SOAP2 </O> 
The cultivations were performed in a Biostat C 15 L bioreactor with the DCU-3 controlling unit and MFCS-win supervisory system ( Sartorius ) with an initial working volume of 8 L . The mineral salt medium contained per liter : <Gtype> 14.6 g K2HPO4 , 3.6 g NaH2PO4 × 2 H2O , 2.0 g Na2SO4 , 2.47 g ( NH4 ) 2SO4 , 0.5 g NH4Cl , 1.0 g ( NH4 ) 2-H-citrate , 2 mM MgSO4 , 0.1 g thiamine hydrochloride , 0.1 mL antifoam 204 ( Sigma ) and 2 mL trace element solution ( 1 ) . The initial glucose concentration was 40 g L-1 . The feed solution contained 650 g L-1 glucose . 2 mL L-1 of sterile filtered 1M MgSO4 were added regularly per OD600 = 10 increase . </O> 
The cultured cells were inoculated with 1:100 dilution into 50 mL of the fresh <Med> M9 medium </Med> containing 2 g/L glucose in either the presence or absence of 1 g/L arginine and continued to culture at <Temp> 37 °C </Temp> until reaching an appropriate cell density ( OD600 ≈ 0.5 ) . 
The cultures were centrifuged at 8000 rpm for 10 minutes and the pellet was dissolved in 15 mL of 10 mM NaCl , 20 mM Tris-HCl ( pH 8.0 ) , 1 mM EDTA , 100 μg/mL proteinase K and 0.5 % SDS . This suspension was incubated at 50oC for 2 h and DNA extracted with an equal volume of phenol : <Gtype> chloroform : isoamyl </Gtype> alcohol ( 25:24:1 ) . Following centrifugation for 10 min at 8000 rpm , the upper phase was removed and precipitated by adding 0.1 volume of 3 M NaOAc ( pH 5.2 ) and 2 volumes of 99 % ethanol . The DNA precipitate was then spooled out of the solution using a sterile glass rod , washed with 70 % ethanol , and dissolved in 5 mL of TE ( 10 mM Tris-HCl , 1 mM EDTA , pH 8.0 ) buffer . 
The cultures were prepared by inoculating one colony from tryptone soya agar ( TSA ) ( Oxoid ) ( overnight growth at <Temp> 37 °C </Temp> ) to 5 ml TSB and incubating overnight at <Temp> 37 °C </Temp> , with shaking ( 200 rpm ) . This culture was initially diluted 1:10 in medium and used to inoculate room-temperature TSB for each of the different stress factors ( 40 ml total volume ) to a final concentration of approx. 1 ' 107 CFU/ml ( 1:100 dilution of overnight culture ) . For cold stress experiment the medium was chilled to 15 °C prior to inoculation . The cultures were incubated at <Temp> 37 °C </Temp> ( except fpr 15 °C and 46 °C conditions ) , shaking at 200 rpm and samples were collected during exponential growth at a cell density of approx. 1 ' 108 CFU/ml . All the stress conditions , including the control , were inoculated with the same overnight culture and started at the same time point . The experiment was performed 3 times at different days and with freshly prepared solutions , resulting in 3 biological replicates . 
The culture was divided into two 20-ml volumes and the cells collected by centrifugation . The supernatant was removed and the two pellets were subjected to different treatments . One was resuspended in 1 ml of pre-warmed 1X EG-minimal medium pH 7.2 . The second was resuspended in 1 ml of pre-warmed 1X EG-minimal medium pH 4.5 . Each suspension was added to a final volume of 20 ml <Med> 1X EG minimal medium </Med> of the same pH in a 250 ml flask . Cells were grown at <Temp> 37 °C </Temp> and 200 rpm shaking for 90 min before harvesting for analysis . 
The E. coli K12 strain MG1655 and its isogenic ptsN mutant were grown in <Med> M9 minimal medium </Med> containing 0.5 % glucose as carbon source . Cells from duplicate experiments were harvested in exponential growth phase when cultures reached an A600 of 0.4 . 
The equivalent of 5 OD600 was saved for RNA extraction with TriZOL before adding antibodies ( lysate RNA sample ) . For coIP samples , beads were resuspended in the lysis buffer , mixed with an equal volume of phenol : <Gtype> chloroform : isopropanol </Gtype> ( 25:24:1 , pH4 .5 , Roth ) for 20 s and incubated at room temperature for 3 min . After centrifugation , the aqueous phase was precipitated with isopropanol ( coIP RNA sample ) . The purified RNA coIP sample was treated with DNase I ( Thermo Scientific ) to remove the residual DNA and reisolated with phenol : <Gtype> chloroform : isopropanol </Gtype> . The spike-in RNA ( 5 ' P-CUCGUCCGACGUCACCUAGA , IBA ) had been added to 40 pg/µl for coIP samples and to 1.6 ng/µl for lysate samples . 
The exponential phase culture was split in two , and one part was induced with mitomycin C at a final concentration of 0.25 μg/ml . Both cultures were subsequently incubated at <Temp> 37 °C </Temp> with agitation for 1.5 hours . Bacterial cells were then spun down and resuspended in 5-10 volumes of RNA later ( QIAGEN ) before being frozen at -20 °C . 
The fed-batch cultivations were carried out with the bacterial strain E. coli K-12 W3110 ( DSM 5911 , German Collection of Microorganisms and Cell Cultures ) in a 30-l bioreactor ( Bioengineering AG , Wald , Switzerland ) . Minimal medium supplemented with glucose as the carbon source was used . The batch medium ( batch volume VR ,0 = 17 l ) consisted of 8.8 g l − 1 glucose • H2O , 2.0 g l − 1 Na2SO4 • 10H2O , 2.68 g l − 1 ( NH4 ) 2SO4 , 1.0 g l − 1 NH4Cl , 14.6 g l − 1 K2HPO4 , 4.02 g l − 1 NaH2PO4 • 2H2O , 0.01 g l − 1 thiamine HCl ; 0.3 mM CaCl2 • 2H2O , 2mM MgSO4 • 7H2O ; 3 ml l − 1 of trace element solution ( TES : <Supp> 16.7 g l − </Supp> 1 FeCl3 • 6H2O , 20.1 g l − 1 
The five bacterial strains ( JO2057 , JO2081 , JO2083 , JO3020 and MW30 ) were grown in 100 ml LB 0.5 % NaCl , M9 minimal glucose or M9 minimal glycerol at 200 rpm in New Brunswick laboratory shaker in 2liter flasks . The typical doubling time , observed in exponential phase in LB , was 40 min for JO2057 , JO2081 , JO2083 , MW30 and 75 min for JO3020 . After growth curve calibration , the various growth phase sample were collected at the following cell densities : <Phase> exponential phase : </O> <Gtype> OD600 0.6-0.7 ; transition : 2.2-2.5 </Gtype> and stationary : <Anti> 4.6-4.8 ( 3.0 for hupAB ) . </O> 
The intensity of each spot was measured with ScanArray Express using the histogram quantitation method ; the percentile ranges for histograms were 80 % for low signal range , 95 % for high signal range , 5 % for low background range and 20 % for high background range . The median intensity minus the median background intensity was used for further calculations performed in Microsoft Excel . The background measurement refers to the local spot background intensity . Prior to normalization , all spots with a Signal-to-Noise ratio ( SNR ) lower than 3 were removed . The SNR was calculated using the following formula : <Gtype> ( Median Signal -- Median Background ) / Standard Deviation </Gtype> of Background . Normalization between each array was performed using an internal labeling control ( IC ) consisting of a 290 bp luxA fragment . This fragment was added to each labeling reaction at a ratio of 0.05 % of the DNA to be labeled . The intensity of each Cy5-sample gene spot was corrected using the average intensity of all Cy3-lambda signals . Corrected intensity values were averaged over triplicate spots to give a single value per gene . The intensity of the genes for which hybridization of the probes could not be visually detected in image analysis was set to zero . Relative intensity values were then calculated by dividing the intensity of a gene by the sum of the intensity for all genes ( excluding controls ) . This `` relative abundance '' represents the fraction of the total intensity that is due to a particular gene and this value was subsequently used in statistical analyses . 
The laboratory strain E. coli K12 MG1655 was grown for 24 h at <Temp> 37 °C </Temp> under continuous shaking ( 120 rpm ) , in 200 mL M9 medium ( Merck Prolabo ) complemented with 2.5 g/L of anhydrous glucose , and inoculated at 108 CFU/mL ( corresponding to an optical density at 595 nm -LSB- OD595 nm -RSB- of 0.12 ) . The inoculum for this culture was prepared in 40 mL M9 broth inoculated with approximately 1.5 x107 CFU/mL ( corresponding to an OD595 nm of 0.12 ) and incubated overnight under the same conditions ( <Temp> 37 °C </Temp> , 120 rpm ) . This inoculum was obtained by adding 1 mL of stock culture of the bacterial cells in 5 mL of Luria Bertani broth ( Biokar Diagnotics , PRS Panreac ) in a 15-mL half-opened BD FalconTM tube , followed by 8 h of incubation at <Temp> 37 °C </Temp> and 120 rpm . 
The microarray data were analyzed using R ( v. 2.2.1 ) and the MAANOVA ( v. 0.98.8 ) package . Raw intensity values from replicate probes were averaged and log2 transformed after normalization with the pin-tip LOWESS method . The normalized intensity values were fitted to a mixed model ANOVA considering array and biological replicates as random factors and dye , strain and growth phase as fixed factors . The linear model tested was Y ( intensity ) = array + dye + strain ( <Gtype> wild type </Gtype> or mutant ) + growth phase ( exponential or stationary ) + strain * growth phase + sample ( biological replicate ) + error . Significant differences in expression due to strain , growth phase and strain * growth phase were determined using the Fs test in MAANOVA which uses a shrinkage estimator for gene-specific variance components that makes no assumption about the variances across genes with 500 random permutations to estimate the p-values . The q-value package in R was used for determining the false discovery rate ( FDR ) . 
The microarray experiment was performed with two serotypes of <Gtype> wild type </Gtype> E. coli and their adhE mutants : <Supp> ( 1 ) K-12 strain , </O> <Gtype> wild type </Gtype> ; ( 2 ) B strain , <Gtype> wild type </Gtype> ; ( 3 ) BW25113 , adhE mutants ; ( 4 ) BL21 ( DE3 ) , adhE mutants . 
The number of sequence reads that aligned to features in annotation file ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA _ 000005845.2.24 . gtf from http://bacteria.ensembl.org ) were tabulated from the resulting SAM alignment files using the HTSeq-count program ( Anders et al. , 2015 , Bioinformatics ) with intersection non-empty mode . </O> 
The optical density was measured every <Supp> 30 min </Supp> and expression of the heterologous sigma factor was induced with <Supp> 1mM IPTG </Supp> at an optical density of 0.1 . Samples for RNA extractions ( 1 ml ) were taken after 4.5 , 6 and 9 hours after induction . Cell pellets were stored at -80 °C until total RNA extraction was performed . 
The overnight culture ( 0.25 ml ) was used to inoculate 25 ml <Med> of fresh LB </Med> medium . After incubation at 30 °C with shaking ( <Agit> 250 rpm </Agit> ) to OD600 0.5 , 100 uM AI-2 was added in . after further 3-h incubation , 2.0 ml of cell culture was removed and cells were pelleted and frozen in -80 C . After breaking the cells with a bead beater , and the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) 
The overnight culture ( 0.25 ml ) was used to inoculate 25 ml <Med> of fresh LB </Med> medium . After incubation at 30 °C with shaking ( <Agit> 250 rpm </Agit> ) to OD600 0.5 , no AI-2 was added in . after further 3-h incubation , 2.0 ml of cell culture was removed and cells were pelleted and frozen in -80 C . After breaking the cells with a bead beater , and the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) 
The overnight culture ( 0.25 ml ) was used to inoculate 25 ml <Med> of fresh LB </Med> medium . After incubation at 30 °C with shaking ( <Agit> 250 rpm </Agit> ) to OD600 4.0 , 2.0 ml of cell culture was removed and cells were pelleted and frozen in -80 C . After breaking the cells with a bead beater , and the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) 
The overnight culture ( 0.25 ml ) was used to inoculate 25 ml <Med> of fresh LB </Med> medium . After incubation at <Temp> 37 °C </Temp> with shaking ( <Agit> 250 rpm </Agit> ) to OD600 0.5 , 100 uM AI-2 was added in . after further 3-h incubation , 2.0 ml of cell culture was removed and cells were pelleted and frozen in -80 C . After breaking the cells with a bead beater , and the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) 
The overnight culture ( 0.25 ml ) was used to inoculate 25 ml <Med> of fresh LB </Med> medium . After incubation at <Temp> 37 °C </Temp> with shaking ( <Agit> 250 rpm </Agit> ) to OD600 0.5 , no AI-2 was added in . after further 3-h incubation , 2.0 ml of cell culture was removed and cells were pelleted and frozen in -80 C . After breaking the cells with a bead beater , and the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) 
The overnight culture ( 0.25 ml ) was used to inoculate 25 ml <Med> of fresh LB </Med> medium . Planktonic cells were grown to a turbidity of 0.5 at 600 nm in LB medium with <Supp> 1 mM IPTG </Supp> at <Temp> 37 °C </Temp> , adjusted the turbidity to 1 , and exposed to 20 μg/mL ampicillin with <Supp> 1 mM IPTG </Supp> for 1 h. Cells were isolated by centrifuging at 0 °C , and RNALater buffer ( Ambion , Cat # AM7021 ) was added to stabilize RNA during the RNA preparation steps . After breaking the cells with a bead beater , the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) 
The overnight culture ( 0.25 mL ) was used to inoculate 25 mL of fresh LB medium . Planktonic cells were grown to a turbidity of 0.5 at 600 nm in LB medium with <Supp> 1 mM IPTG </Supp> at <Temp> 37 °C </Temp> , adjusted the turbidity to 1 , and exposed to 20 μg/mL ampicillin with <Supp> 1 mM IPTG </Supp> for 1 h. Cells were isolated by centrifuging at 0 °C , and RNALater buffer ( Ambion , Cat # AM7021 ) was added to stabilize RNA during the RNA preparation steps . After breaking the cells with a bead beater , the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) . 
The overnight culture ( 2.5 ml ) was used to inoculate 250 ml <Med> of fresh LB </Med> glu medium with 10 g of submerged glass wool ( Corning Glass Works , Corning , NY ) for forming biofilm . After incubation for 15 h at <Temp> 37 °C </Temp> with shaking ( <Agit> 250 rpm </Agit> ) , the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85 % NaCl solution at 0 °C . Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85 % NaCl solution at 0 °C . After breaking the cells with a bead beater , and the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) 
The overnight culture ( 2.5 ml ) was used to inoculate 250 ml <Med> of fresh LB </Med> glu medium with 10 g of submerged glass wool ( Corning Glass Works , Corning , NY ) for forming biofilm . After incubation for 15 h at <Temp> 37 °C </Temp> with shaking ( <Agit> 250 rpm </Agit> ) , the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85 % NaCl solution at 0 °C . Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85 % NaCl solution at 0 °C . After breaking the cells with a bead beater , and the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) . 
The overnight culture ( 2.5 ml ) was used to inoculate 250 ml <Med> of fresh LB </Med> medium . After incubation at 30 °C with shaking ( <Agit> 250 rpm </Agit> ) for 7 hours , 2.0 ml of cell culture was removed from suspension part and cells were pelleted and frozen in -80 C . After breaking the cells with a bead beater , and the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) 
The overnight culture ( 2.5 ml ) was used to inoculate 250 ml <Med> of fresh LB </Med> medium with 10 g of submerged glass wool ( Corning Glass Works , Corning , NY ) and 1 mM indole for forming biofilm . After incubation for 7 h at 30 °C with shaking ( <Agit> 250 rpm </Agit> ) , the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85 % NaCl solution at 0 °C . Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85 % NaCl solution at 0 °C . After breaking the cells with a bead beater , and the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) . 
The overnight culture ( 2.5 ml ) was used to inoculate 250 ml <Med> of fresh LB </Med> medium with 10 g of submerged glass wool ( Corning Glass Works , Corning , NY ) and DMF for forming biofilm . After incubation for 7 h at 30 °C with shaking ( <Agit> 250 rpm </Agit> ) , the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85 % NaCl solution at 0 °C . Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85 % NaCl solution at 0 °C . After breaking the cells with a bead beater , and the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) 
The overnight culture ( 2.5 ml ) was used to inoculate 250 ml <Med> of fresh LB </Med> medium with 10 g of submerged glass wool ( Corning Glass Works , Corning , NY ) and DMF for forming biofilm . After incubation for 7 h at 30 °C with shaking ( <Agit> 250 rpm </Agit> ) , the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85 % NaCl solution at 0 °C . Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85 % NaCl solution at 0 °C . After breaking the cells with a bead beater , and the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) . 
The overnight culture ( 2.5 ml ) was used to inoculate 250 ml <Med> of fresh LB </Med> medium with 10 g of submerged glass wool ( Corning Glass Works , Corning , NY ) and DMF for forming biofilm . After incubation for 7 h at <Temp> 37 °C </Temp> with shaking ( <Agit> 250 rpm </Agit> ) , the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85 % NaCl solution at 0 °C . Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85 % NaCl solution at 0 °C . After breaking the cells with a bead beater , and the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) 
The overnight culture ( 2.5 ml ) was used to inoculate 250 ml <Med> of fresh LB </Med> medium with 10 g of submerged glass wool ( Corning Glass Works , Corning , NY ) and with 100 uM indole for forming biofilm . After incubation for 7 h at 30 °C with shaking ( <Agit> 250 rpm </Agit> ) , the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85 % NaCl solution at 0 °C . Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85 % NaCl solution at 0 °C . After breaking the cells with a bead beater , and the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) 
The overnight culture ( 2.5 ml ) was used to inoculate 250 ml <Med> of fresh LB </Med> medium with 10 g of submerged glass wool ( Corning Glass Works , Corning , NY ) and with 100 uM indole for forming biofilm . After incubation for 7 h at <Temp> 37 °C </Temp> with shaking ( <Agit> 250 rpm </Agit> ) , the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85 % NaCl solution at 0 °C . Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85 % NaCl solution at 0 °C . After breaking the cells with a bead beater , and the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) 
`` The overnight culture ( 2.5 ml ) was used to inoculate 250 ml <Med> of fresh LB </Med> medium with 10 g of submerged glass wool ( Corning Glass Works , Corning , NY ) for forming biofilm . After incubation for 15 h at <Temp> 37 °C </Temp> with shaking ( <Agit> 250 rpm </Agit> ) , the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85 % NaCl solution at 0 °C . Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85 % NaCl solution at 0 °C . After breaking the cells with a bead beater , and the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) . 
The overnight culture ( 2.5 ml ) was used to inoculate 250 ml <Med> of fresh LB </Med> medium with 10 g of submerged glass wool ( Corning Glass Works , Corning , NY ) for forming biofilm . After incubation for 15 h at <Temp> 37 °C </Temp> with shaking ( <Agit> 250 rpm </Agit> ) , the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85 % NaCl solution at 0 °C . Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85 % NaCl solution at 0 °C . After breaking the cells with a bead beater , and the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) 
The overnight culture ( 2.5 ml ) was used to inoculate 250 ml <Med> of fresh LB </Med> medium with 10 g of submerged glass wool ( Corning Glass Works , Corning , NY ) for forming biofilm . After incubation for 24 h at 37oC with shaking ( <Agit> 250 rpm </Agit> ) , the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85 % NaCl solution at 0oC . Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85 % NaCl solution at 0oC . After breaking the cells with a bead beater , and the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) . 
The overnight culture ( 2.5 ml ) was used to inoculate 250 ml <Med> of fresh LB </Med> medium with 10 g of submerged glass wool ( Corning Glass Works , Corning , NY ) for forming biofilm . After incubation for 7 h at 30 °C with shaking ( <Agit> 250 rpm </Agit> ) , the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85 % NaCl solution at 0 °C . Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85 % NaCl solution at 0 °C . After breaking the cells with a bead beater , and the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) 
The overnight culture ( 2.5 ml ) was used to inoculate 250 ml <Med> of fresh LB </Med> medium with 10 g of submerged glass wool ( Corning Glass Works , Corning , NY ) for forming biofilm . After incubation for 7 h at <Temp> 37 °C </Temp> with shaking ( <Agit> 250 rpm </Agit> ) , the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85 % NaCl solution at 0 °C . Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85 % NaCl solution at 0 °C . After breaking the cells with a bead beater , and the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) . 
The overnight culture was used to inoculate 25 ml <Med> of fresh LB </Med> medium . After incubation for OD600 = 0.5 at 37oC with shaking ( <Agit> 250 rpm </Agit> ) , the planktonic cells were quickly removed and the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) . 
The overnight culture was used to inoculate 25 ml <Med> of fresh LB </Med> medium . After incubation for OD600 = 0.5 at <Supp> 37oC under 2 mM IPTG </Supp> with shaking ( <Agit> 250 rpm </Agit> ) , the planktonic cells were quickly removed and the total RNA was isolated with Qiagen RNeasy mini Kit ( Cat # 74104 ) . 
The overnight culture was used to inoculate 25 ml <Med> of fresh LB </Med> medium . After incubation for OD600 = 0.8 at 37oC with shaking ( <Agit> 250 rpm </Agit> ) , adding 0.5 % L-arabinose and incubated for 24 h 
The program Rockhopper ( described in Mc Clure , et al. . Nucleic Acids Research . 2013 , 41 ( 14 ) ) was used for alignment , normalization , and quantification . Genome _ builg : <Strain> K-12 subst . MG1655 genome ( NC _ </O> <Gtype> 000913.3 ) / ASM584v1 </Gtype> 
The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 substr . MG1655 using Tophat2 using the following parameters , -- </O> <Gtype> GTF -- library type fr-secondstrand </Gtype> 
The RNeasy Mini Purification Kit ( Qiagen ; Valencia , CA ) was used to extract total RNA from E. coli O157 : <Gtype> H7 cultures . RNAlater Stabilization Reagent ( 1.2 ml ) ( Qiagen ; Valencia , CA ) was combined with 0.6 ml E. coli O157 : </O> <Supp> H7 . After 10 min at room temperature , the mixture was centrifuged at 8000 x g for 10 min under refrigeration . The supernatant was decanted and the bacterial pellet was stored at -70 °C until further processed ( 2-10 h ) . </O> 
The samples were sonicated for a total of 16 minutes and 50 uL protein A/G sepharose . All reactions are performed in an Eppendorf ThermalMixerR while being mixed at 1.4 k x rpm . After each reaction , the sepharose was washed with 1 mL of each of the following buffers , leaving 50-100 uL buffer above the sepharose in-between each wash : 1x TE : <Gtype> 10mM Tris-HCl , pH </Gtype> <Supp> 8.0 + 1 mM EDTA ; </Supp> 1 x High Salt - 1M NaCl ( 1 % Triton X-100 , 50 mM HEPES , pH 8.0 , 2 mM EDTA , 0.1 % sodium deoxycholate and 1M NaCl ) ; 1x Wash Buffer 2 ( 1 % Triton X-100 , 50 mM HEPES , pH 8.0 , 2 mM EDTA , 0.1 % sodium deoxycholate and 0.5 M NaCl ) ; 1x Wash Buffer 3 ( 1 % Triton X-100 , 50 mM HEPES , pH 8.0 , 2 mM EDTA , 1.0 % sodium deoxycholate , 0.25 M LiCl , 1 % NP-40 , and 10 mM Tris-HCl , pH 8.0 ) ; 1x TE : <Gtype> 10mM Tris-HCl , pH 8.0 + 1mM EDTA . </O> 
The scanned images were analyzed with Feature Extraction Software version 9.5.3.1 ( Agilent ) using default parameters ( protocol GE1-v5 _ 95 and Grid : <Supp> 020097 _ D _ </O> <Supp> F _ 20080627 ) to obtain background subtracted and spatially detrended Processed Signal intensities but not included the normalization process . Features flagged in Feature Extraction as Feature Non-uniform outliers were excluded . </O> 
The sequence data were mapped against the genome sequence of E. coli K12 substr . MG1655 ( NCBI accession number NC _ 000913.3 ) using Bowtie2 ( Langmead and Salzberg , 2012 , doi : <Gtype> 10.1038 / nmeth .1923 </Gtype> ) . 
The sigPep.csv file contains the counts for each specific signal peptide fusion to each specific test gene . Entries with <Supp> SP _ spkA/D/G / K represent spike in control molecules used for normalization . </O> 
The Sphingomonas sp. strain NM-05 used in the study is a known degrader of γ-hexachlorocyclohexane ( γ-HCH ) and has been isolated from the vicinity of an industry India Pesticide Limited , Chinhat industrial area , Lucknow which is involved in manufacturing chlorinated pesticides for last 25 years . The strain was harvested in mineral salt medium with 0.34 mM γ-HCH as sole source of carbon and energy . The strain Escherichia coli DH-5α was grown in Luria-Bertani medium to an <OD> O.D. of 0.4 </OD> at 37 degree centigrade with continuous shaking . The soil/sludge samples were collected in air tight vessels , transported on ice ( 4 ○ C ) to the laboratory and processed immediately for DNA isolation . At each sampling location multiple samples were collected from close ( 100m ) to far ( 500m ) from the industry , along the effluent channel and at the place where effluent channel from the industrial area falls into the river . 
The strain E. coli CMCC ( B ) 44102 , was provided by Institute of Microbiology , Chinese Academy of Sciences and preserved at the Department of Food Science and Nutrition , Zhejiang University . The strain was maintained in nutrient agar medium ( NA , Hangzhou Microbiological Agents Co. , Ltd. , China ) at <Temp> 37 °C </Temp> , and cultured in tryptic soy broth ( TSB , Qingdao Hope Biotechnology Co. , Ltd. , China ) at pH 7.0 and transferred every 20-24 h with incubation at <Temp> 37 °C </Temp> . 
The strain Escherichia coli MG1655 -LSB- pPROEx-CAT -RSB- was cultured in a fed-batch fermenter in <Med> LB media </Med> w / glucose and a glucose/MgS04 feed at <Temp> 37 degrees </Temp> . Cultures were synchronized to the late log phase , approximately 4.5 hours of fermentation time . Serine hydrxamate ( 100mg/L final concentration ) was added to the cultures . Samples were taken 1 hour after the beginning the serine hydrxamate addition . 
The strain MG1655 -LSB- pPROEx-CAT -RSB- was cultured in a fed-batch fermenter in <Med> LB media </Med> w / glucose and a glucose/MgS04 feed at <Temp> 37 degrees </Temp> . Cultures were synchronized to the late log phase , approximately 4.5 hours of fermentation time . One set of fermentations were exposed to IPTG and one set was not exposed to IPTG . Samples were taken 0 , 1 , and 4 hours post-synchronization ( Time S0 , S1 , and S4 ) . 
The strains were grown exponentially ( after initiation by a 1,000-fold dilution from overnight cultures ) for ~ 5 generations at <Temp> 37 °C </Temp> in <Med> Vogel-Bonner ( VB ) minimal medium </Med> supplemented with glucose ( 0.4 % ) , pantothenic acid ( 5 µg/ml ) , casamino acids ( Becton-Dickenson ) ( 1 % ) , and hypoxanthine ( 50 µg/ml ) . 
The subculture was split into two 10 ml portions , one of which was treated with 6ug/ml triclosan and the other retained as an untreated control . Treated and untreated samples were incubated at 37c for <Supp> 30 min </Supp> . 
The total sequencing base pair coverage for all annotated genes was summed for each sample and normalized to total coverage using bedtools and custom R scripts as described in Wu et al. 2015 PLoS Genetics Nov 6 ; 11 ( 11 ) : <Supp> e1005655 . </O> 
The trimmed reads were aligned against E. 149 coli MG1655 ( GenBank : <Gversion> U00096 .3 </Gversion> ) using bowtie2 ( Version 2.2.4 ) 
The wildtype and mutant E. coli O157 : <Gtype> H19 strains were grown on LB agar incubated at 37c x 24h . A single isolated colony for each strain was selected and inoculated into 20 ml LB broth and incubated at 37c until growth reached an optical density of 0.6 at 600nm . </O> 
Third biological repeat <Temp> 37 °C </Temp> 
Thirty-six dye-swap hybridizations were performed between four groups with six strains per group , according to a balanced double loop design . Strains were grouped based on cladestx profiles and each strain was considered an independent biological replicate of its group ( n = 6 ) . The six strains from each group were randomly hybridized with six strains from every other group ; each hybridization compared a pair of strains that differed in either clade or stx profile , or both . Subsequent to local Lowess normalization , averaging of replicate probes and log2 transformation , the microarray data were fitted to a 2-factor mixed ANOVA model ( intensity = Array + Dye + Clade + Stx + Clade : <Gtype> Stx + Sample ; where </Gtype> the biological replicate ( Sample ) and array effects were considered random effects , while all other effects were considered fixed effects ) , using the MAANOVA package ( version 0.98-8 ) in R software ( version 2.2.1 ) . This model allows independent consideration of the effect of ` Clade ' ( clade divergence ) and ` Stx ' ( stx type variation ) parameters on differences in gene expression among O157 : <Gtype> H7 strains , as well as their interaction ( combined ) effect ( Clade : </O> <Gtype> Stx ) . Overall differences in gene expression between groups were determined using the Fs test , followed by pair-wise contrasts to determine significant differential expression between each pair of groups . Subsequently , the Fs statistic was estimated for the ` Clade ' effect to determine significant differences in gene expression between clades 8 ( n = 12 ) and 2 ( n = 12 ) , regardless of stx profile . Similarly , the Fs statistic was estimated for the ` Stx ' effect as well as the ` Clade : </O> <Gtype> Stx ' </Gtype> interaction effect to examine the combined effect of clade and stx type on differences in gene expression among O157 : <Gtype> H7 strains . In other words , this analysis will determine whether the expression of any given gene among groups with different stx types is also dependent on clade . An interaction effect would be observed if expression estimates between strain groups clade8stx2 and clade2stx2 are different from expression estimates between strain groups clade8stx2 ,2 c and clade2stx1 ,2 . For every analysis , 1000 permutations of the data were performed to generate P values ; estimates were considered significant if the P value was < 0.05 after adjusting for multiple comparisons . </O> 
three different concentrations , without H2O2 , 10 % ( v/v ) or 30 % H2O2 were added directly to the cell cultures of <Gtype> wild type </Gtype> or luxS mutants , OD of which is 1.0 . Treated samples were continuously incubated at 30 degree Celcius for <Supp> 30 min </Supp> 
time : 1 h with <Supp> 20 μg/mL ampicillin </Supp> 
time course sample harvested after <Supp> 30 min of glucose </Supp> to acetate shift 
time induction : <Supp> 30 minutes </Supp> 
time induction : <Supp> 5 minutes </Supp> 
time induction : <Supp> 60 minutes </Supp> 
time point : <Gtype> 4.5 hrs after induction </O> 
time point : <pH> time2 .5 </pH> 
time point : <pH> time7 .5 </pH> 
time point : <Supp> 0 min </Supp> 
time point : <Supp> 10 min </Supp> 
time point : <Supp> 135 min </Supp> 
time point : <Supp> 15 min </Supp> 
time point : <Supp> 168 hours </Supp> 
time point : <Supp> 180 min </Supp> 
time point : <Supp> 1 min </Supp> 
time point : <Supp> 20 min </Supp> 
time point : <Supp> 24 hours </Supp> 
time point : <Supp> 2 min </Supp> 
time point : <Supp> 30 min </Supp> 
time point : <Supp> 30 minutes </Supp> related to point of BRP induction 
time point : <Supp> 336 hours </Supp> 
time point : <Supp> 3 hours </Supp> 
time point : <Supp> 45 min </Supp> 
time point : <Supp> 48 hours </Supp> 
time point : <Supp> 4 hours </Supp> 
time point : <Supp> 4 min </Supp> 
time point : <Supp> 5 hours </Supp> 
time point : <Supp> 6 hours </Supp> 
time point : <Supp> 6 min </Supp> 
time point : <Supp> 8 hours </Supp> 
time point : <Supp> 8 min </Supp> 
time point : <Supp> 90 min </Supp> 
time : <Supp> 0.5 min </Supp> 
time : <Supp> 0 mins </Supp> 
time : <Supp> 0 min </Supp> 
time : <Supp> 10 mins </Supp> 
time : <Supp> 10 min </Supp> 
time : <Supp> 120 min </Supp> 
time : <Supp> 120 minutes </Supp> 
time : <Supp> 12 h </Supp> 
time : <Supp> 180 minutes </Supp> 
time : <Supp> 195 min </Supp> 
time : <Supp> 1 min </Supp> 
time : <Supp> 20 min </Supp> 
time : <Supp> 210 min </Supp> 
time : <Supp> 24 h </Supp> 
time : <Supp> 2.5 mins </Supp> 
time : <Supp> 2.5 min </Supp> 
time : <Supp> 25 min </Supp> 
time : <Supp> 2 min </Supp> 
time : <Supp> 300 minutes </Supp> 
time : <Supp> 30 mins </Supp> 
time : <Supp> 30 min </Supp> 
time : <Supp> 330 min </Supp> 
time : <Supp> 40 min </Supp> 
time : <Supp> 420 minutes </Supp> 
time : <Supp> 45 min </Supp> 
time : <Supp> 5 min post-infection </Supp> 
time : <Supp> 5 min </Supp> 
time : <Supp> 60 min </Supp> 
time : <Supp> 60 minutes </Supp> 
time : <Supp> 6 h </Supp> 
time : <Supp> 75 min </Supp> 
time : <Supp> 7 hours </Supp> 
time : <Supp> 7 mins </Supp> 
time : <Supp> 80 min </Supp> 
time : <Supp> 9 min post-infection </Supp> 
time : <Supp> Sample was taken after mouse was on the diet for 14 days . </O> 
time : <Supp> Sample was taken after mouse was on the diet for 1 days . </O> 
time : <Supp> Sample was taken after mouse was on the diet for 2 days . </O> 
time : <Supp> Sample was taken after mouse was on the diet for 4 days . </O> 
time : <Supp> Sample was taken after mouse was on the diet for 6 days . </O> 
time : <Supp> Sample was taken after mouse was on the diet for 7 days . </O> 
tissue : <Anti> bacterial cells </Anti> 
tissue : <Gtype> entire bacterial cell </Gtype> 
tissue source : <Anti> kidney from CD-1 mice </O> 
tnaA2trpR2 vs. tnaA2 , W3110 min + <Supp> Trp 50ug/ml </Supp> 
To apply the second approach variable in length reads from Illumina MiSeq were first trimmed from both sides to obtain a set of standard 50 nt sequences taken from the middle of longer reads . Reads shorter than 50 nt were discarded . Then , all four sets from both experiments were aligned to the genome using the Matcher program ( available at : <Gtype> http://www.mathcell.ru/DnaRnaTools/Matcher.zip ) . This software maps only 5 ' - ends if the reads correspond to the top strand of genomic DNA , or only 3 ' - ends , if they are aligned to the bottom strand . As such , the signals from fully complementary reads will match the same ( left ) position . Reporting the distribution of matching reads across the genome the program also evaluates reads with multiple occurrence and their positions . </O> 
To harvest total RNA samples , overnight cultures of <Gtype> wild type </Gtype> MG1655 grown in LB at 37 ˚C were diluted back 1:500 in either fresh LB or M63 minimal glucose medium and allowed to grow until the cultures reached an OD600 of ~ 0.4 and 2.0 for cultures grown in LB and an OD600 of ~ 0.4 for cultures grown in M63 . For samples grown to OD600 of ~ 0.4 a total volume of 25 ml of cells were harvested and combined with 5 ml of stop solution ( 95 % Ethanol , 5 % acid phenol ) . For samples grown to OD600 of 2.0 a total volume of 5 ml of cells were harvested and combined with 1 ml of stop solution . 
To prepare the in vitro samples , APEC strain E058 was grown statically at <Temp> 37 °C </Temp> in 10 mL of LB broth until the absorbance at 600 nm ( A600 ) reached 0.4 . To prepare the in vivo samples , the bacteria was harvested from cardiac blood in 1-day-old chickens at 5 hours post infection . 
total DNaseI treated RNA was depleted of ribosomal RNA using the Ribo-Zero ™ RNA removal kit for Gram-negative bacteria ( Epicentre ) . A 3 ' RNA adapter , based on the Illumina multiplexing adapter sequence ( Oligonucleotide sequences © 2007-2014 Illumina , Inc. . All rights reserved ) blocked at the 3 ' end with an inverted dT ( 5 ' - GAUCGGAAGAGCACACGUCU -LSB- idT -RSB- -3 ' ) , was phosphorylated at the 5 ' end using T4 PNK ( New England Biolabs ) per the manufacturer 's protocol . The 3 ' RNA adapter was ligated to the 3 ' ends of the rRNA depleted RNA using T4 RNA ligase I ( New England Biolabs ) . 1.5 mg of RNA was incubated at 20 °C for 6 hours in 1X T4 RNA ligase reaction buffer with 1 mM ATP , <Supp> 30 µM </Supp> 3 ' RNA adapter , 10 % DMSO , 10 U of T4 RNA ligase I , and 40 U of RNasin ( Promega ) in a 20 ml reaction . RNA was then fragmented in equivalents of 100 ng using the RNA fragmentation reagents ( Ambion ® ) per the manufacturer 's protocol at 70 °C for 3 min and subsequently phosphorylated at the 5 ' ends using T4 PNK ( New England Biolabs ) per the manufacturer 's protocol to allow for ligation of the 5 ' adapter . RNA was size-selected ( ≈ 150-300 nt ) and purified over a denaturing 8 % polyacrylamide/8 M urea/TBE gel . Gel slices were incubated in RNA elution buffer ( 10 mM Tris-HCl , pH 7.5 , 2 mM EDTA , 0.1 % SDS , 0.3 M NaOAc ) with vigorous shaking at 4 °C overnight . The supernatant was subsequently ethanol precipitated using glycogen as a carrier molecule . The Illumina small RNA 5 ' adapter ( 5 ' - GUUCAGAGUUCUACAGUCCGACGAUC-3 ' ) was ligated to the RNA as described before except the concentration of the adapter was 52 mM and 20 U of T4 RNA ligase I was used in total volume of 25 µl . The ligated RNAs were size-selected ( ≈ 200-300 nt ) and gel-purified over a denaturing 8 % polyacrylamide/8 M urea/TBE gel ( as described above ) . The di-tagged RNA libraries were reverse-transcribed with SuperScript ® II reverse transcriptase ( Invitrogen ) using random nonamers per the manufacturer 's protocol . RNA was removed using RNase H ( Promega ) per the manufacturer 's protocol and cDNA was amplified in PCR carried out using Phusion ® High-Fidelity Polymerase ( New England Biolabs ) . cDNA was amplified with modified designed Illumina-compatible PCR primers ( 3 ' library Forward 5 ' - CAAGCAGAAGACGGCATACGACAGGTTCAGAGTTCTACAGTCCGA-3 ' ; Reverse 5 ' - AATGATACGGCGACCACCGAGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3 ' ) by 18 cycles of PCR . The products were purified using Agencourt AMPure XP beads ( Beckman ) and analyzed on an Agilent 2100 Bioanalyzer . 3 ' end enriched cDNA libraries were sequenced on individual Genome Analyzer IIx lanes ( 36 bp , single-end ) or on HiSeq 2000 lanes ( 50 bp , single-end ) using primer based on Illumina Multiplexing Read 2 Sequencing Primer ( 5 ' - GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3 ' ) at the CSF NGS unit http://csf.ac.at/ . 
Total RNA ( 2ug ) was subjected to rRNA depletion using Ribozero rRNA removal kit -- Bacteria ( Epicenter , illumina ) . rRNA-depleted RNA was purified using Ampure XP beads . Purified RNA was then fragmented using RNA Fragmentation Reagents ( Ambion ) at 70C for 2 mins , targeting fragments ranging from 200-300bp . Fragmented RNA was then purified using Ampure XP beads ( Agencourt ) . Reverse transcription was performed using SuperScript II Reverse Transcription ( Invitrogen ) with an initial annealing of random hexamers ( Fermentas ) at 65C for 5 mins , follow by an incubation of 42C for 50 mins and an inactivation step at 70C for 10 mins . cDNA was then purified with Ampure XP beads . This was followed by second strand synthesis using dNTP mix where dTTP is replaced by dUTP . Reaction was performed at 16C for 1h . Double stranded cDNA fragments were purified and selected for targeted fragments ( 200-300bp ) using Ampure XP beads . The dscDNA were then blunt-ended , the 3 ' ends were adenylated with a single A , and ligated with library adapters using Kapa Library Amplification Kit ( Kapa Biosystems ) . Adapter-ligated DNA was purified using Ampure XP beads . Digestion of dUTP was then performed using AmpErase UNG ( Applied Biosystems ) to remove second strand cDNA . Digested cDNA was again cleaned up with Ampure SPRI beads . This was followed by amplification by 10 cycles of PCR using Kapa Library Amplification Kit ( Kapa Biosystems ) . The final library was cleaned up with Ampure SPRI beads . Sequencing was done on the Illumina HiSeq platform generating paired end reads of 100bp each . Note : <Gtype> Target fragments here refers to the insert only , that is the cDNA . The actual size we use in selection will be larger , typically the target fragment size + 125bp adaptors ( ~ 300-450bp ) . </O> 
Total RNA is extracted from 10 ^ 9 cells by phenol-chloroform extraction according to Sambrook et al. and ethanol precipitation with 5M NaCl . Subsequently a DNAse I digest at <Temp> 37 °C </Temp> for 30 minutes and an additional phenol-chloroform extraction step is performed . Integrity of the total RNA is electrophoretically confirmed using the Agilent 2100 Bioanalyzer . 
Total RNA is extracted from 10 ^ 9 cells by phenol-chloroform extraction and ethanol precipitation with 5M NaCl . Subsequently a DNAse I digest at <Temp> 37 °C </Temp> for 30 minutes and an additional phenol-chloroform extraction step is performed . Integrity of the total RNA is electrophoretically confirmed using the Agilent 2100 Bioanalyzer . 
Total RNA was extracted from cell pellets with TRI Reagent ( MRC ) . RNA was precipitated , resuspended in DNase Reaction Buffer ( Invitrogen ) for <Supp> 30 min </Supp> at room temperature . DNase-treated samples were subsequently purified with an Rneasy Plus Mini Kit ( Qiagen ) . 
Total RNA was extracted using Qiagen RNeasy Mini Kit . DNA was removed using Ambion DNA-free kit . RNA quality was assessed using 2 % agarose gels and OD260/OD280 ratio . Amino-allyl dUTP was used to label 5µg of RNA during reverse transcription . The reverse transcription was performed at 42 °C during 50 min using 600 units of superscript RT II ( Invitrogen ) , 3 µg of random hexamers , 0.6 mM dATP , dCTP and dGTP , 0.2 mM dTTP , and 0.4 mM amino-allyl dUTP ( Ambion ) . RNA was then degraded by incubation at 65 °C , for 15 min , after adding 10µL of <Supp> 0.5 M EDTA and 10µL of 1M NaOH </Supp> . 
Total RNA was extracted using the Trizol reagent ( Thermo Fisher Scientific ) and the concentration and purity of the samples were determined using Nano Drop . RNA integrity was monitored using the R6K ScreenTape system on the Agilent 2200 TapeStation . gDNA was removed by Turbo DNase ( Thermo Fisher Scientific ) in the presence of 1U / L RiboLock RNase Inhibitor ( Thermo Fisher Scientific ) for 60 min at <Temp> 37 °C </Temp> . Following organic extraction ( 1x 25:24:1 v/v phenol/chloroform / isoamyalcohol , 1x chloroform ) , RNA was recovered by overnight precipitation with 3 volumes of 30:1 100 % ethanol/3 M sodium acetate ( pH 5.2 ) . Next , the sample ( TEX + ) was depleted of processed RNAs using 1U per 1μg of RNA Terminator 5 ' - Phosphate-Dependent Exonuclease ( TEX , Epicentre ) in the presence of 1U/μL RNase Inhibitor for 60 min at 30 ° C . A control reaction without TEX ( TEX - ) was run in parallel . Following organic extraction , RNA was recovered by overnight precipitation and resuspended in RNase-free water . 
Total RNA was extracted using TRIzol reagent ( Invitrogen ) and the sample was enriched in mRNA , depleting small RNAs with GeneJET ™ RNA Purification Kit ( Fermentas ) and ribosomal RNA with two cycle of MICROBExpress ™ Bacterial mRNA Enrichment Kit ( Ambion ) . To probe the RNA structure two µg of enriched mRNA were resuspended in 45 µl of DEPC water and denatured for 3 min at 95 °C , refolded at <Temp> 37 °C </Temp> , after addition of 10x RNA-structure buffer with pH 7.0 ( 100 mM Tris , 1 M KCl , 100 mM MgCl2 ) and digested for 1 min at <Temp> 37 °C </Temp> with either 0.05 U RNase V1 ( Life Technologies ) or a combination of 2 µg RNase A and 5 U RNase T1 ( Thermo Scientific ) . The reaction was stopped by extracting the RNA with phenol-chlorophorm . The RNase A/T1-digested sample was phosphorylated with T4 PNK ( NEB ) and purified with RNA Clean & Concentrator ™ kit ( Zymo Research ) . Both the V1 and A/T1 digested samples were randomly fragmented in buffer with pH 9.2 ( 100 mM Na2CO3 , 2 mM EDTA ) for 12 min at 95 °C . 
Transcriptomic analyses were carried out after growing bacteria in minimal media supplemented with <Supp> glucose . Several Ni concentrations and exposure times were assayed . rcnA gene expression was taken as an internal control to arbitrate between the different conditions . rcnA is induced by Ni when cells are overloaded with this ion and must detoxify the cytoplasm by extruding excess metal via the RcnAB efflux system . rcnA induction was maximised after culture incubation for 10 min , and longer periods of incubation lead to a decline in rcnA expression ( Fig . S1 ) . For the RNA-Seq experiments , bacteria were grown until O.D600nm = 0.3 , were treated with </O> <Supp> 50 µM NiCl2 </Supp> for 10 min and were frozen prior to RNA extraction . 
Transcripts evaluation of differential expression were accomplished using MARS ( MA-plot-based method with Random sampling model ) in DEGseq package . ( Bioinformatics 2010 , 26 : <Gtype> 136-138 ) </Gtype> 
transformation : <Gtype> empty vector </Gtype> 
treated with : 100 µg/ml BSA for <Supp> 30 min </Supp> ( control ) 
treated with : 100 µg/ml PGRP for <Supp> 30 min </Supp> 
treated with : 5 µg/ml gentamicin for <Supp> 30 min </Supp> 
treated with : <Anti> none ( untreated control ) </O> 
treated with : <Gtype> 0.5 μg/ml trimethoprim </Gtype> 
treated with : <Gtype> 172mM NaCl </Gtype> 
treated with : <Gtype> 172mM short chain fatty acid mix </O> 
treated with : <Gtype> 30mM NaCl </Gtype> 
treated with : <Gtype> 30mM short chain fatty acid mix </O> 
treated with : <Gtype> Rifampicin for 20 minutes </O> 
treated with : <Supp> 20 ug/ml bicyclomycin </Supp> 
treated with : <Supp> 250 uM of paraquat </Supp> at mid-log pahse for <Supp> 20 min </Supp> 
treated with : <Supp> 250 uM of paraquat </Supp> at mid-log phase for <Supp> 20 min </Supp> 
treated with : <Supp> 800 µM CCCP </Supp> for <Supp> 15 min </Supp> 
Treatment 1 : <Anti> UA30 ( EHEC 86-24 exposed to pH 3 for </O> <Supp> 30 min ) </Supp> 
Treatment 3 : <Anti> UA15 ( EHEC 86-24 exposed to pH 3 for 15 min ) </O> 
treatment : After 10 mg/mL kasugamycin treatment for <Supp> 40 min </Supp> 
treatment : <Air> Continuous aerobically </Air> grown cultures in Evans medium , exposed to 0.1 L/min CO gas 
treatment : <Air> Continuous aerobically </Air> grown cultures in Evans medium , exposed to 40uM CORM-3 
treatment : <Air> Continuous aerobically </Air> grown cultures in Evans medium , exposed to 40uM iCORM-3 
treatment : <Air> control , anaerobic </Air> 
treatment : <Anti> ampicillin ( 50 µg/mL final concentration ) </O> 
treatment : <Anti> florfenicol ( 30 µg/mL final concentration ) </O> 
treatment : <Anti> Pooled RNA </Anti> from mixture of the same amount of wt , wt + SHX , dksA , dksA + SHX RNA samples 
treatment : <Anti> streptomycin ( 50 µg/mL final concentration ) </O> 
treatment duration : <Gtype> 2.5 h </Gtype> 
treatment duration : <Supp> 10 min </Supp> 
treatment duration : <Supp> 15 h </Supp> 
treatment duration : <Supp> 8 min </Supp> 
treatment : exposed to 100uM CORM-3 for <Supp> 10 min </Supp> 
treatment : exposed to 100uM CORM-3 for <Supp> 120 min </Supp> 
treatment : exposed to 100uM CORM-3 for <Supp> 20 min </Supp> 
treatment : exposed to 100uM CORM-3 for <Supp> 40 min </Supp> 
treatment : exposed to 100uM CORM-3 for <Supp> 60 min </Supp> 
treatment : exposed to 100uM iCORM-3 for <Supp> 10 min </Supp> 
treatment : exposed to 100uM iCORM-3 for <Supp> 120 min </Supp> 
treatment : exposed to 100uM iCORM-3 for <Supp> 20 min </Supp> 
treatment : exposed to 100uM iCORM-3 for <Supp> 40 min </Supp> 
treatment : exposed to 100uM iCORM-3 for <Supp> 60 min </Supp> 
treatment group : <Anti> indole treated </Anti> 
treatment group : <Gtype> cold stress </Gtype> 
treatment group : <Gtype> oxidative stress </Gtype> 
treatment group : <Phase> heat stress </Phase> 
treatment group : <Phase> lactose shift </Phase> 
treatment group : <Supp> rifampicin time point 0 </Supp> 
treatment group : <Supp> rifampicin time point 4 </Supp> 
treatment group : <Supp> rifampicin time point 6 </Supp> 
treatment group : <Supp> rifampicin time point 8 </Supp> 
treatment group : <Supp> rifampicin time point </Supp> 2 
treatment : <Gtype> 0.025 mM CspA protein </Gtype> 
treatment : <Gtype> 0.05 mM CspA protein </Gtype> 
treatment : <Gtype> 0.5 µg/ml Carolacton </Gtype> 
treatment : <Gtype> 0.5 mg/ml menadione </Gtype> 
treatment : <Gtype> 0.5 mg/ml serine hydroxamate for </O> <Supp> 20 min </Supp> 
treatment : <Gtype> 0.5 mg/ml SHX for </O> <Supp> 40 min </Supp> 
treatment : <Gtype> 0.8 % </Gtype> n-butanol was added at time 0 
treatment : <Gtype> bicontinious microemulsion </Gtype> 
treatment : <Gtype> Carbon starvation </Gtype> 
treatment : <Gtype> Cold Shock </Gtype> 
treatment : <Gtype> DpnI digested DNA </O> 
treatment : <Gtype> Heat Shock </Gtype> 
treatment : <Gtype> Low pH </Gtype> 
treatment : <Gtype> minimal C&N source </Gtype> 
treatment : <Gtype> minimal C source </Gtype> 
treatment : <Gtype> minimal N source </Gtype> 
treatment : <Gtype> Nitrogen starvation </Gtype> 
treatment : <Gtype> No treatment </Gtype> 
treatment : <Gtype> Osmotic stress </Gtype> 
treatment : <Gtype> Oxidative stress </Gtype> 
treatment : <Gtype> Ribosome-protected mRNA , Ribosome footprint sample digested with 60 units of micrococcal nuclease per A260 absorbance </O> 
treatment : <Gtype> sham-treated power line intermittent ( 2 min on , 4 min off ) magnetic field </O> 
treatment : <Gtype> sham-treated sinusoidal continous magnetic field </Gtype> 
treatment : <Gtype> Treated by HPCD at 5 MPa and 25 ℃ for </O> <Supp> 40 min </Supp> 
treatment : <Gtype> unexposed , left chamber/bioreacator </Gtype> 
treatment : <Gtype> unexposed , right chamber/bioreacator </Gtype> 
treatment : <Gtype> untreated culture </Gtype> 
treatment : <Gtype> vector control </Gtype> 
treatment : <Gtype> WT Rho plasmid </Gtype> 
treatment : <Med> Bacillus volatile organic compounds ( VOCs ) </Med> 
treatment : <Med> glucose ( 2 g/L ) minimal M9 medium </Med> supplemented without <Supp> 10 mM leucine </Supp> . 
treatment : <Med> glucose ( 2 g/L ) minimal M9 medium </Med> supplemented without <Supp> 20 mg/L tryptophan </Supp> . 
treatment : <Med> glucose ( 2 g/L ) minimal M9 medium </Med> supplemented with <Supp> 10 mM leucine </Supp> . 
treatment : <Med> glucose ( 2 g/L ) minimal M9 medium </Med> supplemented with <Supp> 20 mg/L tryptophan </Supp> . 
treatment : <Med> glucose ( 2 g/L ) minimal W2 medium </Med> supplemented with <Supp> 1g/L arginine </Supp> . 
treatment : <Med> glucose ( 2 g/L ) minimal W2 medium </Med> supplemented with <Supp> 2g/L glutamine </Supp> . 
treatment : <Med> sham-treated sinusoidal intermittent ( </Med> 2 min on , 4 min off ) magnetic field 
treatment : <Med> tobacco acid pyrophosphatase ( TAP ) </Med> 
treatment : <Med> treated sinusoidal intermittent ( </Med> 2 min on , 4 min off ) magnetic field 
treatment : <Phase> batch growth </Phase> 
treatment : <Phase> chemostat growth </Phase> 
treatment : <Phase> heat shock </Phase> 
treatment : <Phase> log phase sample </Phase> 
treatment : <Phase> starvation growth </Phase> 
treatment : <Phase> stationary phase </Phase> 
Treatment protocol - E.coli cells grown in <Med> LB media </Med> with at 37C until early log phase ( 0.4 ) , then were treated with 200 mM glyphosate for 1 h , after that the cells were harvested to extract RNA . 
treatment : <Substrain> MG1655 + 3µM HgCl2 at t10 </O> 
treatment : <Substrain> MG1655 + 3µM HgCl2 at t30 </O> 
treatment : <Substrain> MG1655 + 3µM HgCl2 at t60 </O> 
treatment : <Substrain> MG1655 + 3µM PMA at t10 </O> 
treatment : <Substrain> MG1655 + 3µM PMA at t30 </O> 
treatment : <Substrain> MG1655 + 3µM PMA at t60 </O> 
treatment : <Supp> 0.1 mM CspA protein </Supp> 
treatment : <Supp> 0.3 % glucose </Supp> 
treatment : <Supp> 0.4 % glucose </Supp> 
treatment : <Supp> 10 % H202 </Supp> 
treatment : <Supp> 15 min </Supp> 
treatment : <Supp> 15 min </Supp> after induction with <Supp> arabinose 
treatment : <Supp> 15 min </Supp> after induction with <Supp> rhamnose 
treatment : <Supp> 1mM IPTG </Supp> 
treatment : <Supp> 1 % </Supp> <Air> H202 , anaerobic </Air> 
treatment : <Supp> 1 % </Supp> <Air> H2O2 , anaerobic </Air> 
treatment : <Supp> 200 mM glyphosate shock for 1 h </O> 
treatment : <Supp> 2 mM NaN3 </Supp> for 10 minutes 
treatment : <Supp> 2ug/ml of ciprofloxacin </Supp> 
treatment : <Supp> 30 C </Supp> 
treatment : <Supp> 30 % H202 </Supp> 
treatment : <Supp> 42 C </Supp> 
treatment : <Supp> 4ug/ml of ciprofloxacin </Supp> 
treatment : <Supp> 5 percent isooctane </Supp> 
treatment : <Supp> 60 min </Supp> after induction with <Supp> arabinose 
treatment : <Supp> 60 min </Supp> after induction with <Supp> rhamnose 
treatment : <Supp> Before rifampicin treatment </Supp> 
treatment : <Supp> oil in water </Supp> 
treatment : <Supp> water in oil </Supp> 
treatment : <Supp> without salt shock </Supp> 
treatment : <Temp> 37 °C </Temp> 
treatment : <Temp> 50 °C </Temp> heatshock 
treatment time : <Gtype> T10 : </O> <Supp> 210 min </Supp> after stress 
treatment time : <Gtype> T11 : </O> <Supp> 235 min </Supp> after stress 
treatment time : <Gtype> T12 : </O> <Supp> 260 min </Supp> after stress 
treatment time : <Gtype> T1 : OD 0.3 </Gtype> 
treatment time : <Gtype> T1 : OD 0.5 </Gtype> 
treatment time : <Gtype> T2 : OD 0.5 </Gtype> 
treatment time : <Gtype> T2 : OD 0.6 </Gtype> 
treatment time : <Gtype> T3 : OD 0.6 </Gtype> 
treatment time : <Gtype> T3 : OD 0.7 </Gtype> 
treatment time : <Gtype> T3 : </O> <Supp> 10 min </Supp> after reaching OD 0.6 
treatment time : <Gtype> T3 : </O> <Supp> 10 min </Supp> after stress 
treatment time : <Gtype> T4 : </O> <Supp> 10 min </Supp> after growth lag 
treatment time : <Gtype> T4 : </O> <Supp> 10 min </Supp> after stress 
treatment time : <Gtype> T4 : </O> <Supp> 20 min </Supp> after reaching OD 0.6 
treatment time : <Gtype> T4 : </O> <Supp> 20 min </Supp> after stress 
treatment time : <Gtype> T5 : </O> <Supp> 20 min </Supp> after growth lag 
treatment time : <Gtype> T5 : </O> <Supp> 20 min </Supp> after stress 
treatment time : <Gtype> T5 : </O> <Supp> 30 min </Supp> after reaching OD 0.6 
treatment time : <Gtype> T5 : </O> <Supp> 30 min </Supp> after stress 
treatment time : <Gtype> T6 : </O> <Supp> 30 min </Supp> after growth lag 
treatment time : <Gtype> T6 : </O> <Supp> 30 min </Supp> after stress 
treatment time : <Gtype> T6 : </O> <Supp> 40 min </Supp> after reaching OD 0.6 
treatment time : <Gtype> T6 : </O> <Supp> 40 min </Supp> after stress 
treatment time : <Gtype> T7 : </O> <Supp> 40 min </Supp> after growth lag 
treatment time : <Gtype> T7 : </O> <Supp> 40 min </Supp> after stress 
treatment time : <Gtype> T7 : </O> <Supp> 50 min </Supp> after reaching OD 0.6 
treatment time : <Gtype> T7 : </O> <Supp> 50 min </Supp> after stress 
treatment time : <Gtype> T8 : </O> <Supp> 90 min </Supp> after reaching OD 0.6 
treatment time : <Gtype> T8 : </O> <Supp> 90 min </Supp> after stress 
treatment time : <Gtype> T9 : </O> <Supp> 150 min </Supp> after stress 
trpEA2trpR2 vs. trpEA2 , W3110 min + <Supp> Trp 50ug/ml </Supp> 
Tube state 2 <Supp> ( IPTG </Supp> + / aTc - / Ara - ) 
Two Avian Pathogenic Escherichia coli strains ( APEC ) were grown at <Temp> 37 °C </Temp> in Dulbecco 's Modified Eagle 's Media ( DMEM ) media until reach O.D 600 = 0.8 . 
Two color cDNA microarray data are never devoid of spurious technical contributions that originate during array printing , as well as during the collection and processing of samples , fluorescent labeling and hybridization and scanning of the microarray images ( Balazsi et al. 2003 , PNAS ) . To minimize the effect of such contributions , microarray data were normalized as described before ( Tong et al. 2004 BBRC ) . Briefly , spots were excluded from further analysis if the foreground intensity of less than 50 % of the pixels within the spot were above 2 standard deviations of the background . We generated expression data tables in Microsoft Excel , containing the following information for each of the 14,352 entries : <Anti> block ( B ) , column ( X ) , and row ( Y ) number , red foreground ( f _ r ) and background ( b _ r ) , green foreground ( f _ g ) and background ( b _ g ) intensity . The position of each probe within a block , P is defined by the pair of integers ( X , Y ) . Log ratios were defined as the base 10 logarithm of ( F _ </O> <Supp> r-B _ r ) / ( F _ </O> <Supp> g-B _ g ) , where F _ r , B _ r , F _ g and B _ g represent the median Cy5 ( red ) foreground and background , and the median Cy3 ( green ) foreground and background intensities , respectively . In some cases , when the intensity of the background was higher than or equal to the intensity of the foreground , the resulting log ratios became complex or infinity . These values were eliminated using the find , imag , and isfinite functions in Matlab . Next , data were normalized , by averaging the log ratios resulting from all spots printed by a print tip , and subtracting the resulting average from all the individual log ratios corresponding to the same tip . Finally , all the log ratios of the same gene from each slide were averaged and listed in a new file . </O> 
Two precultures were performed in LB medium and mineral salt medium with <Supp> 10 g L 1 of glucose </Supp> without antifoam agent consecutively at <Temp> 37 °C </Temp> at a rotary shaker at 180 rpm . Main cultivations were started as batch cultures at a temperature of <Temp> 37 °C </Temp> . The pH was kept at 7.0 by controlled addition of 25 % ammonia solution . At the end of the exponential growth phase ( cell dry weight about 16 g L-1 ) the stirrer rate was lowered from 1000 rpm to 500 rpm , to provoke oxygen limitation by decreased oxygen transfer . Constant glucose feed of 100 g L-1 h-1 was started 15 min after the oxygen drop which was enough to ensure glucose excess during the whole cultivation . 
ug/ml smx / ug/ml tm : <Gtype> 20/4 ( 1x ) </Gtype> 
ug/ml smx / ug/ml tm : <Gtype> 540/108 ( 27x ) </Gtype> 
Using Bowtie2 ( version 2.0.2 ) , sequenced reads were mapped to an EPEC O127 : <Gtype> H6 reference genome ( EMBL/GenBank accession codes FM180568 , FM180569 , and FM180570 ) . </O> 
Viable clones of the UvsW-expressing strains GJ13531 ( Δrho ) and GJ13507 ( ΔnusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 μM ( for Δrho ) or 3 μM ( for ΔnusG ) , as previously described 
\ W3110 lrp - at OD420 ~ 0.3 in <Med> MOPS ( ile , val , thi ) , 20 ug total , 10 ug pdN6 \ </O> 
\ W3110 lrp - at OD420 ~ 0.3 in <Med> MOPS ( ile , val , thi ) + Leu , 20 ug total RNA ,10 ug pdN6 \ </O> 
\ W3110 lrp - at OD420 ~ 0.3 in <Med> MOPS ( ile , val , thi ) plus Leu , 20 ug total RNA , 10 ug pdN6 \ </O> 
\ W3110 lrp - in <Med> MOPS ( ile , val , thi ) to OD420 ~ 0.3 , 20 ug total RNA , 10 ug pdN6 \ </O> 
W3110 rpoC-6xHis : <Gtype> : kan gal490 </Gtype> 
W3110 rpoC-6xHis : <Gtype> : kan greA : : tet , greB : : amp </Gtype> 
W3110 trpR2 , min +.2 % glucose , <Supp> 30 ug RNA </Supp> 
W3110 wt , min +.2 % glucose , <Supp> 30 ug RNA </Supp> 
\ W3110 wt OD420 ~ 0.3 in <Med> MOPS ( ile , val , thi ) + Leu , 20 ug total RNA , 10 ug pdN6 \ </O> 
Washed pellets were resuspended in 1 ml of TESS buffer ( 10 mM Tris-Cl pH7 .5 , 1 mM EDTA , 250 mM NaCl , 0.02 % SDS , 0.2 % Tween-20 ) with addition of proteases inhibitors cocktail ( cOmplete ultra EDTA free , Roche ) and RNAse A ( Thermo Scientific ) . Resulting suspensions were sonicated with parameters optimized to obtain DNA fragments between 200 and 700 bp ( SONOPULS HD 3100 ) . Lysates were diluted with 1 ml of TES buffer and 100 μl of ANTI-FLAG ® M2 affinity gel ( Sigma-Aldrich ) was added . Immunoprecipitation was performed for <Supp> 1.5-2 hours </Supp> at room temperature with moderate mixing , then affinity gel was washed 4 times by repeating steps of centrifugation ( 1.5 minute , 1000xg at room temperature ) and resuspention ( x2 with 1 ml of TESS buffer , x1 with 1 ml of TES buffer , x1 with 1 ml of TE buffer ) . 
We grew cells in 10 ml <Med> M9 minimal medium </Med> to OD600 = 0.5-0.6 . Then , we divided each culture into 500µl aliquots to which we added the appropriate concentration of NA . 
When the cultures reached an OD600 0.6 they were split into two flasks , each containing 20 ml of the culture . One was treated with a subinhibitory concentration of purified colicin M , while the untreated served as a control . 2-ml culture aliquotes were harvested from each flask after <Supp> 30 min </Supp> and 60 min incubation at <Temp> 37 °C </Temp> and were mixed with 4 ml RNAProtect Bacteria Reagent ( Qiagen ) . 
Whole cell , aspC KO , M9 and 0.4 <Supp> % glucose </Supp> 
Whole cell , cysA KO , M9 and 0.4 <Supp> % glucose </Supp> 
Whole cell , entF KO , M9 and 0.4 <Supp> % glucose </Supp> 
Whole cell , fliY KO , M9 and 0.4 <Supp> % glucose </Supp> 
Whole cell , gabT KO , M9 and 0.4 <Supp> % glucose </Supp> 
Whole cell , galE KO , M9 and 0.4 <Supp> % glucose </Supp> 
Whole cell , kefB KO , M9 and 0.4 <Supp> % glucose </Supp> 
Whole cell , khc KO , M9 and 0.4 <Supp> % glucose </Supp> 
Whole cell , lplA KO , M9 and 0.4 <Supp> % glucose </Supp> 
Whole cell , mgtA KO , M9 and 0.4 <Supp> % glucose </Supp> 
Whole cell , mhpD KO , M9 and 0.4 <Supp> % glucose </Supp> 
Whole cell , putP KO , M9 and 0.4 <Supp> % glucose </Supp> 
Whole cell , rfbA KO , M9 and 0.4 <Supp> % glucose </Supp> 
Whole cell , sdhC KO , M9 and 0.4 <Supp> % glucose </Supp> 
Whole cell , trpD KO , M9 and 0.4 <Supp> % glucose </Supp> 
Whole cell , ugpC KO , M9 and 0.4 <Supp> % glucose </Supp> 
Whole cell , WT , M9 and 0.4 <Supp> % glucose </Supp> 
wild-type MG1655 + <Supp> glycolaldehyde 10 mM </Supp> 
Wild-types cells were grown in <Med> MOPS medium </Med> with <Supp> 0.2 % glucose </Supp> , leucine , isoleucine , valine , glycine , phenylalanine , threonine ( 40 mg/ml ) and uracil ( 50 mg/ml ) until <Phase> mid-log phase </Phase> and treated with 0.5 mg/ml serine hydroxamate ( SHX ) for <Supp> 20 min </Supp> at <Temp> 37 °C </Temp> with vigorous shaking . 
Wild-types cells were grown in <Med> MOPS medium </Med> with <Supp> 0.2 % glucose </Supp> , leucine , isoleucine , valine , glycine , phenylalanine , threonine ( 40 mg/ml ) and uracil ( 50 mg/ml ) until <Phase> mid-log phase </Phase> at <Temp> 37 °C </Temp> with vigorous shaking . 
Wild-types cells were grown in <Med> MOPS medium </Med> with <Supp> 0.2 % glucose </Supp> , leucine , isoleucine , valine , glycine , phenylalanine , threonine ( 40 mg/ml ) and uracil ( 50 mg/ml ) until <Phase> mid-log phase </Phase> ( OD600 ~ 0.4 ) at <Temp> 37 °C </Temp> with vigorous shaking . 
wild-type <Supp> 30 min ( 2 ) slide </Supp> 2 
WTB _ <pH> time7 .5 </pH> 
WTKasRep1 _ <Supp> 0 min </Supp> 
WTKasRep2 _ <Supp> 0 min </Supp> 
wt or mutant : <Gtype> WT @ 0.8 % But </Gtype> 
WTRep1 _ <Supp> 0 min </Supp> 
WTRep2 _ <Supp> 0 min </Supp> 
yPileup was used to generate count data for the whole genome - Example : <Gtype> pyPileup.py -- file _ type </Gtype> = novo - f DL4184.novo -- tab = NC000913 .3 . tab -- chr = Wholechom.txt -- ignorestrand 
yPileup was used to generate count data for the whole genome - Example : <Gtype> pyPileup.py -- file _ type </Gtype> = novo - f DL4900.novo -- tab = NC000913 .3 . tab -- chr = Wholechom.txt.gz -- ignorestrand 
Zn-depleted custom-built chemostats were grown for 50 h . At this point , ZnSO4 .7 H2O in water was added to a final concentration of <Supp> 0.2 M </Supp> in the chemostat . A 10 ml sample of culture was taken using a polypropylene pipette tip immediately prior to Zn addition and 2.5 , 7 , 10 and <Supp> 30 min </Supp> after addition . The culture was pipetted directly into RNAprotect ( Qiagen ) to stabilize RNA . Total RNA was purified using Qiagen 's RNeasy Mini kit as recommended by the suppliers . RNA was quantified using a BioPhotometer ( Eppendorf ) . A control experiment was carried out in which water was added . 
Δrac + <Supp> 20 ug/ml bicyclomycin 1 </Supp> 
Δrac + <Supp> 20 ug/ml bicyclomycin </Supp> 
Δrac + <Supp> 20 ug/ml bicyclomycin </Supp> 2 
σ32 <Temp> 30 °C </Temp> rep1 
σ32 <Temp> 30 °C </Temp> rep2 
σ32 <Temp> 30 °C </Temp> short RNase 
σ32 <Temp> 43 °C </Temp> rep1 
σ32 <Temp> 43 °C </Temp> rep2 
σ32 <Temp> 43 °C </Temp> short RNase 
σ70 IP <Technique> ChIP-seq <Air> Anaerobic B </O>