{"id": "", "name": "U00096 .3", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .3", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE100373/GSE100373.soft.gz", "source": "GEO", "id": "GSM2679694", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> U00096 .3 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2679694", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29669858"}]}{"id": "", "name": "U00096 .3", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .3", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE100373/GSE100373.soft.gz", "source": "GEO", "id": "GSM2679696", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> U00096 .3 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2679696", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29669858"}]}{"id": "", "name": "\u2206 hfq : : cat )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u2206 hfq : : cat )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE100373/GSE100373.soft.gz", "source": "GEO", "id": "GSM2679696", "field": "source_name", "associatedPhrase": "E. coli CMA540 ( MG1693 <Gtype> \u2206 hfq : : cat ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2679696", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29669858"}]}{"id": "", "name": "U00096 .3", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .3", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE100373/GSE100373.soft.gz", "source": "GEO", "id": "GSM2679698", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> U00096 .3 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2679698", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29669858"}]}{"id": "", "name": "U00096 .3", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .3", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE100373/GSE100373.soft.gz", "source": "GEO", "id": "GSM2679700", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> U00096 .3 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2679700", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29669858"}]}{"id": "", "name": "\u2206 hfq : : cat )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u2206 hfq : : cat )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE100373/GSE100373.soft.gz", "source": "GEO", "id": "GSM2679700", "field": "source_name", "associatedPhrase": "E. coli CMA540 ( MG1693 <Gtype> \u2206 hfq : : cat ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2679700", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29669858"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2770989", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2770989", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2770989", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2770989", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2770991", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2770991", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2770991", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2770991", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2770994", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2770994", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2770994", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2770994", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2770995", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2770995", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2770995", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2770995", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2770996", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2770996", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2770996", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2770996", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2770997", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2770997", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2770997", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2770997", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2770998", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2770998", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2770998", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2770998", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2770999", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2770999", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2770999", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2770999", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771000", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2771000", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "\u2206 cspABEG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u2206 cspABEG", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771000", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain> <Gtype> \u2206 cspABEG </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771000", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "-LCB- delta -RCB- cspABEG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- cspABEG", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771000", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> -LCB- delta -RCB- cspABEG </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771000", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771001", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2771001", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771001", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2771001", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771002", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2771002", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "\u2206 cspABCEG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u2206 cspABCEG", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771002", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain> <Gtype> \u2206 cspABCEG </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771002", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "-LCB- delta -RCB- cspABCEG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- cspABCEG", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771002", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> -LCB- delta -RCB- cspABCEG </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771002", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771008", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2771008", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771008", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2771008", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771010", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2771010", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771010", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2771010", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771011", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2771011", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "\u2206 cspABEG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u2206 cspABEG", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771011", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain> <Gtype> \u2206 cspABEG </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771011", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "-LCB- delta -RCB- cspABEG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- cspABEG", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771011", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> -LCB- delta -RCB- cspABEG </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771011", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771014", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2771014", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771014", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2771014", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "DMS-modified mRNA", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "DMS-modified mRNA", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771014", "field": "characteristics", "associatedPhrase": "molecule subtype : <Gtype> DMS-modified mRNA </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771014", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771015", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2771015", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771015", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2771015", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "DMS-modified mRNA", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "DMS-modified mRNA", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771015", "field": "characteristics", "associatedPhrase": "molecule subtype : <Gtype> DMS-modified mRNA </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771015", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771016", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2771016", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771016", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2771016", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "DMS-modified mRNA", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "DMS-modified mRNA", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771016", "field": "characteristics", "associatedPhrase": "molecule subtype : <Gtype> DMS-modified mRNA </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771016", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771017", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2771017", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "\u2206 cspABEG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u2206 cspABEG", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771017", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain> <Gtype> \u2206 cspABEG </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771017", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "-LCB- delta -RCB- cspABEG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- cspABEG", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771017", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> -LCB- delta -RCB- cspABEG </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771017", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "DMS-modified mRNA", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "DMS-modified mRNA", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771017", "field": "characteristics", "associatedPhrase": "molecule subtype : <Gtype> DMS-modified mRNA </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771017", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771018", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2771018", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "\u2206 cspBG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u2206 cspBG", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771018", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain> <Gtype> \u2206 cspBG </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771018", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "-LCB- delta -RCB- cspBG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- cspBG", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771018", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> -LCB- delta -RCB- cspBG </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771018", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "DMS-modified mRNA", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "DMS-modified mRNA", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771018", "field": "characteristics", "associatedPhrase": "molecule subtype : <Gtype> DMS-modified mRNA </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771018", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771019", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2771019", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771019", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2771019", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771020", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2771020", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771020", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2771020", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771021", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2771021", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771021", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2771021", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771022", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2771022", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "\u2206 rnr", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u2206 rnr", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771022", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain> <Gtype> \u2206 rnr </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771022", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "-LCB- delta -RCB- rnr", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- rnr", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771022", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> -LCB- delta -RCB- rnr </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771022", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771023", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2771023", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "\u2206 rnr", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u2206 rnr", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771023", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain> <Gtype> \u2206 rnr </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771023", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "-LCB- delta -RCB- rnr", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- rnr", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771023", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> -LCB- delta -RCB- rnr </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771023", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771024", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2771024", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "\u2206 rnr", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u2206 rnr", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771024", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain> <Gtype> \u2206 rnr </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771024", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "-LCB- delta -RCB- rnr", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- rnr", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771024", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> -LCB- delta -RCB- rnr </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771024", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771025", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2771025", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771025", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2771025", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771026", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2771026", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771026", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2771026", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771027", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2771027", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "\u2206 rnr", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u2206 rnr", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771027", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain> <Gtype> \u2206 rnr </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771027", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "-LCB- delta -RCB- rnr", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- rnr", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771027", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> -LCB- delta -RCB- rnr </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771027", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771028", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2771028", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "\u2206 rnr", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u2206 rnr", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771028", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain> <Gtype> \u2206 rnr </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771028", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "-LCB- delta -RCB- rnr", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- rnr", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz", "source": "GEO", "id": "GSM2771028", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> -LCB- delta -RCB- rnr </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2771028", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29628307"}]}{"id": "", "name": "Xgal and IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Xgal and IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786596", "field": "growth_protocol", "associatedPhrase": "Viable clones of the UvsW-expressing strains GJ13531 ( \u0394rho ) and GJ13507 ( \u0394nusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 \u03bcM ( for \u0394rho ) or 3 \u03bcM ( for \u0394nusG ) , as previously described "}], "externalCrossReferences": [{"objectId": "GSM2786596", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786596", "field": "treatment_protocol", "associatedPhrase": "Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 \u03bcM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 \u03bcM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations "}], "externalCrossReferences": [{"objectId": "GSM2786596", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "Xgal and IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Xgal and IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786597", "field": "growth_protocol", "associatedPhrase": "Viable clones of the UvsW-expressing strains GJ13531 ( \u0394rho ) and GJ13507 ( \u0394nusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 \u03bcM ( for \u0394rho ) or 3 \u03bcM ( for \u0394nusG ) , as previously described "}], "externalCrossReferences": [{"objectId": "GSM2786597", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786597", "field": "treatment_protocol", "associatedPhrase": "Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 \u03bcM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 \u03bcM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations "}], "externalCrossReferences": [{"objectId": "GSM2786597", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "Xgal and IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Xgal and IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786598", "field": "growth_protocol", "associatedPhrase": "Viable clones of the UvsW-expressing strains GJ13531 ( \u0394rho ) and GJ13507 ( \u0394nusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 \u03bcM ( for \u0394rho ) or 3 \u03bcM ( for \u0394nusG ) , as previously described "}], "externalCrossReferences": [{"objectId": "GSM2786598", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786598", "field": "treatment_protocol", "associatedPhrase": "Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 \u03bcM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 \u03bcM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations "}], "externalCrossReferences": [{"objectId": "GSM2786598", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "Xgal and IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Xgal and IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786599", "field": "growth_protocol", "associatedPhrase": "Viable clones of the UvsW-expressing strains GJ13531 ( \u0394rho ) and GJ13507 ( \u0394nusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 \u03bcM ( for \u0394rho ) or 3 \u03bcM ( for \u0394nusG ) , as previously described "}], "externalCrossReferences": [{"objectId": "GSM2786599", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786599", "field": "treatment_protocol", "associatedPhrase": "Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 \u03bcM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 \u03bcM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations "}], "externalCrossReferences": [{"objectId": "GSM2786599", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "Xgal and IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Xgal and IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786600", "field": "growth_protocol", "associatedPhrase": "Viable clones of the UvsW-expressing strains GJ13531 ( \u0394rho ) and GJ13507 ( \u0394nusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 \u03bcM ( for \u0394rho ) or 3 \u03bcM ( for \u0394nusG ) , as previously described "}], "externalCrossReferences": [{"objectId": "GSM2786600", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786600", "field": "treatment_protocol", "associatedPhrase": "Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 \u03bcM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 \u03bcM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations "}], "externalCrossReferences": [{"objectId": "GSM2786600", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "Xgal and IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Xgal and IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786601", "field": "growth_protocol", "associatedPhrase": "Viable clones of the UvsW-expressing strains GJ13531 ( \u0394rho ) and GJ13507 ( \u0394nusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 \u03bcM ( for \u0394rho ) or 3 \u03bcM ( for \u0394nusG ) , as previously described "}], "externalCrossReferences": [{"objectId": "GSM2786601", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786601", "field": "treatment_protocol", "associatedPhrase": "Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 \u03bcM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 \u03bcM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations "}], "externalCrossReferences": [{"objectId": "GSM2786601", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "Xgal and IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Xgal and IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786602", "field": "growth_protocol", "associatedPhrase": "Viable clones of the UvsW-expressing strains GJ13531 ( \u0394rho ) and GJ13507 ( \u0394nusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 \u03bcM ( for \u0394rho ) or 3 \u03bcM ( for \u0394nusG ) , as previously described "}], "externalCrossReferences": [{"objectId": "GSM2786602", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786602", "field": "treatment_protocol", "associatedPhrase": "Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 \u03bcM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 \u03bcM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations "}], "externalCrossReferences": [{"objectId": "GSM2786602", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "Xgal and IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Xgal and IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786603", "field": "growth_protocol", "associatedPhrase": "Viable clones of the UvsW-expressing strains GJ13531 ( \u0394rho ) and GJ13507 ( \u0394nusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 \u03bcM ( for \u0394rho ) or 3 \u03bcM ( for \u0394nusG ) , as previously described "}], "externalCrossReferences": [{"objectId": "GSM2786603", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786603", "field": "treatment_protocol", "associatedPhrase": "Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 \u03bcM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 \u03bcM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations "}], "externalCrossReferences": [{"objectId": "GSM2786603", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "Xgal and IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Xgal and IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786604", "field": "growth_protocol", "associatedPhrase": "Viable clones of the UvsW-expressing strains GJ13531 ( \u0394rho ) and GJ13507 ( \u0394nusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 \u03bcM ( for \u0394rho ) or 3 \u03bcM ( for \u0394nusG ) , as previously described "}], "externalCrossReferences": [{"objectId": "GSM2786604", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786604", "field": "treatment_protocol", "associatedPhrase": "Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 \u03bcM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 \u03bcM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations "}], "externalCrossReferences": [{"objectId": "GSM2786604", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "Xgal and IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Xgal and IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786605", "field": "growth_protocol", "associatedPhrase": "Viable clones of the UvsW-expressing strains GJ13531 ( \u0394rho ) and GJ13507 ( \u0394nusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 \u03bcM ( for \u0394rho ) or 3 \u03bcM ( for \u0394nusG ) , as previously described "}], "externalCrossReferences": [{"objectId": "GSM2786605", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786605", "field": "treatment_protocol", "associatedPhrase": "Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 \u03bcM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 \u03bcM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations "}], "externalCrossReferences": [{"objectId": "GSM2786605", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "-LCB- delta -RCB- rho", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- rho", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786605", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- rho </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2786605", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "Xgal and IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Xgal and IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786606", "field": "growth_protocol", "associatedPhrase": "Viable clones of the UvsW-expressing strains GJ13531 ( \u0394rho ) and GJ13507 ( \u0394nusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 \u03bcM ( for \u0394rho ) or 3 \u03bcM ( for \u0394nusG ) , as previously described "}], "externalCrossReferences": [{"objectId": "GSM2786606", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786606", "field": "treatment_protocol", "associatedPhrase": "Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 \u03bcM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 \u03bcM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations "}], "externalCrossReferences": [{"objectId": "GSM2786606", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "-LCB- delta -RCB- rho", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- rho", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786606", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- rho </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2786606", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "Xgal and IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Xgal and IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786607", "field": "growth_protocol", "associatedPhrase": "Viable clones of the UvsW-expressing strains GJ13531 ( \u0394rho ) and GJ13507 ( \u0394nusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 \u03bcM ( for \u0394rho ) or 3 \u03bcM ( for \u0394nusG ) , as previously described "}], "externalCrossReferences": [{"objectId": "GSM2786607", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786607", "field": "treatment_protocol", "associatedPhrase": "Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 \u03bcM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 \u03bcM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations "}], "externalCrossReferences": [{"objectId": "GSM2786607", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "-LCB- delta -RCB- rho", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- rho", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786607", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- rho </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2786607", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "Xgal and IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Xgal and IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786608", "field": "growth_protocol", "associatedPhrase": "Viable clones of the UvsW-expressing strains GJ13531 ( \u0394rho ) and GJ13507 ( \u0394nusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 \u03bcM ( for \u0394rho ) or 3 \u03bcM ( for \u0394nusG ) , as previously described "}], "externalCrossReferences": [{"objectId": "GSM2786608", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786608", "field": "treatment_protocol", "associatedPhrase": "Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 \u03bcM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 \u03bcM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations "}], "externalCrossReferences": [{"objectId": "GSM2786608", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "-LCB- delta -RCB- nusG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- nusG", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786608", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- nusG </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2786608", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "Xgal and IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Xgal and IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786609", "field": "growth_protocol", "associatedPhrase": "Viable clones of the UvsW-expressing strains GJ13531 ( \u0394rho ) and GJ13507 ( \u0394nusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 \u03bcM ( for \u0394rho ) or 3 \u03bcM ( for \u0394nusG ) , as previously described "}], "externalCrossReferences": [{"objectId": "GSM2786609", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786609", "field": "treatment_protocol", "associatedPhrase": "Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 \u03bcM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 \u03bcM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations "}], "externalCrossReferences": [{"objectId": "GSM2786609", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "-LCB- delta -RCB- nusG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- nusG", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786609", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- nusG </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2786609", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "Xgal and IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Xgal and IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786610", "field": "growth_protocol", "associatedPhrase": "Viable clones of the UvsW-expressing strains GJ13531 ( \u0394rho ) and GJ13507 ( \u0394nusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 \u03bcM ( for \u0394rho ) or 3 \u03bcM ( for \u0394nusG ) , as previously described "}], "externalCrossReferences": [{"objectId": "GSM2786610", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786610", "field": "treatment_protocol", "associatedPhrase": "Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 \u03bcM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 \u03bcM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations "}], "externalCrossReferences": [{"objectId": "GSM2786610", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "-LCB- delta -RCB- nusG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- nusG", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz", "source": "GEO", "id": "GSM2786610", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- nusG </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2786610", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29474582"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861128", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861128", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861128", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861128", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861128", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861128", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861129", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861129", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861129", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861129", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861129", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861129", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861132", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861132", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861132", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861132", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861132", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861132", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861137", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861137", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861137", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861137", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861137", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861137", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861142", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861142", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861142", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861142", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861142", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861142", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861145", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861145", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861145", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861145", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861145", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861145", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861152", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861152", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861152", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861152", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861152", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861152", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861153", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861153", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861153", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861153", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861153", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861153", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861155", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861155", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861155", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861155", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861155", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861155", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "15 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "15 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861155", "field": "characteristics", "associatedPhrase": "treatment : <Supp> 15 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2861155", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861159", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861159", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861159", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861159", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861159", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861159", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861160", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861160", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861160", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861160", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861160", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861160", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861163", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861163", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861163", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861163", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861163", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861163", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861165", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861165", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861165", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861165", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861165", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861165", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861166", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861166", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861166", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861166", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861166", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861166", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861173", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861173", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861173", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861173", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861173", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861173", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861178", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861178", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861178", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861178", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861178", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861178", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861182", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861182", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861182", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861182", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861182", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861182", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861191", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861191", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861191", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861191", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861191", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861191", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861192", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861192", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861192", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861192", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861192", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861192", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861207", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861207", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861207", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861207", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861207", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861207", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861209", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861209", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861209", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861209", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861209", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861209", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861214", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861214", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861214", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861214", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861214", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861214", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861215", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861215", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861215", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . "}], "externalCrossReferences": [{"objectId": "GSM2861215", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "of fresh medium", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "of fresh medium", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861215", "field": "growth_protocol", "associatedPhrase": "E. coli cells with construct and control plasmids were grown at <Temp> 37 \u00b0C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 \u03bcl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 \u00b0C </Temp> with shaking for another hour ( outgrowth ) . 200 \u03bcl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 \u00b0C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . "}], "externalCrossReferences": [{"objectId": "GSM2861215", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "15 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "15 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz", "source": "GEO", "id": "GSM2861215", "field": "characteristics", "associatedPhrase": "treatment : <Supp> 15 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2861215", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29578536"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107301/GSE107301.soft.gz", "source": "GEO", "id": "GSM2870440", "field": "data_processing", "associatedPhrase": "Genome _ build : E. coli MG1655 GenBank : <Gversion> U00096 .2 </Gversion> , total length : <Supp> 4639675 bp </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2870440", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29358050"}]}{"id": "", "name": "4639675 bp", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "4639675 bp", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107301/GSE107301.soft.gz", "source": "GEO", "id": "GSM2870440", "field": "data_processing", "associatedPhrase": "Genome _ build : E. coli MG1655 GenBank : <Gversion> U00096 .2 </Gversion> , total length : <Supp> 4639675 bp </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2870440", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29358050"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107301/GSE107301.soft.gz", "source": "GEO", "id": "GSM2870440", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2870440", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29358050"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107301/GSE107301.soft.gz", "source": "GEO", "id": "GSM2870440", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2870440", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29358050"}]}{"id": "", "name": "MM + 0.12 % casaminoacids +0.4 % glucose", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MM + 0.12 % casaminoacids +0.4 % glucose", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107301/GSE107301.soft.gz", "source": "GEO", "id": "GSM2870440", "field": "characteristics", "associatedPhrase": "growth condition : <Supp> MM + 0.12 % casaminoacids +0.4 % glucose </Supp> at <Temp> 30 \u00b0C </Temp> "}], "externalCrossReferences": [{"objectId": "GSM2870440", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29358050"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107301/GSE107301.soft.gz", "source": "GEO", "id": "GSM2870441", "field": "data_processing", "associatedPhrase": "Genome _ build : E. coli MG1655 GenBank : <Gversion> U00096 .2 </Gversion> , total length : <Supp> 4639675 bp </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2870441", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29358050"}]}{"id": "", "name": "4639675 bp", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "4639675 bp", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107301/GSE107301.soft.gz", "source": "GEO", "id": "GSM2870441", "field": "data_processing", "associatedPhrase": "Genome _ build : E. coli MG1655 GenBank : <Gversion> U00096 .2 </Gversion> , total length : <Supp> 4639675 bp </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2870441", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29358050"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107301/GSE107301.soft.gz", "source": "GEO", "id": "GSM2870441", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2870441", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29358050"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107301/GSE107301.soft.gz", "source": "GEO", "id": "GSM2870441", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2870441", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29358050"}]}{"id": "", "name": "MM + 0.12 % casaminoacids +0.4 % glucose", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MM + 0.12 % casaminoacids +0.4 % glucose", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107301/GSE107301.soft.gz", "source": "GEO", "id": "GSM2870441", "field": "characteristics", "associatedPhrase": "growth condition : <Supp> MM + 0.12 % casaminoacids +0.4 % glucose </Supp> at <Temp> 30 \u00b0C </Temp> "}], "externalCrossReferences": [{"objectId": "GSM2870441", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29358050"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107327/GSE107327.soft.gz", "source": "GEO", "id": "GSM2864853", "field": "growth_protocol", "associatedPhrase": "Separate E. coli colonies were picked from LB agar plates for each replicate . Overnight cultures ( 12-16 hrs ) were grown at <Temp> 37 \u00b0C </Temp> in M9 media supplemented with 0.1 % casamino acids , 0.4 % glycerol , 0.4 % glucose , 2 mM MgSO4 , and 0.1 mM CaCl2 . Overnight cultures were back diluted into fresh <Med> media </Med> and grown 3-4 hours to an <OD> OD600 of ~ 0.35 </OD> at <Temp> 37 \u00b0C </Temp> in an orbital shaker at 200 RPM . Cultures were centrifuged , washed , and back diluted into media lacking glucose . After at least 30 minutes of recovery Para was induced by adding arabinose to 0.2 % . Cells were harvested by centrifuging 1 mL of culture for 1 minute at maximum speed on a benchtop centrifuge . Pellets were immediately flash frozen in lN2 . "}], "externalCrossReferences": [{"objectId": "GSM2864853", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29861158"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107327/GSE107327.soft.gz", "source": "GEO", "id": "GSM2864854", "field": "growth_protocol", "associatedPhrase": "Separate E. coli colonies were picked from LB agar plates for each replicate . Overnight cultures ( 12-16 hrs ) were grown at <Temp> 37 \u00b0C </Temp> in M9 media supplemented with 0.1 % casamino acids , 0.4 % glycerol , 0.4 % glucose , 2 mM MgSO4 , and 0.1 mM CaCl2 . Overnight cultures were back diluted into fresh <Med> media </Med> and grown 3-4 hours to an <OD> OD600 of ~ 0.35 </OD> at <Temp> 37 \u00b0C </Temp> in an orbital shaker at 200 RPM . Cultures were centrifuged , washed , and back diluted into media lacking glucose . After at least 30 minutes of recovery Para was induced by adding arabinose to 0.2 % . Cells were harvested by centrifuging 1 mL of culture for 1 minute at maximum speed on a benchtop centrifuge . Pellets were immediately flash frozen in lN2 . "}], "externalCrossReferences": [{"objectId": "GSM2864854", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29861158"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107327/GSE107327.soft.gz", "source": "GEO", "id": "GSM2864855", "field": "growth_protocol", "associatedPhrase": "Separate E. coli colonies were picked from LB agar plates for each replicate . Overnight cultures ( 12-16 hrs ) were grown at <Temp> 37 \u00b0C </Temp> in M9 media supplemented with 0.1 % casamino acids , 0.4 % glycerol , 0.4 % glucose , 2 mM MgSO4 , and 0.1 mM CaCl2 . Overnight cultures were back diluted into fresh <Med> media </Med> and grown 3-4 hours to an <OD> OD600 of ~ 0.35 </OD> at <Temp> 37 \u00b0C </Temp> in an orbital shaker at 200 RPM . Cultures were centrifuged , washed , and back diluted into media lacking glucose . After at least 30 minutes of recovery Para was induced by adding arabinose to 0.2 % . Cells were harvested by centrifuging 1 mL of culture for 1 minute at maximum speed on a benchtop centrifuge . Pellets were immediately flash frozen in lN2 . "}], "externalCrossReferences": [{"objectId": "GSM2864855", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29861158"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107327/GSE107327.soft.gz", "source": "GEO", "id": "GSM2864856", "field": "growth_protocol", "associatedPhrase": "Separate E. coli colonies were picked from LB agar plates for each replicate . Overnight cultures ( 12-16 hrs ) were grown at <Temp> 37 \u00b0C </Temp> in M9 media supplemented with 0.1 % casamino acids , 0.4 % glycerol , 0.4 % glucose , 2 mM MgSO4 , and 0.1 mM CaCl2 . Overnight cultures were back diluted into fresh <Med> media </Med> and grown 3-4 hours to an <OD> OD600 of ~ 0.35 </OD> at <Temp> 37 \u00b0C </Temp> in an orbital shaker at 200 RPM . Cultures were centrifuged , washed , and back diluted into media lacking glucose . After at least 30 minutes of recovery Para was induced by adding arabinose to 0.2 % . Cells were harvested by centrifuging 1 mL of culture for 1 minute at maximum speed on a benchtop centrifuge . Pellets were immediately flash frozen in lN2 . "}], "externalCrossReferences": [{"objectId": "GSM2864856", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29861158"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz", "source": "GEO", "id": "GSM2914313", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) "}], "externalCrossReferences": [{"objectId": "GSM2914313", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29378945"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz", "source": "GEO", "id": "GSM2914315", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) "}], "externalCrossReferences": [{"objectId": "GSM2914315", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29378945"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz", "source": "GEO", "id": "GSM2914317", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) "}], "externalCrossReferences": [{"objectId": "GSM2914317", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29378945"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz", "source": "GEO", "id": "GSM2914318", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) "}], "externalCrossReferences": [{"objectId": "GSM2914318", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29378945"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz", "source": "GEO", "id": "GSM2914319", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) "}], "externalCrossReferences": [{"objectId": "GSM2914319", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29378945"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz", "source": "GEO", "id": "GSM2914320", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) "}], "externalCrossReferences": [{"objectId": "GSM2914320", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29378945"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz", "source": "GEO", "id": "GSM2914321", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) "}], "externalCrossReferences": [{"objectId": "GSM2914321", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29378945"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz", "source": "GEO", "id": "GSM2914322", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) "}], "externalCrossReferences": [{"objectId": "GSM2914322", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29378945"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz", "source": "GEO", "id": "GSM2914323", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) "}], "externalCrossReferences": [{"objectId": "GSM2914323", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29378945"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz", "source": "GEO", "id": "GSM2914324", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) "}], "externalCrossReferences": [{"objectId": "GSM2914324", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29378945"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz", "source": "GEO", "id": "GSM2914325", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) "}], "externalCrossReferences": [{"objectId": "GSM2914325", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29378945"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz", "source": "GEO", "id": "GSM2914326", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) "}], "externalCrossReferences": [{"objectId": "GSM2914326", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29378945"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz", "source": "GEO", "id": "GSM2914327", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) "}], "externalCrossReferences": [{"objectId": "GSM2914327", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29378945"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz", "source": "GEO", "id": "GSM2914328", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) "}], "externalCrossReferences": [{"objectId": "GSM2914328", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29378945"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3022135", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3022135", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3022135", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3022135", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3022136", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3022136", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3022136", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3022136", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3022137", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3022137", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3022137", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3022137", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3022138", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3022138", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3022138", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3022138", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3022139", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3022139", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3022139", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3022139", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3022140", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3022140", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3022140", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3022140", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3022141", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3022141", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3022141", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3022141", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3022142", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3022142", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3022142", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3022142", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3022143", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3022143", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3022143", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3022143", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3022144", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3022144", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3022144", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3022144", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108934", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108934", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108934", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108934", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "pH5 .5", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "pH5 .5", "term_id": "", "term_type": "pH", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108934", "field": "characteristics", "associatedPhrase": "medium : <Supp> glucose </Supp> M9 minimal <pH> pH5 .5 </pH> "}], "externalCrossReferences": [{"objectId": "GSM3108934", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108935", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108935", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108935", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108935", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "pH5 .5", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "pH5 .5", "term_id": "", "term_type": "pH", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108935", "field": "characteristics", "associatedPhrase": "medium : <Supp> glucose </Supp> M9 minimal <pH> pH5 .5 </pH> "}], "externalCrossReferences": [{"objectId": "GSM3108935", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108936", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108936", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108936", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108936", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108937", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108937", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108937", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108937", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108938", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108938", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108938", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108938", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108939", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108939", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108939", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108939", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108940", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108940", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108940", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108940", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108941", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108941", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108941", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108941", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108942", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108942", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108942", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108942", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108943", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108943", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108943", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108943", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108944", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108944", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108944", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108944", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "pH5 .5", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "pH5 .5", "term_id": "", "term_type": "pH", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108944", "field": "characteristics", "associatedPhrase": "medium : <Supp> glucose </Supp> M9 minimal <pH> pH5 .5 </pH> "}], "externalCrossReferences": [{"objectId": "GSM3108944", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108945", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108945", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108945", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108945", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "pH5 .5", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "pH5 .5", "term_id": "", "term_type": "pH", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108945", "field": "characteristics", "associatedPhrase": "medium : <Supp> glucose </Supp> M9 minimal <pH> pH5 .5 </pH> "}], "externalCrossReferences": [{"objectId": "GSM3108945", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108946", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108946", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108946", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108946", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108947", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108947", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108947", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108947", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108948", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108948", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108948", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108948", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108949", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108949", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108949", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108949", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108950", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108950", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108950", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108950", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108951", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108951", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz", "source": "GEO", "id": "GSM3108951", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3108951", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33149261"}]}{"id": "", "name": "U00096 .3", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .3", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154484", "field": "data_processing", "associatedPhrase": "The trimmed reads were aligned against E. 149 coli MG1655 ( GenBank : <Gversion> U00096 .3 </Gversion> ) using bowtie2 ( Version 2.2.4 ) "}], "externalCrossReferences": [{"objectId": "GSM3154484", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "U00096 .3", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .3", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154484", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> U00096 .3 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM3154484", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154484", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154484", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154484", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154484", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154484", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154484", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154484", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154484", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "U00096 .3", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .3", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154485", "field": "data_processing", "associatedPhrase": "The trimmed reads were aligned against E. 149 coli MG1655 ( GenBank : <Gversion> U00096 .3 </Gversion> ) using bowtie2 ( Version 2.2.4 ) "}], "externalCrossReferences": [{"objectId": "GSM3154485", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "U00096 .3", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .3", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154485", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> U00096 .3 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM3154485", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154485", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154485", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154485", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154485", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154485", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154485", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154485", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154485", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "U00096 .3", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .3", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154486", "field": "data_processing", "associatedPhrase": "The trimmed reads were aligned against E. 149 coli MG1655 ( GenBank : <Gversion> U00096 .3 </Gversion> ) using bowtie2 ( Version 2.2.4 ) "}], "externalCrossReferences": [{"objectId": "GSM3154486", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "U00096 .3", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .3", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154486", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> U00096 .3 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM3154486", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154486", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154486", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154486", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154486", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154486", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154486", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154486", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154486", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "U00096 .3", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .3", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154487", "field": "data_processing", "associatedPhrase": "The trimmed reads were aligned against E. 149 coli MG1655 ( GenBank : <Gversion> U00096 .3 </Gversion> ) using bowtie2 ( Version 2.2.4 ) "}], "externalCrossReferences": [{"objectId": "GSM3154487", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "U00096 .3", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .3", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154487", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> U00096 .3 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM3154487", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154487", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154487", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154487", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154487", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154487", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154487", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154487", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154487", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "U00096 .3", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .3", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154488", "field": "data_processing", "associatedPhrase": "The trimmed reads were aligned against E. 149 coli MG1655 ( GenBank : <Gversion> U00096 .3 </Gversion> ) using bowtie2 ( Version 2.2.4 ) "}], "externalCrossReferences": [{"objectId": "GSM3154488", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "U00096 .3", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .3", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154488", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> U00096 .3 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM3154488", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154488", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154488", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154488", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154488", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154488", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154488", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154488", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154488", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "U00096 .3", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .3", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154489", "field": "data_processing", "associatedPhrase": "The trimmed reads were aligned against E. 149 coli MG1655 ( GenBank : <Gversion> U00096 .3 </Gversion> ) using bowtie2 ( Version 2.2.4 ) "}], "externalCrossReferences": [{"objectId": "GSM3154489", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "U00096 .3", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .3", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154489", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> U00096 .3 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM3154489", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154489", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154489", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154489", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154489", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154489", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154489", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154489", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154489", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "U00096 .3", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .3", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154490", "field": "data_processing", "associatedPhrase": "The trimmed reads were aligned against E. 149 coli MG1655 ( GenBank : <Gversion> U00096 .3 </Gversion> ) using bowtie2 ( Version 2.2.4 ) "}], "externalCrossReferences": [{"objectId": "GSM3154490", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "U00096 .3", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .3", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154490", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> U00096 .3 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM3154490", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154490", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154490", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154490", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154490", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154490", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154490", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154490", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154490", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "U00096 .3", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .3", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154491", "field": "data_processing", "associatedPhrase": "The trimmed reads were aligned against E. 149 coli MG1655 ( GenBank : <Gversion> U00096 .3 </Gversion> ) using bowtie2 ( Version 2.2.4 ) "}], "externalCrossReferences": [{"objectId": "GSM3154491", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "U00096 .3", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .3", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154491", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> U00096 .3 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM3154491", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154491", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154491", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154491", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154491", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154491", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154491", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz", "source": "GEO", "id": "GSM3154491", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3154491", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30016375"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE117737/GSE117737.soft.gz", "source": "GEO", "id": "GSM3566393", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NC _ 000913.3 "}], "externalCrossReferences": [{"objectId": "GSM3566393", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31308523"}]}{"id": "", "name": "inactive the rho activity , the wild type ( WT ) Wild type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "inactive the rho activity , the wild type ( WT ) Wild type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE117737/GSE117737.soft.gz", "source": "GEO", "id": "GSM3566393", "field": "treatment_protocol", "associatedPhrase": "<Gtype> Wild type </Gtype> E. coli , pnp knoctout , rnb knoctout and rnr knoct out strains were cultured in <Med> LB media </Med> at <Temp> 37 \u00b0C </Temp> , RNA samples and ChIP-seq samples were collected when the growth stage of indicated cells reached to log phase or stationary phase . rne-3071 ( ts ) mutation strain was cultured in <Med> LB media </Med> at 28 \u00b0C to retain the RNase E activity or shifted to 44 \u00b0C in water bath for 30 minutes to deactivate RNase E . In order to <Gtype> inactive the rho activity , the wild type ( WT ) Wild type </Gtype> E. coli was cultured in <Med> LB media </Med> with 50 \u03bcg/ml bicyclomycin at <Temp> 37 \u00b0C </Temp> for 15 min at indicated growth condition . "}], "externalCrossReferences": [{"objectId": "GSM3566393", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31308523"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE117737/GSE117737.soft.gz", "source": "GEO", "id": "GSM3566394", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NC _ 000913.3 "}], "externalCrossReferences": [{"objectId": "GSM3566394", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31308523"}]}{"id": "", "name": "inactive the rho activity , the wild type ( WT ) Wild type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "inactive the rho activity , the wild type ( WT ) Wild type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE117737/GSE117737.soft.gz", "source": "GEO", "id": "GSM3566394", "field": "treatment_protocol", "associatedPhrase": "<Gtype> Wild type </Gtype> E. coli , pnp knoctout , rnb knoctout and rnr knoct out strains were cultured in <Med> LB media </Med> at <Temp> 37 \u00b0C </Temp> , RNA samples and ChIP-seq samples were collected when the growth stage of indicated cells reached to log phase or stationary phase . rne-3071 ( ts ) mutation strain was cultured in <Med> LB media </Med> at 28 \u00b0C to retain the RNase E activity or shifted to 44 \u00b0C in water bath for 30 minutes to deactivate RNase E . In order to <Gtype> inactive the rho activity , the wild type ( WT ) Wild type </Gtype> E. coli was cultured in <Med> LB media </Med> with 50 \u03bcg/ml bicyclomycin at <Temp> 37 \u00b0C </Temp> for 15 min at indicated growth condition . "}], "externalCrossReferences": [{"objectId": "GSM3566394", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31308523"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE117737/GSE117737.soft.gz", "source": "GEO", "id": "GSM3566395", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NC _ 000913.3 "}], "externalCrossReferences": [{"objectId": "GSM3566395", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31308523"}]}{"id": "", "name": "inactive the rho activity , the wild type ( WT ) Wild type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "inactive the rho activity , the wild type ( WT ) Wild type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE117737/GSE117737.soft.gz", "source": "GEO", "id": "GSM3566395", "field": "treatment_protocol", "associatedPhrase": "<Gtype> Wild type </Gtype> E. coli , pnp knoctout , rnb knoctout and rnr knoct out strains were cultured in <Med> LB media </Med> at <Temp> 37 \u00b0C </Temp> , RNA samples and ChIP-seq samples were collected when the growth stage of indicated cells reached to log phase or stationary phase . rne-3071 ( ts ) mutation strain was cultured in <Med> LB media </Med> at 28 \u00b0C to retain the RNase E activity or shifted to 44 \u00b0C in water bath for 30 minutes to deactivate RNase E . In order to <Gtype> inactive the rho activity , the wild type ( WT ) Wild type </Gtype> E. coli was cultured in <Med> LB media </Med> with 50 \u03bcg/ml bicyclomycin at <Temp> 37 \u00b0C </Temp> for 15 min at indicated growth condition . "}], "externalCrossReferences": [{"objectId": "GSM3566395", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31308523"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE117737/GSE117737.soft.gz", "source": "GEO", "id": "GSM3566396", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NC _ 000913.3 "}], "externalCrossReferences": [{"objectId": "GSM3566396", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31308523"}]}{"id": "", "name": "inactive the rho activity , the wild type ( WT ) Wild type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "inactive the rho activity , the wild type ( WT ) Wild type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE117737/GSE117737.soft.gz", "source": "GEO", "id": "GSM3566396", "field": "treatment_protocol", "associatedPhrase": "<Gtype> Wild type </Gtype> E. coli , pnp knoctout , rnb knoctout and rnr knoct out strains were cultured in <Med> LB media </Med> at <Temp> 37 \u00b0C </Temp> , RNA samples and ChIP-seq samples were collected when the growth stage of indicated cells reached to log phase or stationary phase . rne-3071 ( ts ) mutation strain was cultured in <Med> LB media </Med> at 28 \u00b0C to retain the RNase E activity or shifted to 44 \u00b0C in water bath for 30 minutes to deactivate RNase E . In order to <Gtype> inactive the rho activity , the wild type ( WT ) Wild type </Gtype> E. coli was cultured in <Med> LB media </Med> with 50 \u03bcg/ml bicyclomycin at <Temp> 37 \u00b0C </Temp> for 15 min at indicated growth condition . "}], "externalCrossReferences": [{"objectId": "GSM3566396", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31308523"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122211/GSE122211.soft.gz", "source": "GEO", "id": "GSM3461156", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3461156", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122211/GSE122211.soft.gz", "source": "GEO", "id": "GSM3461156", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3461156", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122211/GSE122211.soft.gz", "source": "GEO", "id": "GSM3461157", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3461157", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122211/GSE122211.soft.gz", "source": "GEO", "id": "GSM3461157", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3461157", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122211/GSE122211.soft.gz", "source": "GEO", "id": "GSM3461164", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3461164", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122211/GSE122211.soft.gz", "source": "GEO", "id": "GSM3461164", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3461164", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122211/GSE122211.soft.gz", "source": "GEO", "id": "GSM3461165", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3461165", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122211/GSE122211.soft.gz", "source": "GEO", "id": "GSM3461165", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3461165", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122211/GSE122211.soft.gz", "source": "GEO", "id": "GSM3461166", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3461166", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122211/GSE122211.soft.gz", "source": "GEO", "id": "GSM3461166", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3461166", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463565", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463565", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463566", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463566", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463567", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463567", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463568", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463568", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463569", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463569", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463570", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463570", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463571", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463571", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463572", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463572", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463573", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463573", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463574", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463574", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463575", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463575", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463576", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463576", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463577", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463577", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463578", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463578", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463579", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463579", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463580", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463580", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463581", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463581", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463582", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463582", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463583", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463583", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463584", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463584", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463585", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463585", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463586", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463586", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463587", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463587", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "M9 minimal media w / 3.3 g/L pyruvate", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "M9 minimal media w / 3.3 g/L pyruvate", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463587", "field": "characteristics", "associatedPhrase": "media : <Med> M9 minimal media w / 3.3 g/L pyruvate </Med> "}], "externalCrossReferences": [{"objectId": "GSM3463587", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463588", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3463588", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "M9 minimal media w / 3.3 g/L pyruvate", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "M9 minimal media w / 3.3 g/L pyruvate", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3463588", "field": "characteristics", "associatedPhrase": "media : <Med> M9 minimal media w / 3.3 g/L pyruvate </Med> "}], "externalCrossReferences": [{"objectId": "GSM3463588", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3854833", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3854833", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3854834", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3854834", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3854835", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3854835", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3854836", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3854836", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3854837", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3854837", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz", "source": "GEO", "id": "GSM3854838", "field": "growth_protocol", "associatedPhrase": "glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . "}], "externalCrossReferences": [{"objectId": "GSM3854838", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31797920"}]}{"id": "", "name": "aerobically", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "aerobically", "term_id": "", "term_type": "Aeration", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz", "source": "GEO", "id": "GSM3507068", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT , \u0394fis and \u0394hns were grown in Luria-Bertani ( LB ) broth and agar ( 15g/l ) . Where needed , kanamycin was used at final concentration of 50\u00b5g/ml . For RNA extraction , E. coli cultures were grown to mid-exponential growth phase <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with 40 % ( w/v ) glucose . "}], "externalCrossReferences": [{"objectId": "GSM3507068", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz", "source": "GEO", "id": "GSM3507068", "field": "characteristics", "associatedPhrase": "strain : <Supp> str </Supp> . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3507068", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz", "source": "GEO", "id": "GSM3507068", "field": "characteristics", "associatedPhrase": "strain : <Supp> str </Supp> . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3507068", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "material type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "material type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz", "source": "GEO", "id": "GSM3507068", "field": "characteristics", "associatedPhrase": "<Gtype> material type </Gtype> : <Gtype> whole organism </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM3507068", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "aerobically", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "aerobically", "term_id": "", "term_type": "Aeration", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz", "source": "GEO", "id": "GSM3507069", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT , \u0394fis and \u0394hns were grown in Luria-Bertani ( LB ) broth and agar ( 15g/l ) . Where needed , kanamycin was used at final concentration of 50\u00b5g/ml . For RNA extraction , E. coli cultures were grown to mid-exponential growth phase <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with 40 % ( w/v ) glucose . "}], "externalCrossReferences": [{"objectId": "GSM3507069", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz", "source": "GEO", "id": "GSM3507069", "field": "characteristics", "associatedPhrase": "strain : <Supp> str </Supp> . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3507069", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz", "source": "GEO", "id": "GSM3507069", "field": "characteristics", "associatedPhrase": "strain : <Supp> str </Supp> . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3507069", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "material type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "material type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz", "source": "GEO", "id": "GSM3507069", "field": "characteristics", "associatedPhrase": "<Gtype> material type </Gtype> : <Gtype> whole organism </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM3507069", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "aerobically", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "aerobically", "term_id": "", "term_type": "Aeration", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz", "source": "GEO", "id": "GSM3507070", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT , \u0394fis and \u0394hns were grown in Luria-Bertani ( LB ) broth and agar ( 15g/l ) . Where needed , kanamycin was used at final concentration of 50\u00b5g/ml . For RNA extraction , E. coli cultures were grown to mid-exponential growth phase <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with 40 % ( w/v ) glucose . "}], "externalCrossReferences": [{"objectId": "GSM3507070", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz", "source": "GEO", "id": "GSM3507070", "field": "characteristics", "associatedPhrase": "strain : <Supp> str </Supp> . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3507070", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz", "source": "GEO", "id": "GSM3507070", "field": "characteristics", "associatedPhrase": "strain : <Supp> str </Supp> . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3507070", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "material type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "material type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz", "source": "GEO", "id": "GSM3507070", "field": "characteristics", "associatedPhrase": "<Gtype> material type </Gtype> : <Gtype> whole organism </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM3507070", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "aerobically", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "aerobically", "term_id": "", "term_type": "Aeration", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz", "source": "GEO", "id": "GSM3507071", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT , \u0394fis and \u0394hns were grown in Luria-Bertani ( LB ) broth and agar ( 15g/l ) . Where needed , kanamycin was used at final concentration of 50\u00b5g/ml . For RNA extraction , E. coli cultures were grown to mid-exponential growth phase <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with 40 % ( w/v ) glucose . "}], "externalCrossReferences": [{"objectId": "GSM3507071", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz", "source": "GEO", "id": "GSM3507071", "field": "characteristics", "associatedPhrase": "strain : <Supp> str </Supp> . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3507071", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz", "source": "GEO", "id": "GSM3507071", "field": "characteristics", "associatedPhrase": "strain : <Supp> str </Supp> . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM3507071", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "material type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "material type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz", "source": "GEO", "id": "GSM3507071", "field": "characteristics", "associatedPhrase": "<Gtype> material type </Gtype> : <Gtype> whole organism </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM3507071", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE126710/GSE126710.soft.gz", "source": "GEO", "id": "GSM3611666", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM3611666", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31208335"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE126710/GSE126710.soft.gz", "source": "GEO", "id": "GSM3611667", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM3611667", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31208335"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE126710/GSE126710.soft.gz", "source": "GEO", "id": "GSM3611668", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM3611668", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31208335"}]}{"id": "", "name": "phageO104 in the wrbA gene", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "phageO104 in the wrbA gene", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE126710/GSE126710.soft.gz", "source": "GEO", "id": "GSM3611669", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> phageO104 in the wrbA gene </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM3611669", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31208335"}]}{"id": "", "name": "phageO104 in the wrbA gene", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "phageO104 in the wrbA gene", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE126710/GSE126710.soft.gz", "source": "GEO", "id": "GSM3611670", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> phageO104 in the wrbA gene </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM3611670", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31208335"}]}{"id": "", "name": "phageO104 in the wrbA gene", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "phageO104 in the wrbA gene", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE126710/GSE126710.soft.gz", "source": "GEO", "id": "GSM3611671", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> phageO104 in the wrbA gene </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM3611671", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31208335"}]}{"id": "", "name": "phagePA8 in the argW gene", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "phagePA8 in the argW gene", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE126710/GSE126710.soft.gz", "source": "GEO", "id": "GSM3611672", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> phagePA8 in the argW gene </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM3611672", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31208335"}]}{"id": "", "name": "phagePA8 in the argW gene", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "phagePA8 in the argW gene", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE126710/GSE126710.soft.gz", "source": "GEO", "id": "GSM3611673", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> phagePA8 in the argW gene </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM3611673", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31208335"}]}{"id": "", "name": "phagePA8 in the argW gene", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "phagePA8 in the argW gene", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE126710/GSE126710.soft.gz", "source": "GEO", "id": "GSM3611674", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> phagePA8 in the argW gene </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM3611674", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31208335"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013462", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013462", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013463", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013463", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013464", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013464", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013465", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013465", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013466", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013466", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013467", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013467", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013468", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013468", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013470", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013470", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013471", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013471", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013472", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013472", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013473", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013473", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013474", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013474", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013475", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013475", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013476", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013476", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013477", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013477", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013478", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013478", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013479", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013479", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013480", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013480", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013481", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013481", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013482", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013482", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013483", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013483", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013484", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013484", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz", "source": "GEO", "id": "GSM4013485", "field": "growth_protocol", "associatedPhrase": "Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 \u2248 0.5 ) . "}], "externalCrossReferences": [{"objectId": "GSM4013485", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "31651953"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275442", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275442", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275442", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275442", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275442", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275442", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275442", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275442", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275443", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275443", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275443", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275443", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275443", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275443", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275443", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275443", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275444", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275444", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275444", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275444", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275444", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275444", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275444", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275444", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275446", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275446", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275446", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275446", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275446", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275446", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275446", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275446", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "-LCB- delta -RCB- baeR", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- baeR", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275446", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- baeR </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4275446", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275447", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275447", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275447", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275447", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275447", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275447", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275447", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275447", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "-LCB- delta -RCB- baeR", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- baeR", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275447", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- baeR </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4275447", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275448", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275448", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275448", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275448", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275448", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275448", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275448", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275448", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "-LCB- delta -RCB- baeR", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- baeR", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275448", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- baeR </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4275448", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275450", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275450", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275450", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275450", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275450", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275450", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275450", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275450", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "-LCB- delta -RCB- cpxR", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- cpxR", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275450", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- cpxR </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4275450", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275451", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275451", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275451", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275451", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275451", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275451", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275451", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275451", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "-LCB- delta -RCB- cpxR", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- cpxR", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275451", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- cpxR </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4275451", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275454", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275454", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275454", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275454", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275454", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275454", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275454", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275454", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "TMA + 0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "TMA + 0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275454", "field": "characteristics", "associatedPhrase": "media : <Supp> TMA + 0.1 mM KCl </Supp> "}], "externalCrossReferences": [{"objectId": "GSM4275454", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "-LCB- delta -RCB- kdpE", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- kdpE", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275454", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- kdpE </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4275454", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275455", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275455", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275455", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275455", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275455", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275455", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275455", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275455", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "TMA + 0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "TMA + 0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275455", "field": "characteristics", "associatedPhrase": "media : <Supp> TMA + 0.1 mM KCl </Supp> "}], "externalCrossReferences": [{"objectId": "GSM4275455", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "-LCB- delta -RCB- kdpE", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- kdpE", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275455", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- kdpE </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4275455", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275456", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275456", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275456", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275456", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275456", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275456", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275456", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275456", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "TMA + 115 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "TMA + 115 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275456", "field": "characteristics", "associatedPhrase": "media : <Supp> TMA + 115 mM KCl </Supp> "}], "externalCrossReferences": [{"objectId": "GSM4275456", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "-LCB- delta -RCB- kdpE", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- kdpE", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275456", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- kdpE </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4275456", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275457", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275457", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275457", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275457", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275457", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275457", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275457", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275457", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "TMA + 115 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "TMA + 115 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275457", "field": "characteristics", "associatedPhrase": "media : <Supp> TMA + 115 mM KCl </Supp> "}], "externalCrossReferences": [{"objectId": "GSM4275457", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "-LCB- delta -RCB- kdpE", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- kdpE", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275457", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- kdpE </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4275457", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275458", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275458", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275458", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275458", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275458", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275458", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275458", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275458", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "TMA + 0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "TMA + 0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275458", "field": "characteristics", "associatedPhrase": "media : <Supp> TMA + 0.1 mM KCl </Supp> "}], "externalCrossReferences": [{"objectId": "GSM4275458", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275459", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275459", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275459", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275459", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275459", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275459", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275459", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275459", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "TMA + 0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "TMA + 0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275459", "field": "characteristics", "associatedPhrase": "media : <Supp> TMA + 0.1 mM KCl </Supp> "}], "externalCrossReferences": [{"objectId": "GSM4275459", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275460", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275460", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275460", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275460", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275460", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275460", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275460", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275460", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "TMA + 115 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "TMA + 115 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275460", "field": "characteristics", "associatedPhrase": "media : <Supp> TMA + 115 mM KCl </Supp> "}], "externalCrossReferences": [{"objectId": "GSM4275460", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275461", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275461", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275461", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275461", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275461", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275461", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275461", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275461", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "TMA + 115 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "TMA + 115 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275461", "field": "characteristics", "associatedPhrase": "media : <Supp> TMA + 115 mM KCl </Supp> "}], "externalCrossReferences": [{"objectId": "GSM4275461", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275462", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275462", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275462", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275462", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275462", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275462", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275462", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275462", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "-LCB- delta -RCB- phoB", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- phoB", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275462", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- phoB </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4275462", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275463", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275463", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275463", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275463", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275463", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275463", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275463", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275463", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "-LCB- delta -RCB- phoB", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- phoB", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275463", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- phoB </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4275463", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275464", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275464", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275464", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275464", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275464", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275464", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275464", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275464", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "-LCB- delta -RCB- phoB", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- phoB", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275464", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- phoB </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4275464", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275465", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275465", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275465", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275465", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275465", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275465", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275465", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275465", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "-LCB- delta -RCB- phoB", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- phoB", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275465", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- phoB </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4275465", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275466", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275466", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275466", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275466", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275466", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275466", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275466", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275466", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275467", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275467", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275467", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275467", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275467", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275467", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275467", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275467", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275469", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275469", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275469", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275469", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275469", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275469", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275469", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275469", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "-LCB- delta -RCB- zraR", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- zraR", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275469", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- zraR </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4275469", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275470", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275470", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275470", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275470", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275470", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275470", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275470", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275470", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "-LCB- delta -RCB- zraR", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- zraR", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275470", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- zraR </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4275470", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275471", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275471", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275471", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275471", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275471", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275471", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275471", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275471", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "-LCB- delta -RCB- zraR", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- zraR", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275471", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- zraR </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4275471", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275472", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275472", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275472", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275472", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275472", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275472", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275472", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275472", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275473", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275473", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "0.1 mM KCl", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.1 mM KCl", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275473", "field": "growth_protocol", "associatedPhrase": "For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 \u00b0C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 \u00b0C </Temp> . For ZraSR : Cells were grown at <Temp> 37 \u00b0C </Temp> in liquid LB medium containing 1 mM ZnCl2 . "}], "externalCrossReferences": [{"objectId": "GSM4275473", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275473", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275473", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz", "source": "GEO", "id": "GSM4275473", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM4275473", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33172971"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435425", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NC _ 000913.2 "}], "externalCrossReferences": [{"objectId": "GSM4435425", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435425", "field": "extract_protocol", "associatedPhrase": "Cells were resuspended in TRIzol ( Invitrogen ) and incubated for 4 min at 95 \u00baC to disrupt the cells . The total RNA was purified by PCI extraction and chloroform extraction . After centrifugation , equal volume of isopropanol was added to the top water phase to precipitate the total RNA . The genomic DNA was digested by 50 U DNase I for <Supp> 30 min </Supp> at room temperature . The RNA was then purified by RNeasy Mini Kit ( Qiagen ) . "}], "externalCrossReferences": [{"objectId": "GSM4435425", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435425", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . W3110 "}], "externalCrossReferences": [{"objectId": "GSM4435425", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "sigma70 WT", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "sigma70 WT", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435425", "field": "characteristics", "associatedPhrase": "strain : <Gtype> sigma70 WT </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4435425", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "W3110 6xHis-rpoD", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "W3110 6xHis-rpoD", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435425", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> W3110 6xHis-rpoD </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4435425", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435426", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NC _ 000913.2 "}], "externalCrossReferences": [{"objectId": "GSM4435426", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435426", "field": "extract_protocol", "associatedPhrase": "Cells were resuspended in TRIzol ( Invitrogen ) and incubated for 4 min at 95 \u00baC to disrupt the cells . The total RNA was purified by PCI extraction and chloroform extraction . After centrifugation , equal volume of isopropanol was added to the top water phase to precipitate the total RNA . The genomic DNA was digested by 50 U DNase I for <Supp> 30 min </Supp> at room temperature . The RNA was then purified by RNeasy Mini Kit ( Qiagen ) . "}], "externalCrossReferences": [{"objectId": "GSM4435426", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435426", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . W3110 "}], "externalCrossReferences": [{"objectId": "GSM4435426", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "sigma70 WT", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "sigma70 WT", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435426", "field": "characteristics", "associatedPhrase": "strain : <Gtype> sigma70 WT </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4435426", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "W3110 6xHis-rpoD", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "W3110 6xHis-rpoD", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435426", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> W3110 6xHis-rpoD </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4435426", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435427", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NC _ 000913.2 "}], "externalCrossReferences": [{"objectId": "GSM4435427", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435427", "field": "extract_protocol", "associatedPhrase": "Cells were resuspended in TRIzol ( Invitrogen ) and incubated for 4 min at 95 \u00baC to disrupt the cells . The total RNA was purified by PCI extraction and chloroform extraction . After centrifugation , equal volume of isopropanol was added to the top water phase to precipitate the total RNA . The genomic DNA was digested by 50 U DNase I for <Supp> 30 min </Supp> at room temperature . The RNA was then purified by RNeasy Mini Kit ( Qiagen ) . "}], "externalCrossReferences": [{"objectId": "GSM4435427", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435427", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . W3110 "}], "externalCrossReferences": [{"objectId": "GSM4435427", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "sigma70 WT", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "sigma70 WT", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435427", "field": "characteristics", "associatedPhrase": "strain : <Gtype> sigma70 WT </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4435427", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "W3110 6xHis-rpoD", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "W3110 6xHis-rpoD", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435427", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> W3110 6xHis-rpoD </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4435427", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435428", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NC _ 000913.2 "}], "externalCrossReferences": [{"objectId": "GSM4435428", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435428", "field": "extract_protocol", "associatedPhrase": "Cells were resuspended in TRIzol ( Invitrogen ) and incubated for 4 min at 95 \u00baC to disrupt the cells . The total RNA was purified by PCI extraction and chloroform extraction . After centrifugation , equal volume of isopropanol was added to the top water phase to precipitate the total RNA . The genomic DNA was digested by 50 U DNase I for <Supp> 30 min </Supp> at room temperature . The RNA was then purified by RNeasy Mini Kit ( Qiagen ) . "}], "externalCrossReferences": [{"objectId": "GSM4435428", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435428", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . W3110 "}], "externalCrossReferences": [{"objectId": "GSM4435428", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "W3110 6xHis-rpoD greA : : tet greB : : amp", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "W3110 6xHis-rpoD greA : : tet greB : : amp", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435428", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> W3110 6xHis-rpoD greA : : tet greB : : amp </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4435428", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435429", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NC _ 000913.2 "}], "externalCrossReferences": [{"objectId": "GSM4435429", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435429", "field": "extract_protocol", "associatedPhrase": "Cells were resuspended in TRIzol ( Invitrogen ) and incubated for 4 min at 95 \u00baC to disrupt the cells . The total RNA was purified by PCI extraction and chloroform extraction . After centrifugation , equal volume of isopropanol was added to the top water phase to precipitate the total RNA . The genomic DNA was digested by 50 U DNase I for <Supp> 30 min </Supp> at room temperature . The RNA was then purified by RNeasy Mini Kit ( Qiagen ) . "}], "externalCrossReferences": [{"objectId": "GSM4435429", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435429", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . W3110 "}], "externalCrossReferences": [{"objectId": "GSM4435429", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "W3110 6xHis-rpoD greA : : tet greB : : amp", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "W3110 6xHis-rpoD greA : : tet greB : : amp", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435429", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> W3110 6xHis-rpoD greA : : tet greB : : amp </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4435429", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435430", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NC _ 000913.2 "}], "externalCrossReferences": [{"objectId": "GSM4435430", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435430", "field": "extract_protocol", "associatedPhrase": "Cells were resuspended in TRIzol ( Invitrogen ) and incubated for 4 min at 95 \u00baC to disrupt the cells . The total RNA was purified by PCI extraction and chloroform extraction . After centrifugation , equal volume of isopropanol was added to the top water phase to precipitate the total RNA . The genomic DNA was digested by 50 U DNase I for <Supp> 30 min </Supp> at room temperature . The RNA was then purified by RNeasy Mini Kit ( Qiagen ) . "}], "externalCrossReferences": [{"objectId": "GSM4435430", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435430", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . W3110 "}], "externalCrossReferences": [{"objectId": "GSM4435430", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "W3110 6xHis-rpoD greA : : tet greB : : amp", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "W3110 6xHis-rpoD greA : : tet greB : : amp", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz", "source": "GEO", "id": "GSM4435430", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> W3110 6xHis-rpoD greA : : tet greB : : amp </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM4435430", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "33568644"}]}{"id": "", "name": "DY330 ( W3110 )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "DY330 ( W3110 )", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE21341/GSE21341.soft.gz", "source": "GEO", "id": "GSM533304", "field": "characteristics", "associatedPhrase": "strain : <Med> DY330 ( W3110 ) </Med> "}], "externalCrossReferences": [{"objectId": "GSM533304", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "20671182"}]}{"id": "", "name": "DY330 ( W3110 )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "DY330 ( W3110 )", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE21341/GSE21341.soft.gz", "source": "GEO", "id": "GSM533305", "field": "characteristics", "associatedPhrase": "strain : <Med> DY330 ( W3110 ) </Med> "}], "externalCrossReferences": [{"objectId": "GSM533305", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "20671182"}]}{"id": "", "name": "DY330 ( W3110 )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "DY330 ( W3110 )", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE21341/GSE21341.soft.gz", "source": "GEO", "id": "GSM533306", "field": "characteristics", "associatedPhrase": "strain : <Med> DY330 ( W3110 ) </Med> "}], "externalCrossReferences": [{"objectId": "GSM533306", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "20671182"}]}{"id": "", "name": "DY330 ( W3110 )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "DY330 ( W3110 )", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE21341/GSE21341.soft.gz", "source": "GEO", "id": "GSM533307", "field": "characteristics", "associatedPhrase": "strain : <Med> DY330 ( W3110 ) </Med> "}], "externalCrossReferences": [{"objectId": "GSM533307", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "20671182"}]}{"id": "", "name": "DY330 ( W3110 )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "DY330 ( W3110 )", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE21341/GSE21341.soft.gz", "source": "GEO", "id": "GSM533308", "field": "characteristics", "associatedPhrase": "strain : <Med> DY330 ( W3110 ) </Med> "}], "externalCrossReferences": [{"objectId": "GSM533308", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "20671182"}]}{"id": "", "name": "70 \u00b5M IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "70 \u00b5M IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz", "source": "GEO", "id": "GSM832606", "field": "growth_protocol", "associatedPhrase": "An overnight culture was diluted to an <OD> OD600 of 0.02 </OD> in <Med> LB media </Med> supplemented with 100 \u00b5g/ml of carbenicillin , 40 \u00b5g/ml biotin , and <Supp> 70 \u00b5M IPTG </Supp> . The back diluted culture was grown at <Temp> 37 \u00b0C </Temp> until reaching an OD600 of 0.45 . "}], "externalCrossReferences": [{"objectId": "GSM832606", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22153074"}]}{"id": "", "name": "MC4100 \u2206 tig : : kan pTig-TEV-Avi", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MC4100 \u2206 tig : : kan pTig-TEV-Avi", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz", "source": "GEO", "id": "GSM832606", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> MC4100 \u2206 tig : : kan pTig-TEV-Avi </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM832606", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22153074"}]}{"id": "", "name": "70 \u00b5M IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "70 \u00b5M IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz", "source": "GEO", "id": "GSM832607", "field": "growth_protocol", "associatedPhrase": "An overnight culture was diluted to an <OD> OD600 of 0.02 </OD> in <Med> LB media </Med> supplemented with 100 \u00b5g/ml of carbenicillin , 40 \u00b5g/ml biotin , and <Supp> 70 \u00b5M IPTG </Supp> . The back diluted culture was grown at <Temp> 37 \u00b0C </Temp> until reaching an OD600 of 0.45 . "}], "externalCrossReferences": [{"objectId": "GSM832607", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22153074"}]}{"id": "", "name": "MC4100 \u2206 tig : : kan pTig-TEV-Avi", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MC4100 \u2206 tig : : kan pTig-TEV-Avi", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz", "source": "GEO", "id": "GSM832607", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> MC4100 \u2206 tig : : kan pTig-TEV-Avi </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM832607", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22153074"}]}{"id": "", "name": "70 \u00b5M IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "70 \u00b5M IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz", "source": "GEO", "id": "GSM832608", "field": "growth_protocol", "associatedPhrase": "An overnight culture was diluted to an <OD> OD600 of 0.02 </OD> in <Med> LB media </Med> supplemented with 100 \u00b5g/ml of carbenicillin , 40 \u00b5g/ml biotin , and <Supp> 70 \u00b5M IPTG </Supp> . The back diluted culture was grown at <Temp> 37 \u00b0C </Temp> until reaching an OD600 of 0.45 . "}], "externalCrossReferences": [{"objectId": "GSM832608", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22153074"}]}{"id": "", "name": "MC4100 \u2206 tig : : kan pTig-TEV-Avi", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MC4100 \u2206 tig : : kan pTig-TEV-Avi", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz", "source": "GEO", "id": "GSM832608", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> MC4100 \u2206 tig : : kan pTig-TEV-Avi </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM832608", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22153074"}]}{"id": "", "name": "70 \u00b5M IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "70 \u00b5M IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz", "source": "GEO", "id": "GSM832609", "field": "growth_protocol", "associatedPhrase": "An overnight culture was diluted to an <OD> OD600 of 0.02 </OD> in <Med> LB media </Med> supplemented with 100 \u00b5g/ml of carbenicillin , 40 \u00b5g/ml biotin , and <Supp> 70 \u00b5M IPTG </Supp> . The back diluted culture was grown at <Temp> 37 \u00b0C </Temp> until reaching an OD600 of 0.45 . "}], "externalCrossReferences": [{"objectId": "GSM832609", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22153074"}]}{"id": "", "name": "MC4100 \u2206 tig : : kan pTig-TEV-Avi", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MC4100 \u2206 tig : : kan pTig-TEV-Avi", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz", "source": "GEO", "id": "GSM832609", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> MC4100 \u2206 tig : : kan pTig-TEV-Avi </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM832609", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22153074"}]}{"id": "", "name": "70 \u00b5M IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "70 \u00b5M IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz", "source": "GEO", "id": "GSM832610", "field": "growth_protocol", "associatedPhrase": "An overnight culture was diluted to an <OD> OD600 of 0.02 </OD> in <Med> LB media </Med> supplemented with 100 \u00b5g/ml of carbenicillin , 40 \u00b5g/ml biotin , and <Supp> 70 \u00b5M IPTG </Supp> . The back diluted culture was grown at <Temp> 37 \u00b0C </Temp> until reaching an OD600 of 0.45 . "}], "externalCrossReferences": [{"objectId": "GSM832610", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22153074"}]}{"id": "", "name": "MC4100 \u2206 tig : : kan pTig-TEV-Avi", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MC4100 \u2206 tig : : kan pTig-TEV-Avi", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz", "source": "GEO", "id": "GSM832610", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> MC4100 \u2206 tig : : kan pTig-TEV-Avi </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM832610", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22153074"}]}{"id": "", "name": "70 \u00b5M IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "70 \u00b5M IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz", "source": "GEO", "id": "GSM832611", "field": "growth_protocol", "associatedPhrase": "An overnight culture was diluted to an <OD> OD600 of 0.02 </OD> in <Med> LB media </Med> supplemented with 100 \u00b5g/ml of carbenicillin , 40 \u00b5g/ml biotin , and <Supp> 70 \u00b5M IPTG </Supp> . The back diluted culture was grown at <Temp> 37 \u00b0C </Temp> until reaching an OD600 of 0.45 . "}], "externalCrossReferences": [{"objectId": "GSM832611", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22153074"}]}{"id": "", "name": "MC4100 \u2206 tig : : kan pTig-TEV-Avi", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MC4100 \u2206 tig : : kan pTig-TEV-Avi", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz", "source": "GEO", "id": "GSM832611", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> MC4100 \u2206 tig : : kan pTig-TEV-Avi </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM832611", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22153074"}]}{"id": "", "name": "70 \u00b5M IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "70 \u00b5M IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz", "source": "GEO", "id": "GSM832612", "field": "growth_protocol", "associatedPhrase": "An overnight culture was diluted to an <OD> OD600 of 0.02 </OD> in <Med> LB media </Med> supplemented with 100 \u00b5g/ml of carbenicillin , 40 \u00b5g/ml biotin , and <Supp> 70 \u00b5M IPTG </Supp> . The back diluted culture was grown at <Temp> 37 \u00b0C </Temp> until reaching an OD600 of 0.45 . "}], "externalCrossReferences": [{"objectId": "GSM832612", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22153074"}]}{"id": "", "name": "MC4100 \u2206 tig : : kan pTig-TEV-Avi", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MC4100 \u2206 tig : : kan pTig-TEV-Avi", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz", "source": "GEO", "id": "GSM832612", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> MC4100 \u2206 tig : : kan pTig-TEV-Avi </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM832612", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22153074"}]}{"id": "", "name": "70 \u00b5M IPTG", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "70 \u00b5M IPTG", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz", "source": "GEO", "id": "GSM832613", "field": "growth_protocol", "associatedPhrase": "An overnight culture was diluted to an <OD> OD600 of 0.02 </OD> in <Med> LB media </Med> supplemented with 100 \u00b5g/ml of carbenicillin , 40 \u00b5g/ml biotin , and <Supp> 70 \u00b5M IPTG </Supp> . The back diluted culture was grown at <Temp> 37 \u00b0C </Temp> until reaching an OD600 of 0.45 . "}], "externalCrossReferences": [{"objectId": "GSM832613", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22153074"}]}{"id": "", "name": "MC4100 \u2206 tig : : kan pTig-TEV-Avi", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MC4100 \u2206 tig : : kan pTig-TEV-Avi", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz", "source": "GEO", "id": "GSM832613", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> MC4100 \u2206 tig : : kan pTig-TEV-Avi </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM832613", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22153074"}]}{"id": "", "name": "U00096 .2 )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2 )", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz", "source": "GEO", "id": "GSM849370", "field": "data_processing", "associatedPhrase": "Genome build : E. coli [ K-12 MG1655 strain ( <Gversion> U00096 .2 ) </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM849370", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22232676"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz", "source": "GEO", "id": "GSM849370", "field": "growth_protocol", "associatedPhrase": "E. coli [ K-12 MG1655 strain ( <Gversion> U00096 .2 </Gversion> ) ] was grown overnight at <Temp> 30 \u00b0C </Temp> in LB medium . The resulting culture was diluted 500-fold in fresh LB medium and grown at 30 \u00b0C for 3.5 hours such that O.D. at 600 nm became 0.30-0.35 . "}], "externalCrossReferences": [{"objectId": "GSM849370", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22232676"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz", "source": "GEO", "id": "GSM849370", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM849370", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22232676"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz", "source": "GEO", "id": "GSM849370", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM849370", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22232676"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz", "source": "GEO", "id": "GSM849370", "field": "characteristics", "associatedPhrase": "reference genome : <Gversion> U00096 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM849370", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22232676"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz", "source": "GEO", "id": "GSM849370", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM849370", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22232676"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz", "source": "GEO", "id": "GSM849370", "field": "growth_protocol", "associatedPhrase": "E. coli [ K-12 MG1655 strain ( <Gversion> U00096 .2 </Gversion> ) ] was grown overnight at <Temp> 30 \u00b0C </Temp> in LB medium . The resulting culture was diluted 500-fold in fresh LB medium and grown at 30 \u00b0C for 3.5 hours such that O.D. at 600 nm became 0.30-0.35 . "}], "externalCrossReferences": [{"objectId": "GSM849370", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22232676"}]}{"id": "", "name": "U00096 .2 )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2 )", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz", "source": "GEO", "id": "GSM849371", "field": "data_processing", "associatedPhrase": "Genome build : E. coli [ K-12 MG1655 strain ( <Gversion> U00096 .2 ) </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM849371", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22232676"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz", "source": "GEO", "id": "GSM849371", "field": "growth_protocol", "associatedPhrase": "E. coli [ K-12 MG1655 strain ( <Gversion> U00096 .2 </Gversion> ) ] was grown overnight at <Temp> 30 \u00b0C </Temp> in LB medium . The resulting culture was diluted 500-fold in fresh LB medium and grown at 30 \u00b0C for 3.5 hours such that O.D. at 600 nm became 0.30-0.35 . "}], "externalCrossReferences": [{"objectId": "GSM849371", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22232676"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz", "source": "GEO", "id": "GSM849371", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM849371", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22232676"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz", "source": "GEO", "id": "GSM849371", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM849371", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22232676"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz", "source": "GEO", "id": "GSM849371", "field": "characteristics", "associatedPhrase": "reference genome : <Gversion> U00096 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM849371", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22232676"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz", "source": "GEO", "id": "GSM849371", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM849371", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22232676"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz", "source": "GEO", "id": "GSM849371", "field": "growth_protocol", "associatedPhrase": "E. coli [ K-12 MG1655 strain ( <Gversion> U00096 .2 </Gversion> ) ] was grown overnight at <Temp> 30 \u00b0C </Temp> in LB medium . The resulting culture was diluted 500-fold in fresh LB medium and grown at 30 \u00b0C for 3.5 hours such that O.D. at 600 nm became 0.30-0.35 . "}], "externalCrossReferences": [{"objectId": "GSM849371", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "22232676"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz", "source": "GEO", "id": "GSM981539", "field": "data_processing", "associatedPhrase": "preprocessed RNA-Seq reads were mapped to the reference Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 </Gversion> ) by BWA toolkit version 0.5.9-r16 with the following options : bwa aln - q 20 "}], "externalCrossReferences": [{"objectId": "GSM981539", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23385483"}]}{"id": "", "name": "U00096 .2 )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2 )", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz", "source": "GEO", "id": "GSM981539", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 ) </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM981539", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23385483"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz", "source": "GEO", "id": "GSM981540", "field": "data_processing", "associatedPhrase": "preprocessed RNA-Seq reads were mapped to the reference Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 </Gversion> ) by BWA toolkit version 0.5.9-r16 with the following options : bwa aln - q 20 "}], "externalCrossReferences": [{"objectId": "GSM981540", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23385483"}]}{"id": "", "name": "U00096 .2 )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2 )", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz", "source": "GEO", "id": "GSM981540", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 ) </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM981540", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23385483"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz", "source": "GEO", "id": "GSM981541", "field": "data_processing", "associatedPhrase": "preprocessed RNA-Seq reads were mapped to the reference Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 </Gversion> ) by BWA toolkit version 0.5.9-r16 with the following options : bwa aln - q 20 "}], "externalCrossReferences": [{"objectId": "GSM981541", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23385483"}]}{"id": "", "name": "U00096 .2 )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2 )", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz", "source": "GEO", "id": "GSM981541", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 ) </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM981541", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23385483"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz", "source": "GEO", "id": "GSM981542", "field": "data_processing", "associatedPhrase": "preprocessed RNA-Seq reads were mapped to the reference Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 </Gversion> ) by BWA toolkit version 0.5.9-r16 with the following options : bwa aln - q 20 "}], "externalCrossReferences": [{"objectId": "GSM981542", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23385483"}]}{"id": "", "name": "U00096 .2 )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2 )", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz", "source": "GEO", "id": "GSM981542", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 ) </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM981542", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23385483"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz", "source": "GEO", "id": "GSM981543", "field": "data_processing", "associatedPhrase": "preprocessed RNA-Seq reads were mapped to the reference Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 </Gversion> ) by BWA toolkit version 0.5.9-r16 with the following options : bwa aln - q 20 "}], "externalCrossReferences": [{"objectId": "GSM981543", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23385483"}]}{"id": "", "name": "U00096 .2 )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2 )", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz", "source": "GEO", "id": "GSM981543", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 ) </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM981543", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23385483"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz", "source": "GEO", "id": "GSM981544", "field": "data_processing", "associatedPhrase": "preprocessed RNA-Seq reads were mapped to the reference Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 </Gversion> ) by BWA toolkit version 0.5.9-r16 with the following options : bwa aln - q 20 "}], "externalCrossReferences": [{"objectId": "GSM981544", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23385483"}]}{"id": "", "name": "U00096 .2 )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2 )", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz", "source": "GEO", "id": "GSM981544", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 ) </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM981544", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23385483"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE43408/GSE43408.soft.gz", "source": "GEO", "id": "GSM1217967", "field": "treatment_protocol", "associatedPhrase": "Total RNA was isolated with TRIzol ( invitrogen , Carlsbad , CA ) according to the manufacture [ linebreak ] s instruction . DNA was removed from RNA extracts with RNase-free DNase I ( New England Biolabs , Beverly , MA , USA ) by incubation at <Temp> 37 \u00b0C </Temp> for <Supp> 30 min </Supp> . The quality of total RNA was assessed by using 2100 Bioanalyzer ( Agilent , Santa Clara , USA ) and also checked by agarose gel electrophoresis . rRNAs was subsquently removed from the total mRNA following the instruction of the Ribo-Zero rRNATM Removal kit ( Epicentre , Madison , WI , USA ) . "}], "externalCrossReferences": [{"objectId": "GSM1217967", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23856776"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE43408/GSE43408.soft.gz", "source": "GEO", "id": "GSM1217968", "field": "treatment_protocol", "associatedPhrase": "Total RNA was isolated with TRIzol ( invitrogen , Carlsbad , CA ) according to the manufacture [ linebreak ] s instruction . DNA was removed from RNA extracts with RNase-free DNase I ( New England Biolabs , Beverly , MA , USA ) by incubation at <Temp> 37 \u00b0C </Temp> for <Supp> 30 min </Supp> . The quality of total RNA was assessed by using 2100 Bioanalyzer ( Agilent , Santa Clara , USA ) and also checked by agarose gel electrophoresis . rRNAs was subsquently removed from the total mRNA following the instruction of the Ribo-Zero rRNATM Removal kit ( Epicentre , Madison , WI , USA ) . "}], "externalCrossReferences": [{"objectId": "GSM1217968", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23856776"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE43408/GSE43408.soft.gz", "source": "GEO", "id": "GSM1217969", "field": "treatment_protocol", "associatedPhrase": "Total RNA was isolated with TRIzol ( invitrogen , Carlsbad , CA ) according to the manufacture [ linebreak ] s instruction . DNA was removed from RNA extracts with RNase-free DNase I ( New England Biolabs , Beverly , MA , USA ) by incubation at <Temp> 37 \u00b0C </Temp> for <Supp> 30 min </Supp> . The quality of total RNA was assessed by using 2100 Bioanalyzer ( Agilent , Santa Clara , USA ) and also checked by agarose gel electrophoresis . rRNAs was subsquently removed from the total mRNA following the instruction of the Ribo-Zero rRNATM Removal kit ( Epicentre , Madison , WI , USA ) . "}], "externalCrossReferences": [{"objectId": "GSM1217969", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23856776"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE43408/GSE43408.soft.gz", "source": "GEO", "id": "GSM1217970", "field": "treatment_protocol", "associatedPhrase": "Total RNA was isolated with TRIzol ( invitrogen , Carlsbad , CA ) according to the manufacture [ linebreak ] s instruction . DNA was removed from RNA extracts with RNase-free DNase I ( New England Biolabs , Beverly , MA , USA ) by incubation at <Temp> 37 \u00b0C </Temp> for <Supp> 30 min </Supp> . The quality of total RNA was assessed by using 2100 Bioanalyzer ( Agilent , Santa Clara , USA ) and also checked by agarose gel electrophoresis . rRNAs was subsquently removed from the total mRNA following the instruction of the Ribo-Zero rRNATM Removal kit ( Epicentre , Madison , WI , USA ) . "}], "externalCrossReferences": [{"objectId": "GSM1217970", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23856776"}]}{"id": "", "name": "BL21 ( DE3 )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "BL21 ( DE3 )", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE44928/GSE44928.soft.gz", "source": "GEO", "id": "GSM1094082", "field": "characteristics", "associatedPhrase": "strain : <Med> BL21 ( DE3 ) </Med> "}], "externalCrossReferences": [{"objectId": "GSM1094082", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "BL21 ( DE3 )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "BL21 ( DE3 )", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE44928/GSE44928.soft.gz", "source": "GEO", "id": "GSM1094083", "field": "characteristics", "associatedPhrase": "strain : <Med> BL21 ( DE3 ) </Med> "}], "externalCrossReferences": [{"objectId": "GSM1094083", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "mM IPTG + 50\u03bcg/ml Amp", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "mM IPTG + 50\u03bcg/ml Amp", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE44928/GSE44928.soft.gz", "source": "GEO", "id": "GSM1094083", "field": "characteristics", "associatedPhrase": "condition : <Gtype> LB </Gtype> +3 g/L Glc +0.1 <Supp> mM IPTG + 50\u03bcg/ml Amp </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1094083", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104381", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104381", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104381", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104381", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104381", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104381", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104381", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104381", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104386", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104386", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104386", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104386", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104386", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104386", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104386", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104386", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104387", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104387", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104387", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104387", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104387", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104387", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104387", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104387", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104388", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104388", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104388", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104388", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104388", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104388", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104388", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104388", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104389", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104389", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104389", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104389", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104389", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104389", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104389", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104389", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104390", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104390", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104390", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104390", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104390", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104390", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104390", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104390", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104391", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104391", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104391", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104391", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104391", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104391", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104391", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104391", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104392", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104392", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104392", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104392", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104392", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104392", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104392", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104392", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104393", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104393", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104393", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104393", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104393", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104393", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104393", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104393", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104394", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104394", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104394", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104394", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104394", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104394", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104394", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104394", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104395", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104395", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104395", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104395", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104395", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104395", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104395", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104395", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104396", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104396", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104396", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104396", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104396", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104396", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104396", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104396", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104397", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104397", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104397", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104397", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104397", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104397", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104397", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104397", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104398", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104398", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104398", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104398", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104398", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104398", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104398", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104398", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104399", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104399", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104399", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104399", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104399", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104399", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104399", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104399", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104400", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104400", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104400", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104400", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104400", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104400", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104400", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104400", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104401", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104401", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104401", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104401", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104401", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104401", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104401", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104401", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104402", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104402", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104402", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104402", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104402", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104402", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104402", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104402", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104403", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104403", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104403", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104403", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104403", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104403", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104403", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104403", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104404", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104404", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104404", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104404", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104404", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104404", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104404", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104404", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104405", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104405", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104405", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104405", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104405", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104405", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104405", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104405", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104406", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104406", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104406", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104406", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104406", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104406", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104406", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104406", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104407", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104407", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104407", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104407", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104407", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104407", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104407", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104407", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104408", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104408", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104408", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104408", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104408", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104408", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104408", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104408", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104410", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104410", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104410", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104410", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104410", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104410", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104410", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104410", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104411", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104411", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104411", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104411", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104411", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104411", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104411", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104411", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104412", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104412", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104412", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104412", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104412", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104412", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104412", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104412", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104413", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104413", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104413", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104413", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104413", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104413", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104413", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104413", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104414", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104414", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104414", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104414", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104414", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104414", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104414", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104414", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104415", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104415", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104415", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104415", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104415", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104415", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104415", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104415", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104416", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104416", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104416", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104416", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104416", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104416", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104416", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104416", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104417", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104417", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104417", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104417", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104417", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104417", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104417", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104417", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104418", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104418", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104418", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104418", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104418", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104418", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104418", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104418", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104419", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104419", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104419", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104419", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104419", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104419", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104419", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104419", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104420", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104420", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104420", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104420", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104420", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104420", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104420", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104420", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104421", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104421", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104421", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104421", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104421", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104421", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104421", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104421", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104422", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104422", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104422", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104422", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104422", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104422", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104422", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104422", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104423", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104423", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104423", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104423", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104423", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104423", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104423", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104423", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104424", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104424", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104424", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104424", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104424", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104424", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104424", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104424", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104425", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104425", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104425", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104425", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104425", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104425", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104425", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104425", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104426", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104426", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104426", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104426", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104426", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104426", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104426", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104426", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104427", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104427", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104427", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104427", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104427", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104427", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104427", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104427", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104428", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1104428", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104428", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104428", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104428", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1104428", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz", "source": "GEO", "id": "GSM1104428", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1104428", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23716638"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46507/GSE46507.soft.gz", "source": "GEO", "id": "GSM1131348", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gtype> The </Gtype> reference genomes used for E. coli K12 strain BW25113 and S. coelicolor A3 ( 2 ) strain M145 were <Gversion> U00096 .2 </Gversion> and AL645882 , respectively . "}], "externalCrossReferences": [{"objectId": "GSM1131348", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46507/GSE46507.soft.gz", "source": "GEO", "id": "GSM1131349", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gtype> The </Gtype> reference genomes used for E. coli K12 strain BW25113 and S. coelicolor A3 ( 2 ) strain M145 were <Gversion> U00096 .2 </Gversion> and AL645882 , respectively . "}], "externalCrossReferences": [{"objectId": "GSM1131349", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46737/GSE46737.soft.gz", "source": "GEO", "id": "GSM1137316", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1137316", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24461193"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46737/GSE46737.soft.gz", "source": "GEO", "id": "GSM1137316", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1137316", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24461193"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46737/GSE46737.soft.gz", "source": "GEO", "id": "GSM1137318", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1137318", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24461193"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46737/GSE46737.soft.gz", "source": "GEO", "id": "GSM1137318", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1137318", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24461193"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46737/GSE46737.soft.gz", "source": "GEO", "id": "GSM1137319", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1137319", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24461193"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46737/GSE46737.soft.gz", "source": "GEO", "id": "GSM1137319", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1137319", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24461193"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46737/GSE46737.soft.gz", "source": "GEO", "id": "GSM1137320", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1137320", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24461193"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46737/GSE46737.soft.gz", "source": "GEO", "id": "GSM1137320", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1137320", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24461193"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46737/GSE46737.soft.gz", "source": "GEO", "id": "GSM1137321", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1137321", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24461193"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46737/GSE46737.soft.gz", "source": "GEO", "id": "GSM1137321", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1137321", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24461193"}]}{"id": "", "name": "Heatshock 15 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Heatshock 15 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48151/GSE48151.soft.gz", "source": "GEO", "id": "GSM1170026", "field": "characteristics", "associatedPhrase": "culture/growth condition : <Supp> Heatshock 15 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1170026", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23899370"}]}{"id": "", "name": "Heatshock 15 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Heatshock 15 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48151/GSE48151.soft.gz", "source": "GEO", "id": "GSM1170027", "field": "characteristics", "associatedPhrase": "culture/growth condition : <Supp> Heatshock 15 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1170027", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23899370"}]}{"id": "", "name": "Heatshock 30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Heatshock 30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48151/GSE48151.soft.gz", "source": "GEO", "id": "GSM1170029", "field": "characteristics", "associatedPhrase": "culture/growth condition : <Supp> Heatshock 30 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1170029", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23899370"}]}{"id": "", "name": "Heatshock 30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Heatshock 30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48151/GSE48151.soft.gz", "source": "GEO", "id": "GSM1170030", "field": "characteristics", "associatedPhrase": "culture/growth condition : <Supp> Heatshock 30 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1170030", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23899370"}]}{"id": "", "name": "M-P0h", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "M-P0h", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48151/GSE48151.soft.gz", "source": "GEO", "id": "GSM1170033", "field": "source_name", "associatedPhrase": "E. coli cells _ <Gtype> M-P0h </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1170033", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23899370"}]}{"id": "", "name": "M-P0h", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "M-P0h", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48151/GSE48151.soft.gz", "source": "GEO", "id": "GSM1170034", "field": "source_name", "associatedPhrase": "E. coli cells _ <Gtype> M-P0h </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1170034", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23899370"}]}{"id": "", "name": "M-P2h", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "M-P2h", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48151/GSE48151.soft.gz", "source": "GEO", "id": "GSM1170035", "field": "source_name", "associatedPhrase": "E. coli cells _ <Gtype> M-P2h </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1170035", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23899370"}]}{"id": "", "name": "M-P2h", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "M-P2h", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48151/GSE48151.soft.gz", "source": "GEO", "id": "GSM1170036", "field": "source_name", "associatedPhrase": "E. coli cells _ <Gtype> M-P2h </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1170036", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23899370"}]}{"id": "", "name": "M-P4h", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "M-P4h", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48151/GSE48151.soft.gz", "source": "GEO", "id": "GSM1170037", "field": "source_name", "associatedPhrase": "E. coli cells _ <Gtype> M-P4h </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1170037", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23899370"}]}{"id": "", "name": "M-P4h", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "M-P4h", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48151/GSE48151.soft.gz", "source": "GEO", "id": "GSM1170038", "field": "source_name", "associatedPhrase": "E. coli cells _ <Gtype> M-P4h </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1170038", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "23899370"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174823", "field": "data_processing", "associatedPhrase": "FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174823", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174823", "field": "data_processing", "associatedPhrase": "Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174823", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174823", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1174823", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174824", "field": "data_processing", "associatedPhrase": "FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174824", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174824", "field": "data_processing", "associatedPhrase": "Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174824", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174824", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1174824", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174825", "field": "data_processing", "associatedPhrase": "FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174825", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174825", "field": "data_processing", "associatedPhrase": "Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174825", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174825", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1174825", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174826", "field": "data_processing", "associatedPhrase": "FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174826", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174826", "field": "data_processing", "associatedPhrase": "Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174826", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "ade", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ade", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174826", "field": "source_name", "associatedPhrase": "<Gtype> WT + </Gtype> <Supp> ade </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1174826", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174826", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1174826", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174827", "field": "data_processing", "associatedPhrase": "FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174827", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174827", "field": "data_processing", "associatedPhrase": "Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174827", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "L-trp", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "L-trp", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174827", "field": "source_name", "associatedPhrase": "<Gtype> WT + </Gtype> <Supp> L-trp </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1174827", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174827", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1174827", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174828", "field": "data_processing", "associatedPhrase": "FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174828", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174828", "field": "data_processing", "associatedPhrase": "Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174828", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174828", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1174828", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174829", "field": "data_processing", "associatedPhrase": "FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174829", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174829", "field": "data_processing", "associatedPhrase": "Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174829", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174829", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1174829", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174830", "field": "data_processing", "associatedPhrase": "FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174830", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174830", "field": "data_processing", "associatedPhrase": "Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174830", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174830", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1174830", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174831", "field": "data_processing", "associatedPhrase": "FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174831", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174831", "field": "data_processing", "associatedPhrase": "Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174831", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "nac KO ; BW25113 Dnac", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "nac KO ; BW25113 Dnac", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174831", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> nac KO ; BW25113 Dnac </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174831", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174831", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1174831", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174832", "field": "data_processing", "associatedPhrase": "FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174832", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174832", "field": "data_processing", "associatedPhrase": "Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174832", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "nac KO ; BW25113 Dnac", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "nac KO ; BW25113 Dnac", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174832", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> nac KO ; BW25113 Dnac </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174832", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174832", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1174832", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174833", "field": "data_processing", "associatedPhrase": "FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174833", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174833", "field": "data_processing", "associatedPhrase": "Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174833", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "cra KO ; BW25113 Dcra", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "cra KO ; BW25113 Dcra", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174833", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> cra KO ; BW25113 Dcra </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174833", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174833", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1174833", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174834", "field": "data_processing", "associatedPhrase": "FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174834", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174834", "field": "data_processing", "associatedPhrase": "Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174834", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "cra KO ; BW25113 Dcra", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "cra KO ; BW25113 Dcra", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174834", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> cra KO ; BW25113 Dcra </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174834", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174834", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1174834", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174835", "field": "data_processing", "associatedPhrase": "FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174835", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174835", "field": "data_processing", "associatedPhrase": "Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174835", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "mntR KO ; BW25113 DmntR", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "mntR KO ; BW25113 DmntR", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174835", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> mntR KO ; BW25113 DmntR </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174835", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174835", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1174835", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174836", "field": "data_processing", "associatedPhrase": "FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174836", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "library type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "library type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174836", "field": "data_processing", "associatedPhrase": "Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174836", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "mntR KO ; BW25113 DmntR", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "mntR KO ; BW25113 DmntR", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174836", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> mntR KO ; BW25113 DmntR </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1174836", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz", "source": "GEO", "id": "GSM1174836", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1174836", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24987116"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185369", "field": "data_processing", "associatedPhrase": "Sequenced reads were trimmed for adaptor sequence , and masked for low-complexity or low-quality sequence , then mapped to Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , complete genome using bowtie2 version 2.0.5 with default parameters . "}], "externalCrossReferences": [{"objectId": "GSM1185369", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185369", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1185369", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185369", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1185369", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185369", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1185369", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185370", "field": "data_processing", "associatedPhrase": "Sequenced reads were trimmed for adaptor sequence , and masked for low-complexity or low-quality sequence , then mapped to Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , complete genome using bowtie2 version 2.0.5 with default parameters . "}], "externalCrossReferences": [{"objectId": "GSM1185370", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185370", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1185370", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185370", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1185370", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185370", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1185370", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185371", "field": "data_processing", "associatedPhrase": "Sequenced reads were trimmed for adaptor sequence , and masked for low-complexity or low-quality sequence , then mapped to Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , complete genome using bowtie2 version 2.0.5 with default parameters . "}], "externalCrossReferences": [{"objectId": "GSM1185371", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185371", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1185371", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185371", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1185371", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185371", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1185371", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185372", "field": "data_processing", "associatedPhrase": "Sequenced reads were trimmed for adaptor sequence , and masked for low-complexity or low-quality sequence , then mapped to Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , complete genome using bowtie2 version 2.0.5 with default parameters . "}], "externalCrossReferences": [{"objectId": "GSM1185372", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185372", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1185372", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185372", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1185372", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185372", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1185372", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185373", "field": "data_processing", "associatedPhrase": "Sequenced reads were trimmed for adaptor sequence , and masked for low-complexity or low-quality sequence , then mapped to Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , complete genome using bowtie2 version 2.0.5 with default parameters . "}], "externalCrossReferences": [{"objectId": "GSM1185373", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185373", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1185373", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185373", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1185373", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185373", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1185373", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185374", "field": "data_processing", "associatedPhrase": "Sequenced reads were trimmed for adaptor sequence , and masked for low-complexity or low-quality sequence , then mapped to Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , complete genome using bowtie2 version 2.0.5 with default parameters . "}], "externalCrossReferences": [{"objectId": "GSM1185374", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185374", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1185374", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185374", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1185374", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185374", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1185374", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185375", "field": "data_processing", "associatedPhrase": "Sequenced reads were trimmed for adaptor sequence , and masked for low-complexity or low-quality sequence , then mapped to Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , complete genome using bowtie2 version 2.0.5 with default parameters . "}], "externalCrossReferences": [{"objectId": "GSM1185375", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185375", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1185375", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185375", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1185375", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185375", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1185375", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185376", "field": "data_processing", "associatedPhrase": "Sequenced reads were trimmed for adaptor sequence , and masked for low-complexity or low-quality sequence , then mapped to Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , complete genome using bowtie2 version 2.0.5 with default parameters . "}], "externalCrossReferences": [{"objectId": "GSM1185376", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185376", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1185376", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185376", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1185376", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185376", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1185376", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185377", "field": "data_processing", "associatedPhrase": "Sequenced reads were trimmed for adaptor sequence , and masked for low-complexity or low-quality sequence , then mapped to Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , complete genome using bowtie2 version 2.0.5 with default parameters . "}], "externalCrossReferences": [{"objectId": "GSM1185377", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185377", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1185377", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185377", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1185377", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz", "source": "GEO", "id": "GSM1185377", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM1185377", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24214998"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE53767/GSE53767.soft.gz", "source": "GEO", "id": "GSM1300282", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1300282", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24766808"}]}{"id": "", "name": "fresh media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "fresh media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE53767/GSE53767.soft.gz", "source": "GEO", "id": "GSM1300282", "field": "growth_protocol", "associatedPhrase": "All cultures were based on MOPS media with <Supp> 0.2 % glucose </Supp> ( Teknova ) , with either full supplement ( Neidhardt et al. , 1974 ) . An overnight liquid culture was diluted 400-fold into 200 ml <Med> fresh media </Med> . The culture was kept in a 2.8-liter flask at 37C with aeration ( 180 rpm ) until OD600 reached 0.3 . "}], "externalCrossReferences": [{"objectId": "GSM1300282", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24766808"}]}{"id": "", "name": "fresh media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "fresh media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE53767/GSE53767.soft.gz", "source": "GEO", "id": "GSM1300282", "field": "growth_protocol", "associatedPhrase": "All cultures were based on MOPS media with <Supp> 0.2 % glucose </Supp> ( Teknova ) , with either full supplement ( Neidhardt et al. , 1974 ) . An overnight liquid culture was diluted 400-fold into 200 ml <Med> fresh media </Med> . The culture was kept in a 2.8-liter flask at 37C with aeration ( 180 rpm ) until OD600 reached 0.3 . "}], "externalCrossReferences": [{"objectId": "GSM1300282", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "24766808"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326347", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1326347", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "0.2 mM of DPD", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.2 mM of DPD", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326347", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT and \u0394fur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . "}], "externalCrossReferences": [{"objectId": "GSM1326347", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "2h", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "2h", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326347", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT and \u0394fur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . "}], "externalCrossReferences": [{"objectId": "GSM1326347", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326347", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1326347", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326347", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1326347", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "Fe", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Fe", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326347", "field": "characteristics", "associatedPhrase": "agent : <Supp> Fe </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1326347", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326348", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1326348", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "0.2 mM of DPD", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.2 mM of DPD", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326348", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT and \u0394fur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . "}], "externalCrossReferences": [{"objectId": "GSM1326348", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "2h", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "2h", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326348", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT and \u0394fur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . "}], "externalCrossReferences": [{"objectId": "GSM1326348", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326348", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1326348", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326348", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1326348", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "Fe", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Fe", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326348", "field": "characteristics", "associatedPhrase": "agent : <Supp> Fe </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1326348", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326349", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1326349", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "0.2 mM of DPD", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.2 mM of DPD", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326349", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT and \u0394fur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . "}], "externalCrossReferences": [{"objectId": "GSM1326349", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "2h", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "2h", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326349", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT and \u0394fur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . "}], "externalCrossReferences": [{"objectId": "GSM1326349", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326349", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1326349", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326349", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1326349", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "DPD", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "DPD", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326349", "field": "characteristics", "associatedPhrase": "agent : <Supp> DPD </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1326349", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326350", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1326350", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "0.2 mM of DPD", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.2 mM of DPD", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326350", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT and \u0394fur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . "}], "externalCrossReferences": [{"objectId": "GSM1326350", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "2h", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "2h", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326350", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT and \u0394fur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . "}], "externalCrossReferences": [{"objectId": "GSM1326350", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326350", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1326350", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326350", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1326350", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "DPD", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "DPD", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326350", "field": "characteristics", "associatedPhrase": "agent : <Supp> DPD </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1326350", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326351", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1326351", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "0.2 mM of DPD", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.2 mM of DPD", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326351", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT and \u0394fur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . "}], "externalCrossReferences": [{"objectId": "GSM1326351", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "2h", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "2h", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326351", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT and \u0394fur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . "}], "externalCrossReferences": [{"objectId": "GSM1326351", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326351", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1326351", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326351", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1326351", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "\u0394fur", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u0394fur", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326351", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> \u0394fur </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1326351", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "Fe", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Fe", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326351", "field": "characteristics", "associatedPhrase": "agent : <Supp> Fe </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1326351", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326352", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1326352", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "0.2 mM of DPD", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.2 mM of DPD", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326352", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT and \u0394fur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . "}], "externalCrossReferences": [{"objectId": "GSM1326352", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "2h", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "2h", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326352", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT and \u0394fur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . "}], "externalCrossReferences": [{"objectId": "GSM1326352", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326352", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1326352", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326352", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1326352", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "\u0394fur", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u0394fur", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326352", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> \u0394fur </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1326352", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "Fe", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Fe", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326352", "field": "characteristics", "associatedPhrase": "agent : <Supp> Fe </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1326352", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326353", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1326353", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "0.2 mM of DPD", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.2 mM of DPD", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326353", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT and \u0394fur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . "}], "externalCrossReferences": [{"objectId": "GSM1326353", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "2h", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "2h", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326353", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT and \u0394fur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . "}], "externalCrossReferences": [{"objectId": "GSM1326353", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326353", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1326353", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326353", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1326353", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "\u0394fur", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u0394fur", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326353", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> \u0394fur </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1326353", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "DPD", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "DPD", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326353", "field": "characteristics", "associatedPhrase": "agent : <Supp> DPD </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1326353", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326354", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1326354", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "0.2 mM of DPD", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.2 mM of DPD", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326354", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT and \u0394fur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . "}], "externalCrossReferences": [{"objectId": "GSM1326354", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "2h", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "2h", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326354", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT and \u0394fur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . "}], "externalCrossReferences": [{"objectId": "GSM1326354", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326354", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1326354", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326354", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1326354", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "\u0394fur", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u0394fur", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326354", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> \u0394fur </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1326354", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "DPD", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "DPD", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz", "source": "GEO", "id": "GSM1326354", "field": "characteristics", "associatedPhrase": "agent : <Supp> DPD </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1326354", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25222563"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331409", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331409", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331409", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331409", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331410", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331410", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331410", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331410", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331411", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331411", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331411", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331411", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331412", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331412", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331412", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331412", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331413", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331413", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331413", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331413", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331414", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331414", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331414", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331414", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331415", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331415", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331415", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331415", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331416", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331416", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331416", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331416", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331417", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331417", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331417", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331417", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331418", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331418", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331418", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331418", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331419", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331419", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331419", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331419", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331420", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331420", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331420", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331420", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331421", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331421", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331421", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331421", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331422", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331422", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331422", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331422", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331423", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331423", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331423", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331423", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331424", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331424", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331424", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331424", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331426", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331426", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331426", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331426", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331427", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331427", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331427", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331427", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331428", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331428", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331428", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331428", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331429", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331429", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331429", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331429", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331430", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331430", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz", "source": "GEO", "id": "GSM1331430", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1331430", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25266388"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE58285/GSE58285.soft.gz", "source": "GEO", "id": "GSM1405877", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> U00096 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1405877", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25237058"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE58285/GSE58285.soft.gz", "source": "GEO", "id": "GSM1405878", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> U00096 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1405878", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25237058"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE58285/GSE58285.soft.gz", "source": "GEO", "id": "GSM1405879", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> U00096 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1405879", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25237058"}]}{"id": "", "name": "0 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE58285/GSE58285.soft.gz", "source": "GEO", "id": "GSM1405879", "field": "characteristics", "associatedPhrase": "incubation time : <Supp> 0 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1405879", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25237058"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE58285/GSE58285.soft.gz", "source": "GEO", "id": "GSM1405880", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> U00096 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1405880", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25237058"}]}{"id": "", "name": "10 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "10 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE58285/GSE58285.soft.gz", "source": "GEO", "id": "GSM1405880", "field": "characteristics", "associatedPhrase": "incubation time : <Supp> 10 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1405880", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25237058"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE58285/GSE58285.soft.gz", "source": "GEO", "id": "GSM1405882", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> U00096 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1405882", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25237058"}]}{"id": "", "name": "sample type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "sample type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE58556/GSE58556.soft.gz", "source": "GEO", "id": "GSM1413874", "field": "characteristics", "associatedPhrase": "<Gtype> sample type </Gtype> : <Anti> no RNA treatment </Anti> "}], "externalCrossReferences": [{"objectId": "GSM1413874", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25483350"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE58637/GSE58637.soft.gz", "source": "GEO", "id": "GSM1415871", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1415871", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25030700"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE58637/GSE58637.soft.gz", "source": "GEO", "id": "GSM1415872", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1415872", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25030700"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz", "source": "GEO", "id": "GSM1436266", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1436266", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz", "source": "GEO", "id": "GSM1436267", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1436267", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz", "source": "GEO", "id": "GSM1436270", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1436270", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz", "source": "GEO", "id": "GSM1436272", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1436272", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz", "source": "GEO", "id": "GSM1436273", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1436273", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz", "source": "GEO", "id": "GSM1436274", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1436274", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz", "source": "GEO", "id": "GSM1436275", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1436275", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz", "source": "GEO", "id": "GSM1436276", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1436276", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz", "source": "GEO", "id": "GSM1436277", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1436277", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz", "source": "GEO", "id": "GSM1436280", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1436280", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz", "source": "GEO", "id": "GSM1436281", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1436281", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz", "source": "GEO", "id": "GSM1436282", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1436282", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz", "source": "GEO", "id": "GSM1436283", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1436283", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz", "source": "GEO", "id": "GSM1436284", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1436284", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE60107/GSE60107.soft.gz", "source": "GEO", "id": "GSM1465035", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1465035", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2575788830486791"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE60107/GSE60107.soft.gz", "source": "GEO", "id": "GSM1465036", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1465036", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2575788830486791"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE60107/GSE60107.soft.gz", "source": "GEO", "id": "GSM1465037", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1465037", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2575788830486791"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE60107/GSE60107.soft.gz", "source": "GEO", "id": "GSM1465038", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM1465038", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2575788830486791"}]}{"id": "", "name": "W3110 rpoC-6xHis : : kan gal490", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "W3110 rpoC-6xHis : : kan gal490", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE62102/GSE62102.soft.gz", "source": "GEO", "id": "GSM1519656", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> W3110 rpoC-6xHis : : kan gal490 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1519656", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25976475"}]}{"id": "", "name": ": kan greA : : tet , greB : : amp", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": ": kan greA : : tet , greB : : amp", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE62102/GSE62102.soft.gz", "source": "GEO", "id": "GSM1519657", "field": "source_name", "associatedPhrase": "W3110 rpoC-6xHis : <Gtype> : kan greA : : tet , greB : : amp </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1519657", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25976475"}]}{"id": "", "name": "W3110 rpoC-6xHis : : kan greA : : tet , greB : : amp", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "W3110 rpoC-6xHis : : kan greA : : tet , greB : : amp", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE62102/GSE62102.soft.gz", "source": "GEO", "id": "GSM1519657", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> W3110 rpoC-6xHis : : kan greA : : tet , greB : : amp </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1519657", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "25976475"}]}{"id": "", "name": "O157 : H7 NCTC 12900", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "O157 : H7 NCTC 12900", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE62394/GSE62394.soft.gz", "source": "GEO", "id": "GSM1526511", "field": "characteristics", "associatedPhrase": "strain : <Gtype> O157 : H7 NCTC 12900 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1526511", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27578754"}]}{"id": "", "name": "O157 : H7 NCTC 12900", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "O157 : H7 NCTC 12900", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE62394/GSE62394.soft.gz", "source": "GEO", "id": "GSM1526512", "field": "characteristics", "associatedPhrase": "strain : <Gtype> O157 : H7 NCTC 12900 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1526512", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27578754"}]}{"id": "", "name": "sample type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "sample type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE63817/GSE63817.soft.gz", "source": "GEO", "id": "GSM1558079", "field": "characteristics", "associatedPhrase": "<Gtype> sample type </Gtype> : <Supp> ribosome protected </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1558079", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26495981"}]}{"id": "", "name": "ribosome protected", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ribosome protected", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE63817/GSE63817.soft.gz", "source": "GEO", "id": "GSM1558079", "field": "characteristics", "associatedPhrase": "<Gtype> sample type </Gtype> : <Supp> ribosome protected </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1558079", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26495981"}]}{"id": "", "name": "sample type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "sample type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE63817/GSE63817.soft.gz", "source": "GEO", "id": "GSM1558081", "field": "characteristics", "associatedPhrase": "<Gtype> sample type </Gtype> : <Supp> ribosome protected </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1558081", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26495981"}]}{"id": "", "name": "ribosome protected", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ribosome protected", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE63817/GSE63817.soft.gz", "source": "GEO", "id": "GSM1558081", "field": "characteristics", "associatedPhrase": "<Gtype> sample type </Gtype> : <Supp> ribosome protected </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1558081", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26495981"}]}{"id": "", "name": "sample type", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "sample type", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE63817/GSE63817.soft.gz", "source": "GEO", "id": "GSM1558086", "field": "characteristics", "associatedPhrase": "<Gtype> sample type </Gtype> : <Gtype> AT1 digested total RNA </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1558086", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26495981"}]}{"id": "", "name": "AT1 digested total RNA", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AT1 digested total RNA", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE63817/GSE63817.soft.gz", "source": "GEO", "id": "GSM1558086", "field": "characteristics", "associatedPhrase": "<Gtype> sample type </Gtype> : <Gtype> AT1 digested total RNA </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1558086", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26495981"}]}{"id": "", "name": "\u0394cra", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u0394cra", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz", "source": "GEO", "id": "GSM1602353", "field": "source_name", "associatedPhrase": "<Gtype> \u0394cra </Gtype> _ <Supp> glucose </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1602353", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29394395"}]}{"id": "", "name": "delta _ cra", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta _ cra", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz", "source": "GEO", "id": "GSM1602353", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> delta _ cra </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1602353", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29394395"}]}{"id": "", "name": "\u0394cra", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u0394cra", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz", "source": "GEO", "id": "GSM1602354", "field": "source_name", "associatedPhrase": "<Gtype> \u0394cra </Gtype> _ <Supp> glucose </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1602354", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29394395"}]}{"id": "", "name": "delta _ cra", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta _ cra", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz", "source": "GEO", "id": "GSM1602354", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> delta _ cra </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1602354", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29394395"}]}{"id": "", "name": "\u0394cra", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u0394cra", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz", "source": "GEO", "id": "GSM1602355", "field": "source_name", "associatedPhrase": "<Gtype> \u0394cra </Gtype> _ <Supp> fructose </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1602355", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29394395"}]}{"id": "", "name": "delta _ cra", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta _ cra", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz", "source": "GEO", "id": "GSM1602355", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> delta _ cra </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1602355", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29394395"}]}{"id": "", "name": "\u0394cra", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u0394cra", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz", "source": "GEO", "id": "GSM1602356", "field": "source_name", "associatedPhrase": "<Gtype> \u0394cra </Gtype> _ <Supp> fructose </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1602356", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29394395"}]}{"id": "", "name": "delta _ cra", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta _ cra", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz", "source": "GEO", "id": "GSM1602356", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> delta _ cra </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1602356", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29394395"}]}{"id": "", "name": "\u0394cra", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u0394cra", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz", "source": "GEO", "id": "GSM1602357", "field": "source_name", "associatedPhrase": "<Gtype> \u0394cra </Gtype> _ <Supp> acetate </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1602357", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29394395"}]}{"id": "", "name": "delta _ cra", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta _ cra", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz", "source": "GEO", "id": "GSM1602357", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> delta _ cra </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1602357", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29394395"}]}{"id": "", "name": "\u0394cra", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u0394cra", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz", "source": "GEO", "id": "GSM1602358", "field": "source_name", "associatedPhrase": "<Gtype> \u0394cra </Gtype> _ <Supp> acetate </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1602358", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29394395"}]}{"id": "", "name": "delta _ cra", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta _ cra", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz", "source": "GEO", "id": "GSM1602358", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> delta _ cra </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1602358", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29394395"}]}{"id": "", "name": "PQ", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "PQ", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603386", "field": "source_name", "associatedPhrase": "<Gtype> WT </Gtype> <Supp> PQ </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1603386", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "20 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "20 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603386", "field": "characteristics", "associatedPhrase": "treated with : <Supp> 250 uM of paraquat </Supp> at mid-log pahse for <Supp> 20 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1603386", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "PQ", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "PQ", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603387", "field": "source_name", "associatedPhrase": "<Gtype> WT </Gtype> <Supp> PQ </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1603387", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "20 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "20 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603387", "field": "characteristics", "associatedPhrase": "treated with : <Supp> 250 uM of paraquat </Supp> at mid-log pahse for <Supp> 20 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1603387", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "\u0394oxyR", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u0394oxyR", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603388", "field": "source_name", "associatedPhrase": "<Gtype> \u0394oxyR </Gtype> <Supp> PQ </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1603388", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "PQ", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "PQ", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603388", "field": "source_name", "associatedPhrase": "<Gtype> \u0394oxyR </Gtype> <Supp> PQ </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1603388", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "delta-oxyR", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta-oxyR", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603388", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> delta-oxyR </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1603388", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "20 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "20 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603388", "field": "characteristics", "associatedPhrase": "treated with : <Supp> 250 uM of paraquat </Supp> at mid-log pahse for <Supp> 20 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1603388", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "\u0394oxyR", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u0394oxyR", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603389", "field": "source_name", "associatedPhrase": "<Gtype> \u0394oxyR </Gtype> <Supp> PQ </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1603389", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "PQ", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "PQ", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603389", "field": "source_name", "associatedPhrase": "<Gtype> \u0394oxyR </Gtype> <Supp> PQ </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1603389", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "delta-oxyR", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta-oxyR", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603389", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> delta-oxyR </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1603389", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "20 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "20 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603389", "field": "characteristics", "associatedPhrase": "treated with : <Supp> 250 uM of paraquat </Supp> at mid-log pahse for <Supp> 20 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1603389", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "\u0394soxR", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u0394soxR", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603391", "field": "source_name", "associatedPhrase": "<Gtype> \u0394soxR </Gtype> <Supp> PQ </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1603391", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "PQ", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "PQ", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603391", "field": "source_name", "associatedPhrase": "<Gtype> \u0394soxR </Gtype> <Supp> PQ </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1603391", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "delta-soxR", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta-soxR", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603391", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> delta-soxR </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1603391", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "20 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "20 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603391", "field": "characteristics", "associatedPhrase": "treated with : <Supp> 250 uM of paraquat </Supp> at mid-log pahse for <Supp> 20 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1603391", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "\u0394soxS", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u0394soxS", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603392", "field": "source_name", "associatedPhrase": "<Gtype> \u0394soxS </Gtype> <Supp> PQ </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1603392", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "PQ", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "PQ", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603392", "field": "source_name", "associatedPhrase": "<Gtype> \u0394soxS </Gtype> <Supp> PQ </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1603392", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "delta-soxS", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta-soxS", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603392", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> delta-soxS </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1603392", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "20 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "20 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603392", "field": "characteristics", "associatedPhrase": "treated with : <Supp> 250 uM of paraquat </Supp> at mid-log pahse for <Supp> 20 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1603392", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "\u0394soxS", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u0394soxS", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603393", "field": "source_name", "associatedPhrase": "<Gtype> \u0394soxS </Gtype> <Supp> PQ </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1603393", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "PQ", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "PQ", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603393", "field": "source_name", "associatedPhrase": "<Gtype> \u0394soxS </Gtype> <Supp> PQ </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1603393", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "delta-soxS", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta-soxS", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603393", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> delta-soxS </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1603393", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "20 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "20 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz", "source": "GEO", "id": "GSM1603393", "field": "characteristics", "associatedPhrase": "treated with : <Supp> 250 uM of paraquat </Supp> at mid-log pahse for <Supp> 20 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1603393", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26279566"}]}{"id": "", "name": "pH5 .5", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "pH5 .5", "term_id": "", "term_type": "pH", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz", "source": "GEO", "id": "GSM1623160", "field": "source_name", "associatedPhrase": "<Gtype> WT </Gtype> <pH> pH5 .5 </pH> "}], "externalCrossReferences": [{"objectId": "GSM1623160", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26258987"}]}{"id": "", "name": "pH5 .5", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "pH5 .5", "term_id": "", "term_type": "pH", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz", "source": "GEO", "id": "GSM1623161", "field": "source_name", "associatedPhrase": "<Gtype> WT </Gtype> <pH> pH5 .5 </pH> "}], "externalCrossReferences": [{"objectId": "GSM1623161", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26258987"}]}{"id": "", "name": "\u0394gadE", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u0394gadE", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz", "source": "GEO", "id": "GSM1623162", "field": "source_name", "associatedPhrase": "<Gtype> \u0394gadE </Gtype> <pH> pH5 .5 </pH> "}], "externalCrossReferences": [{"objectId": "GSM1623162", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26258987"}]}{"id": "", "name": "pH5 .5", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "pH5 .5", "term_id": "", "term_type": "pH", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz", "source": "GEO", "id": "GSM1623162", "field": "source_name", "associatedPhrase": "<Gtype> \u0394gadE </Gtype> <pH> pH5 .5 </pH> "}], "externalCrossReferences": [{"objectId": "GSM1623162", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26258987"}]}{"id": "", "name": "delta-gadE", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta-gadE", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz", "source": "GEO", "id": "GSM1623162", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> delta-gadE </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1623162", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26258987"}]}{"id": "", "name": "\u0394gadE", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u0394gadE", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz", "source": "GEO", "id": "GSM1623163", "field": "source_name", "associatedPhrase": "<Gtype> \u0394gadE </Gtype> <pH> pH5 .5 </pH> "}], "externalCrossReferences": [{"objectId": "GSM1623163", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26258987"}]}{"id": "", "name": "pH5 .5", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "pH5 .5", "term_id": "", "term_type": "pH", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz", "source": "GEO", "id": "GSM1623163", "field": "source_name", "associatedPhrase": "<Gtype> \u0394gadE </Gtype> <pH> pH5 .5 </pH> "}], "externalCrossReferences": [{"objectId": "GSM1623163", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26258987"}]}{"id": "", "name": "delta-gadE", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta-gadE", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz", "source": "GEO", "id": "GSM1623163", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> delta-gadE </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1623163", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26258987"}]}{"id": "", "name": "\u0394gadW", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u0394gadW", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz", "source": "GEO", "id": "GSM1623164", "field": "source_name", "associatedPhrase": "<Gtype> \u0394gadW </Gtype> <pH> pH5 .5 </pH> "}], "externalCrossReferences": [{"objectId": "GSM1623164", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26258987"}]}{"id": "", "name": "pH5 .5", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "pH5 .5", "term_id": "", "term_type": "pH", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz", "source": "GEO", "id": "GSM1623164", "field": "source_name", "associatedPhrase": "<Gtype> \u0394gadW </Gtype> <pH> pH5 .5 </pH> "}], "externalCrossReferences": [{"objectId": "GSM1623164", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26258987"}]}{"id": "", "name": "delta-gadW", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta-gadW", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz", "source": "GEO", "id": "GSM1623164", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> delta-gadW </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1623164", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26258987"}]}{"id": "", "name": "\u0394gadW", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u0394gadW", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz", "source": "GEO", "id": "GSM1623165", "field": "source_name", "associatedPhrase": "<Gtype> \u0394gadW </Gtype> <pH> pH5 .5 </pH> "}], "externalCrossReferences": [{"objectId": "GSM1623165", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26258987"}]}{"id": "", "name": "pH5 .5", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "pH5 .5", "term_id": "", "term_type": "pH", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz", "source": "GEO", "id": "GSM1623165", "field": "source_name", "associatedPhrase": "<Gtype> \u0394gadW </Gtype> <pH> pH5 .5 </pH> "}], "externalCrossReferences": [{"objectId": "GSM1623165", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26258987"}]}{"id": "", "name": "delta-gadW", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta-gadW", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz", "source": "GEO", "id": "GSM1623165", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> delta-gadW </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1623165", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26258987"}]}{"id": "", "name": "\u0394gadX", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u0394gadX", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz", "source": "GEO", "id": "GSM1623166", "field": "source_name", "associatedPhrase": "<Gtype> \u0394gadX </Gtype> <pH> pH5 .5 </pH> "}], "externalCrossReferences": [{"objectId": "GSM1623166", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26258987"}]}{"id": "", "name": "pH5 .5", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "pH5 .5", "term_id": "", "term_type": "pH", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz", "source": "GEO", "id": "GSM1623166", "field": "source_name", "associatedPhrase": "<Gtype> \u0394gadX </Gtype> <pH> pH5 .5 </pH> "}], "externalCrossReferences": [{"objectId": "GSM1623166", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26258987"}]}{"id": "", "name": "delta-gadX", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta-gadX", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz", "source": "GEO", "id": "GSM1623166", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> delta-gadX </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1623166", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26258987"}]}{"id": "", "name": "\u0394gadX", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "\u0394gadX", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz", "source": "GEO", "id": "GSM1623167", "field": "source_name", "associatedPhrase": "<Gtype> \u0394gadX </Gtype> <pH> pH5 .5 </pH> "}], "externalCrossReferences": [{"objectId": "GSM1623167", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26258987"}]}{"id": "", "name": "pH5 .5", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "pH5 .5", "term_id": "", "term_type": "pH", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz", "source": "GEO", "id": "GSM1623167", "field": "source_name", "associatedPhrase": "<Gtype> \u0394gadX </Gtype> <pH> pH5 .5 </pH> "}], "externalCrossReferences": [{"objectId": "GSM1623167", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26258987"}]}{"id": "", "name": "delta-gadX", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta-gadX", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz", "source": "GEO", "id": "GSM1623167", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> delta-gadX </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1623167", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26258987"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz", "source": "GEO", "id": "GSM1642593", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1642593", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz", "source": "GEO", "id": "GSM1642593", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1642593", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz", "source": "GEO", "id": "GSM1642593", "field": "source_name", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1642593", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz", "source": "GEO", "id": "GSM1642593", "field": "source_name", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1642593", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz", "source": "GEO", "id": "GSM1642593", "field": "characteristics", "associatedPhrase": "<Gtype> cell type </Gtype> : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1642593", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz", "source": "GEO", "id": "GSM1642593", "field": "characteristics", "associatedPhrase": "<Gtype> cell type </Gtype> : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1642593", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz", "source": "GEO", "id": "GSM1642594", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1642594", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz", "source": "GEO", "id": "GSM1642594", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1642594", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz", "source": "GEO", "id": "GSM1642594", "field": "source_name", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1642594", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz", "source": "GEO", "id": "GSM1642594", "field": "source_name", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1642594", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz", "source": "GEO", "id": "GSM1642594", "field": "characteristics", "associatedPhrase": "<Gtype> cell type </Gtype> : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1642594", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz", "source": "GEO", "id": "GSM1642594", "field": "characteristics", "associatedPhrase": "<Gtype> cell type </Gtype> : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1642594", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "3 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "3 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646283", "field": "characteristics", "associatedPhrase": "time point : <Supp> 3 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646283", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "4 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "4 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646284", "field": "characteristics", "associatedPhrase": "time point : <Supp> 4 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646284", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "5 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "5 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646285", "field": "characteristics", "associatedPhrase": "time point : <Supp> 5 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646285", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "8 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "8 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646287", "field": "characteristics", "associatedPhrase": "time point : <Supp> 8 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646287", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "24 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "24 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646288", "field": "characteristics", "associatedPhrase": "time point : <Supp> 24 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646288", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "48 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "48 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646289", "field": "characteristics", "associatedPhrase": "time point : <Supp> 48 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646289", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "168 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "168 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646290", "field": "characteristics", "associatedPhrase": "time point : <Supp> 168 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646290", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "336 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "336 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646291", "field": "characteristics", "associatedPhrase": "time point : <Supp> 336 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646291", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "3 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "3 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646292", "field": "characteristics", "associatedPhrase": "time point : <Supp> 3 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646292", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "4 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "4 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646293", "field": "characteristics", "associatedPhrase": "time point : <Supp> 4 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646293", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "5 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "5 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646294", "field": "characteristics", "associatedPhrase": "time point : <Supp> 5 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646294", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "6 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "6 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646295", "field": "characteristics", "associatedPhrase": "time point : <Supp> 6 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646295", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "8 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "8 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646296", "field": "characteristics", "associatedPhrase": "time point : <Supp> 8 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646296", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "24 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "24 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646297", "field": "characteristics", "associatedPhrase": "time point : <Supp> 24 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646297", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "48 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "48 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646298", "field": "characteristics", "associatedPhrase": "time point : <Supp> 48 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646298", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "336 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "336 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646300", "field": "characteristics", "associatedPhrase": "time point : <Supp> 336 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646300", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "3 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "3 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646301", "field": "characteristics", "associatedPhrase": "time point : <Supp> 3 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646301", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "4 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "4 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646302", "field": "characteristics", "associatedPhrase": "time point : <Supp> 4 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646302", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "5 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "5 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646303", "field": "characteristics", "associatedPhrase": "time point : <Supp> 5 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646303", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "6 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "6 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646304", "field": "characteristics", "associatedPhrase": "time point : <Supp> 6 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646304", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "8 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "8 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646305", "field": "characteristics", "associatedPhrase": "time point : <Supp> 8 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646305", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "24 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "24 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646306", "field": "characteristics", "associatedPhrase": "time point : <Supp> 24 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646306", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "48 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "48 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646307", "field": "characteristics", "associatedPhrase": "time point : <Supp> 48 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646307", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "168 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "168 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646308", "field": "characteristics", "associatedPhrase": "time point : <Supp> 168 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646308", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "336 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "336 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646309", "field": "characteristics", "associatedPhrase": "time point : <Supp> 336 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646309", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "3 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "3 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646310", "field": "characteristics", "associatedPhrase": "time point : <Supp> 3 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646310", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "4 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "4 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646311", "field": "characteristics", "associatedPhrase": "time point : <Supp> 4 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646311", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "5 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "5 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646312", "field": "characteristics", "associatedPhrase": "time point : <Supp> 5 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646312", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "6 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "6 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646313", "field": "characteristics", "associatedPhrase": "time point : <Supp> 6 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646313", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "8 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "8 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646314", "field": "characteristics", "associatedPhrase": "time point : <Supp> 8 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646314", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "24 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "24 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646315", "field": "characteristics", "associatedPhrase": "time point : <Supp> 24 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646315", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "48 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "48 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646316", "field": "characteristics", "associatedPhrase": "time point : <Supp> 48 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646316", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "168 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "168 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646317", "field": "characteristics", "associatedPhrase": "time point : <Supp> 168 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646317", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "336 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "336 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz", "source": "GEO", "id": "GSM1646318", "field": "characteristics", "associatedPhrase": "time point : <Supp> 336 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1646318", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "26275208"}]}{"id": "", "name": "0 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz", "source": "GEO", "id": "GSM1838496", "field": "characteristics", "associatedPhrase": "time : <Supp> 0 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1838496", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "273849562826451232246034"}]}{"id": "", "name": "0.5 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.5 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz", "source": "GEO", "id": "GSM1838497", "field": "characteristics", "associatedPhrase": "time : <Supp> 0.5 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1838497", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "273849562826451232246034"}]}{"id": "", "name": "1 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "1 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz", "source": "GEO", "id": "GSM1838498", "field": "characteristics", "associatedPhrase": "time : <Supp> 1 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1838498", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "273849562826451232246034"}]}{"id": "", "name": "2 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "2 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz", "source": "GEO", "id": "GSM1838499", "field": "characteristics", "associatedPhrase": "time : <Supp> 2 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1838499", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "273849562826451232246034"}]}{"id": "", "name": "5 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "5 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz", "source": "GEO", "id": "GSM1838500", "field": "characteristics", "associatedPhrase": "time : <Supp> 5 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1838500", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "273849562826451232246034"}]}{"id": "", "name": "10 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "10 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz", "source": "GEO", "id": "GSM1838501", "field": "characteristics", "associatedPhrase": "time : <Supp> 10 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1838501", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "273849562826451232246034"}]}{"id": "", "name": "0 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz", "source": "GEO", "id": "GSM1838502", "field": "characteristics", "associatedPhrase": "time : <Supp> 0 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1838502", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "273849562826451232246034"}]}{"id": "", "name": "0.5 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.5 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz", "source": "GEO", "id": "GSM1838503", "field": "characteristics", "associatedPhrase": "time : <Supp> 0.5 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1838503", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "273849562826451232246034"}]}{"id": "", "name": "5 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "5 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz", "source": "GEO", "id": "GSM1838506", "field": "characteristics", "associatedPhrase": "time : <Supp> 5 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1838506", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "273849562826451232246034"}]}{"id": "", "name": "10 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "10 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz", "source": "GEO", "id": "GSM1838507", "field": "characteristics", "associatedPhrase": "time : <Supp> 10 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1838507", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "273849562826451232246034"}]}{"id": "", "name": "0 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz", "source": "GEO", "id": "GSM1838508", "field": "characteristics", "associatedPhrase": "time : <Supp> 0 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1838508", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "273849562826451232246034"}]}{"id": "", "name": "0.5 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0.5 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz", "source": "GEO", "id": "GSM1838509", "field": "characteristics", "associatedPhrase": "time : <Supp> 0.5 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1838509", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "273849562826451232246034"}]}{"id": "", "name": "1 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "1 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz", "source": "GEO", "id": "GSM1838510", "field": "characteristics", "associatedPhrase": "time : <Supp> 1 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1838510", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "273849562826451232246034"}]}{"id": "", "name": "2 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "2 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz", "source": "GEO", "id": "GSM1838511", "field": "characteristics", "associatedPhrase": "time : <Supp> 2 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1838511", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "273849562826451232246034"}]}{"id": "", "name": "5 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "5 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz", "source": "GEO", "id": "GSM1838512", "field": "characteristics", "associatedPhrase": "time : <Supp> 5 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1838512", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "273849562826451232246034"}]}{"id": "", "name": "10 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "10 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz", "source": "GEO", "id": "GSM1838513", "field": "characteristics", "associatedPhrase": "time : <Supp> 10 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1838513", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "273849562826451232246034"}]}{"id": "", "name": "-LCB- delta -RCB- hns", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- hns", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE73969/GSE73969.soft.gz", "source": "GEO", "id": "GSM1906889", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- hns </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1906889", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2717363528288207"}]}{"id": "", "name": "-LCB- delta -RCB- hns", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- hns", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE73969/GSE73969.soft.gz", "source": "GEO", "id": "GSM1906890", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> -LCB- delta -RCB- hns </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM1906890", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2717363528288207"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE74809/GSE74809.soft.gz", "source": "GEO", "id": "GSM1933982", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1933982", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29686109"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE74809/GSE74809.soft.gz", "source": "GEO", "id": "GSM1933982", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1933982", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29686109"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE74809/GSE74809.soft.gz", "source": "GEO", "id": "GSM1933999", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1933999", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29686109"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE74809/GSE74809.soft.gz", "source": "GEO", "id": "GSM1933999", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM1933999", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29686109"}]}{"id": "", "name": "0 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968346", "field": "characteristics", "associatedPhrase": "time point : <Supp> 0 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968346", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "2 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "2 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968347", "field": "characteristics", "associatedPhrase": "time point : <Supp> 2 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968347", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "4 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "4 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968348", "field": "characteristics", "associatedPhrase": "time point : <Supp> 4 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968348", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "6 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "6 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968349", "field": "characteristics", "associatedPhrase": "time point : <Supp> 6 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968349", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "8 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "8 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968350", "field": "characteristics", "associatedPhrase": "time point : <Supp> 8 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968350", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "10 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "10 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968351", "field": "characteristics", "associatedPhrase": "time point : <Supp> 10 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968351", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "15 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "15 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968352", "field": "characteristics", "associatedPhrase": "time point : <Supp> 15 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968352", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "20 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "20 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968353", "field": "characteristics", "associatedPhrase": "time point : <Supp> 20 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968353", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "0 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968354", "field": "characteristics", "associatedPhrase": "time point : <Supp> 0 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968354", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "2 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "2 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968355", "field": "characteristics", "associatedPhrase": "time point : <Supp> 2 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968355", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "4 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "4 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968356", "field": "characteristics", "associatedPhrase": "time point : <Supp> 4 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968356", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "6 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "6 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968357", "field": "characteristics", "associatedPhrase": "time point : <Supp> 6 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968357", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "8 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "8 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968358", "field": "characteristics", "associatedPhrase": "time point : <Supp> 8 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968358", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "10 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "10 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968359", "field": "characteristics", "associatedPhrase": "time point : <Supp> 10 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968359", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "15 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "15 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968360", "field": "characteristics", "associatedPhrase": "time point : <Supp> 15 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968360", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "20 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "20 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968361", "field": "characteristics", "associatedPhrase": "time point : <Supp> 20 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968361", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "0 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968362", "field": "characteristics", "associatedPhrase": "time point : <Supp> 0 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968362", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "4 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "4 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968364", "field": "characteristics", "associatedPhrase": "time point : <Supp> 4 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968364", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "15 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "15 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968368", "field": "characteristics", "associatedPhrase": "time point : <Supp> 15 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968368", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "20 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "20 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968369", "field": "characteristics", "associatedPhrase": "time point : <Supp> 20 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968369", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "0 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968370", "field": "characteristics", "associatedPhrase": "time point : <Supp> 0 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968370", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "2 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "2 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968371", "field": "characteristics", "associatedPhrase": "time point : <Supp> 2 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968371", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "4 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "4 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968372", "field": "characteristics", "associatedPhrase": "time point : <Supp> 4 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968372", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "8 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "8 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968374", "field": "characteristics", "associatedPhrase": "time point : <Supp> 8 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968374", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "20 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "20 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968377", "field": "characteristics", "associatedPhrase": "time point : <Supp> 20 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968377", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "0 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968378", "field": "characteristics", "associatedPhrase": "time point : <Supp> 0 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968378", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "2 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "2 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968379", "field": "characteristics", "associatedPhrase": "time point : <Supp> 2 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968379", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "4 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "4 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968380", "field": "characteristics", "associatedPhrase": "time point : <Supp> 4 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968380", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "6 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "6 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968381", "field": "characteristics", "associatedPhrase": "time point : <Supp> 6 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968381", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "8 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "8 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968382", "field": "characteristics", "associatedPhrase": "time point : <Supp> 8 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968382", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "10 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "10 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968383", "field": "characteristics", "associatedPhrase": "time point : <Supp> 10 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968383", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "15 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "15 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968384", "field": "characteristics", "associatedPhrase": "time point : <Supp> 15 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968384", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "20 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "20 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968385", "field": "characteristics", "associatedPhrase": "time point : <Supp> 20 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968385", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "0 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968386", "field": "characteristics", "associatedPhrase": "time point : <Supp> 0 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968386", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "2 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "2 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968387", "field": "characteristics", "associatedPhrase": "time point : <Supp> 2 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968387", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "4 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "4 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968388", "field": "characteristics", "associatedPhrase": "time point : <Supp> 4 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968388", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "6 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "6 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968389", "field": "characteristics", "associatedPhrase": "time point : <Supp> 6 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968389", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "8 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "8 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968390", "field": "characteristics", "associatedPhrase": "time point : <Supp> 8 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968390", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "10 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "10 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968391", "field": "characteristics", "associatedPhrase": "time point : <Supp> 10 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968391", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "15 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "15 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968392", "field": "characteristics", "associatedPhrase": "time point : <Supp> 15 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968392", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "20 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "20 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968393", "field": "characteristics", "associatedPhrase": "time point : <Supp> 20 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968393", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "0 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968394", "field": "characteristics", "associatedPhrase": "time point : <Supp> 0 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968394", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "1 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "1 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968395", "field": "characteristics", "associatedPhrase": "time point : <Supp> 1 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968395", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "2 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "2 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968396", "field": "characteristics", "associatedPhrase": "time point : <Supp> 2 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968396", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "4 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "4 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968397", "field": "characteristics", "associatedPhrase": "time point : <Supp> 4 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968397", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "6 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "6 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968398", "field": "characteristics", "associatedPhrase": "time point : <Supp> 6 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968398", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "8 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "8 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968399", "field": "characteristics", "associatedPhrase": "time point : <Supp> 8 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968399", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "10 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "10 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968400", "field": "characteristics", "associatedPhrase": "time point : <Supp> 10 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968400", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "15 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "15 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968401", "field": "characteristics", "associatedPhrase": "time point : <Supp> 15 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968401", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "0 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968402", "field": "characteristics", "associatedPhrase": "time point : <Supp> 0 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968402", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "1 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "1 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968403", "field": "characteristics", "associatedPhrase": "time point : <Supp> 1 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968403", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "2 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "2 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968404", "field": "characteristics", "associatedPhrase": "time point : <Supp> 2 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968404", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "4 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "4 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968405", "field": "characteristics", "associatedPhrase": "time point : <Supp> 4 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968405", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "6 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "6 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968406", "field": "characteristics", "associatedPhrase": "time point : <Supp> 6 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968406", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "8 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "8 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968407", "field": "characteristics", "associatedPhrase": "time point : <Supp> 8 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968407", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "10 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "10 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968408", "field": "characteristics", "associatedPhrase": "time point : <Supp> 10 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968408", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "15 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "15 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968409", "field": "characteristics", "associatedPhrase": "time point : <Supp> 15 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968409", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "0 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968410", "field": "characteristics", "associatedPhrase": "time point : <Supp> 0 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968410", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "1 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "1 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968411", "field": "characteristics", "associatedPhrase": "time point : <Supp> 1 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968411", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "2 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "2 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968412", "field": "characteristics", "associatedPhrase": "time point : <Supp> 2 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968412", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "4 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "4 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968413", "field": "characteristics", "associatedPhrase": "time point : <Supp> 4 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968413", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "6 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "6 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968414", "field": "characteristics", "associatedPhrase": "time point : <Supp> 6 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968414", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "8 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "8 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968415", "field": "characteristics", "associatedPhrase": "time point : <Supp> 8 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968415", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "10 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "10 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968416", "field": "characteristics", "associatedPhrase": "time point : <Supp> 10 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968416", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "15 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "15 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968417", "field": "characteristics", "associatedPhrase": "time point : <Supp> 15 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968417", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "0 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968418", "field": "characteristics", "associatedPhrase": "time point : <Supp> 0 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968418", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "1 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "1 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968419", "field": "characteristics", "associatedPhrase": "time point : <Supp> 1 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968419", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "2 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "2 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968420", "field": "characteristics", "associatedPhrase": "time point : <Supp> 2 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968420", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "4 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "4 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968421", "field": "characteristics", "associatedPhrase": "time point : <Supp> 4 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968421", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "6 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "6 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968422", "field": "characteristics", "associatedPhrase": "time point : <Supp> 6 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968422", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "8 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "8 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968423", "field": "characteristics", "associatedPhrase": "time point : <Supp> 8 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968423", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "10 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "10 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968424", "field": "characteristics", "associatedPhrase": "time point : <Supp> 10 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968424", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "15 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "15 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968425", "field": "characteristics", "associatedPhrase": "time point : <Supp> 15 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968425", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "0 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968426", "field": "characteristics", "associatedPhrase": "time point : <Supp> 0 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968426", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "1 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "1 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968427", "field": "characteristics", "associatedPhrase": "time point : <Supp> 1 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968427", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "2 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "2 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968428", "field": "characteristics", "associatedPhrase": "time point : <Supp> 2 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968428", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "4 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "4 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968429", "field": "characteristics", "associatedPhrase": "time point : <Supp> 4 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968429", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "6 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "6 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968430", "field": "characteristics", "associatedPhrase": "time point : <Supp> 6 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968430", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "8 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "8 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968431", "field": "characteristics", "associatedPhrase": "time point : <Supp> 8 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968431", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "10 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "10 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968432", "field": "characteristics", "associatedPhrase": "time point : <Supp> 10 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968432", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "15 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "15 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz", "source": "GEO", "id": "GSM1968433", "field": "characteristics", "associatedPhrase": "time point : <Supp> 15 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM1968433", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27198188"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040687", "field": "data_processing", "associatedPhrase": "The program Rockhopper ( described in Mc Clure , et al. . Nucleic Acids Research . 2013 , 41 ( 14 ) ) was used for alignment , normalization , and quantification . Genome _ builg : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2040687", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040687", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2040687", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040687", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2040687", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040687", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2040687", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "delta dicF , lacIq", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta dicF , lacIq", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040687", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> delta dicF , lacIq </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2040687", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "vector control", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "vector control", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040687", "field": "characteristics", "associatedPhrase": "protocol : <Gtype> vector control </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2040687", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040688", "field": "data_processing", "associatedPhrase": "The program Rockhopper ( described in Mc Clure , et al. . Nucleic Acids Research . 2013 , 41 ( 14 ) ) was used for alignment , normalization , and quantification . Genome _ builg : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2040688", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040688", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2040688", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040688", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2040688", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040688", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2040688", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "delta dicF , lacIq", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta dicF , lacIq", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040688", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> delta dicF , lacIq </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2040688", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "vector control", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "vector control", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040688", "field": "characteristics", "associatedPhrase": "protocol : <Gtype> vector control </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2040688", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040689", "field": "data_processing", "associatedPhrase": "The program Rockhopper ( described in Mc Clure , et al. . Nucleic Acids Research . 2013 , 41 ( 14 ) ) was used for alignment , normalization , and quantification . Genome _ builg : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2040689", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040689", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2040689", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040689", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2040689", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040689", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2040689", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "delta dicF , lacIq", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta dicF , lacIq", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040689", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> delta dicF , lacIq </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2040689", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "vector control", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "vector control", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040689", "field": "characteristics", "associatedPhrase": "protocol : <Gtype> vector control </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2040689", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040690", "field": "data_processing", "associatedPhrase": "The program Rockhopper ( described in Mc Clure , et al. . Nucleic Acids Research . 2013 , 41 ( 14 ) ) was used for alignment , normalization , and quantification . Genome _ builg : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2040690", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040690", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2040690", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040690", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2040690", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040690", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2040690", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "delta dicF , lacIq", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta dicF , lacIq", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040690", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> delta dicF , lacIq </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2040690", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040691", "field": "data_processing", "associatedPhrase": "The program Rockhopper ( described in Mc Clure , et al. . Nucleic Acids Research . 2013 , 41 ( 14 ) ) was used for alignment , normalization , and quantification . Genome _ builg : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2040691", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040691", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2040691", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040691", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2040691", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040691", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2040691", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "delta dicF , lacIq", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta dicF , lacIq", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040691", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> delta dicF , lacIq </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2040691", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040692", "field": "data_processing", "associatedPhrase": "The program Rockhopper ( described in Mc Clure , et al. . Nucleic Acids Research . 2013 , 41 ( 14 ) ) was used for alignment , normalization , and quantification . Genome _ builg : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2040692", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040692", "field": "data_processing", "associatedPhrase": "Genome _ build : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2040692", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040692", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2040692", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040692", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2040692", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "delta dicF , lacIq", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "delta dicF , lacIq", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz", "source": "GEO", "id": "GSM2040692", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> delta dicF , lacIq </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2040692", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE77617/GSE77617.soft.gz", "source": "GEO", "id": "GSM2462936", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2462936", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28139975"}]}{"id": "", "name": "fresh media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "fresh media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE77617/GSE77617.soft.gz", "source": "GEO", "id": "GSM2462936", "field": "growth_protocol", "associatedPhrase": "All cultures were based on MOPS media with <Supp> 0.2 % glucose </Supp> ( Teknova ) , with full supplement ( Neidhardt et al. , 1974 ) minus methionine . An overnight liquid culture was diluted 400-fold into 200 ml <Med> fresh media </Med> . The culture was kept in a 1 liter flask at <Temp> 37 \u00b0C </Temp> with aeration until OD420 reached 0.4 . "}], "externalCrossReferences": [{"objectId": "GSM2462936", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28139975"}]}{"id": "", "name": "fresh media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "fresh media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE77617/GSE77617.soft.gz", "source": "GEO", "id": "GSM2462936", "field": "growth_protocol", "associatedPhrase": "All cultures were based on MOPS media with <Supp> 0.2 % glucose </Supp> ( Teknova ) , with full supplement ( Neidhardt et al. , 1974 ) minus methionine . An overnight liquid culture was diluted 400-fold into 200 ml <Med> fresh media </Med> . The culture was kept in a 1 liter flask at <Temp> 37 \u00b0C </Temp> with aeration until OD420 reached 0.4 . "}], "externalCrossReferences": [{"objectId": "GSM2462936", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28139975"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE77617/GSE77617.soft.gz", "source": "GEO", "id": "GSM2462937", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2462937", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28139975"}]}{"id": "", "name": "fresh media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "fresh media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE77617/GSE77617.soft.gz", "source": "GEO", "id": "GSM2462937", "field": "growth_protocol", "associatedPhrase": "All cultures were based on MOPS media with <Supp> 0.2 % glucose </Supp> ( Teknova ) , with full supplement ( Neidhardt et al. , 1974 ) minus methionine . An overnight liquid culture was diluted 400-fold into 200 ml <Med> fresh media </Med> . The culture was kept in a 1 liter flask at <Temp> 37 \u00b0C </Temp> with aeration until OD420 reached 0.4 . "}], "externalCrossReferences": [{"objectId": "GSM2462937", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28139975"}]}{"id": "", "name": "fresh media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "fresh media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE77617/GSE77617.soft.gz", "source": "GEO", "id": "GSM2462937", "field": "growth_protocol", "associatedPhrase": "All cultures were based on MOPS media with <Supp> 0.2 % glucose </Supp> ( Teknova ) , with full supplement ( Neidhardt et al. , 1974 ) minus methionine . An overnight liquid culture was diluted 400-fold into 200 ml <Med> fresh media </Med> . The culture was kept in a 1 liter flask at <Temp> 37 \u00b0C </Temp> with aeration until OD420 reached 0.4 . "}], "externalCrossReferences": [{"objectId": "GSM2462937", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28139975"}]}{"id": "", "name": "NC000913 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "NC000913 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE77617/GSE77617.soft.gz", "source": "GEO", "id": "GSM2462938", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> NC000913 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2462938", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28139975"}]}{"id": "", "name": "fresh media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "fresh media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE77617/GSE77617.soft.gz", "source": "GEO", "id": "GSM2462938", "field": "growth_protocol", "associatedPhrase": "All cultures were based on MOPS media with <Supp> 0.2 % glucose </Supp> ( Teknova ) , with full supplement ( Neidhardt et al. , 1974 ) minus methionine . An overnight liquid culture was diluted 400-fold into 200 ml <Med> fresh media </Med> . The culture was kept in a 1 liter flask at <Temp> 37 \u00b0C </Temp> with aeration until OD420 reached 0.4 . "}], "externalCrossReferences": [{"objectId": "GSM2462938", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28139975"}]}{"id": "", "name": "fresh media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "fresh media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE77617/GSE77617.soft.gz", "source": "GEO", "id": "GSM2462938", "field": "growth_protocol", "associatedPhrase": "All cultures were based on MOPS media with <Supp> 0.2 % glucose </Supp> ( Teknova ) , with full supplement ( Neidhardt et al. , 1974 ) minus methionine . An overnight liquid culture was diluted 400-fold into 200 ml <Med> fresh media </Med> . The culture was kept in a 1 liter flask at <Temp> 37 \u00b0C </Temp> with aeration until OD420 reached 0.4 . "}], "externalCrossReferences": [{"objectId": "GSM2462938", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28139975"}]}{"id": "", "name": "glucose-M9 minimal media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "glucose-M9 minimal media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE78756/GSE78756.soft.gz", "source": "GEO", "id": "GSM2075722", "field": "growth_protocol", "associatedPhrase": "Escherichia coli strains E.coli C ( DSMZ 4860 ) , E. coli Crooks ( DSMZ 1576 ) , E. coli DH5\u03b1 ( DSMZ 6897 ) E. coli W ( DSMZ 1116 ) , E. coli W3110 ( DSMZ 5911 ) were obtained from DSMZ-German Collection of Microorganism and Cell Cultures ; E. coli BL21 ( DE3 ) was purchased as competent cells from Agilent ( Agilent Technologies Inc. , USA ) , E. coli K-12 MG1655 ( ATCC 700926 ) . All strains were cultured in <Med> M9 minimal medium </Med> ( 1 ) containing Na2HPO4 x 7H2O ( 6.8 g ) , KH2PO4 ( 3 g ) , NaCl ( 0.5 g ) , NH4Cl ( 1 g ) , MgSO4 ( 2 mmol ) , CaCl2 ( 0.1 mmol ) , trace elements , Wolf 's vitamin solution ( 2 ) and glucose ( 2 g L-1 ) . Anoxic <Med> M9 minimal media </Med> with <Supp> glucose </Supp> was obtained by flushing solution with oxygen free nitrogen ( 95 % ) . Overnight cultures from single colonies of each of seven E. coli strains were diluted to a starting optical density ( OD600 ) of 0.01 . Cultures were grown in 250 ml flasks or 300 ml oxygen-free sealed bottles containing 50 ml <Med> glucose-M9 minimal media </Med> in a shaking incubator at <Temp> 37 \u00b0C </Temp> and <Agit> 250 rpm </Agit> . "}], "externalCrossReferences": [{"objectId": "GSM2075722", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27667363"}]}{"id": "", "name": "glucose-M9 minimal media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "glucose-M9 minimal media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE78756/GSE78756.soft.gz", "source": "GEO", "id": "GSM2075723", "field": "growth_protocol", "associatedPhrase": "Escherichia coli strains E.coli C ( DSMZ 4860 ) , E. coli Crooks ( DSMZ 1576 ) , E. coli DH5\u03b1 ( DSMZ 6897 ) E. coli W ( DSMZ 1116 ) , E. coli W3110 ( DSMZ 5911 ) were obtained from DSMZ-German Collection of Microorganism and Cell Cultures ; E. coli BL21 ( DE3 ) was purchased as competent cells from Agilent ( Agilent Technologies Inc. , USA ) , E. coli K-12 MG1655 ( ATCC 700926 ) . All strains were cultured in <Med> M9 minimal medium </Med> ( 1 ) containing Na2HPO4 x 7H2O ( 6.8 g ) , KH2PO4 ( 3 g ) , NaCl ( 0.5 g ) , NH4Cl ( 1 g ) , MgSO4 ( 2 mmol ) , CaCl2 ( 0.1 mmol ) , trace elements , Wolf 's vitamin solution ( 2 ) and glucose ( 2 g L-1 ) . Anoxic <Med> M9 minimal media </Med> with <Supp> glucose </Supp> was obtained by flushing solution with oxygen free nitrogen ( 95 % ) . Overnight cultures from single colonies of each of seven E. coli strains were diluted to a starting optical density ( OD600 ) of 0.01 . Cultures were grown in 250 ml flasks or 300 ml oxygen-free sealed bottles containing 50 ml <Med> glucose-M9 minimal media </Med> in a shaking incubator at <Temp> 37 \u00b0C </Temp> and <Agit> 250 rpm </Agit> . "}], "externalCrossReferences": [{"objectId": "GSM2075723", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27667363"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz", "source": "GEO", "id": "GSM2122743", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NCBI Reference Sequence : <Supp> NC </Supp> _ 000913.3 "}], "externalCrossReferences": [{"objectId": "GSM2122743", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27645242"}]}{"id": "", "name": "Chuang", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Chuang", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz", "source": "GEO", "id": "GSM2122743", "field": "treatment_protocol", "associatedPhrase": "The cells were untreated , or treated with ( 100\u00b5g/mL Erythromycin or 50 \u00b5g/mL Clindamycin in 70 % Ethanol ) . After 10 minutes at <Temp> 37 \u00b0C </Temp> , 1 mL samples were subjected to hot phenol-chloroform extraction . Ref : <Gtype> Chuang </Gtype> SE , Daniels DL , and Blattner FR ( 1993 ) Global regulation of gene expression in Escherichia coli . J. Bacteriol . 175:2026-2036 . "}], "externalCrossReferences": [{"objectId": "GSM2122743", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27645242"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz", "source": "GEO", "id": "GSM2122744", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NCBI Reference Sequence : <Supp> NC </Supp> _ 000913.3 "}], "externalCrossReferences": [{"objectId": "GSM2122744", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27645242"}]}{"id": "", "name": "Chuang", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Chuang", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz", "source": "GEO", "id": "GSM2122744", "field": "treatment_protocol", "associatedPhrase": "The cells were untreated , or treated with ( 100\u00b5g/mL Erythromycin or 50 \u00b5g/mL Clindamycin in 70 % Ethanol ) . After 10 minutes at <Temp> 37 \u00b0C </Temp> , 1 mL samples were subjected to hot phenol-chloroform extraction . Ref : <Gtype> Chuang </Gtype> SE , Daniels DL , and Blattner FR ( 1993 ) Global regulation of gene expression in Escherichia coli . J. Bacteriol . 175:2026-2036 . "}], "externalCrossReferences": [{"objectId": "GSM2122744", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27645242"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz", "source": "GEO", "id": "GSM2122745", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NCBI Reference Sequence : <Supp> NC </Supp> _ 000913.3 "}], "externalCrossReferences": [{"objectId": "GSM2122745", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27645242"}]}{"id": "", "name": "Chuang", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Chuang", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz", "source": "GEO", "id": "GSM2122745", "field": "treatment_protocol", "associatedPhrase": "The cells were untreated , or treated with ( 100\u00b5g/mL Erythromycin or 50 \u00b5g/mL Clindamycin in 70 % Ethanol ) . After 10 minutes at <Temp> 37 \u00b0C </Temp> , 1 mL samples were subjected to hot phenol-chloroform extraction . Ref : <Gtype> Chuang </Gtype> SE , Daniels DL , and Blattner FR ( 1993 ) Global regulation of gene expression in Escherichia coli . J. Bacteriol . 175:2026-2036 . "}], "externalCrossReferences": [{"objectId": "GSM2122745", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27645242"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz", "source": "GEO", "id": "GSM2122746", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NCBI Reference Sequence : <Supp> NC </Supp> _ 000913.3 "}], "externalCrossReferences": [{"objectId": "GSM2122746", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27645242"}]}{"id": "", "name": "Chuang", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Chuang", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz", "source": "GEO", "id": "GSM2122746", "field": "treatment_protocol", "associatedPhrase": "The cells were untreated , or treated with ( 100\u00b5g/mL Erythromycin or 50 \u00b5g/mL Clindamycin in 70 % Ethanol ) . After 10 minutes at <Temp> 37 \u00b0C </Temp> , 1 mL samples were subjected to hot phenol-chloroform extraction . Ref : <Gtype> Chuang </Gtype> SE , Daniels DL , and Blattner FR ( 1993 ) Global regulation of gene expression in Escherichia coli . J. Bacteriol . 175:2026-2036 . "}], "externalCrossReferences": [{"objectId": "GSM2122746", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27645242"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz", "source": "GEO", "id": "GSM2122747", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NCBI Reference Sequence : <Supp> NC </Supp> _ 000913.3 "}], "externalCrossReferences": [{"objectId": "GSM2122747", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27645242"}]}{"id": "", "name": "Chuang", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Chuang", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz", "source": "GEO", "id": "GSM2122747", "field": "treatment_protocol", "associatedPhrase": "The cells were untreated , or treated with ( 100\u00b5g/mL Erythromycin or 50 \u00b5g/mL Clindamycin in 70 % Ethanol ) . After 10 minutes at <Temp> 37 \u00b0C </Temp> , 1 mL samples were subjected to hot phenol-chloroform extraction . Ref : <Gtype> Chuang </Gtype> SE , Daniels DL , and Blattner FR ( 1993 ) Global regulation of gene expression in Escherichia coli . J. Bacteriol . 175:2026-2036 . "}], "externalCrossReferences": [{"objectId": "GSM2122747", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27645242"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz", "source": "GEO", "id": "GSM2122748", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NCBI Reference Sequence : <Supp> NC </Supp> _ 000913.3 "}], "externalCrossReferences": [{"objectId": "GSM2122748", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27645242"}]}{"id": "", "name": "Chuang", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Chuang", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz", "source": "GEO", "id": "GSM2122748", "field": "treatment_protocol", "associatedPhrase": "The cells were untreated , or treated with ( 100\u00b5g/mL Erythromycin or 50 \u00b5g/mL Clindamycin in 70 % Ethanol ) . After 10 minutes at <Temp> 37 \u00b0C </Temp> , 1 mL samples were subjected to hot phenol-chloroform extraction . Ref : <Gtype> Chuang </Gtype> SE , Daniels DL , and Blattner FR ( 1993 ) Global regulation of gene expression in Escherichia coli . J. Bacteriol . 175:2026-2036 . "}], "externalCrossReferences": [{"objectId": "GSM2122748", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27645242"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz", "source": "GEO", "id": "GSM2122749", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NCBI Reference Sequence : <Supp> NC </Supp> _ 000913.3 "}], "externalCrossReferences": [{"objectId": "GSM2122749", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27645242"}]}{"id": "", "name": "Chuang", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Chuang", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz", "source": "GEO", "id": "GSM2122749", "field": "treatment_protocol", "associatedPhrase": "The cells were untreated , or treated with ( 100\u00b5g/mL Erythromycin or 50 \u00b5g/mL Clindamycin in 70 % Ethanol ) . After 10 minutes at <Temp> 37 \u00b0C </Temp> , 1 mL samples were subjected to hot phenol-chloroform extraction . Ref : <Gtype> Chuang </Gtype> SE , Daniels DL , and Blattner FR ( 1993 ) Global regulation of gene expression in Escherichia coli . J. Bacteriol . 175:2026-2036 . "}], "externalCrossReferences": [{"objectId": "GSM2122749", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27645242"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz", "source": "GEO", "id": "GSM2122750", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NCBI Reference Sequence : <Supp> NC </Supp> _ 000913.3 "}], "externalCrossReferences": [{"objectId": "GSM2122750", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27645242"}]}{"id": "", "name": "Chuang", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Chuang", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz", "source": "GEO", "id": "GSM2122750", "field": "treatment_protocol", "associatedPhrase": "The cells were untreated , or treated with ( 100\u00b5g/mL Erythromycin or 50 \u00b5g/mL Clindamycin in 70 % Ethanol ) . After 10 minutes at <Temp> 37 \u00b0C </Temp> , 1 mL samples were subjected to hot phenol-chloroform extraction . Ref : <Gtype> Chuang </Gtype> SE , Daniels DL , and Blattner FR ( 1993 ) Global regulation of gene expression in Escherichia coli . J. Bacteriol . 175:2026-2036 . "}], "externalCrossReferences": [{"objectId": "GSM2122750", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27645242"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz", "source": "GEO", "id": "GSM2122751", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NCBI Reference Sequence : <Supp> NC </Supp> _ 000913.3 "}], "externalCrossReferences": [{"objectId": "GSM2122751", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27645242"}]}{"id": "", "name": "Chuang", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Chuang", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz", "source": "GEO", "id": "GSM2122751", "field": "treatment_protocol", "associatedPhrase": "The cells were untreated , or treated with ( 100\u00b5g/mL Erythromycin or 50 \u00b5g/mL Clindamycin in 70 % Ethanol ) . After 10 minutes at <Temp> 37 \u00b0C </Temp> , 1 mL samples were subjected to hot phenol-chloroform extraction . Ref : <Gtype> Chuang </Gtype> SE , Daniels DL , and Blattner FR ( 1993 ) Global regulation of gene expression in Escherichia coli . J. Bacteriol . 175:2026-2036 . "}], "externalCrossReferences": [{"objectId": "GSM2122751", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "27645242"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz", "source": "GEO", "id": "GSM2157648", "field": "extract_protocol", "associatedPhrase": "Cell pellets were lysed and RNA collected using Qiagen 's RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit . RNA samples were then treated with DNase ( New England Biolabs ) for <Supp> 30 min </Supp> at <Temp> 37 \u00b0C </Temp> . "}], "externalCrossReferences": [{"objectId": "GSM2157648", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz", "source": "GEO", "id": "GSM2157648", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2157648", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz", "source": "GEO", "id": "GSM2157649", "field": "extract_protocol", "associatedPhrase": "Cell pellets were lysed and RNA collected using Qiagen 's RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit . RNA samples were then treated with DNase ( New England Biolabs ) for <Supp> 30 min </Supp> at <Temp> 37 \u00b0C </Temp> . "}], "externalCrossReferences": [{"objectId": "GSM2157649", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz", "source": "GEO", "id": "GSM2157649", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2157649", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz", "source": "GEO", "id": "GSM2157650", "field": "extract_protocol", "associatedPhrase": "Cell pellets were lysed and RNA collected using Qiagen 's RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit . RNA samples were then treated with DNase ( New England Biolabs ) for <Supp> 30 min </Supp> at <Temp> 37 \u00b0C </Temp> . "}], "externalCrossReferences": [{"objectId": "GSM2157650", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz", "source": "GEO", "id": "GSM2157650", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2157650", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz", "source": "GEO", "id": "GSM2157651", "field": "extract_protocol", "associatedPhrase": "Cell pellets were lysed and RNA collected using Qiagen 's RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit . RNA samples were then treated with DNase ( New England Biolabs ) for <Supp> 30 min </Supp> at <Temp> 37 \u00b0C </Temp> . "}], "externalCrossReferences": [{"objectId": "GSM2157651", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz", "source": "GEO", "id": "GSM2157651", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2157651", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz", "source": "GEO", "id": "GSM2157652", "field": "extract_protocol", "associatedPhrase": "Cell pellets were lysed and RNA collected using Qiagen 's RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit . RNA samples were then treated with DNase ( New England Biolabs ) for <Supp> 30 min </Supp> at <Temp> 37 \u00b0C </Temp> . "}], "externalCrossReferences": [{"objectId": "GSM2157652", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz", "source": "GEO", "id": "GSM2157652", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2157652", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz", "source": "GEO", "id": "GSM2157653", "field": "extract_protocol", "associatedPhrase": "Cell pellets were lysed and RNA collected using Qiagen 's RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit . RNA samples were then treated with DNase ( New England Biolabs ) for <Supp> 30 min </Supp> at <Temp> 37 \u00b0C </Temp> . "}], "externalCrossReferences": [{"objectId": "GSM2157653", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz", "source": "GEO", "id": "GSM2157653", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2157653", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz", "source": "GEO", "id": "GSM2157654", "field": "extract_protocol", "associatedPhrase": "Cell pellets were lysed and RNA collected using Qiagen 's RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit . RNA samples were then treated with DNase ( New England Biolabs ) for <Supp> 30 min </Supp> at <Temp> 37 \u00b0C </Temp> . "}], "externalCrossReferences": [{"objectId": "GSM2157654", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz", "source": "GEO", "id": "GSM2157654", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2157654", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz", "source": "GEO", "id": "GSM2157655", "field": "extract_protocol", "associatedPhrase": "Cell pellets were lysed and RNA collected using Qiagen 's RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit . RNA samples were then treated with DNase ( New England Biolabs ) for <Supp> 30 min </Supp> at <Temp> 37 \u00b0C </Temp> . "}], "externalCrossReferences": [{"objectId": "GSM2157655", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz", "source": "GEO", "id": "GSM2157655", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2157655", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz", "source": "GEO", "id": "GSM2157656", "field": "extract_protocol", "associatedPhrase": "Cell pellets were lysed and RNA collected using Qiagen 's RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit . RNA samples were then treated with DNase ( New England Biolabs ) for <Supp> 30 min </Supp> at <Temp> 37 \u00b0C </Temp> . "}], "externalCrossReferences": [{"objectId": "GSM2157656", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz", "source": "GEO", "id": "GSM2157656", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2157656", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz", "source": "GEO", "id": "GSM2157657", "field": "extract_protocol", "associatedPhrase": "Cell pellets were lysed and RNA collected using Qiagen 's RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit . RNA samples were then treated with DNase ( New England Biolabs ) for <Supp> 30 min </Supp> at <Temp> 37 \u00b0C </Temp> . "}], "externalCrossReferences": [{"objectId": "GSM2157657", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz", "source": "GEO", "id": "GSM2157657", "field": "source_name", "associatedPhrase": "<Substrain> MG1655 </Substrain>"}], "externalCrossReferences": [{"objectId": "GSM2157657", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "approximately 2 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "approximately 2 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE87071/GSE87071.soft.gz", "source": "GEO", "id": "GSM2321583", "field": "growth_protocol", "associatedPhrase": "Synchronization was achieved by passaging cells through one or two rounds of stationary phase according to Cutler and Evans 1966 . Briefly : <Gtype> Individual </Gtype> colonies ( LB plate , <Temp> 37 \u00b0C </Temp> , 24 h ) were inoculated into M9 media and grown O/N ( <Temp> 37 \u00b0C </Temp> , 200 rpm ) . M9 media was inoculated to a final OD600 = 0.25 ( early-logarithmic phase ) . Cultures were grown ( <Temp> 37 \u00b0C </Temp> , 200 rpm ) and maintained in stationary phase ( OD600 1.8 ) for <Supp> approximately 2 hours </Supp> . An appropriate amount of each culture was used to inoculate pre-warmed ( <Temp> 37 \u00b0C </Temp> ) M9 media to a final OD600 = 0.25 ( approximate 7-fold dilution ) . Released cultures were grown ( <Temp> 37 \u00b0C </Temp> , 200 rpm ) and harvested ( time = 0 , 1 hr , or 2 hr ) for GCC and RNA isolation . Samples ( 1 mL ) were also taken for FACS analysis and fluorescence microscopy ( t = 0 , 1 hr , and 2 hr ) . "}], "externalCrossReferences": [{"objectId": "GSM2321583", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "approximately 2 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "approximately 2 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE87071/GSE87071.soft.gz", "source": "GEO", "id": "GSM2321584", "field": "growth_protocol", "associatedPhrase": "Synchronization was achieved by passaging cells through one or two rounds of stationary phase according to Cutler and Evans 1966 . Briefly : <Gtype> Individual </Gtype> colonies ( LB plate , <Temp> 37 \u00b0C </Temp> , 24 h ) were inoculated into M9 media and grown O/N ( <Temp> 37 \u00b0C </Temp> , 200 rpm ) . M9 media was inoculated to a final OD600 = 0.25 ( early-logarithmic phase ) . Cultures were grown ( <Temp> 37 \u00b0C </Temp> , 200 rpm ) and maintained in stationary phase ( OD600 1.8 ) for <Supp> approximately 2 hours </Supp> . An appropriate amount of each culture was used to inoculate pre-warmed ( <Temp> 37 \u00b0C </Temp> ) M9 media to a final OD600 = 0.25 ( approximate 7-fold dilution ) . Released cultures were grown ( <Temp> 37 \u00b0C </Temp> , 200 rpm ) and harvested ( time = 0 , 1 hr , or 2 hr ) for GCC and RNA isolation . Samples ( 1 mL ) were also taken for FACS analysis and fluorescence microscopy ( t = 0 , 1 hr , and 2 hr ) . "}], "externalCrossReferences": [{"objectId": "GSM2321584", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "Replicate 1", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Replicate 1", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE87071/GSE87071.soft.gz", "source": "GEO", "id": "GSM2321584", "field": "characteristics", "associatedPhrase": "biological replicate : <Supp> Replicate 1 </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2321584", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "approximately 2 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "approximately 2 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE87071/GSE87071.soft.gz", "source": "GEO", "id": "GSM2321585", "field": "growth_protocol", "associatedPhrase": "Synchronization was achieved by passaging cells through one or two rounds of stationary phase according to Cutler and Evans 1966 . Briefly : <Gtype> Individual </Gtype> colonies ( LB plate , <Temp> 37 \u00b0C </Temp> , 24 h ) were inoculated into M9 media and grown O/N ( <Temp> 37 \u00b0C </Temp> , 200 rpm ) . M9 media was inoculated to a final OD600 = 0.25 ( early-logarithmic phase ) . Cultures were grown ( <Temp> 37 \u00b0C </Temp> , 200 rpm ) and maintained in stationary phase ( OD600 1.8 ) for <Supp> approximately 2 hours </Supp> . An appropriate amount of each culture was used to inoculate pre-warmed ( <Temp> 37 \u00b0C </Temp> ) M9 media to a final OD600 = 0.25 ( approximate 7-fold dilution ) . Released cultures were grown ( <Temp> 37 \u00b0C </Temp> , 200 rpm ) and harvested ( time = 0 , 1 hr , or 2 hr ) for GCC and RNA isolation . Samples ( 1 mL ) were also taken for FACS analysis and fluorescence microscopy ( t = 0 , 1 hr , and 2 hr ) . "}], "externalCrossReferences": [{"objectId": "GSM2321585", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "= 2 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "= 2 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE87071/GSE87071.soft.gz", "source": "GEO", "id": "GSM2321585", "field": "source_name", "associatedPhrase": "Dividing t <Supp> = 2 hours </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2321585", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "Replicate 1", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "Replicate 1", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE87071/GSE87071.soft.gz", "source": "GEO", "id": "GSM2321585", "field": "characteristics", "associatedPhrase": "biological replicate : <Supp> Replicate 1 </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2321585", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "approximately 2 hours", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "approximately 2 hours", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE87071/GSE87071.soft.gz", "source": "GEO", "id": "GSM2321586", "field": "growth_protocol", "associatedPhrase": "Synchronization was achieved by passaging cells through one or two rounds of stationary phase according to Cutler and Evans 1966 . Briefly : <Gtype> Individual </Gtype> colonies ( LB plate , <Temp> 37 \u00b0C </Temp> , 24 h ) were inoculated into M9 media and grown O/N ( <Temp> 37 \u00b0C </Temp> , 200 rpm ) . M9 media was inoculated to a final OD600 = 0.25 ( early-logarithmic phase ) . Cultures were grown ( <Temp> 37 \u00b0C </Temp> , 200 rpm ) and maintained in stationary phase ( OD600 1.8 ) for <Supp> approximately 2 hours </Supp> . An appropriate amount of each culture was used to inoculate pre-warmed ( <Temp> 37 \u00b0C </Temp> ) M9 media to a final OD600 = 0.25 ( approximate 7-fold dilution ) . Released cultures were grown ( <Temp> 37 \u00b0C </Temp> , 200 rpm ) and harvested ( time = 0 , 1 hr , or 2 hr ) for GCC and RNA isolation . Samples ( 1 mL ) were also taken for FACS analysis and fluorescence microscopy ( t = 0 , 1 hr , and 2 hr ) . "}], "externalCrossReferences": [{"objectId": "GSM2321586", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MOPS complete-glucose liquid media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MOPS complete-glucose liquid media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344783", "field": "growth_protocol", "associatedPhrase": "All strains were grown shaking at <Temp> 37 \u00b0C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 "}], "externalCrossReferences": [{"objectId": "GSM2344783", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "MOPS complete-glucose liquid media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MOPS complete-glucose liquid media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344784", "field": "growth_protocol", "associatedPhrase": "All strains were grown shaking at <Temp> 37 \u00b0C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 "}], "externalCrossReferences": [{"objectId": "GSM2344784", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "MOPS complete-glucose liquid media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MOPS complete-glucose liquid media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344785", "field": "growth_protocol", "associatedPhrase": "All strains were grown shaking at <Temp> 37 \u00b0C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 "}], "externalCrossReferences": [{"objectId": "GSM2344785", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "MOPS complete-glucose liquid media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MOPS complete-glucose liquid media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344786", "field": "growth_protocol", "associatedPhrase": "All strains were grown shaking at <Temp> 37 \u00b0C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 "}], "externalCrossReferences": [{"objectId": "GSM2344786", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "MOPS complete-glucose liquid media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MOPS complete-glucose liquid media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344787", "field": "growth_protocol", "associatedPhrase": "All strains were grown shaking at <Temp> 37 \u00b0C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 "}], "externalCrossReferences": [{"objectId": "GSM2344787", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "K12 MG1655 deltaprfC", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K12 MG1655 deltaprfC", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344787", "field": "characteristics", "associatedPhrase": "strain : <Gtype> K12 MG1655 deltaprfC </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2344787", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "MOPS complete-glucose liquid media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MOPS complete-glucose liquid media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344788", "field": "growth_protocol", "associatedPhrase": "All strains were grown shaking at <Temp> 37 \u00b0C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 "}], "externalCrossReferences": [{"objectId": "GSM2344788", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "K12 MG1655 deltaprfC", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K12 MG1655 deltaprfC", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344788", "field": "characteristics", "associatedPhrase": "strain : <Gtype> K12 MG1655 deltaprfC </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2344788", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "MOPS complete-glucose liquid media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MOPS complete-glucose liquid media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344789", "field": "growth_protocol", "associatedPhrase": "All strains were grown shaking at <Temp> 37 \u00b0C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 "}], "externalCrossReferences": [{"objectId": "GSM2344789", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "K12 MG1655 prfB-Bstrain allele", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K12 MG1655 prfB-Bstrain allele", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344789", "field": "characteristics", "associatedPhrase": "strain : <Gtype> K12 MG1655 prfB-Bstrain allele </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2344789", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "MOPS complete-glucose liquid media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MOPS complete-glucose liquid media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344790", "field": "growth_protocol", "associatedPhrase": "All strains were grown shaking at <Temp> 37 \u00b0C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 "}], "externalCrossReferences": [{"objectId": "GSM2344790", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "K12 MG1655 prfB-Bstrain allele", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K12 MG1655 prfB-Bstrain allele", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344790", "field": "characteristics", "associatedPhrase": "strain : <Gtype> K12 MG1655 prfB-Bstrain allele </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2344790", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "MOPS complete-glucose liquid media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MOPS complete-glucose liquid media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344791", "field": "growth_protocol", "associatedPhrase": "All strains were grown shaking at <Temp> 37 \u00b0C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 "}], "externalCrossReferences": [{"objectId": "GSM2344791", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "K12 MG1655 prfB-Bstrain allele deltaprfC", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K12 MG1655 prfB-Bstrain allele deltaprfC", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344791", "field": "characteristics", "associatedPhrase": "strain : <Gtype> K12 MG1655 prfB-Bstrain allele deltaprfC </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2344791", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "MOPS complete-glucose liquid media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MOPS complete-glucose liquid media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344792", "field": "growth_protocol", "associatedPhrase": "All strains were grown shaking at <Temp> 37 \u00b0C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 "}], "externalCrossReferences": [{"objectId": "GSM2344792", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "K12 MG1655 prfB-Bstrain allele deltaprfC", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K12 MG1655 prfB-Bstrain allele deltaprfC", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344792", "field": "characteristics", "associatedPhrase": "strain : <Gtype> K12 MG1655 prfB-Bstrain allele deltaprfC </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2344792", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "MOPS complete-glucose liquid media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MOPS complete-glucose liquid media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344793", "field": "growth_protocol", "associatedPhrase": "All strains were grown shaking at <Temp> 37 \u00b0C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 "}], "externalCrossReferences": [{"objectId": "GSM2344793", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "K12 MG1655 prfB-Bstrain allele deltaprfC", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K12 MG1655 prfB-Bstrain allele deltaprfC", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344793", "field": "characteristics", "associatedPhrase": "strain : <Gtype> K12 MG1655 prfB-Bstrain allele deltaprfC </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2344793", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "MOPS complete-glucose liquid media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MOPS complete-glucose liquid media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344794", "field": "growth_protocol", "associatedPhrase": "All strains were grown shaking at <Temp> 37 \u00b0C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 "}], "externalCrossReferences": [{"objectId": "GSM2344794", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "K12 MG1655 prfB-Bstrain allele deltaprfC", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K12 MG1655 prfB-Bstrain allele deltaprfC", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344794", "field": "characteristics", "associatedPhrase": "strain : <Gtype> K12 MG1655 prfB-Bstrain allele deltaprfC </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2344794", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "MOPS complete-glucose liquid media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MOPS complete-glucose liquid media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344795", "field": "growth_protocol", "associatedPhrase": "All strains were grown shaking at <Temp> 37 \u00b0C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 "}], "externalCrossReferences": [{"objectId": "GSM2344795", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "K12 MG1655 prfB-Bstrain allele deltaprfC", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K12 MG1655 prfB-Bstrain allele deltaprfC", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344795", "field": "characteristics", "associatedPhrase": "strain : <Gtype> K12 MG1655 prfB-Bstrain allele deltaprfC </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2344795", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "MOPS complete-glucose liquid media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MOPS complete-glucose liquid media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344809", "field": "growth_protocol", "associatedPhrase": "All strains were grown shaking at <Temp> 37 \u00b0C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 "}], "externalCrossReferences": [{"objectId": "GSM2344809", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "MOPS complete-glucose liquid media", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MOPS complete-glucose liquid media", "term_id": "", "term_type": "Medium", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344810", "field": "growth_protocol", "associatedPhrase": "All strains were grown shaking at <Temp> 37 \u00b0C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 "}], "externalCrossReferences": [{"objectId": "GSM2344810", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "K12 MG1655 deltaprfC", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K12 MG1655 deltaprfC", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz", "source": "GEO", "id": "GSM2344810", "field": "characteristics", "associatedPhrase": "strain : <Gtype> K12 MG1655 deltaprfC </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2344810", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28301469"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz", "source": "GEO", "id": "GSM2356687", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT and \u0394ompR were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . Then cells were treated with <Supp> 0.3 M of NaCl </Supp> at mid-log pahse for <Supp> 30 min </Supp> with agitation . "}], "externalCrossReferences": [{"objectId": "GSM2356687", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28526842"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz", "source": "GEO", "id": "GSM2356687", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2356687", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28526842"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz", "source": "GEO", "id": "GSM2356687", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2356687", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28526842"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz", "source": "GEO", "id": "GSM2356688", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT and \u0394ompR were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . Then cells were treated with <Supp> 0.3 M of NaCl </Supp> at mid-log pahse for <Supp> 30 min </Supp> with agitation . "}], "externalCrossReferences": [{"objectId": "GSM2356688", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28526842"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz", "source": "GEO", "id": "GSM2356688", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2356688", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28526842"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz", "source": "GEO", "id": "GSM2356688", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2356688", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28526842"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz", "source": "GEO", "id": "GSM2356689", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT and \u0394ompR were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . Then cells were treated with <Supp> 0.3 M of NaCl </Supp> at mid-log pahse for <Supp> 30 min </Supp> with agitation . "}], "externalCrossReferences": [{"objectId": "GSM2356689", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28526842"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz", "source": "GEO", "id": "GSM2356689", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2356689", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28526842"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz", "source": "GEO", "id": "GSM2356689", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2356689", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28526842"}]}{"id": "", "name": "ompR deletion mutant", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ompR deletion mutant", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz", "source": "GEO", "id": "GSM2356689", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> ompR deletion mutant </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2356689", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28526842"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz", "source": "GEO", "id": "GSM2356690", "field": "growth_protocol", "associatedPhrase": "E. coli K-12 MG1655 WT and \u0394ompR were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 \u00b0C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . Then cells were treated with <Supp> 0.3 M of NaCl </Supp> at mid-log pahse for <Supp> 30 min </Supp> with agitation . "}], "externalCrossReferences": [{"objectId": "GSM2356690", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28526842"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz", "source": "GEO", "id": "GSM2356690", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2356690", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28526842"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz", "source": "GEO", "id": "GSM2356690", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2356690", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28526842"}]}{"id": "", "name": "ompR deletion mutant", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ompR deletion mutant", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz", "source": "GEO", "id": "GSM2356690", "field": "characteristics", "associatedPhrase": "genotype : <Gtype> ompR deletion mutant </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2356690", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28526842"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz", "source": "GEO", "id": "GSM2374957", "field": "treatment_protocol", "associatedPhrase": "E. coli ST131 UR40 was treated with ciprofloxacin ( 2\u00b5g/mL ) and samples were taken at time points 0 min , <Supp> 30 min </Supp> and 90 min . "}], "externalCrossReferences": [{"objectId": "GSM2374957", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30013537"}]}{"id": "", "name": "0 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz", "source": "GEO", "id": "GSM2374957", "field": "characteristics", "associatedPhrase": "time point : <Supp> 0 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2374957", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30013537"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz", "source": "GEO", "id": "GSM2374958", "field": "treatment_protocol", "associatedPhrase": "E. coli ST131 UR40 was treated with ciprofloxacin ( 2\u00b5g/mL ) and samples were taken at time points 0 min , <Supp> 30 min </Supp> and 90 min . "}], "externalCrossReferences": [{"objectId": "GSM2374958", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30013537"}]}{"id": "", "name": "0 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz", "source": "GEO", "id": "GSM2374958", "field": "characteristics", "associatedPhrase": "time point : <Supp> 0 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2374958", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30013537"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz", "source": "GEO", "id": "GSM2374959", "field": "source_name", "associatedPhrase": "Clinical isolate , minus ciprofloxacin , <Supp> 30 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2374959", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30013537"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz", "source": "GEO", "id": "GSM2374959", "field": "treatment_protocol", "associatedPhrase": "E. coli ST131 UR40 was treated with ciprofloxacin ( 2\u00b5g/mL ) and samples were taken at time points 0 min , <Supp> 30 min </Supp> and 90 min . "}], "externalCrossReferences": [{"objectId": "GSM2374959", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30013537"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz", "source": "GEO", "id": "GSM2374959", "field": "characteristics", "associatedPhrase": "time point : <Supp> 30 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2374959", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30013537"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz", "source": "GEO", "id": "GSM2374960", "field": "source_name", "associatedPhrase": "Clinical isolate , plus ciprofloxacin , <Supp> 30 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2374960", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30013537"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz", "source": "GEO", "id": "GSM2374960", "field": "treatment_protocol", "associatedPhrase": "E. coli ST131 UR40 was treated with ciprofloxacin ( 2\u00b5g/mL ) and samples were taken at time points 0 min , <Supp> 30 min </Supp> and 90 min . "}], "externalCrossReferences": [{"objectId": "GSM2374960", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30013537"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz", "source": "GEO", "id": "GSM2374960", "field": "characteristics", "associatedPhrase": "time point : <Supp> 30 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2374960", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30013537"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz", "source": "GEO", "id": "GSM2374961", "field": "treatment_protocol", "associatedPhrase": "E. coli ST131 UR40 was treated with ciprofloxacin ( 2\u00b5g/mL ) and samples were taken at time points 0 min , <Supp> 30 min </Supp> and 90 min . "}], "externalCrossReferences": [{"objectId": "GSM2374961", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30013537"}]}{"id": "", "name": "90 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "90 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz", "source": "GEO", "id": "GSM2374961", "field": "characteristics", "associatedPhrase": "time point : <Supp> 90 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2374961", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30013537"}]}{"id": "", "name": "30 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz", "source": "GEO", "id": "GSM2374962", "field": "treatment_protocol", "associatedPhrase": "E. coli ST131 UR40 was treated with ciprofloxacin ( 2\u00b5g/mL ) and samples were taken at time points 0 min , <Supp> 30 min </Supp> and 90 min . "}], "externalCrossReferences": [{"objectId": "GSM2374962", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30013537"}]}{"id": "", "name": "90 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "90 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz", "source": "GEO", "id": "GSM2374962", "field": "characteristics", "associatedPhrase": "time point : <Supp> 90 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2374962", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "30013537"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396709", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396709", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396709", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396709", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396711", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396711", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396711", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396711", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396713", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396713", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396713", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396713", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396715", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396715", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396715", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396715", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396717", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396717", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396717", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396717", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396719", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396719", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396719", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396719", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396721", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396721", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396721", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396721", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "0 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396721", "field": "characteristics", "associatedPhrase": "heat shock time : <Supp> 0 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2396721", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396723", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396723", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396723", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396723", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "10 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "10 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396723", "field": "characteristics", "associatedPhrase": "heat shock time : <Supp> 10 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2396723", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396725", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396725", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396725", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396725", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "20 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "20 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396725", "field": "characteristics", "associatedPhrase": "heat shock time : <Supp> 20 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2396725", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396727", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396727", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396727", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396727", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "0 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396727", "field": "characteristics", "associatedPhrase": "heat shock time : <Supp> 0 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2396727", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396729", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396729", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396729", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396729", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "10 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "10 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396729", "field": "characteristics", "associatedPhrase": "heat shock time : <Supp> 10 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2396729", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396731", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396731", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396731", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396731", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "20 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "20 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396731", "field": "characteristics", "associatedPhrase": "heat shock time : <Supp> 20 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2396731", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396733", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396733", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396733", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396733", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "0 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "0 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396733", "field": "characteristics", "associatedPhrase": "heat shock time : <Supp> 0 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2396733", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396735", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396735", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396735", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396735", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "10 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "10 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396735", "field": "characteristics", "associatedPhrase": "heat shock time : <Supp> 10 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2396735", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396737", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396737", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396737", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396737", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "20 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "20 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396737", "field": "characteristics", "associatedPhrase": "heat shock time : <Supp> 20 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2396737", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396739", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396739", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396739", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396739", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396741", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396741", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396741", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396741", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396743", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396743", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz", "source": "GEO", "id": "GSM2396743", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2396743", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29183994"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411669", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411669", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "5 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "5 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411669", "field": "characteristics", "associatedPhrase": "time : <Supp> 5 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411669", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411670", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411670", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "10 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "10 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411670", "field": "characteristics", "associatedPhrase": "time : <Supp> 10 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411670", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411671", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411671", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "25 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "25 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411671", "field": "characteristics", "associatedPhrase": "time : <Supp> 25 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411671", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411672", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411672", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "45 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "45 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411672", "field": "characteristics", "associatedPhrase": "time : <Supp> 45 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411672", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411673", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411673", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "75 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "75 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411673", "field": "characteristics", "associatedPhrase": "time : <Supp> 75 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411673", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411674", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411674", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "120 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "120 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411674", "field": "characteristics", "associatedPhrase": "time : <Supp> 120 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411674", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411675", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411675", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "210 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "210 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411675", "field": "characteristics", "associatedPhrase": "time : <Supp> 210 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411675", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411676", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411676", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "330 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "330 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411676", "field": "characteristics", "associatedPhrase": "time : <Supp> 330 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411676", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411677", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411677", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411678", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411678", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411679", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411679", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411680", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411680", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411681", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411681", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411682", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411682", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411683", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411683", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "5 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "5 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411683", "field": "characteristics", "associatedPhrase": "time : <Supp> 5 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411683", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411684", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411684", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "10 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "10 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411684", "field": "characteristics", "associatedPhrase": "time : <Supp> 10 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411684", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411685", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411685", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "25 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "25 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411685", "field": "characteristics", "associatedPhrase": "time : <Supp> 25 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411685", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411686", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411686", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "25 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "25 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411686", "field": "characteristics", "associatedPhrase": "time : <Supp> 25 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411686", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411687", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411687", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "25 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "25 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411687", "field": "characteristics", "associatedPhrase": "time : <Supp> 25 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411687", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411688", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411688", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "45 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "45 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411688", "field": "characteristics", "associatedPhrase": "time : <Supp> 45 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411688", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411689", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411689", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "120 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "120 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411689", "field": "characteristics", "associatedPhrase": "time : <Supp> 120 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411689", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411690", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411690", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "120 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "120 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411690", "field": "characteristics", "associatedPhrase": "time : <Supp> 120 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411690", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411691", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411691", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "120 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "120 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411691", "field": "characteristics", "associatedPhrase": "time : <Supp> 120 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411691", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411692", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411692", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "210 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "210 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411692", "field": "characteristics", "associatedPhrase": "time : <Supp> 210 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411692", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411693", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411693", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411694", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411694", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411695", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411695", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411696", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411696", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411697", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411697", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "5 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "5 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411697", "field": "characteristics", "associatedPhrase": "time : <Supp> 5 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411697", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411698", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411698", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "10 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "10 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411698", "field": "characteristics", "associatedPhrase": "time : <Supp> 10 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411698", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411699", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411699", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "25 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "25 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411699", "field": "characteristics", "associatedPhrase": "time : <Supp> 25 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411699", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411700", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411700", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "45 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "45 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411700", "field": "characteristics", "associatedPhrase": "time : <Supp> 45 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411700", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411701", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411701", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "75 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "75 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411701", "field": "characteristics", "associatedPhrase": "time : <Supp> 75 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411701", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411702", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411702", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "120 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "120 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411702", "field": "characteristics", "associatedPhrase": "time : <Supp> 120 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411702", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411703", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411703", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "210 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "210 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411703", "field": "characteristics", "associatedPhrase": "time : <Supp> 210 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411703", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411704", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411704", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "330 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "330 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411704", "field": "characteristics", "associatedPhrase": "time : <Supp> 330 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411704", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411705", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411705", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411706", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411706", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411707", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411707", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411708", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411708", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411709", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411709", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411710", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411710", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411711", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411711", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "5 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "5 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411711", "field": "characteristics", "associatedPhrase": "time : <Supp> 5 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411711", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411712", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411712", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "10 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "10 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411712", "field": "characteristics", "associatedPhrase": "time : <Supp> 10 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411712", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411713", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411713", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "25 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "25 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411713", "field": "characteristics", "associatedPhrase": "time : <Supp> 25 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411713", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411714", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411714", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "25 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "25 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411714", "field": "characteristics", "associatedPhrase": "time : <Supp> 25 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411714", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411715", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411715", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "25 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "25 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411715", "field": "characteristics", "associatedPhrase": "time : <Supp> 25 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411715", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411716", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411716", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "45 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "45 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411716", "field": "characteristics", "associatedPhrase": "time : <Supp> 45 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411716", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411717", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411717", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "75 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "75 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411717", "field": "characteristics", "associatedPhrase": "time : <Supp> 75 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411717", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411718", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411718", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "120 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "120 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411718", "field": "characteristics", "associatedPhrase": "time : <Supp> 120 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411718", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411719", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411719", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "120 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "120 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411719", "field": "characteristics", "associatedPhrase": "time : <Supp> 120 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411719", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411720", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411720", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "120 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "120 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411720", "field": "characteristics", "associatedPhrase": "time : <Supp> 120 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411720", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411721", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411721", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "210 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "210 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411721", "field": "characteristics", "associatedPhrase": "time : <Supp> 210 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411721", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411722", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411722", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "330 min", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "330 min", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411722", "field": "characteristics", "associatedPhrase": "time : <Supp> 330 min </Supp> "}], "externalCrossReferences": [{"objectId": "GSM2411722", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411723", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411723", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411724", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411724", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411725", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411725", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411726", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411726", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "AP009048 .1 ) )", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "AP009048 .1 ) )", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz", "source": "GEO", "id": "GSM2411727", "field": "data_processing", "associatedPhrase": "Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2411727", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "2844739128702020"}]}{"id": "", "name": "tabular : Tabular", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "tabular : Tabular", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE91001/GSE91001.soft.gz", "source": "GEO", "id": "GSM2418921", "field": "data_processing", "associatedPhrase": "<Supp> Supplementary </Supp> _ files _ format _ and _ content : <Gtype> tabular : Tabular </Gtype> data that informs the excel spreadsheet . The data are averaged across the three samples per strain . Both averaged strain data are presented for each gene on the same line . Data contain gene ID , gene number , locus , fragments per kilobase mapped ( FPKM ) for WT and mutant strains , log2 ( fold-change ) relative epxression of WT over mutant strains , test-statistic , p-value , q-value , and significance analyzed via the cummeRbund package in R whereby a q-value of < 0.05 is considered significant . "}], "externalCrossReferences": [{"objectId": "GSM2418921", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28224117"}]}{"id": "", "name": "-LCB- delta -RCB- perC : : kanR", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- perC : : kanR", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE91001/GSE91001.soft.gz", "source": "GEO", "id": "GSM2418921", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> -LCB- delta -RCB- perC : : kanR </Gtype> , coisogenic to <Gtype> WT </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2418921", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28224117"}]}{"id": "", "name": "tabular : Tabular", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "tabular : Tabular", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE91001/GSE91001.soft.gz", "source": "GEO", "id": "GSM2418922", "field": "data_processing", "associatedPhrase": "<Supp> Supplementary </Supp> _ files _ format _ and _ content : <Gtype> tabular : Tabular </Gtype> data that informs the excel spreadsheet . The data are averaged across the three samples per strain . Both averaged strain data are presented for each gene on the same line . Data contain gene ID , gene number , locus , fragments per kilobase mapped ( FPKM ) for WT and mutant strains , log2 ( fold-change ) relative epxression of WT over mutant strains , test-statistic , p-value , q-value , and significance analyzed via the cummeRbund package in R whereby a q-value of < 0.05 is considered significant . "}], "externalCrossReferences": [{"objectId": "GSM2418922", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28224117"}]}{"id": "", "name": "-LCB- delta -RCB- perC : : kanR", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- perC : : kanR", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE91001/GSE91001.soft.gz", "source": "GEO", "id": "GSM2418922", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> -LCB- delta -RCB- perC : : kanR </Gtype> , coisogenic to <Gtype> WT </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2418922", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28224117"}]}{"id": "", "name": "tabular : Tabular", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "tabular : Tabular", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE91001/GSE91001.soft.gz", "source": "GEO", "id": "GSM2418923", "field": "data_processing", "associatedPhrase": "<Supp> Supplementary </Supp> _ files _ format _ and _ content : <Gtype> tabular : Tabular </Gtype> data that informs the excel spreadsheet . The data are averaged across the three samples per strain . Both averaged strain data are presented for each gene on the same line . Data contain gene ID , gene number , locus , fragments per kilobase mapped ( FPKM ) for WT and mutant strains , log2 ( fold-change ) relative epxression of WT over mutant strains , test-statistic , p-value , q-value , and significance analyzed via the cummeRbund package in R whereby a q-value of < 0.05 is considered significant . "}], "externalCrossReferences": [{"objectId": "GSM2418923", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28224117"}]}{"id": "", "name": "-LCB- delta -RCB- perC : : kanR", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "-LCB- delta -RCB- perC : : kanR", "term_id": "", "term_type": "Genetic background", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE91001/GSE91001.soft.gz", "source": "GEO", "id": "GSM2418923", "field": "characteristics", "associatedPhrase": "genotype/variation : <Gtype> -LCB- delta -RCB- perC : : kanR </Gtype> , coisogenic to <Gtype> WT </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2418923", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28224117"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz", "source": "GEO", "id": "GSM2433290", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2433290", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29807996"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz", "source": "GEO", "id": "GSM2433290", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2433290", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29807996"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz", "source": "GEO", "id": "GSM2433291", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2433291", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29807996"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz", "source": "GEO", "id": "GSM2433291", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2433291", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29807996"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz", "source": "GEO", "id": "GSM2433292", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2433292", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29807996"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz", "source": "GEO", "id": "GSM2433292", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2433292", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29807996"}]}{"id": "", "name": "ORF1 replicate", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ORF1 replicate", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz", "source": "GEO", "id": "GSM2433292", "field": "characteristics", "associatedPhrase": "replicates : <Supp> ORF1 replicate </Supp> 2 / induced "}], "externalCrossReferences": [{"objectId": "GSM2433292", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29807996"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz", "source": "GEO", "id": "GSM2433293", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2433293", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29807996"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz", "source": "GEO", "id": "GSM2433293", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2433293", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29807996"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz", "source": "GEO", "id": "GSM2433294", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2433294", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29807996"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz", "source": "GEO", "id": "GSM2433294", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2433294", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29807996"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz", "source": "GEO", "id": "GSM2433295", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2433295", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29807996"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz", "source": "GEO", "id": "GSM2433295", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2433295", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29807996"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz", "source": "GEO", "id": "GSM2433296", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2433296", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29807996"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz", "source": "GEO", "id": "GSM2433296", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2433296", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29807996"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz", "source": "GEO", "id": "GSM2433297", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2433297", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29807996"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz", "source": "GEO", "id": "GSM2433297", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2433297", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29807996"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz", "source": "GEO", "id": "GSM2433298", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2433298", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29807996"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz", "source": "GEO", "id": "GSM2433298", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2433298", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29807996"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz", "source": "GEO", "id": "GSM2433299", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2433299", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29807996"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz", "source": "GEO", "id": "GSM2433299", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2433299", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29807996"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz", "source": "GEO", "id": "GSM2516397", "field": "data_processing", "associatedPhrase": "FastQ files were examined using the FastQC tool . Reads were clipped from 3 ' adapter sequences using Cutadapt v1 .10 , discarding reads shorter than 15 nucleotides . Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( GenBank : <Gversion> U00096 .2 </Gversion> ) was used as the reference genome . Reads were mapped to the reference genome using Bowtie v1 .1.2 , by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes ( parameters : - n 2 - m 7 - a -- best -- strata -5 5 ) . "}], "externalCrossReferences": [{"objectId": "GSM2516397", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28934475"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz", "source": "GEO", "id": "GSM2516397", "field": "data_processing", "associatedPhrase": "FastQ files were examined using the FastQC tool . Reads were clipped from 3 ' adapter sequences using Cutadapt v1 .10 , discarding reads shorter than 15 nucleotides . Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( GenBank : <Gversion> U00096 .2 </Gversion> ) was used as the reference genome . Reads were mapped to the reference genome using Bowtie v1 .1.2 , by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes ( parameters : - n 2 - m 7 - a -- best -- strata -5 5 ) . "}], "externalCrossReferences": [{"objectId": "GSM2516397", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28934475"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz", "source": "GEO", "id": "GSM2516397", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> U00096 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2516397", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28934475"}]}{"id": "", "name": "150 mM KCl ; 10 mM MgCl2 ; 1 mM DTT", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "150 mM KCl ; 10 mM MgCl2 ; 1 mM DTT", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz", "source": "GEO", "id": "GSM2516397", "field": "extract_protocol", "associatedPhrase": "Each bacteria pellet from a 25 ml culture ( OD600 ~ 0.3 ) was homogeneously resuspended in 200 \u00b5l of Buffer A [ 10 mM Tris pH 8.0 ; 20 % Sucrose ; 100 mM NaCl ] supplemented with 200 U SUPERase \u2022 In \u2122 RNase Inhibitor , by pipetting . 50 \u00b5l of Buffer B [ 50 mM EDTA ; 120 mM Tris pH 8.0 ] supplemented with 1 \u00b5l Ready-Lyse \u2122 Lysozyme Solution ( Epicentre , cat . R1810M ) were added dropwise , and the vial was gently tilted 5 times to ensure homogenous mixing . The sample was then incubated 1 minute at room temperature . 250 \u00b5l of Buffer C [ 0.5 % Tween-20 : <Supp> 0.4 % NaDOC ; 2 M NaCl </Supp> ; 10 mM EDTA ] were immediately added dropwise . The sample was then incubated 5 minutes at room temperature . At this stage the solution clears considerably without increasing its viscosity , and nucleoid becomes visible . Using a cut P1000 pipette tip , the whole sample was gently layered on the top of a 5-30 % w/v sucrose gradient [ 10 mM Tris pH 8.0 <Supp> ; 1 M NaCl ; 1 mM EDTA ; 1 mM DTT </Supp> ] , and centrifuged at 17,000 RPM in a SW55Ti rotor ( Beckman Coulter , cat . 342194 ) for 9 minutes ( 4 \u00b0C ) . After centrifugation , the nucleoid fraction was collected using a syringe with a 18G blunt fill needle , and transferred to a new centrifuge tube . The remaining gradient was assumed to represent the cytosolic fraction . The nucleoid was then resuspended in 2.5 ml Wash & Resuspension buffer [ 40 mM Tris pH 7.5 ; <Supp> 150 mM KCl ; 10 mM MgCl2 ; 1 mM DTT </Supp> ; 0.01 % Triton X-100 ] supplemented with 200 U SUPERase \u2022 In \u2122 RNase Inhibitor , pulse vortexed for 5 seconds , and then centrifuged at 28,000 RPM in a SW55Ti rotor for 30 minutes ( 0 \u00b0C ) . After centrifugation the supernatant was decanted , and the nucleoid pellet was washed twice with 2 ml of Wash & Resuspension buffer , taking care not to disturb it . The nucleoid was then resuspended in 500 \u00b5l Wash & Resuspension buffer , and solubilized by addition of 0.1 gr acid-washed glass beads ( Sigma , cat . G1145 ) , and shaking for 5 minutes in a TissueLyser ( QIAGEN ) . For each 100 \u00b5l of purified nucleoids ( or cytosolic fraction ) , 1 ml of TRIzol \u00ae Reagent ( Invitrogen , cat . 15596-018 ) was added , and RNA was extracted following manufacturer 's instructions . RNA was analyzed on a 2100 Bioanalyzer ( Agilent ) . In all experiments , RNA from cytosolic fraction ( corresponding to mature RNA species ) had RIN > 9.5 . Total RNA yield from nucleoid fraction was ~ 6 % of the total RNA content . "}], "externalCrossReferences": [{"objectId": "GSM2516397", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28934475"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz", "source": "GEO", "id": "GSM2516397", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM2516397", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28934475"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz", "source": "GEO", "id": "GSM2516400", "field": "data_processing", "associatedPhrase": "FastQ files were examined using the FastQC tool . Reads were clipped from 3 ' adapter sequences using Cutadapt v1 .10 , discarding reads shorter than 15 nucleotides . Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( GenBank : <Gversion> U00096 .2 </Gversion> ) was used as the reference genome . Reads were mapped to the reference genome using Bowtie v1 .1.2 , by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes ( parameters : - n 2 - m 7 - a -- best -- strata -5 5 ) . "}], "externalCrossReferences": [{"objectId": "GSM2516400", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28934475"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz", "source": "GEO", "id": "GSM2516400", "field": "data_processing", "associatedPhrase": "FastQ files were examined using the FastQC tool . Reads were clipped from 3 ' adapter sequences using Cutadapt v1 .10 , discarding reads shorter than 15 nucleotides . Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( GenBank : <Gversion> U00096 .2 </Gversion> ) was used as the reference genome . Reads were mapped to the reference genome using Bowtie v1 .1.2 , by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes ( parameters : - n 2 - m 7 - a -- best -- strata -5 5 ) . "}], "externalCrossReferences": [{"objectId": "GSM2516400", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28934475"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz", "source": "GEO", "id": "GSM2516400", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> U00096 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2516400", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28934475"}]}{"id": "", "name": "150 mM KCl ; 10 mM MgCl2 ; 1 mM DTT", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "150 mM KCl ; 10 mM MgCl2 ; 1 mM DTT", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz", "source": "GEO", "id": "GSM2516400", "field": "extract_protocol", "associatedPhrase": "Each bacteria pellet from a 25 ml culture ( OD600 ~ 0.3 ) was homogeneously resuspended in 200 \u00b5l of Buffer A [ 10 mM Tris pH 8.0 ; 20 % Sucrose ; 100 mM NaCl ] supplemented with 200 U SUPERase \u2022 In \u2122 RNase Inhibitor , by pipetting . 50 \u00b5l of Buffer B [ 50 mM EDTA ; 120 mM Tris pH 8.0 ] supplemented with 1 \u00b5l Ready-Lyse \u2122 Lysozyme Solution ( Epicentre , cat . R1810M ) were added dropwise , and the vial was gently tilted 5 times to ensure homogenous mixing . The sample was then incubated 1 minute at room temperature . 250 \u00b5l of Buffer C [ 0.5 % Tween-20 : <Supp> 0.4 % NaDOC ; 2 M NaCl </Supp> ; 10 mM EDTA ] were immediately added dropwise . The sample was then incubated 5 minutes at room temperature . At this stage the solution clears considerably without increasing its viscosity , and nucleoid becomes visible . Using a cut P1000 pipette tip , the whole sample was gently layered on the top of a 5-30 % w/v sucrose gradient [ 10 mM Tris pH 8.0 <Supp> ; 1 M NaCl ; 1 mM EDTA ; 1 mM DTT </Supp> ] , and centrifuged at 17,000 RPM in a SW55Ti rotor ( Beckman Coulter , cat . 342194 ) for 9 minutes ( 4 \u00b0C ) . After centrifugation , the nucleoid fraction was collected using a syringe with a 18G blunt fill needle , and transferred to a new centrifuge tube . The remaining gradient was assumed to represent the cytosolic fraction . The nucleoid was then resuspended in 2.5 ml Wash & Resuspension buffer [ 40 mM Tris pH 7.5 ; <Supp> 150 mM KCl ; 10 mM MgCl2 ; 1 mM DTT </Supp> ; 0.01 % Triton X-100 ] supplemented with 200 U SUPERase \u2022 In \u2122 RNase Inhibitor , pulse vortexed for 5 seconds , and then centrifuged at 28,000 RPM in a SW55Ti rotor for 30 minutes ( 0 \u00b0C ) . After centrifugation the supernatant was decanted , and the nucleoid pellet was washed twice with 2 ml of Wash & Resuspension buffer , taking care not to disturb it . The nucleoid was then resuspended in 500 \u00b5l Wash & Resuspension buffer , and solubilized by addition of 0.1 gr acid-washed glass beads ( Sigma , cat . G1145 ) , and shaking for 5 minutes in a TissueLyser ( QIAGEN ) . For each 100 \u00b5l of purified nucleoids ( or cytosolic fraction ) , 1 ml of TRIzol \u00ae Reagent ( Invitrogen , cat . 15596-018 ) was added , and RNA was extracted following manufacturer 's instructions . RNA was analyzed on a 2100 Bioanalyzer ( Agilent ) . In all experiments , RNA from cytosolic fraction ( corresponding to mature RNA species ) had RIN > 9.5 . Total RNA yield from nucleoid fraction was ~ 6 % of the total RNA content . "}], "externalCrossReferences": [{"objectId": "GSM2516400", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28934475"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz", "source": "GEO", "id": "GSM2516400", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM2516400", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28934475"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz", "source": "GEO", "id": "GSM2516401", "field": "data_processing", "associatedPhrase": "FastQ files were examined using the FastQC tool . Reads were clipped from 3 ' adapter sequences using Cutadapt v1 .10 , discarding reads shorter than 15 nucleotides . Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( GenBank : <Gversion> U00096 .2 </Gversion> ) was used as the reference genome . Reads were mapped to the reference genome using Bowtie v1 .1.2 , by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes ( parameters : - n 2 - m 7 - a -- best -- strata -5 5 ) . "}], "externalCrossReferences": [{"objectId": "GSM2516401", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28934475"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz", "source": "GEO", "id": "GSM2516401", "field": "data_processing", "associatedPhrase": "FastQ files were examined using the FastQC tool . Reads were clipped from 3 ' adapter sequences using Cutadapt v1 .10 , discarding reads shorter than 15 nucleotides . Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( GenBank : <Gversion> U00096 .2 </Gversion> ) was used as the reference genome . Reads were mapped to the reference genome using Bowtie v1 .1.2 , by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes ( parameters : - n 2 - m 7 - a -- best -- strata -5 5 ) . "}], "externalCrossReferences": [{"objectId": "GSM2516401", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28934475"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz", "source": "GEO", "id": "GSM2516401", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> U00096 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2516401", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28934475"}]}{"id": "", "name": "150 mM KCl ; 10 mM MgCl2 ; 1 mM DTT", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "150 mM KCl ; 10 mM MgCl2 ; 1 mM DTT", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz", "source": "GEO", "id": "GSM2516401", "field": "extract_protocol", "associatedPhrase": "Each bacteria pellet from a 25 ml culture ( OD600 ~ 0.3 ) was homogeneously resuspended in 200 \u00b5l of Buffer A [ 10 mM Tris pH 8.0 ; 20 % Sucrose ; 100 mM NaCl ] supplemented with 200 U SUPERase \u2022 In \u2122 RNase Inhibitor , by pipetting . 50 \u00b5l of Buffer B [ 50 mM EDTA ; 120 mM Tris pH 8.0 ] supplemented with 1 \u00b5l Ready-Lyse \u2122 Lysozyme Solution ( Epicentre , cat . R1810M ) were added dropwise , and the vial was gently tilted 5 times to ensure homogenous mixing . The sample was then incubated 1 minute at room temperature . 250 \u00b5l of Buffer C [ 0.5 % Tween-20 : <Supp> 0.4 % NaDOC ; 2 M NaCl </Supp> ; 10 mM EDTA ] were immediately added dropwise . The sample was then incubated 5 minutes at room temperature . At this stage the solution clears considerably without increasing its viscosity , and nucleoid becomes visible . Using a cut P1000 pipette tip , the whole sample was gently layered on the top of a 5-30 % w/v sucrose gradient [ 10 mM Tris pH 8.0 <Supp> ; 1 M NaCl ; 1 mM EDTA ; 1 mM DTT </Supp> ] , and centrifuged at 17,000 RPM in a SW55Ti rotor ( Beckman Coulter , cat . 342194 ) for 9 minutes ( 4 \u00b0C ) . After centrifugation , the nucleoid fraction was collected using a syringe with a 18G blunt fill needle , and transferred to a new centrifuge tube . The remaining gradient was assumed to represent the cytosolic fraction . The nucleoid was then resuspended in 2.5 ml Wash & Resuspension buffer [ 40 mM Tris pH 7.5 ; <Supp> 150 mM KCl ; 10 mM MgCl2 ; 1 mM DTT </Supp> ; 0.01 % Triton X-100 ] supplemented with 200 U SUPERase \u2022 In \u2122 RNase Inhibitor , pulse vortexed for 5 seconds , and then centrifuged at 28,000 RPM in a SW55Ti rotor for 30 minutes ( 0 \u00b0C ) . After centrifugation the supernatant was decanted , and the nucleoid pellet was washed twice with 2 ml of Wash & Resuspension buffer , taking care not to disturb it . The nucleoid was then resuspended in 500 \u00b5l Wash & Resuspension buffer , and solubilized by addition of 0.1 gr acid-washed glass beads ( Sigma , cat . G1145 ) , and shaking for 5 minutes in a TissueLyser ( QIAGEN ) . For each 100 \u00b5l of purified nucleoids ( or cytosolic fraction ) , 1 ml of TRIzol \u00ae Reagent ( Invitrogen , cat . 15596-018 ) was added , and RNA was extracted following manufacturer 's instructions . RNA was analyzed on a 2100 Bioanalyzer ( Agilent ) . In all experiments , RNA from cytosolic fraction ( corresponding to mature RNA species ) had RIN > 9.5 . Total RNA yield from nucleoid fraction was ~ 6 % of the total RNA content . "}], "externalCrossReferences": [{"objectId": "GSM2516401", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28934475"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz", "source": "GEO", "id": "GSM2516401", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM2516401", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28934475"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz", "source": "GEO", "id": "GSM2516402", "field": "data_processing", "associatedPhrase": "FastQ files were examined using the FastQC tool . Reads were clipped from 3 ' adapter sequences using Cutadapt v1 .10 , discarding reads shorter than 15 nucleotides . Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( GenBank : <Gversion> U00096 .2 </Gversion> ) was used as the reference genome . Reads were mapped to the reference genome using Bowtie v1 .1.2 , by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes ( parameters : - n 2 - m 7 - a -- best -- strata -5 5 ) . "}], "externalCrossReferences": [{"objectId": "GSM2516402", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28934475"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz", "source": "GEO", "id": "GSM2516402", "field": "data_processing", "associatedPhrase": "FastQ files were examined using the FastQC tool . Reads were clipped from 3 ' adapter sequences using Cutadapt v1 .10 , discarding reads shorter than 15 nucleotides . Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( GenBank : <Gversion> U00096 .2 </Gversion> ) was used as the reference genome . Reads were mapped to the reference genome using Bowtie v1 .1.2 , by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes ( parameters : - n 2 - m 7 - a -- best -- strata -5 5 ) . "}], "externalCrossReferences": [{"objectId": "GSM2516402", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28934475"}]}{"id": "", "name": "U00096 .2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "U00096 .2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz", "source": "GEO", "id": "GSM2516402", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> U00096 .2 </Gversion> "}], "externalCrossReferences": [{"objectId": "GSM2516402", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28934475"}]}{"id": "", "name": "150 mM KCl ; 10 mM MgCl2 ; 1 mM DTT", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "150 mM KCl ; 10 mM MgCl2 ; 1 mM DTT", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz", "source": "GEO", "id": "GSM2516402", "field": "extract_protocol", "associatedPhrase": "Each bacteria pellet from a 25 ml culture ( OD600 ~ 0.3 ) was homogeneously resuspended in 200 \u00b5l of Buffer A [ 10 mM Tris pH 8.0 ; 20 % Sucrose ; 100 mM NaCl ] supplemented with 200 U SUPERase \u2022 In \u2122 RNase Inhibitor , by pipetting . 50 \u00b5l of Buffer B [ 50 mM EDTA ; 120 mM Tris pH 8.0 ] supplemented with 1 \u00b5l Ready-Lyse \u2122 Lysozyme Solution ( Epicentre , cat . R1810M ) were added dropwise , and the vial was gently tilted 5 times to ensure homogenous mixing . The sample was then incubated 1 minute at room temperature . 250 \u00b5l of Buffer C [ 0.5 % Tween-20 : <Supp> 0.4 % NaDOC ; 2 M NaCl </Supp> ; 10 mM EDTA ] were immediately added dropwise . The sample was then incubated 5 minutes at room temperature . At this stage the solution clears considerably without increasing its viscosity , and nucleoid becomes visible . Using a cut P1000 pipette tip , the whole sample was gently layered on the top of a 5-30 % w/v sucrose gradient [ 10 mM Tris pH 8.0 <Supp> ; 1 M NaCl ; 1 mM EDTA ; 1 mM DTT </Supp> ] , and centrifuged at 17,000 RPM in a SW55Ti rotor ( Beckman Coulter , cat . 342194 ) for 9 minutes ( 4 \u00b0C ) . After centrifugation , the nucleoid fraction was collected using a syringe with a 18G blunt fill needle , and transferred to a new centrifuge tube . The remaining gradient was assumed to represent the cytosolic fraction . The nucleoid was then resuspended in 2.5 ml Wash & Resuspension buffer [ 40 mM Tris pH 7.5 ; <Supp> 150 mM KCl ; 10 mM MgCl2 ; 1 mM DTT </Supp> ; 0.01 % Triton X-100 ] supplemented with 200 U SUPERase \u2022 In \u2122 RNase Inhibitor , pulse vortexed for 5 seconds , and then centrifuged at 28,000 RPM in a SW55Ti rotor for 30 minutes ( 0 \u00b0C ) . After centrifugation the supernatant was decanted , and the nucleoid pellet was washed twice with 2 ml of Wash & Resuspension buffer , taking care not to disturb it . The nucleoid was then resuspended in 500 \u00b5l Wash & Resuspension buffer , and solubilized by addition of 0.1 gr acid-washed glass beads ( Sigma , cat . G1145 ) , and shaking for 5 minutes in a TissueLyser ( QIAGEN ) . For each 100 \u00b5l of purified nucleoids ( or cytosolic fraction ) , 1 ml of TRIzol \u00ae Reagent ( Invitrogen , cat . 15596-018 ) was added , and RNA was extracted following manufacturer 's instructions . RNA was analyzed on a 2100 Bioanalyzer ( Agilent ) . In all experiments , RNA from cytosolic fraction ( corresponding to mature RNA species ) had RIN > 9.5 . Total RNA yield from nucleoid fraction was ~ 6 % of the total RNA content . "}], "externalCrossReferences": [{"objectId": "GSM2516402", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28934475"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz", "source": "GEO", "id": "GSM2516402", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM2516402", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28934475"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516609", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516609", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516609", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516609", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516609", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516609", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516610", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516610", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516610", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516610", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516610", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516610", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516611", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516611", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516611", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516611", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516611", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516611", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516612", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516612", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516612", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516612", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516612", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516612", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516613", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516613", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516613", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516613", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516613", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516613", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516614", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516614", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516614", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516614", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516614", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516614", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516615", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516615", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516615", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516615", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516615", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516615", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516616", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516616", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516616", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516616", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516616", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516616", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516617", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516617", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516617", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516617", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516617", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516617", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516618", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516618", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516618", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516618", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516618", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516618", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516619", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516619", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516619", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516619", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516619", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516619", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516620", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516620", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516620", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516620", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516620", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516620", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516621", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516621", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516621", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516621", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516621", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516621", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516622", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516622", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516622", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516622", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516622", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516622", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516623", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516623", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516623", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516623", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516623", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516623", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516624", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516624", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516624", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516624", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516624", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516624", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516625", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516625", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516625", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516625", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516625", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516625", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516626", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516626", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516626", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516626", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516626", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516626", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516627", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516627", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516627", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516627", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516627", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516627", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516628", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516628", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516628", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516628", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516628", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516628", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516629", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516629", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516629", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516629", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516629", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516629", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516630", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516630", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516630", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516630", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516630", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516630", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516631", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516631", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516631", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516631", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516631", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516631", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516632", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516632", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516632", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516632", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516632", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516632", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516633", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516633", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516633", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516633", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516633", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516633", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516634", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516634", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516634", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516634", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516634", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516634", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516635", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516635", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516635", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516635", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516635", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516635", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516636", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516636", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516636", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516636", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516636", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516636", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516637", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516637", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516637", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516637", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516637", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516637", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "ASM584v2", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "ASM584v2", "term_id": "", "term_type": "Gversion", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516638", "field": "data_processing", "associatedPhrase": "Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) "}], "externalCrossReferences": [{"objectId": "GSM2516638", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516638", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516638", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz", "source": "GEO", "id": "GSM2516638", "field": "organism", "associatedPhrase": "Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2516638", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "29338696"}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2563999", "field": "data_processing", "associatedPhrase": "The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 using Tophat2 using the following parameters , -- <Gtype> GTF -- library type fr-secondstrand </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2563999", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2563999", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2563999", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2563999", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2563999", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2563999", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM2563999", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564000", "field": "data_processing", "associatedPhrase": "The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 using Tophat2 using the following parameters , -- <Gtype> GTF -- library type fr-secondstrand </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2564000", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564000", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2564000", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564000", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2564000", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564000", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM2564000", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564001", "field": "data_processing", "associatedPhrase": "The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 using Tophat2 using the following parameters , -- <Gtype> GTF -- library type fr-secondstrand </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2564001", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564001", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2564001", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564001", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2564001", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564001", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM2564001", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564002", "field": "data_processing", "associatedPhrase": "The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 using Tophat2 using the following parameters , -- <Gtype> GTF -- library type fr-secondstrand </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2564002", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564002", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2564002", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564002", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2564002", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564002", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM2564002", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564003", "field": "data_processing", "associatedPhrase": "The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 using Tophat2 using the following parameters , -- <Gtype> GTF -- library type fr-secondstrand </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2564003", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564003", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2564003", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564003", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2564003", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564003", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM2564003", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564004", "field": "data_processing", "associatedPhrase": "The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 using Tophat2 using the following parameters , -- <Gtype> GTF -- library type fr-secondstrand </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2564004", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564004", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2564004", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564004", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2564004", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564004", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM2564004", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564005", "field": "data_processing", "associatedPhrase": "The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 using Tophat2 using the following parameters , -- <Gtype> GTF -- library type fr-secondstrand </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2564005", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564005", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2564005", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564005", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2564005", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564005", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM2564005", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564006", "field": "data_processing", "associatedPhrase": "The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 using Tophat2 using the following parameters , -- <Gtype> GTF -- library type fr-secondstrand </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2564006", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564006", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2564006", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564006", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2564006", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564006", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM2564006", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564007", "field": "data_processing", "associatedPhrase": "The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 using Tophat2 using the following parameters , -- <Gtype> GTF -- library type fr-secondstrand </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2564007", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564007", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2564007", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564007", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2564007", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564007", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM2564007", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564008", "field": "data_processing", "associatedPhrase": "The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 using Tophat2 using the following parameters , -- <Gtype> GTF -- library type fr-secondstrand </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2564008", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564008", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2564008", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564008", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2564008", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564008", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM2564008", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564009", "field": "data_processing", "associatedPhrase": "The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 using Tophat2 using the following parameters , -- <Gtype> GTF -- library type fr-secondstrand </Gtype> "}], "externalCrossReferences": [{"objectId": "GSM2564009", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564009", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2564009", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "MG1655", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "MG1655", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564009", "field": "data_processing", "associatedPhrase": "Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> "}], "externalCrossReferences": [{"objectId": "GSM2564009", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "K-12", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "K-12", "term_id": "", "term_type": "Organism", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz", "source": "GEO", "id": "GSM2564009", "field": "characteristics", "associatedPhrase": "strain : <Strain> K-12 </Strain> "}], "externalCrossReferences": [{"objectId": "GSM2564009", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": ""}]}{"id": "", "name": "30 \u00b5M", "description": [{"type": "string similarity", "score": 0}], "terms": [{"name": "30 \u00b5M", "term_id": "", "term_type": "Medium supplement", "source_data": "http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE98660/GSE98660.soft.gz", "source": "GEO", "id": "GSM2608039", "field": "extract_protocol", "associatedPhrase": "total DNaseI treated RNA was depleted of ribosomal RNA using the Ribo-Zero \u2122 RNA removal kit for Gram-negative bacteria ( Epicentre ) . A 3 [ linebreak ] RNA adapter , based on the Illumina multiplexing adapter sequence ( Oligonucleotide sequences \u00a9 2007-2014 Illumina , Inc. . All rights reserved ) blocked at the 3 [ linebreak ] end with an inverted dT ( 5 [ linebreak ] - GAUCGGAAGAGCACACGUCU [ idT ] -3 [ linebreak ] ) , was phosphorylated at the 5 [ linebreak ] end using T4 PNK ( New England Biolabs ) per the manufacturer 's protocol . The 3 [ linebreak ] RNA adapter was ligated to the 3 [ linebreak ] ends of the rRNA depleted RNA using T4 RNA ligase I ( New England Biolabs ) . 1.5 mg of RNA was incubated at 20 \u00b0C for 6 hours in 1X T4 RNA ligase reaction buffer with 1 mM ATP , <Supp> 30 \u00b5M </Supp> 3 [ linebreak ] RNA adapter , 10 % DMSO , 10 U of T4 RNA ligase I , and 40 U of RNasin ( Promega ) in a 20 ml reaction . RNA was then fragmented in equivalents of 100 ng using the RNA fragmentation reagents ( Ambion \u00ae ) per the manufacturer 's protocol at 70 \u00b0C for 3 min and subsequently phosphorylated at the 5 [ linebreak ] ends using T4 PNK ( New England Biolabs ) per the manufacturer 's protocol to allow for ligation of the 5 [ linebreak ] adapter . RNA was size-selected ( \u2248 150-300 nt ) and purified over a denaturing 8 % polyacrylamide/8 M urea/TBE gel . Gel slices were incubated in RNA elution buffer ( 10 mM Tris-HCl , pH 7.5 , 2 mM EDTA , 0.1 % SDS , 0.3 M NaOAc ) with vigorous shaking at 4 \u00b0C overnight . The supernatant was subsequently ethanol precipitated using glycogen as a carrier molecule . The Illumina small RNA 5 [ linebreak ] adapter ( 5 [ linebreak ] - GUUCAGAGUUCUACAGUCCGACGAUC-3 [ linebreak ] ) was ligated to the RNA as described before except the concentration of the adapter was 52 mM and 20 U of T4 RNA ligase I was used in total volume of 25 \u00b5l . The ligated RNAs were size-selected ( \u2248 200-300 nt ) and gel-purified over a denaturing 8 % polyacrylamide/8 M urea/TBE gel ( as described above ) . The di-tagged RNA libraries were reverse-transcribed with SuperScript \u00ae II reverse transcriptase ( Invitrogen ) using random nonamers per the manufacturer 's protocol . RNA was removed using RNase H ( Promega ) per the manufacturer 's protocol and cDNA was amplified in PCR carried out using Phusion \u00ae High-Fidelity Polymerase ( New England Biolabs ) . cDNA was amplified with modified designed Illumina-compatible PCR primers ( 3 ' library Forward 5 ' - CAAGCAGAAGACGGCATACGACAGGTTCAGAGTTCTACAGTCCGA-3 ' ; Reverse 5 ' - AATGATACGGCGACCACCGAGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3 ' ) by 18 cycles of PCR . The products were purified using Agencourt AMPure XP beads ( Beckman ) and analyzed on an Agilent 2100 Bioanalyzer . 3 ' end enriched cDNA libraries were sequenced on individual Genome Analyzer IIx lanes ( 36 bp , single-end ) or on HiSeq 2000 lanes ( 50 bp , single-end ) using primer based on Illumina Multiplexing Read 2 Sequencing Primer ( 5 ' - GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3 ' ) at the CSF NGS unit http://csf.ac.at/ . "}], "externalCrossReferences": [{"objectId": "GSM2608039", "externalCrossReferences_name": "GEO"}], "citations": [{"evidence_id": "", "evidence_name": "NPL-CRF", "pmid": "28648779"}]}