full_unmap_srr_htregulondb.tsv 1.31 MB

Raw Blame History Permalink

SRR	GSE	GSM	GPL	PMID	GSM_NAME	GSE_NAME	GPL_NAME	BANGLINE	SOURCE_TEXT_CTRL	FULL_TEXT	TERM_NAME	TERM_TYPE	PROB	REPO_FILE	TERM_ID	SOURCE	CASE_MATCH	SET	SORT	MAP
SRR5742248	GSE100373	GSM2679694	GPL14548	29669858	WT exp mRNA	The RNA-binding protein Hfq is important for ribosome biogenesis and affects translation fidelity	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	data_processing	Genome_build: U00096.3 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> U00096 .3 </Gversion> 	U00096 .3	Gversion	0.9571804153484504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE100373/GSE100373.soft.gz				0	0	False
SRR5742250	GSE100373	GSM2679696	GPL14548	29669858	Hfq mut exp mRNA	The RNA-binding protein Hfq is important for ribosome biogenesis and affects translation fidelity	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	data_processing	Genome_build: U00096.3 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> U00096 .3 </Gversion> 	U00096 .3	Gversion	0.9571804153484504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE100373/GSE100373.soft.gz				0	0	False
SRR5742250	GSE100373	GSM2679696	GPL14548	29669858	Hfq mut exp mRNA	The RNA-binding protein Hfq is important for ribosome biogenesis and affects translation fidelity	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	source_name	E. coli CMA540(MG1693 ∆hfq::cat) PGCGROWTHCONDITIONS	E. coli CMA540 ( MG1693 <Gtype> ∆ hfq : : cat ) </Gtype> 	∆ hfq : : cat )	Genetic background	0.9432930823000856	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE100373/GSE100373.soft.gz				0	0	False
SRR5742252	GSE100373	GSM2679698	GPL14548	29669858	WT exp RPF	The RNA-binding protein Hfq is important for ribosome biogenesis and affects translation fidelity	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	data_processing	Genome_build: U00096.3 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> U00096 .3 </Gversion> 	U00096 .3	Gversion	0.9571804153484504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE100373/GSE100373.soft.gz				0	0	False
SRR5742254	GSE100373	GSM2679700	GPL14548	29669858	Hfq mut exp RPF	The RNA-binding protein Hfq is important for ribosome biogenesis and affects translation fidelity	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	data_processing	Genome_build: U00096.3 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> U00096 .3 </Gversion> 	U00096 .3	Gversion	0.9571804153484504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE100373/GSE100373.soft.gz				0	0	False
SRR5742254	GSE100373	GSM2679700	GPL14548	29669858	Hfq mut exp RPF	The RNA-binding protein Hfq is important for ribosome biogenesis and affects translation fidelity	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	source_name	E. coli CMA540(MG1693 ∆hfq::cat) PGCGROWTHCONDITIONS	E. coli CMA540 ( MG1693 <Gtype> ∆ hfq : : cat ) </Gtype> 	∆ hfq : : cat )	Genetic background	0.9432930823000856	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE100373/GSE100373.soft.gz				0	0	False
SRR6001737	GSE103421	GSM2770989	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling at 37°C in WT cells_1	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001737	GSE103421	GSM2770989	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling at 37°C in WT cells_1	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001739	GSE103421	GSM2770991	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling 30 min after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001739	GSE103421	GSM2770991	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling 30 min after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001742	GSE103421	GSM2770994	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling 4 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001742	GSE103421	GSM2770994	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling 4 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001743	GSE103421	GSM2770995	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling 6 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001743	GSE103421	GSM2770995	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling 6 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001744	GSE103421	GSM2770996	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling 5 min after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001744	GSE103421	GSM2770996	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling 5 min after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001745	GSE103421	GSM2770997	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling 10 min after shift to 10°C in WT cells_2	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001745	GSE103421	GSM2770997	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling 10 min after shift to 10°C in WT cells_2	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001746	GSE103421	GSM2770998	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling 15 min after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001746	GSE103421	GSM2770998	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling 15 min after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001747SRR6001748	GSE103421	GSM2770999	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling 8 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001747SRR6001748	GSE103421	GSM2770999	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling 8 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001749SRR6001750	GSE103421	GSM2771000	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling 8 hr after shift to 10°C in ∆cspABEG cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001749SRR6001750	GSE103421	GSM2771000	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling 8 hr after shift to 10°C in ∆cspABEG cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 ∆cspABEG PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain> <Gtype> ∆ cspABEG </Gtype> 	∆ cspABEG	Genetic background	0.9969461035976109	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001749SRR6001750	GSE103421	GSM2771000	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling 8 hr after shift to 10°C in ∆cspABEG cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype/variation: {delta}cspABEG PGCGROWTHCONDITIONS	genotype/variation : <Gtype> -LCB- delta -RCB- cspABEG </Gtype> 	-LCB- delta -RCB- cspABEG	Genetic background	0.9996316677898744	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001751	GSE103421	GSM2771001	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling at 37°C in WT cells_2	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001751	GSE103421	GSM2771001	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling at 37°C in WT cells_2	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001752	GSE103421	GSM2771002	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling at 37°C in ∆cspABCEG cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001752	GSE103421	GSM2771002	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling at 37°C in ∆cspABCEG cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 ∆cspABCEG PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain> <Gtype> ∆ cspABCEG </Gtype> 	∆ cspABCEG	Genetic background	0.9969461035976109	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001752	GSE103421	GSM2771002	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Ribosome profiling at 37°C in ∆cspABCEG cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype/variation: {delta}cspABCEG PGCGROWTHCONDITIONS	genotype/variation : <Gtype> -LCB- delta -RCB- cspABCEG </Gtype> 	-LCB- delta -RCB- cspABCEG	Genetic background	0.9996316677898744	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001758	GSE103421	GSM2771008	GPL10328-GPL14548-GPL15010-GPL17439	29628307	mRNA-seq 4 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001758	GSE103421	GSM2771008	GPL10328-GPL14548-GPL15010-GPL17439	29628307	mRNA-seq 4 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001760SRR6001761	GSE103421	GSM2771010	GPL10328-GPL14548-GPL15010-GPL17439	29628307	mRNA-seq 8 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001760SRR6001761	GSE103421	GSM2771010	GPL10328-GPL14548-GPL15010-GPL17439	29628307	mRNA-seq 8 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001762SRR6001763	GSE103421	GSM2771011	GPL10328-GPL14548-GPL15010-GPL17439	29628307	mRNA-seq 8 hr after shift to 10°C in ∆cspABEG cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001762SRR6001763	GSE103421	GSM2771011	GPL10328-GPL14548-GPL15010-GPL17439	29628307	mRNA-seq 8 hr after shift to 10°C in ∆cspABEG cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 ∆cspABEG PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain> <Gtype> ∆ cspABEG </Gtype> 	∆ cspABEG	Genetic background	0.9969461035976109	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001762SRR6001763	GSE103421	GSM2771011	GPL10328-GPL14548-GPL15010-GPL17439	29628307	mRNA-seq 8 hr after shift to 10°C in ∆cspABEG cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype/variation: {delta}cspABEG PGCGROWTHCONDITIONS	genotype/variation : <Gtype> -LCB- delta -RCB- cspABEG </Gtype> 	-LCB- delta -RCB- cspABEG	Genetic background	0.9996316677898744	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001766	GSE103421	GSM2771014	GPL10328-GPL14548-GPL15010-GPL17439	29628307	DMS-seq 30 min after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001766	GSE103421	GSM2771014	GPL10328-GPL14548-GPL15010-GPL17439	29628307	DMS-seq 30 min after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001766	GSE103421	GSM2771014	GPL10328-GPL14548-GPL15010-GPL17439	29628307	DMS-seq 30 min after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	molecule subtype: DMS-modified mRNA PGCGROWTHCONDITIONS	molecule subtype : <Gtype> DMS-modified mRNA </Gtype> 	DMS-modified mRNA	Genetic background	0.9328108068336072	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001769	GSE103421	GSM2771015	GPL10328-GPL14548-GPL15010-GPL17439	29628307	DMS-seq 6 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001769	GSE103421	GSM2771015	GPL10328-GPL14548-GPL15010-GPL17439	29628307	DMS-seq 6 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001769	GSE103421	GSM2771015	GPL10328-GPL14548-GPL15010-GPL17439	29628307	DMS-seq 6 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	molecule subtype: DMS-modified mRNA PGCGROWTHCONDITIONS	molecule subtype : <Gtype> DMS-modified mRNA </Gtype> 	DMS-modified mRNA	Genetic background	0.9328108068336072	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001772	GSE103421	GSM2771016	GPL10328-GPL14548-GPL15010-GPL17439	29628307	DMS-seq 8 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001772	GSE103421	GSM2771016	GPL10328-GPL14548-GPL15010-GPL17439	29628307	DMS-seq 8 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001772	GSE103421	GSM2771016	GPL10328-GPL14548-GPL15010-GPL17439	29628307	DMS-seq 8 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	molecule subtype: DMS-modified mRNA PGCGROWTHCONDITIONS	molecule subtype : <Gtype> DMS-modified mRNA </Gtype> 	DMS-modified mRNA	Genetic background	0.9328108068336072	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001773	GSE103421	GSM2771017	GPL10328-GPL14548-GPL15010-GPL17439	29628307	DMS-seq 8 hr after shift to 10°C in ∆cspABEG cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001773	GSE103421	GSM2771017	GPL10328-GPL14548-GPL15010-GPL17439	29628307	DMS-seq 8 hr after shift to 10°C in ∆cspABEG cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 ∆cspABEG PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain> <Gtype> ∆ cspABEG </Gtype> 	∆ cspABEG	Genetic background	0.9969461035976109	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001773	GSE103421	GSM2771017	GPL10328-GPL14548-GPL15010-GPL17439	29628307	DMS-seq 8 hr after shift to 10°C in ∆cspABEG cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype/variation: {delta}cspABEG PGCGROWTHCONDITIONS	genotype/variation : <Gtype> -LCB- delta -RCB- cspABEG </Gtype> 	-LCB- delta -RCB- cspABEG	Genetic background	0.9996316677898744	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001773	GSE103421	GSM2771017	GPL10328-GPL14548-GPL15010-GPL17439	29628307	DMS-seq 8 hr after shift to 10°C in ∆cspABEG cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	molecule subtype: DMS-modified mRNA PGCGROWTHCONDITIONS	molecule subtype : <Gtype> DMS-modified mRNA </Gtype> 	DMS-modified mRNA	Genetic background	0.9328108068336072	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001774	GSE103421	GSM2771018	GPL10328-GPL14548-GPL15010-GPL17439	29628307	DMS-seq 8 hr after shift to 10°C in ∆cspBG cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001774	GSE103421	GSM2771018	GPL10328-GPL14548-GPL15010-GPL17439	29628307	DMS-seq 8 hr after shift to 10°C in ∆cspBG cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 ∆cspBG PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain> <Gtype> ∆ cspBG </Gtype> 	∆ cspBG	Genetic background	0.9969461035976109	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001774	GSE103421	GSM2771018	GPL10328-GPL14548-GPL15010-GPL17439	29628307	DMS-seq 8 hr after shift to 10°C in ∆cspBG cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype/variation: {delta}cspBG PGCGROWTHCONDITIONS	genotype/variation : <Gtype> -LCB- delta -RCB- cspBG </Gtype> 	-LCB- delta -RCB- cspBG	Genetic background	0.9996316677898744	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001774	GSE103421	GSM2771018	GPL10328-GPL14548-GPL15010-GPL17439	29628307	DMS-seq 8 hr after shift to 10°C in ∆cspBG cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	molecule subtype: DMS-modified mRNA PGCGROWTHCONDITIONS	molecule subtype : <Gtype> DMS-modified mRNA </Gtype> 	DMS-modified mRNA	Genetic background	0.9328108068336072	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001775	GSE103421	GSM2771019	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq 20 min after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001775	GSE103421	GSM2771019	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq 20 min after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001776	GSE103421	GSM2771020	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq 4 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001776	GSE103421	GSM2771020	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq 4 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001777	GSE103421	GSM2771021	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq 8 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001777	GSE103421	GSM2771021	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq 8 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001778	GSE103421	GSM2771022	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq 20 min after shift to 10°C in ∆rnr cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001778	GSE103421	GSM2771022	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq 20 min after shift to 10°C in ∆rnr cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 ∆rnr PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain> <Gtype> ∆ rnr </Gtype> 	∆ rnr	Genetic background	0.9909742294363848	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001778	GSE103421	GSM2771022	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq 20 min after shift to 10°C in ∆rnr cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype/variation: {delta}rnr PGCGROWTHCONDITIONS	genotype/variation : <Gtype> -LCB- delta -RCB- rnr </Gtype> 	-LCB- delta -RCB- rnr	Genetic background	0.9984195580373234	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001779	GSE103421	GSM2771023	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq 4 hr after shift to 10°C in ∆rnr cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001779	GSE103421	GSM2771023	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq 4 hr after shift to 10°C in ∆rnr cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 ∆rnr PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain> <Gtype> ∆ rnr </Gtype> 	∆ rnr	Genetic background	0.9909742294363848	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001779	GSE103421	GSM2771023	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq 4 hr after shift to 10°C in ∆rnr cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype/variation: {delta}rnr PGCGROWTHCONDITIONS	genotype/variation : <Gtype> -LCB- delta -RCB- rnr </Gtype> 	-LCB- delta -RCB- rnr	Genetic background	0.9984195580373234	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001780	GSE103421	GSM2771024	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq 8 hr after shift to 10°C in ∆rnr cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001780	GSE103421	GSM2771024	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq 8 hr after shift to 10°C in ∆rnr cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 ∆rnr PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain> <Gtype> ∆ rnr </Gtype> 	∆ rnr	Genetic background	0.9909742294363848	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001780	GSE103421	GSM2771024	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq 8 hr after shift to 10°C in ∆rnr cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype/variation: {delta}rnr PGCGROWTHCONDITIONS	genotype/variation : <Gtype> -LCB- delta -RCB- rnr </Gtype> 	-LCB- delta -RCB- rnr	Genetic background	0.9984195580373234	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001781	GSE103421	GSM2771025	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq before rifampicin treatment -- 2 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001781	GSE103421	GSM2771025	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq before rifampicin treatment -- 2 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001782	GSE103421	GSM2771026	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq after rifampicin treatment -- 4 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001782	GSE103421	GSM2771026	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq after rifampicin treatment -- 4 hr after shift to 10°C in WT cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001783	GSE103421	GSM2771027	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq before rifampicin treatment -- 2 hr after shift to 10°C in ∆rnr cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001783	GSE103421	GSM2771027	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq before rifampicin treatment -- 2 hr after shift to 10°C in ∆rnr cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 ∆rnr PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain> <Gtype> ∆ rnr </Gtype> 	∆ rnr	Genetic background	0.9909742294363848	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001783	GSE103421	GSM2771027	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq before rifampicin treatment -- 2 hr after shift to 10°C in ∆rnr cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype/variation: {delta}rnr PGCGROWTHCONDITIONS	genotype/variation : <Gtype> -LCB- delta -RCB- rnr </Gtype> 	-LCB- delta -RCB- rnr	Genetic background	0.9984195580373234	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001784	GSE103421	GSM2771028	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq after rifampicin treatment -- 4 hr after shift to 10°C in ∆rnr cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001784	GSE103421	GSM2771028	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq after rifampicin treatment -- 4 hr after shift to 10°C in ∆rnr cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	MG1655 ∆rnr PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain> <Gtype> ∆ rnr </Gtype> 	∆ rnr	Genetic background	0.9909742294363848	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6001784	GSE103421	GSM2771028	GPL10328-GPL14548-GPL15010-GPL17439	29628307	Total RNA-seq after rifampicin treatment -- 4 hr after shift to 10°C in ∆rnr cells	A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype/variation: {delta}rnr PGCGROWTHCONDITIONS	genotype/variation : <Gtype> -LCB- delta -RCB- rnr </Gtype> 	-LCB- delta -RCB- rnr	Genetic background	0.9984195580373234	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103421/GSE103421.soft.gz				0	0	False
SRR6048166	GSE103937	GSM2786596	GPL24020	29474582	WT glucose_replicate1	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	growth_protocol	Viable clones of the UvsW-expressing strains GJ13531 (Δrho) and GJ13507 (ΔnusG) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 /pHYD2412 on glucose-minimal A plates supplemented with Xgal and IPTG at 200 μM (for Δrho) or 3 μM (for ΔnusG), as previously described PGCGROWTHCONDITIONS	Viable clones of the UvsW-expressing strains GJ13531 ( Δrho ) and GJ13507 ( ΔnusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 μM ( for Δrho ) or 3 μM ( for ΔnusG ) , as previously described 	Xgal and IPTG	Medium supplement	0.99181532139668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048166	GSE103937	GSM2786596	GPL24020	29474582	WT glucose_replicate1	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	treatment_protocol	Starting from single colonies, the following cultures were set up in triplicate for overnight incubation: GJ13507, GJ13531, and GJ13533 in glucose-minimal A; and GJ13519 also in 0.2% glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG, with the exception of the cultures of GJ13507 whose supplementation with IPTG was at 3 μM. The overnight-grown cultures were each subcultured into 20 ml of fresh medium of the same composition, with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder, and grown to an A600 of 0.4 to 0.45, before the cells were harvested for making the RNA preparations PGCGROWTHCONDITIONS	Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 μM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations 	of fresh medium	Medium	0.9467445315200714	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048167	GSE103937	GSM2786597	GPL24020	29474582	WT glucose_replicate2	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	growth_protocol	Viable clones of the UvsW-expressing strains GJ13531 (Δrho) and GJ13507 (ΔnusG) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 /pHYD2412 on glucose-minimal A plates supplemented with Xgal and IPTG at 200 μM (for Δrho) or 3 μM (for ΔnusG), as previously described PGCGROWTHCONDITIONS	Viable clones of the UvsW-expressing strains GJ13531 ( Δrho ) and GJ13507 ( ΔnusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 μM ( for Δrho ) or 3 μM ( for ΔnusG ) , as previously described 	Xgal and IPTG	Medium supplement	0.99181532139668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048167	GSE103937	GSM2786597	GPL24020	29474582	WT glucose_replicate2	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	treatment_protocol	Starting from single colonies, the following cultures were set up in triplicate for overnight incubation: GJ13507, GJ13531, and GJ13533 in glucose-minimal A; and GJ13519 also in 0.2% glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG, with the exception of the cultures of GJ13507 whose supplementation with IPTG was at 3 μM. The overnight-grown cultures were each subcultured into 20 ml of fresh medium of the same composition, with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder, and grown to an A600 of 0.4 to 0.45, before the cells were harvested for making the RNA preparations PGCGROWTHCONDITIONS	Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 μM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations 	of fresh medium	Medium	0.9467445315200714	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048168	GSE103937	GSM2786598	GPL24020	29474582	WT glucose_replicate3	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	growth_protocol	Viable clones of the UvsW-expressing strains GJ13531 (Δrho) and GJ13507 (ΔnusG) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 /pHYD2412 on glucose-minimal A plates supplemented with Xgal and IPTG at 200 μM (for Δrho) or 3 μM (for ΔnusG), as previously described PGCGROWTHCONDITIONS	Viable clones of the UvsW-expressing strains GJ13531 ( Δrho ) and GJ13507 ( ΔnusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 μM ( for Δrho ) or 3 μM ( for ΔnusG ) , as previously described 	Xgal and IPTG	Medium supplement	0.99181532139668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048168	GSE103937	GSM2786598	GPL24020	29474582	WT glucose_replicate3	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	treatment_protocol	Starting from single colonies, the following cultures were set up in triplicate for overnight incubation: GJ13507, GJ13531, and GJ13533 in glucose-minimal A; and GJ13519 also in 0.2% glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG, with the exception of the cultures of GJ13507 whose supplementation with IPTG was at 3 μM. The overnight-grown cultures were each subcultured into 20 ml of fresh medium of the same composition, with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder, and grown to an A600 of 0.4 to 0.45, before the cells were harvested for making the RNA preparations PGCGROWTHCONDITIONS	Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 μM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations 	of fresh medium	Medium	0.9467445315200714	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048169	GSE103937	GSM2786599	GPL24020	29474582	WT_glycerol_replicate1	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	growth_protocol	Viable clones of the UvsW-expressing strains GJ13531 (Δrho) and GJ13507 (ΔnusG) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 /pHYD2412 on glucose-minimal A plates supplemented with Xgal and IPTG at 200 μM (for Δrho) or 3 μM (for ΔnusG), as previously described PGCGROWTHCONDITIONS	Viable clones of the UvsW-expressing strains GJ13531 ( Δrho ) and GJ13507 ( ΔnusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 μM ( for Δrho ) or 3 μM ( for ΔnusG ) , as previously described 	Xgal and IPTG	Medium supplement	0.99181532139668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048169	GSE103937	GSM2786599	GPL24020	29474582	WT_glycerol_replicate1	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	treatment_protocol	Starting from single colonies, the following cultures were set up in triplicate for overnight incubation: GJ13507, GJ13531, and GJ13533 in glucose-minimal A; and GJ13519 also in 0.2% glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG, with the exception of the cultures of GJ13507 whose supplementation with IPTG was at 3 μM. The overnight-grown cultures were each subcultured into 20 ml of fresh medium of the same composition, with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder, and grown to an A600 of 0.4 to 0.45, before the cells were harvested for making the RNA preparations PGCGROWTHCONDITIONS	Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 μM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations 	of fresh medium	Medium	0.9467445315200714	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048170	GSE103937	GSM2786600	GPL24020	29474582	WT_glycerol_replicate2	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	growth_protocol	Viable clones of the UvsW-expressing strains GJ13531 (Δrho) and GJ13507 (ΔnusG) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 /pHYD2412 on glucose-minimal A plates supplemented with Xgal and IPTG at 200 μM (for Δrho) or 3 μM (for ΔnusG), as previously described PGCGROWTHCONDITIONS	Viable clones of the UvsW-expressing strains GJ13531 ( Δrho ) and GJ13507 ( ΔnusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 μM ( for Δrho ) or 3 μM ( for ΔnusG ) , as previously described 	Xgal and IPTG	Medium supplement	0.99181532139668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048170	GSE103937	GSM2786600	GPL24020	29474582	WT_glycerol_replicate2	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	treatment_protocol	Starting from single colonies, the following cultures were set up in triplicate for overnight incubation: GJ13507, GJ13531, and GJ13533 in glucose-minimal A; and GJ13519 also in 0.2% glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG, with the exception of the cultures of GJ13507 whose supplementation with IPTG was at 3 μM. The overnight-grown cultures were each subcultured into 20 ml of fresh medium of the same composition, with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder, and grown to an A600 of 0.4 to 0.45, before the cells were harvested for making the RNA preparations PGCGROWTHCONDITIONS	Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 μM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations 	of fresh medium	Medium	0.9467445315200714	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048171	GSE103937	GSM2786601	GPL24020	29474582	WT_glycerol_replicate3	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	growth_protocol	Viable clones of the UvsW-expressing strains GJ13531 (Δrho) and GJ13507 (ΔnusG) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 /pHYD2412 on glucose-minimal A plates supplemented with Xgal and IPTG at 200 μM (for Δrho) or 3 μM (for ΔnusG), as previously described PGCGROWTHCONDITIONS	Viable clones of the UvsW-expressing strains GJ13531 ( Δrho ) and GJ13507 ( ΔnusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 μM ( for Δrho ) or 3 μM ( for ΔnusG ) , as previously described 	Xgal and IPTG	Medium supplement	0.99181532139668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048171	GSE103937	GSM2786601	GPL24020	29474582	WT_glycerol_replicate3	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	treatment_protocol	Starting from single colonies, the following cultures were set up in triplicate for overnight incubation: GJ13507, GJ13531, and GJ13533 in glucose-minimal A; and GJ13519 also in 0.2% glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG, with the exception of the cultures of GJ13507 whose supplementation with IPTG was at 3 μM. The overnight-grown cultures were each subcultured into 20 ml of fresh medium of the same composition, with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder, and grown to an A600 of 0.4 to 0.45, before the cells were harvested for making the RNA preparations PGCGROWTHCONDITIONS	Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 μM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations 	of fresh medium	Medium	0.9467445315200714	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048172	GSE103937	GSM2786602	GPL24020	29474582	WT UvsW_replicate1	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	growth_protocol	Viable clones of the UvsW-expressing strains GJ13531 (Δrho) and GJ13507 (ΔnusG) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 /pHYD2412 on glucose-minimal A plates supplemented with Xgal and IPTG at 200 μM (for Δrho) or 3 μM (for ΔnusG), as previously described PGCGROWTHCONDITIONS	Viable clones of the UvsW-expressing strains GJ13531 ( Δrho ) and GJ13507 ( ΔnusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 μM ( for Δrho ) or 3 μM ( for ΔnusG ) , as previously described 	Xgal and IPTG	Medium supplement	0.99181532139668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048172	GSE103937	GSM2786602	GPL24020	29474582	WT UvsW_replicate1	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	treatment_protocol	Starting from single colonies, the following cultures were set up in triplicate for overnight incubation: GJ13507, GJ13531, and GJ13533 in glucose-minimal A; and GJ13519 also in 0.2% glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG, with the exception of the cultures of GJ13507 whose supplementation with IPTG was at 3 μM. The overnight-grown cultures were each subcultured into 20 ml of fresh medium of the same composition, with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder, and grown to an A600 of 0.4 to 0.45, before the cells were harvested for making the RNA preparations PGCGROWTHCONDITIONS	Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 μM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations 	of fresh medium	Medium	0.9467445315200714	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048173	GSE103937	GSM2786603	GPL24020	29474582	WT UvsW_replicate2	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	growth_protocol	Viable clones of the UvsW-expressing strains GJ13531 (Δrho) and GJ13507 (ΔnusG) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 /pHYD2412 on glucose-minimal A plates supplemented with Xgal and IPTG at 200 μM (for Δrho) or 3 μM (for ΔnusG), as previously described PGCGROWTHCONDITIONS	Viable clones of the UvsW-expressing strains GJ13531 ( Δrho ) and GJ13507 ( ΔnusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 μM ( for Δrho ) or 3 μM ( for ΔnusG ) , as previously described 	Xgal and IPTG	Medium supplement	0.99181532139668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048173	GSE103937	GSM2786603	GPL24020	29474582	WT UvsW_replicate2	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	treatment_protocol	Starting from single colonies, the following cultures were set up in triplicate for overnight incubation: GJ13507, GJ13531, and GJ13533 in glucose-minimal A; and GJ13519 also in 0.2% glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG, with the exception of the cultures of GJ13507 whose supplementation with IPTG was at 3 μM. The overnight-grown cultures were each subcultured into 20 ml of fresh medium of the same composition, with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder, and grown to an A600 of 0.4 to 0.45, before the cells were harvested for making the RNA preparations PGCGROWTHCONDITIONS	Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 μM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations 	of fresh medium	Medium	0.9467445315200714	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048174	GSE103937	GSM2786604	GPL24020	29474582	WT UvsW_replicate3	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	growth_protocol	Viable clones of the UvsW-expressing strains GJ13531 (Δrho) and GJ13507 (ΔnusG) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 /pHYD2412 on glucose-minimal A plates supplemented with Xgal and IPTG at 200 μM (for Δrho) or 3 μM (for ΔnusG), as previously described PGCGROWTHCONDITIONS	Viable clones of the UvsW-expressing strains GJ13531 ( Δrho ) and GJ13507 ( ΔnusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 μM ( for Δrho ) or 3 μM ( for ΔnusG ) , as previously described 	Xgal and IPTG	Medium supplement	0.99181532139668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048174	GSE103937	GSM2786604	GPL24020	29474582	WT UvsW_replicate3	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	treatment_protocol	Starting from single colonies, the following cultures were set up in triplicate for overnight incubation: GJ13507, GJ13531, and GJ13533 in glucose-minimal A; and GJ13519 also in 0.2% glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG, with the exception of the cultures of GJ13507 whose supplementation with IPTG was at 3 μM. The overnight-grown cultures were each subcultured into 20 ml of fresh medium of the same composition, with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder, and grown to an A600 of 0.4 to 0.45, before the cells were harvested for making the RNA preparations PGCGROWTHCONDITIONS	Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 μM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations 	of fresh medium	Medium	0.9467445315200714	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048175	GSE103937	GSM2786605	GPL24020	29474582	∆rho UvsW_replicate1	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	growth_protocol	Viable clones of the UvsW-expressing strains GJ13531 (Δrho) and GJ13507 (ΔnusG) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 /pHYD2412 on glucose-minimal A plates supplemented with Xgal and IPTG at 200 μM (for Δrho) or 3 μM (for ΔnusG), as previously described PGCGROWTHCONDITIONS	Viable clones of the UvsW-expressing strains GJ13531 ( Δrho ) and GJ13507 ( ΔnusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 μM ( for Δrho ) or 3 μM ( for ΔnusG ) , as previously described 	Xgal and IPTG	Medium supplement	0.99181532139668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048175	GSE103937	GSM2786605	GPL24020	29474582	∆rho UvsW_replicate1	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	treatment_protocol	Starting from single colonies, the following cultures were set up in triplicate for overnight incubation: GJ13507, GJ13531, and GJ13533 in glucose-minimal A; and GJ13519 also in 0.2% glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG, with the exception of the cultures of GJ13507 whose supplementation with IPTG was at 3 μM. The overnight-grown cultures were each subcultured into 20 ml of fresh medium of the same composition, with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder, and grown to an A600 of 0.4 to 0.45, before the cells were harvested for making the RNA preparations PGCGROWTHCONDITIONS	Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 μM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations 	of fresh medium	Medium	0.9467445315200714	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048175	GSE103937	GSM2786605	GPL24020	29474582	∆rho UvsW_replicate1	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	characteristics	genotype: {delta}rho PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- rho </Gtype> 	-LCB- delta -RCB- rho	Genetic background	0.9984216184468724	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048176	GSE103937	GSM2786606	GPL24020	29474582	∆rho UvsW_replicate2	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	growth_protocol	Viable clones of the UvsW-expressing strains GJ13531 (Δrho) and GJ13507 (ΔnusG) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 /pHYD2412 on glucose-minimal A plates supplemented with Xgal and IPTG at 200 μM (for Δrho) or 3 μM (for ΔnusG), as previously described PGCGROWTHCONDITIONS	Viable clones of the UvsW-expressing strains GJ13531 ( Δrho ) and GJ13507 ( ΔnusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 μM ( for Δrho ) or 3 μM ( for ΔnusG ) , as previously described 	Xgal and IPTG	Medium supplement	0.99181532139668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048176	GSE103937	GSM2786606	GPL24020	29474582	∆rho UvsW_replicate2	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	treatment_protocol	Starting from single colonies, the following cultures were set up in triplicate for overnight incubation: GJ13507, GJ13531, and GJ13533 in glucose-minimal A; and GJ13519 also in 0.2% glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG, with the exception of the cultures of GJ13507 whose supplementation with IPTG was at 3 μM. The overnight-grown cultures were each subcultured into 20 ml of fresh medium of the same composition, with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder, and grown to an A600 of 0.4 to 0.45, before the cells were harvested for making the RNA preparations PGCGROWTHCONDITIONS	Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 μM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations 	of fresh medium	Medium	0.9467445315200714	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048176	GSE103937	GSM2786606	GPL24020	29474582	∆rho UvsW_replicate2	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	characteristics	genotype: {delta}rho PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- rho </Gtype> 	-LCB- delta -RCB- rho	Genetic background	0.9984216184468724	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048177	GSE103937	GSM2786607	GPL24020	29474582	∆rho UvsW_replicate3	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	growth_protocol	Viable clones of the UvsW-expressing strains GJ13531 (Δrho) and GJ13507 (ΔnusG) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 /pHYD2412 on glucose-minimal A plates supplemented with Xgal and IPTG at 200 μM (for Δrho) or 3 μM (for ΔnusG), as previously described PGCGROWTHCONDITIONS	Viable clones of the UvsW-expressing strains GJ13531 ( Δrho ) and GJ13507 ( ΔnusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 μM ( for Δrho ) or 3 μM ( for ΔnusG ) , as previously described 	Xgal and IPTG	Medium supplement	0.99181532139668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048177	GSE103937	GSM2786607	GPL24020	29474582	∆rho UvsW_replicate3	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	treatment_protocol	Starting from single colonies, the following cultures were set up in triplicate for overnight incubation: GJ13507, GJ13531, and GJ13533 in glucose-minimal A; and GJ13519 also in 0.2% glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG, with the exception of the cultures of GJ13507 whose supplementation with IPTG was at 3 μM. The overnight-grown cultures were each subcultured into 20 ml of fresh medium of the same composition, with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder, and grown to an A600 of 0.4 to 0.45, before the cells were harvested for making the RNA preparations PGCGROWTHCONDITIONS	Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 μM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations 	of fresh medium	Medium	0.9467445315200714	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048177	GSE103937	GSM2786607	GPL24020	29474582	∆rho UvsW_replicate3	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	characteristics	genotype: {delta}rho PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- rho </Gtype> 	-LCB- delta -RCB- rho	Genetic background	0.9984216184468724	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048178	GSE103937	GSM2786608	GPL24020	29474582	∆nusG UvsW_replicate1	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	growth_protocol	Viable clones of the UvsW-expressing strains GJ13531 (Δrho) and GJ13507 (ΔnusG) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 /pHYD2412 on glucose-minimal A plates supplemented with Xgal and IPTG at 200 μM (for Δrho) or 3 μM (for ΔnusG), as previously described PGCGROWTHCONDITIONS	Viable clones of the UvsW-expressing strains GJ13531 ( Δrho ) and GJ13507 ( ΔnusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 μM ( for Δrho ) or 3 μM ( for ΔnusG ) , as previously described 	Xgal and IPTG	Medium supplement	0.99181532139668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048178	GSE103937	GSM2786608	GPL24020	29474582	∆nusG UvsW_replicate1	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	treatment_protocol	Starting from single colonies, the following cultures were set up in triplicate for overnight incubation: GJ13507, GJ13531, and GJ13533 in glucose-minimal A; and GJ13519 also in 0.2% glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG, with the exception of the cultures of GJ13507 whose supplementation with IPTG was at 3 μM. The overnight-grown cultures were each subcultured into 20 ml of fresh medium of the same composition, with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder, and grown to an A600 of 0.4 to 0.45, before the cells were harvested for making the RNA preparations PGCGROWTHCONDITIONS	Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 μM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations 	of fresh medium	Medium	0.9467445315200714	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048178	GSE103937	GSM2786608	GPL24020	29474582	∆nusG UvsW_replicate1	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	characteristics	genotype: {delta}nusG PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- nusG </Gtype> 	-LCB- delta -RCB- nusG	Genetic background	0.9996321218501696	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048179	GSE103937	GSM2786609	GPL24020	29474582	∆nusG UvsW_replicate2	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	growth_protocol	Viable clones of the UvsW-expressing strains GJ13531 (Δrho) and GJ13507 (ΔnusG) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 /pHYD2412 on glucose-minimal A plates supplemented with Xgal and IPTG at 200 μM (for Δrho) or 3 μM (for ΔnusG), as previously described PGCGROWTHCONDITIONS	Viable clones of the UvsW-expressing strains GJ13531 ( Δrho ) and GJ13507 ( ΔnusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 μM ( for Δrho ) or 3 μM ( for ΔnusG ) , as previously described 	Xgal and IPTG	Medium supplement	0.99181532139668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048179	GSE103937	GSM2786609	GPL24020	29474582	∆nusG UvsW_replicate2	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	treatment_protocol	Starting from single colonies, the following cultures were set up in triplicate for overnight incubation: GJ13507, GJ13531, and GJ13533 in glucose-minimal A; and GJ13519 also in 0.2% glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG, with the exception of the cultures of GJ13507 whose supplementation with IPTG was at 3 μM. The overnight-grown cultures were each subcultured into 20 ml of fresh medium of the same composition, with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder, and grown to an A600 of 0.4 to 0.45, before the cells were harvested for making the RNA preparations PGCGROWTHCONDITIONS	Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 μM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations 	of fresh medium	Medium	0.9467445315200714	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048179	GSE103937	GSM2786609	GPL24020	29474582	∆nusG UvsW_replicate2	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	characteristics	genotype: {delta}nusG PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- nusG </Gtype> 	-LCB- delta -RCB- nusG	Genetic background	0.9996321218501696	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048180	GSE103937	GSM2786610	GPL24020	29474582	∆nusG UvsW_replicate3	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	growth_protocol	Viable clones of the UvsW-expressing strains GJ13531 (Δrho) and GJ13507 (ΔnusG) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 /pHYD2412 on glucose-minimal A plates supplemented with Xgal and IPTG at 200 μM (for Δrho) or 3 μM (for ΔnusG), as previously described PGCGROWTHCONDITIONS	Viable clones of the UvsW-expressing strains GJ13531 ( Δrho ) and GJ13507 ( ΔnusG ) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 / pHYD2412 on glucose-minimal A plates supplemented with <Supp> Xgal and IPTG </Supp> at 200 μM ( for Δrho ) or 3 μM ( for ΔnusG ) , as previously described 	Xgal and IPTG	Medium supplement	0.99181532139668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048180	GSE103937	GSM2786610	GPL24020	29474582	∆nusG UvsW_replicate3	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	treatment_protocol	Starting from single colonies, the following cultures were set up in triplicate for overnight incubation: GJ13507, GJ13531, and GJ13533 in glucose-minimal A; and GJ13519 also in 0.2% glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG, with the exception of the cultures of GJ13507 whose supplementation with IPTG was at 3 μM. The overnight-grown cultures were each subcultured into 20 ml of fresh medium of the same composition, with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder, and grown to an A600 of 0.4 to 0.45, before the cells were harvested for making the RNA preparations PGCGROWTHCONDITIONS	Starting from single colonies , the following cultures were set up in triplicate for overnight incubation : GJ13507 , GJ13531 , and GJ13533 in glucose-minimal A ; and GJ13519 also in 0.2 % glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG , with the exception of the cultures of GJ13507 whose supplementation with <Supp> IPTG was </Supp> at 3 μM . The overnight-grown cultures were each subcultured into 20 ml <Med> of fresh medium </Med> of the same composition , with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder , and grown to an A600 of 0.4 to 0.45 , before the cells were harvested for making the RNA preparations 	of fresh medium	Medium	0.9467445315200714	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6048180	GSE103937	GSM2786610	GPL24020	29474582	∆nusG UvsW_replicate3	Genome-wide relationship between R-loop formation and antisense transcription in Escherichia coli	GPL24020: Illumina NextSeq 500 (Escherichia coli K-12)	characteristics	genotype: {delta}nusG PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- nusG </Gtype> 	-LCB- delta -RCB- nusG	Genetic background	0.9996321218501696	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE103937/GSE103937.soft.gz				0	0	False
SRR6305247	GSE107093	GSM2861128	GPL18133	29578536	R2 DH10BGFP_pLys_M1_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305247	GSE107093	GSM2861128	GPL18133	29578536	R2 DH10BGFP_pLys_M1_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305247	GSE107093	GSM2861128	GPL18133	29578536	R2 DH10BGFP_pLys_M1_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305248	GSE107093	GSM2861129	GPL18133	29578536	R3 DH10BGFP_pSB1C3_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305248	GSE107093	GSM2861129	GPL18133	29578536	R3 DH10BGFP_pSB1C3_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305248	GSE107093	GSM2861129	GPL18133	29578536	R3 DH10BGFP_pSB1C3_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305251	GSE107093	GSM2861132	GPL18133	29578536	R6 DH10BGFP_pD864_LacZ_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305251	GSE107093	GSM2861132	GPL18133	29578536	R6 DH10BGFP_pD864_LacZ_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305251	GSE107093	GSM2861132	GPL18133	29578536	R6 DH10BGFP_pD864_LacZ_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305256	GSE107093	GSM2861137	GPL18133	29578536	R11 DH10BGFP_pLys_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305256	GSE107093	GSM2861137	GPL18133	29578536	R11 DH10BGFP_pLys_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305256	GSE107093	GSM2861137	GPL18133	29578536	R11 DH10BGFP_pLys_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305261	GSE107093	GSM2861142	GPL18133	29578536	R16 MG1655GFP_pLys_M1_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305261	GSE107093	GSM2861142	GPL18133	29578536	R16 MG1655GFP_pLys_M1_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305261	GSE107093	GSM2861142	GPL18133	29578536	R16 MG1655GFP_pLys_M1_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305264	GSE107093	GSM2861145	GPL18133	29578536	R19 MG1655GFP_Lux_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305264	GSE107093	GSM2861145	GPL18133	29578536	R19 MG1655GFP_Lux_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305264	GSE107093	GSM2861145	GPL18133	29578536	R19 MG1655GFP_Lux_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305271	GSE107093	GSM2861152	GPL18133	29578536	R26 MG1655GFP_Lux_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305271	GSE107093	GSM2861152	GPL18133	29578536	R26 MG1655GFP_Lux_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305271	GSE107093	GSM2861152	GPL18133	29578536	R26 MG1655GFP_Lux_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305272	GSE107093	GSM2861153	GPL18133	29578536	R27 MG1655GFP_pD864_LacZ_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305272	GSE107093	GSM2861153	GPL18133	29578536	R27 MG1655GFP_pD864_LacZ_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305272	GSE107093	GSM2861153	GPL18133	29578536	R27 MG1655GFP_pD864_LacZ_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305274	GSE107093	GSM2861155	GPL18133	29578536	R29 DH10BGFP_None_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305274	GSE107093	GSM2861155	GPL18133	29578536	R29 DH10BGFP_None_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305274	GSE107093	GSM2861155	GPL18133	29578536	R29 DH10BGFP_None_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305274	GSE107093	GSM2861155	GPL18133	29578536	R29 DH10BGFP_None_1	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	treatment: 15 min PGCGROWTHCONDITIONS	treatment : <Supp> 15 min </Supp> 	15 min	Medium supplement	0.9928933150810246	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305278	GSE107093	GSM2861159	GPL18133	29578536	B3 DH10BGFP_pSB1C3_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305278	GSE107093	GSM2861159	GPL18133	29578536	B3 DH10BGFP_pSB1C3_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305278	GSE107093	GSM2861159	GPL18133	29578536	B3 DH10BGFP_pSB1C3_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305279	GSE107093	GSM2861160	GPL18133	29578536	B4 DH10BGFP_pLys_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305279	GSE107093	GSM2861160	GPL18133	29578536	B4 DH10BGFP_pLys_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305279	GSE107093	GSM2861160	GPL18133	29578536	B4 DH10BGFP_pLys_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305282	GSE107093	GSM2861163	GPL18133	29578536	B7 DH10BGFP_pD864_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305282	GSE107093	GSM2861163	GPL18133	29578536	B7 DH10BGFP_pD864_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305282	GSE107093	GSM2861163	GPL18133	29578536	B7 DH10BGFP_pD864_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305284	GSE107093	GSM2861165	GPL18133	29578536	B9 DH10BGFP_pLys_M1_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305284	GSE107093	GSM2861165	GPL18133	29578536	B9 DH10BGFP_pLys_M1_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305284	GSE107093	GSM2861165	GPL18133	29578536	B9 DH10BGFP_pLys_M1_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305285	GSE107093	GSM2861166	GPL18133	29578536	B10 DH10BGFP_pSB1C3_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305285	GSE107093	GSM2861166	GPL18133	29578536	B10 DH10BGFP_pSB1C3_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305285	GSE107093	GSM2861166	GPL18133	29578536	B10 DH10BGFP_pSB1C3_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305292	GSE107093	GSM2861173	GPL18133	29578536	B17 MG1655GFP_pSB1C3_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305292	GSE107093	GSM2861173	GPL18133	29578536	B17 MG1655GFP_pSB1C3_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305292	GSE107093	GSM2861173	GPL18133	29578536	B17 MG1655GFP_pSB1C3_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305297	GSE107093	GSM2861178	GPL18133	29578536	B22 MG1655GFP_pSB1C3_H3_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305297	GSE107093	GSM2861178	GPL18133	29578536	B22 MG1655GFP_pSB1C3_H3_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305297	GSE107093	GSM2861178	GPL18133	29578536	B22 MG1655GFP_pSB1C3_H3_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305301	GSE107093	GSM2861182	GPL18133	29578536	B26 MG1655GFP_Lux_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305301	GSE107093	GSM2861182	GPL18133	29578536	B26 MG1655GFP_Lux_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305301	GSE107093	GSM2861182	GPL18133	29578536	B26 MG1655GFP_Lux_2	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305310	GSE107093	GSM2861191	GPL18133	29578536	G5 DH10BGFP_Lux_3	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305310	GSE107093	GSM2861191	GPL18133	29578536	G5 DH10BGFP_Lux_3	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305310	GSE107093	GSM2861191	GPL18133	29578536	G5 DH10BGFP_Lux_3	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305311	GSE107093	GSM2861192	GPL18133	29578536	G6 DH10BGFP_pD864_LacZ_3	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305311	GSE107093	GSM2861192	GPL18133	29578536	G6 DH10BGFP_pD864_LacZ_3	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305311	GSE107093	GSM2861192	GPL18133	29578536	G6 DH10BGFP_pD864_LacZ_3	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305326	GSE107093	GSM2861207	GPL18133	29578536	G21 MG1655GFP_pD864_3	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305326	GSE107093	GSM2861207	GPL18133	29578536	G21 MG1655GFP_pD864_3	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305326	GSE107093	GSM2861207	GPL18133	29578536	G21 MG1655GFP_pD864_3	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305328	GSE107093	GSM2861209	GPL18133	29578536	G23 MG1655GFP_pLys_M1_3	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305328	GSE107093	GSM2861209	GPL18133	29578536	G23 MG1655GFP_pLys_M1_3	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305328	GSE107093	GSM2861209	GPL18133	29578536	G23 MG1655GFP_pLys_M1_3	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305333	GSE107093	GSM2861214	GPL18133	29578536	G28 MG1655GFP_pD864_3	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305333	GSE107093	GSM2861214	GPL18133	29578536	G28 MG1655GFP_pD864_3	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305333	GSE107093	GSM2861214	GPL18133	29578536	G28 MG1655GFP_pD864_3	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305334	GSE107093	GSM2861215	GPL18133	29578536	G29 DH10BGFP_None_3	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain MG1655GFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , assembly ASM584v2 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556904268504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305334	GSE107093	GSM2861215	GPL18133	29578536	G29 DH10BGFP_None_3	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit. PGCGROWTHCONDITIONS	Genome _ build : <Anti> Samples </Anti> from strain DH10BGFP were mapped to the reference geneome Escherichia coli str . <Strain> K-12 </Strain> substr . DH10B , assembly ASM1942v1 .31 complemented with the GFP sequence , and the sequence of corresponding synthetic circuit . 	K-12	Organism	0.9900556664714552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305334	GSE107093	GSM2861215	GPL18133	29578536	G29 DH10BGFP_None_3	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes. PGCGROWTHCONDITIONS	E. coli cells with construct and control plasmids were grown at <Temp> 37 °C </Temp> overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic . In the morning , 60 μl of each sample were diluted into 3 ml <Med> of fresh medium </Med> and grown at <Temp> 37 °C </Temp> with shaking for another hour ( outgrowth ) . 200 μl of each sample were then transferred in 8 wells of a 96-well plate ( Costar ) at approximately 0.1 OD ( 600 nm ) . The samples were placed in a Synergy HT Microplate Reader ( BioTek ) and incubated at <Temp> 37 °C </Temp> with orbital shaking at 1,000 rpm for 1 h , performing measurements of GFP ( excitation ( ex . ) , 485 nm ; emission ( em . ) , 528 nm ) and OD ( 600 nm ) every 15 minutes . 	of fresh medium	Medium	0.9932815718219624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6305334	GSE107093	GSM2861215	GPL18133	29578536	G29 DH10BGFP_None_3	Burden- driven feedback control of gene expression	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	treatment: 15 min PGCGROWTHCONDITIONS	treatment : <Supp> 15 min </Supp> 	15 min	Medium supplement	0.9928933150810246	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107093/GSE107093.soft.gz				0	0	False
SRR6354578	GSE107301	GSM2870440	GPL15010-GPL21117	29358050	RNA-seq of E. coli wt cells in stationary phase 30°C (30h)	Multiscale structuring of the E. coli chromosome by nucleoid-associated and condensin proteins	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL21117: Illumina NextSeq 500 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: E. coli MG1655 GenBank: U00096.2,total length : 4639675 bp PGCGROWTHCONDITIONS	Genome _ build : E. coli MG1655 GenBank : <Gversion> U00096 .2 </Gversion> , total length : <Supp> 4639675 bp </Supp> 	U00096 .2	Gversion	0.9999003588985931	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107301/GSE107301.soft.gz				0	0	False
SRR6354578	GSE107301	GSM2870440	GPL15010-GPL21117	29358050	RNA-seq of E. coli wt cells in stationary phase 30°C (30h)	Multiscale structuring of the E. coli chromosome by nucleoid-associated and condensin proteins	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL21117: Illumina NextSeq 500 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: E. coli MG1655 GenBank: U00096.2,total length : 4639675 bp PGCGROWTHCONDITIONS	Genome _ build : E. coli MG1655 GenBank : <Gversion> U00096 .2 </Gversion> , total length : <Supp> 4639675 bp </Supp> 	4639675 bp	Medium supplement	0.9999003588985931	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107301/GSE107301.soft.gz				0	0	False
SRR6354578	GSE107301	GSM2870440	GPL15010-GPL21117	29358050	RNA-seq of E. coli wt cells in stationary phase 30°C (30h)	Multiscale structuring of the E. coli chromosome by nucleoid-associated and condensin proteins	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL21117: Illumina NextSeq 500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107301/GSE107301.soft.gz				0	0	False
SRR6354578	GSE107301	GSM2870440	GPL15010-GPL21117	29358050	RNA-seq of E. coli wt cells in stationary phase 30°C (30h)	Multiscale structuring of the E. coli chromosome by nucleoid-associated and condensin proteins	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL21117: Illumina NextSeq 500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107301/GSE107301.soft.gz				0	0	False
SRR6354578	GSE107301	GSM2870440	GPL15010-GPL21117	29358050	RNA-seq of E. coli wt cells in stationary phase 30°C (30h)	Multiscale structuring of the E. coli chromosome by nucleoid-associated and condensin proteins	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL21117: Illumina NextSeq 500 (Escherichia coli str. K-12 substr. MG1655)	characteristics	growth condition: MM + 0.12% casaminoacids +0.4% glucose at 30°C PGCGROWTHCONDITIONS	growth condition : <Supp> MM + 0.12 % casaminoacids +0.4 % glucose </Supp> at <Temp> 30 °C </Temp> 	MM + 0.12 % casaminoacids +0.4 % glucose	Medium supplement	0.9763433648888248	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107301/GSE107301.soft.gz				0	0	False
SRR6354579	GSE107301	GSM2870441	GPL15010-GPL21117	29358050	RNA-seq of E. coli wt cells in stationary phase 30°C (30h) -Replicate 1	Multiscale structuring of the E. coli chromosome by nucleoid-associated and condensin proteins	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL21117: Illumina NextSeq 500 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: E. coli MG1655 GenBank: U00096.2,total length : 4639675 bp PGCGROWTHCONDITIONS	Genome _ build : E. coli MG1655 GenBank : <Gversion> U00096 .2 </Gversion> , total length : <Supp> 4639675 bp </Supp> 	U00096 .2	Gversion	0.9999003588985931	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107301/GSE107301.soft.gz				0	0	False
SRR6354579	GSE107301	GSM2870441	GPL15010-GPL21117	29358050	RNA-seq of E. coli wt cells in stationary phase 30°C (30h) -Replicate 1	Multiscale structuring of the E. coli chromosome by nucleoid-associated and condensin proteins	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL21117: Illumina NextSeq 500 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: E. coli MG1655 GenBank: U00096.2,total length : 4639675 bp PGCGROWTHCONDITIONS	Genome _ build : E. coli MG1655 GenBank : <Gversion> U00096 .2 </Gversion> , total length : <Supp> 4639675 bp </Supp> 	4639675 bp	Medium supplement	0.9999003588985931	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107301/GSE107301.soft.gz				0	0	False
SRR6354579	GSE107301	GSM2870441	GPL15010-GPL21117	29358050	RNA-seq of E. coli wt cells in stationary phase 30°C (30h) -Replicate 1	Multiscale structuring of the E. coli chromosome by nucleoid-associated and condensin proteins	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL21117: Illumina NextSeq 500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107301/GSE107301.soft.gz				0	0	False
SRR6354579	GSE107301	GSM2870441	GPL15010-GPL21117	29358050	RNA-seq of E. coli wt cells in stationary phase 30°C (30h) -Replicate 1	Multiscale structuring of the E. coli chromosome by nucleoid-associated and condensin proteins	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL21117: Illumina NextSeq 500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107301/GSE107301.soft.gz				0	0	False
SRR6354579	GSE107301	GSM2870441	GPL15010-GPL21117	29358050	RNA-seq of E. coli wt cells in stationary phase 30°C (30h) -Replicate 1	Multiscale structuring of the E. coli chromosome by nucleoid-associated and condensin proteins	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL21117: Illumina NextSeq 500 (Escherichia coli str. K-12 substr. MG1655)	characteristics	growth condition: MM + 0.12% casaminoacids +0.4% glucose at 30°C PGCGROWTHCONDITIONS	growth condition : <Supp> MM + 0.12 % casaminoacids +0.4 % glucose </Supp> at <Temp> 30 °C </Temp> 	MM + 0.12 % casaminoacids +0.4 % glucose	Medium supplement	0.9763433648888248	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107301/GSE107301.soft.gz				0	0	False
SRR6322033	GSE107327	GSM2864853	GPL21222	29861158	emptyvec_mRNA_5m_rep1	E. coli MazF does not create specialized ribosomes that translate leaderless mRNAs, but instead blocks rRNA maturation and ribosome biogenesis [RNA-seq]	GPL21222: Illumina NextSeq 500 (Escherichia coli)	growth_protocol	Separate E. coli colonies were picked from LB agar plates for each replicate. Overnight cultures (12-16 hrs) were grown at 37°C in M9 media supplemented with 0.1% casamino acids, 0.4% glycerol, 0.4% glucose, 2 mM MgSO4, and 0.1 mM CaCl2. Overnight cultures were back diluted into fresh media and grown 3-4 hours to an OD600 of ~0.35 at 37°C in an orbital shaker at 200 RPM. Cultures were centrifuged, washed, and back diluted into media lacking glucose. After at least 30 minutes of recovery Para was induced by adding arabinose to 0.2%. Cells were harvested by centrifuging 1 mL of culture for 1 minute at maximum speed on a benchtop centrifuge. Pellets were immediately flash frozen in lN2. PGCGROWTHCONDITIONS	Separate E. coli colonies were picked from LB agar plates for each replicate . Overnight cultures ( 12-16 hrs ) were grown at <Temp> 37 °C </Temp> in M9 media supplemented with 0.1 % casamino acids , 0.4 % glycerol , 0.4 % glucose , 2 mM MgSO4 , and 0.1 mM CaCl2 . Overnight cultures were back diluted into fresh <Med> media </Med> and grown 3-4 hours to an <OD> OD600 of ~ 0.35 </OD> at <Temp> 37 °C </Temp> in an orbital shaker at 200 RPM . Cultures were centrifuged , washed , and back diluted into media lacking glucose . After at least 30 minutes of recovery Para was induced by adding arabinose to 0.2 % . Cells were harvested by centrifuging 1 mL of culture for 1 minute at maximum speed on a benchtop centrifuge . Pellets were immediately flash frozen in lN2 . 	media	Medium	0.9977032275160018	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107327/GSE107327.soft.gz				0	0	False
SRR6322034	GSE107327	GSM2864854	GPL21222	29861158	emptyvec_mRNA_5m_rep2	E. coli MazF does not create specialized ribosomes that translate leaderless mRNAs, but instead blocks rRNA maturation and ribosome biogenesis [RNA-seq]	GPL21222: Illumina NextSeq 500 (Escherichia coli)	growth_protocol	Separate E. coli colonies were picked from LB agar plates for each replicate. Overnight cultures (12-16 hrs) were grown at 37°C in M9 media supplemented with 0.1% casamino acids, 0.4% glycerol, 0.4% glucose, 2 mM MgSO4, and 0.1 mM CaCl2. Overnight cultures were back diluted into fresh media and grown 3-4 hours to an OD600 of ~0.35 at 37°C in an orbital shaker at 200 RPM. Cultures were centrifuged, washed, and back diluted into media lacking glucose. After at least 30 minutes of recovery Para was induced by adding arabinose to 0.2%. Cells were harvested by centrifuging 1 mL of culture for 1 minute at maximum speed on a benchtop centrifuge. Pellets were immediately flash frozen in lN2. PGCGROWTHCONDITIONS	Separate E. coli colonies were picked from LB agar plates for each replicate . Overnight cultures ( 12-16 hrs ) were grown at <Temp> 37 °C </Temp> in M9 media supplemented with 0.1 % casamino acids , 0.4 % glycerol , 0.4 % glucose , 2 mM MgSO4 , and 0.1 mM CaCl2 . Overnight cultures were back diluted into fresh <Med> media </Med> and grown 3-4 hours to an <OD> OD600 of ~ 0.35 </OD> at <Temp> 37 °C </Temp> in an orbital shaker at 200 RPM . Cultures were centrifuged , washed , and back diluted into media lacking glucose . After at least 30 minutes of recovery Para was induced by adding arabinose to 0.2 % . Cells were harvested by centrifuging 1 mL of culture for 1 minute at maximum speed on a benchtop centrifuge . Pellets were immediately flash frozen in lN2 . 	media	Medium	0.9977032275160018	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107327/GSE107327.soft.gz				0	0	False
SRR6322035	GSE107327	GSM2864855	GPL21222	29861158	MazF_mRNA_5m_rep1	E. coli MazF does not create specialized ribosomes that translate leaderless mRNAs, but instead blocks rRNA maturation and ribosome biogenesis [RNA-seq]	GPL21222: Illumina NextSeq 500 (Escherichia coli)	growth_protocol	Separate E. coli colonies were picked from LB agar plates for each replicate. Overnight cultures (12-16 hrs) were grown at 37°C in M9 media supplemented with 0.1% casamino acids, 0.4% glycerol, 0.4% glucose, 2 mM MgSO4, and 0.1 mM CaCl2. Overnight cultures were back diluted into fresh media and grown 3-4 hours to an OD600 of ~0.35 at 37°C in an orbital shaker at 200 RPM. Cultures were centrifuged, washed, and back diluted into media lacking glucose. After at least 30 minutes of recovery Para was induced by adding arabinose to 0.2%. Cells were harvested by centrifuging 1 mL of culture for 1 minute at maximum speed on a benchtop centrifuge. Pellets were immediately flash frozen in lN2. PGCGROWTHCONDITIONS	Separate E. coli colonies were picked from LB agar plates for each replicate . Overnight cultures ( 12-16 hrs ) were grown at <Temp> 37 °C </Temp> in M9 media supplemented with 0.1 % casamino acids , 0.4 % glycerol , 0.4 % glucose , 2 mM MgSO4 , and 0.1 mM CaCl2 . Overnight cultures were back diluted into fresh <Med> media </Med> and grown 3-4 hours to an <OD> OD600 of ~ 0.35 </OD> at <Temp> 37 °C </Temp> in an orbital shaker at 200 RPM . Cultures were centrifuged , washed , and back diluted into media lacking glucose . After at least 30 minutes of recovery Para was induced by adding arabinose to 0.2 % . Cells were harvested by centrifuging 1 mL of culture for 1 minute at maximum speed on a benchtop centrifuge . Pellets were immediately flash frozen in lN2 . 	media	Medium	0.9977032275160018	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107327/GSE107327.soft.gz				0	0	False
SRR6322036	GSE107327	GSM2864856	GPL21222	29861158	MazF_mRNA_5m_rep2	E. coli MazF does not create specialized ribosomes that translate leaderless mRNAs, but instead blocks rRNA maturation and ribosome biogenesis [RNA-seq]	GPL21222: Illumina NextSeq 500 (Escherichia coli)	growth_protocol	Separate E. coli colonies were picked from LB agar plates for each replicate. Overnight cultures (12-16 hrs) were grown at 37°C in M9 media supplemented with 0.1% casamino acids, 0.4% glycerol, 0.4% glucose, 2 mM MgSO4, and 0.1 mM CaCl2. Overnight cultures were back diluted into fresh media and grown 3-4 hours to an OD600 of ~0.35 at 37°C in an orbital shaker at 200 RPM. Cultures were centrifuged, washed, and back diluted into media lacking glucose. After at least 30 minutes of recovery Para was induced by adding arabinose to 0.2%. Cells were harvested by centrifuging 1 mL of culture for 1 minute at maximum speed on a benchtop centrifuge. Pellets were immediately flash frozen in lN2. PGCGROWTHCONDITIONS	Separate E. coli colonies were picked from LB agar plates for each replicate . Overnight cultures ( 12-16 hrs ) were grown at <Temp> 37 °C </Temp> in M9 media supplemented with 0.1 % casamino acids , 0.4 % glycerol , 0.4 % glucose , 2 mM MgSO4 , and 0.1 mM CaCl2 . Overnight cultures were back diluted into fresh <Med> media </Med> and grown 3-4 hours to an <OD> OD600 of ~ 0.35 </OD> at <Temp> 37 °C </Temp> in an orbital shaker at 200 RPM . Cultures were centrifuged , washed , and back diluted into media lacking glucose . After at least 30 minutes of recovery Para was induced by adding arabinose to 0.2 % . Cells were harvested by centrifuging 1 mL of culture for 1 minute at maximum speed on a benchtop centrifuge . Pellets were immediately flash frozen in lN2 . 	media	Medium	0.9977032275160018	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE107327/GSE107327.soft.gz				0	0	False
SRR6449107	GSE108846	GSM2914313	GPL16085	29378945	CF104.3.3_y2	Adaptation of commensal proliferating Escherichia coli to the intestinal tract of young children with cystic fibrosis	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 (U00096.3) PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) 	K-12	Organism	0.99005698197335	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz				0	0	False
SRR6449109	GSE108846	GSM2914315	GPL16085	29378945	CF108.4B_y3	Adaptation of commensal proliferating Escherichia coli to the intestinal tract of young children with cystic fibrosis	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 (U00096.3) PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) 	K-12	Organism	0.99005698197335	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz				0	0	False
SRR6449111	GSE108846	GSM2914317	GPL16085	29378945	CON206.3A_y1	Adaptation of commensal proliferating Escherichia coli to the intestinal tract of young children with cystic fibrosis	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 (U00096.3) PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) 	K-12	Organism	0.99005698197335	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz				0	0	False
SRR6449112	GSE108846	GSM2914318	GPL16085	29378945	CON206.3A_y2	Adaptation of commensal proliferating Escherichia coli to the intestinal tract of young children with cystic fibrosis	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 (U00096.3) PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) 	K-12	Organism	0.99005698197335	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz				0	0	False
SRR6449113	GSE108846	GSM2914319	GPL16085	29378945	CON208.3A_y2	Adaptation of commensal proliferating Escherichia coli to the intestinal tract of young children with cystic fibrosis	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 (U00096.3) PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) 	K-12	Organism	0.99005698197335	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz				0	0	False
SRR6449114	GSE108846	GSM2914320	GPL16085	29378945	CON208.3A_y6	Adaptation of commensal proliferating Escherichia coli to the intestinal tract of young children with cystic fibrosis	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 (U00096.3) PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) 	K-12	Organism	0.99005698197335	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz				0	0	False
SRR6449115	GSE108846	GSM2914321	GPL16085	29378945	CF104.3.3_u1	Adaptation of commensal proliferating Escherichia coli to the intestinal tract of young children with cystic fibrosis	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 (U00096.3) PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) 	K-12	Organism	0.99005698197335	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz				0	0	False
SRR6449116	GSE108846	GSM2914322	GPL16085	29378945	CF104.3.3_u7	Adaptation of commensal proliferating Escherichia coli to the intestinal tract of young children with cystic fibrosis	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 (U00096.3) PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) 	K-12	Organism	0.99005698197335	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz				0	0	False
SRR6449117	GSE108846	GSM2914323	GPL16085	29378945	CF108.4B_u1	Adaptation of commensal proliferating Escherichia coli to the intestinal tract of young children with cystic fibrosis	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 (U00096.3) PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) 	K-12	Organism	0.99005698197335	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz				0	0	False
SRR6449118	GSE108846	GSM2914324	GPL16085	29378945	CF108.4B_u2	Adaptation of commensal proliferating Escherichia coli to the intestinal tract of young children with cystic fibrosis	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 (U00096.3) PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) 	K-12	Organism	0.99005698197335	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz				0	0	False
SRR6449119	GSE108846	GSM2914325	GPL16085	29378945	CON206.3A_u1	Adaptation of commensal proliferating Escherichia coli to the intestinal tract of young children with cystic fibrosis	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 (U00096.3) PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) 	K-12	Organism	0.99005698197335	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz				0	0	False
SRR6449120	GSE108846	GSM2914326	GPL16085	29378945	CON206.3A_u2	Adaptation of commensal proliferating Escherichia coli to the intestinal tract of young children with cystic fibrosis	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 (U00096.3) PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) 	K-12	Organism	0.99005698197335	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz				0	0	False
SRR6449121	GSE108846	GSM2914327	GPL16085	29378945	CON208.3A_u1	Adaptation of commensal proliferating Escherichia coli to the intestinal tract of young children with cystic fibrosis	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 (U00096.3) PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) 	K-12	Organism	0.99005698197335	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz				0	0	False
SRR6449122	GSE108846	GSM2914328	GPL16085	29378945	CON208.3A_u8	Adaptation of commensal proliferating Escherichia coli to the intestinal tract of young children with cystic fibrosis	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 (U00096.3) PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( U00096 .3 ) 	K-12	Organism	0.99005698197335	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE108846/GSE108846.soft.gz				0	0	False
SRR6781997	GSE111094	GSM3022135	GPL24659	33149261	WT rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR6781997	GSE111094	GSM3022135	GPL24659	33149261	WT rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR6781998	GSE111094	GSM3022136	GPL24659	33149261	WT rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR6781998	GSE111094	GSM3022136	GPL24659	33149261	WT rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR6781999	GSE111094	GSM3022137	GPL24659	33149261	yafC-KO rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR6781999	GSE111094	GSM3022137	GPL24659	33149261	yafC-KO rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR6782000	GSE111094	GSM3022138	GPL24659	33149261	yafC-KO rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR6782000	GSE111094	GSM3022138	GPL24659	33149261	yafC-KO rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR6782001	GSE111094	GSM3022139	GPL24659	33149261	yeiE-KO rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR6782001	GSE111094	GSM3022139	GPL24659	33149261	yeiE-KO rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR6782002	GSE111094	GSM3022140	GPL24659	33149261	yeiE-KO rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR6782002	GSE111094	GSM3022140	GPL24659	33149261	yeiE-KO rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR6782003	GSE111094	GSM3022141	GPL24659	33149261	yiaJ-KO rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR6782003	GSE111094	GSM3022141	GPL24659	33149261	yiaJ-KO rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR6782004	GSE111094	GSM3022142	GPL24659	33149261	yiaJ-KO rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR6782004	GSE111094	GSM3022142	GPL24659	33149261	yiaJ-KO rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR6782005	GSE111094	GSM3022143	GPL24659	33149261	yieP-KO rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR6782005	GSE111094	GSM3022143	GPL24659	33149261	yieP-KO rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR6782006	GSE111094	GSM3022144	GPL24659	33149261	yieP-KO rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR6782006	GSE111094	GSM3022144	GPL24659	33149261	yieP-KO rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057985	GSE111094	GSM3108934	GPL24659	33149261	WT-low-ph rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057985	GSE111094	GSM3108934	GPL24659	33149261	WT-low-ph rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057985	GSE111094	GSM3108934	GPL24659	33149261	WT-low-ph rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	medium: glucose M9 minimal pH5.5 PGCGROWTHCONDITIONS	medium : <Supp> glucose </Supp> M9 minimal <pH> pH5 .5 </pH> 	pH5 .5	pH	0.99641769892261	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057986	GSE111094	GSM3108935	GPL24659	33149261	WT-low-ph rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057986	GSE111094	GSM3108935	GPL24659	33149261	WT-low-ph rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057986	GSE111094	GSM3108935	GPL24659	33149261	WT-low-ph rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	medium: glucose M9 minimal pH5.5 PGCGROWTHCONDITIONS	medium : <Supp> glucose </Supp> M9 minimal <pH> pH5 .5 </pH> 	pH5 .5	pH	0.99641769892261	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057987	GSE111094	GSM3108936	GPL24659	33149261	WT-high-ph rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057987	GSE111094	GSM3108936	GPL24659	33149261	WT-high-ph rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057988	GSE111094	GSM3108937	GPL24659	33149261	WT-high-ph rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057988	GSE111094	GSM3108937	GPL24659	33149261	WT-high-ph rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057989	GSE111094	GSM3108938	GPL24659	33149261	ybaO-KO rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057989	GSE111094	GSM3108938	GPL24659	33149261	ybaO-KO rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057990	GSE111094	GSM3108939	GPL24659	33149261	ybaO-KO rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057990	GSE111094	GSM3108939	GPL24659	33149261	ybaO-KO rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057991	GSE111094	GSM3108940	GPL24659	33149261	ybaQ-KO rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057991	GSE111094	GSM3108940	GPL24659	33149261	ybaQ-KO rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057992	GSE111094	GSM3108941	GPL24659	33149261	ybaQ-KO rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057992	GSE111094	GSM3108941	GPL24659	33149261	ybaQ-KO rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057993	GSE111094	GSM3108942	GPL24659	33149261	ybiH-KO rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057993	GSE111094	GSM3108942	GPL24659	33149261	ybiH-KO rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057994	GSE111094	GSM3108943	GPL24659	33149261	ybiH-KO rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057994	GSE111094	GSM3108943	GPL24659	33149261	ybiH-KO rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057995	GSE111094	GSM3108944	GPL24659	33149261	ydcI-KO-low-ph rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057995	GSE111094	GSM3108944	GPL24659	33149261	ydcI-KO-low-ph rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057995	GSE111094	GSM3108944	GPL24659	33149261	ydcI-KO-low-ph rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	medium: glucose M9 minimal pH5.5 PGCGROWTHCONDITIONS	medium : <Supp> glucose </Supp> M9 minimal <pH> pH5 .5 </pH> 	pH5 .5	pH	0.99641769892261	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057996	GSE111094	GSM3108945	GPL24659	33149261	ydcI-KO-low-ph rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057996	GSE111094	GSM3108945	GPL24659	33149261	ydcI-KO-low-ph rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057996	GSE111094	GSM3108945	GPL24659	33149261	ydcI-KO-low-ph rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	medium: glucose M9 minimal pH5.5 PGCGROWTHCONDITIONS	medium : <Supp> glucose </Supp> M9 minimal <pH> pH5 .5 </pH> 	pH5 .5	pH	0.99641769892261	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057997	GSE111094	GSM3108946	GPL24659	33149261	ydcI-KO-high-ph rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057997	GSE111094	GSM3108946	GPL24659	33149261	ydcI-KO-high-ph rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057998	GSE111094	GSM3108947	GPL24659	33149261	ydcI-KO-high-ph rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057998	GSE111094	GSM3108947	GPL24659	33149261	ydcI-KO-high-ph rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057999	GSE111094	GSM3108948	GPL24659	33149261	yddM-KO rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7057999	GSE111094	GSM3108948	GPL24659	33149261	yddM-KO rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7058000	GSE111094	GSM3108949	GPL24659	33149261	yddM-KO rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7058000	GSE111094	GSM3108949	GPL24659	33149261	yddM-KO rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7058001	GSE111094	GSM3108950	GPL24659	33149261	yheO-KO rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7058001	GSE111094	GSM3108950	GPL24659	33149261	yheO-KO rep1	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7058002	GSE111094	GSM3108951	GPL24659	33149261	yheO-KO rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7058002	GSE111094	GSM3108951	GPL24659	33149261	yheO-KO rep2	Systematic discovery of uncharacterized transcription factors in Escherichia coli K-12 MG1655 (RNA-seq data set)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE111094/GSE111094.soft.gz				0	0	False
SRR7217923	GSE114917	GSM3154484	GPL17439	30016375	HP1	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	The trimmed reads were aligned against E. 149 coli MG1655 (GenBank: U00096.3) using bowtie2 (Version 2.2.4) PGCGROWTHCONDITIONS	The trimmed reads were aligned against E. 149 coli MG1655 ( GenBank : <Gversion> U00096 .3 </Gversion> ) using bowtie2 ( Version 2.2.4 ) 	U00096 .3	Gversion	0.9691186465621028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217923	GSE114917	GSM3154484	GPL17439	30016375	HP1	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: U00096.3 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> U00096 .3 </Gversion> 	U00096 .3	Gversion	0.9571804153484504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217923	GSE114917	GSM3154484	GPL17439	30016375	HP1	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217923	GSE114917	GSM3154484	GPL17439	30016375	HP1	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217923	GSE114917	GSM3154484	GPL17439	30016375	HP1	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9999901716080668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217923	GSE114917	GSM3154484	GPL17439	30016375	HP1	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850567154613984	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217924	GSE114917	GSM3154485	GPL17439	30016375	HP2	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	The trimmed reads were aligned against E. 149 coli MG1655 (GenBank: U00096.3) using bowtie2 (Version 2.2.4) PGCGROWTHCONDITIONS	The trimmed reads were aligned against E. 149 coli MG1655 ( GenBank : <Gversion> U00096 .3 </Gversion> ) using bowtie2 ( Version 2.2.4 ) 	U00096 .3	Gversion	0.9691186465621028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217924	GSE114917	GSM3154485	GPL17439	30016375	HP2	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: U00096.3 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> U00096 .3 </Gversion> 	U00096 .3	Gversion	0.9571804153484504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217924	GSE114917	GSM3154485	GPL17439	30016375	HP2	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217924	GSE114917	GSM3154485	GPL17439	30016375	HP2	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217924	GSE114917	GSM3154485	GPL17439	30016375	HP2	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9999901716080668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217924	GSE114917	GSM3154485	GPL17439	30016375	HP2	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850567154613984	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217925	GSE114917	GSM3154486	GPL17439	30016375	HP3	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	The trimmed reads were aligned against E. 149 coli MG1655 (GenBank: U00096.3) using bowtie2 (Version 2.2.4) PGCGROWTHCONDITIONS	The trimmed reads were aligned against E. 149 coli MG1655 ( GenBank : <Gversion> U00096 .3 </Gversion> ) using bowtie2 ( Version 2.2.4 ) 	U00096 .3	Gversion	0.9691186465621028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217925	GSE114917	GSM3154486	GPL17439	30016375	HP3	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: U00096.3 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> U00096 .3 </Gversion> 	U00096 .3	Gversion	0.9571804153484504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217925	GSE114917	GSM3154486	GPL17439	30016375	HP3	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217925	GSE114917	GSM3154486	GPL17439	30016375	HP3	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217925	GSE114917	GSM3154486	GPL17439	30016375	HP3	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9999901716080668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217925	GSE114917	GSM3154486	GPL17439	30016375	HP3	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850567154613984	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217926	GSE114917	GSM3154487	GPL17439	30016375	HP4	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	The trimmed reads were aligned against E. 149 coli MG1655 (GenBank: U00096.3) using bowtie2 (Version 2.2.4) PGCGROWTHCONDITIONS	The trimmed reads were aligned against E. 149 coli MG1655 ( GenBank : <Gversion> U00096 .3 </Gversion> ) using bowtie2 ( Version 2.2.4 ) 	U00096 .3	Gversion	0.9691186465621028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217926	GSE114917	GSM3154487	GPL17439	30016375	HP4	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: U00096.3 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> U00096 .3 </Gversion> 	U00096 .3	Gversion	0.9571804153484504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217926	GSE114917	GSM3154487	GPL17439	30016375	HP4	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217926	GSE114917	GSM3154487	GPL17439	30016375	HP4	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217926	GSE114917	GSM3154487	GPL17439	30016375	HP4	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9999901716080668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217926	GSE114917	GSM3154487	GPL17439	30016375	HP4	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850567154613984	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217927	GSE114917	GSM3154488	GPL17439	30016375	LP1	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	The trimmed reads were aligned against E. 149 coli MG1655 (GenBank: U00096.3) using bowtie2 (Version 2.2.4) PGCGROWTHCONDITIONS	The trimmed reads were aligned against E. 149 coli MG1655 ( GenBank : <Gversion> U00096 .3 </Gversion> ) using bowtie2 ( Version 2.2.4 ) 	U00096 .3	Gversion	0.9691186465621028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217927	GSE114917	GSM3154488	GPL17439	30016375	LP1	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: U00096.3 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> U00096 .3 </Gversion> 	U00096 .3	Gversion	0.9571804153484504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217927	GSE114917	GSM3154488	GPL17439	30016375	LP1	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217927	GSE114917	GSM3154488	GPL17439	30016375	LP1	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217927	GSE114917	GSM3154488	GPL17439	30016375	LP1	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9999901716080668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217927	GSE114917	GSM3154488	GPL17439	30016375	LP1	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850567154613984	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217928	GSE114917	GSM3154489	GPL17439	30016375	LP2	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	The trimmed reads were aligned against E. 149 coli MG1655 (GenBank: U00096.3) using bowtie2 (Version 2.2.4) PGCGROWTHCONDITIONS	The trimmed reads were aligned against E. 149 coli MG1655 ( GenBank : <Gversion> U00096 .3 </Gversion> ) using bowtie2 ( Version 2.2.4 ) 	U00096 .3	Gversion	0.9691186465621028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217928	GSE114917	GSM3154489	GPL17439	30016375	LP2	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: U00096.3 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> U00096 .3 </Gversion> 	U00096 .3	Gversion	0.9571804153484504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217928	GSE114917	GSM3154489	GPL17439	30016375	LP2	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217928	GSE114917	GSM3154489	GPL17439	30016375	LP2	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217928	GSE114917	GSM3154489	GPL17439	30016375	LP2	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9999901716080668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217928	GSE114917	GSM3154489	GPL17439	30016375	LP2	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850567154613984	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217929	GSE114917	GSM3154490	GPL17439	30016375	LP3	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	The trimmed reads were aligned against E. 149 coli MG1655 (GenBank: U00096.3) using bowtie2 (Version 2.2.4) PGCGROWTHCONDITIONS	The trimmed reads were aligned against E. 149 coli MG1655 ( GenBank : <Gversion> U00096 .3 </Gversion> ) using bowtie2 ( Version 2.2.4 ) 	U00096 .3	Gversion	0.9691186465621028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217929	GSE114917	GSM3154490	GPL17439	30016375	LP3	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: U00096.3 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> U00096 .3 </Gversion> 	U00096 .3	Gversion	0.9571804153484504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217929	GSE114917	GSM3154490	GPL17439	30016375	LP3	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217929	GSE114917	GSM3154490	GPL17439	30016375	LP3	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217929	GSE114917	GSM3154490	GPL17439	30016375	LP3	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9999901716080668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217929	GSE114917	GSM3154490	GPL17439	30016375	LP3	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850567154613984	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217930	GSE114917	GSM3154491	GPL17439	30016375	LP4	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	The trimmed reads were aligned against E. 149 coli MG1655 (GenBank: U00096.3) using bowtie2 (Version 2.2.4) PGCGROWTHCONDITIONS	The trimmed reads were aligned against E. 149 coli MG1655 ( GenBank : <Gversion> U00096 .3 </Gversion> ) using bowtie2 ( Version 2.2.4 ) 	U00096 .3	Gversion	0.9691186465621028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217930	GSE114917	GSM3154491	GPL17439	30016375	LP4	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: U00096.3 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> U00096 .3 </Gversion> 	U00096 .3	Gversion	0.9571804153484504	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217930	GSE114917	GSM3154491	GPL17439	30016375	LP4	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217930	GSE114917	GSM3154491	GPL17439	30016375	LP4	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217930	GSE114917	GSM3154491	GPL17439	30016375	LP4	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9999901716080668	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR7217930	GSE114917	GSM3154491	GPL17439	30016375	LP4	Genetic response of E.coli to mild elevated pressure	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850567154613984	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE114917/GSE114917.soft.gz				0	0	False
SRR8449235	GSE117737	GSM3566393	GPL16085-GPL21222	31308523	RNA-seq WT log phase related to total SEnd-seq WT log phase rep 4	Full-length RNA profiling reveals pervasive bidirectional transcription terminators in bacteria	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655, NC_000913.3 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NC _ 000913.3 	K-12	Organism	0.9900556610455188	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE117737/GSE117737.soft.gz				0	0	False
SRR8449235	GSE117737	GSM3566393	GPL16085-GPL21222	31308523	RNA-seq WT log phase related to total SEnd-seq WT log phase rep 4	Full-length RNA profiling reveals pervasive bidirectional transcription terminators in bacteria	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	treatment_protocol	Wild type E. coli, pnp knoctout, rnb knoctout and rnr knoct out strains were cultured in LB media at 37 °C, RNA samples and ChIP-seq samples were collected when the growth stage of indicated cells reached to log phase or stationary phase.  rne-3071(ts) mutation strain was cultured in LB media at 28 °C to retain the RNase E activity or shifted to 44 °C in water bath for 30 minutes to deactivate RNase E. In order to inactive the rho activity, the wild type (WT) Wild type E. coli was cultured in LB media with 50 μg/ml bicyclomycin at 37 °C for 15 min at indicated growth condition. PGCGROWTHCONDITIONS	<Gtype> Wild type </Gtype> E. coli , pnp knoctout , rnb knoctout and rnr knoct out strains were cultured in <Med> LB media </Med> at <Temp> 37 °C </Temp> , RNA samples and ChIP-seq samples were collected when the growth stage of indicated cells reached to log phase or stationary phase . rne-3071 ( ts ) mutation strain was cultured in <Med> LB media </Med> at 28 °C to retain the RNase E activity or shifted to 44 °C in water bath for 30 minutes to deactivate RNase E . In order to <Gtype> inactive the rho activity , the wild type ( WT ) Wild type </Gtype> E. coli was cultured in <Med> LB media </Med> with 50 μg/ml bicyclomycin at <Temp> 37 °C </Temp> for 15 min at indicated growth condition . 	inactive the rho activity , the wild type ( WT ) Wild type	Genetic background	0.957559297677028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE117737/GSE117737.soft.gz				0	0	False
SRR8449236	GSE117737	GSM3566394	GPL16085-GPL21222	31308523	RNA-seq WT log phase related to total SEnd-seq WT log phase rep 5	Full-length RNA profiling reveals pervasive bidirectional transcription terminators in bacteria	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655, NC_000913.3 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NC _ 000913.3 	K-12	Organism	0.9900556610455188	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE117737/GSE117737.soft.gz				0	0	False
SRR8449236	GSE117737	GSM3566394	GPL16085-GPL21222	31308523	RNA-seq WT log phase related to total SEnd-seq WT log phase rep 5	Full-length RNA profiling reveals pervasive bidirectional transcription terminators in bacteria	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	treatment_protocol	Wild type E. coli, pnp knoctout, rnb knoctout and rnr knoct out strains were cultured in LB media at 37 °C, RNA samples and ChIP-seq samples were collected when the growth stage of indicated cells reached to log phase or stationary phase.  rne-3071(ts) mutation strain was cultured in LB media at 28 °C to retain the RNase E activity or shifted to 44 °C in water bath for 30 minutes to deactivate RNase E. In order to inactive the rho activity, the wild type (WT) Wild type E. coli was cultured in LB media with 50 μg/ml bicyclomycin at 37 °C for 15 min at indicated growth condition. PGCGROWTHCONDITIONS	<Gtype> Wild type </Gtype> E. coli , pnp knoctout , rnb knoctout and rnr knoct out strains were cultured in <Med> LB media </Med> at <Temp> 37 °C </Temp> , RNA samples and ChIP-seq samples were collected when the growth stage of indicated cells reached to log phase or stationary phase . rne-3071 ( ts ) mutation strain was cultured in <Med> LB media </Med> at 28 °C to retain the RNase E activity or shifted to 44 °C in water bath for 30 minutes to deactivate RNase E . In order to <Gtype> inactive the rho activity , the wild type ( WT ) Wild type </Gtype> E. coli was cultured in <Med> LB media </Med> with 50 μg/ml bicyclomycin at <Temp> 37 °C </Temp> for 15 min at indicated growth condition . 	inactive the rho activity , the wild type ( WT ) Wild type	Genetic background	0.957559297677028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE117737/GSE117737.soft.gz				0	0	False
SRR8449237	GSE117737	GSM3566395	GPL16085-GPL21222	31308523	RNA-seq WT log phase related to total SEnd-seq WT log phase rep 6	Full-length RNA profiling reveals pervasive bidirectional transcription terminators in bacteria	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655, NC_000913.3 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NC _ 000913.3 	K-12	Organism	0.9900556610455188	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE117737/GSE117737.soft.gz				0	0	False
SRR8449237	GSE117737	GSM3566395	GPL16085-GPL21222	31308523	RNA-seq WT log phase related to total SEnd-seq WT log phase rep 6	Full-length RNA profiling reveals pervasive bidirectional transcription terminators in bacteria	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	treatment_protocol	Wild type E. coli, pnp knoctout, rnb knoctout and rnr knoct out strains were cultured in LB media at 37 °C, RNA samples and ChIP-seq samples were collected when the growth stage of indicated cells reached to log phase or stationary phase.  rne-3071(ts) mutation strain was cultured in LB media at 28 °C to retain the RNase E activity or shifted to 44 °C in water bath for 30 minutes to deactivate RNase E. In order to inactive the rho activity, the wild type (WT) Wild type E. coli was cultured in LB media with 50 μg/ml bicyclomycin at 37 °C for 15 min at indicated growth condition. PGCGROWTHCONDITIONS	<Gtype> Wild type </Gtype> E. coli , pnp knoctout , rnb knoctout and rnr knoct out strains were cultured in <Med> LB media </Med> at <Temp> 37 °C </Temp> , RNA samples and ChIP-seq samples were collected when the growth stage of indicated cells reached to log phase or stationary phase . rne-3071 ( ts ) mutation strain was cultured in <Med> LB media </Med> at 28 °C to retain the RNase E activity or shifted to 44 °C in water bath for 30 minutes to deactivate RNase E . In order to <Gtype> inactive the rho activity , the wild type ( WT ) Wild type </Gtype> E. coli was cultured in <Med> LB media </Med> with 50 μg/ml bicyclomycin at <Temp> 37 °C </Temp> for 15 min at indicated growth condition . 	inactive the rho activity , the wild type ( WT ) Wild type	Genetic background	0.957559297677028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE117737/GSE117737.soft.gz				0	0	False
SRR8449238	GSE117737	GSM3566396	GPL16085-GPL21222	31308523	RNA-seq WT log phase related to total SEnd-seq WT stationary phase rep4	Full-length RNA profiling reveals pervasive bidirectional transcription terminators in bacteria	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655, NC_000913.3 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NC _ 000913.3 	K-12	Organism	0.9900556610455188	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE117737/GSE117737.soft.gz				0	0	False
SRR8449238	GSE117737	GSM3566396	GPL16085-GPL21222	31308523	RNA-seq WT log phase related to total SEnd-seq WT stationary phase rep4	Full-length RNA profiling reveals pervasive bidirectional transcription terminators in bacteria	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	treatment_protocol	Wild type E. coli, pnp knoctout, rnb knoctout and rnr knoct out strains were cultured in LB media at 37 °C, RNA samples and ChIP-seq samples were collected when the growth stage of indicated cells reached to log phase or stationary phase.  rne-3071(ts) mutation strain was cultured in LB media at 28 °C to retain the RNase E activity or shifted to 44 °C in water bath for 30 minutes to deactivate RNase E. In order to inactive the rho activity, the wild type (WT) Wild type E. coli was cultured in LB media with 50 μg/ml bicyclomycin at 37 °C for 15 min at indicated growth condition. PGCGROWTHCONDITIONS	<Gtype> Wild type </Gtype> E. coli , pnp knoctout , rnb knoctout and rnr knoct out strains were cultured in <Med> LB media </Med> at <Temp> 37 °C </Temp> , RNA samples and ChIP-seq samples were collected when the growth stage of indicated cells reached to log phase or stationary phase . rne-3071 ( ts ) mutation strain was cultured in <Med> LB media </Med> at 28 °C to retain the RNase E activity or shifted to 44 °C in water bath for 30 minutes to deactivate RNase E . In order to <Gtype> inactive the rho activity , the wild type ( WT ) Wild type </Gtype> E. coli was cultured in <Med> LB media </Med> with 50 μg/ml bicyclomycin at <Temp> 37 °C </Temp> for 15 min at indicated growth condition . 	inactive the rho activity , the wild type ( WT ) Wild type	Genetic background	0.957559297677028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE117737/GSE117737.soft.gz				0	0	False
SRR8164476	GSE122211	GSM3461156	GPL17024-GPL17439-GPL18995-GPL25769	31797920	MG_no_te_1	Expression profiling of E. coli K-12 MG1655	GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655). GPL18995: Illumina MiSeq (Escherichia coli BW25113). GPL25769: Illumina Genome Analyzer IIx (Escherichia coli BW25113)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122211/GSE122211.soft.gz				0	0	False
SRR8164476	GSE122211	GSM3461156	GPL17024-GPL17439-GPL18995-GPL25769	31797920	MG_no_te_1	Expression profiling of E. coli K-12 MG1655	GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655). GPL18995: Illumina MiSeq (Escherichia coli BW25113). GPL25769: Illumina Genome Analyzer IIx (Escherichia coli BW25113)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122211/GSE122211.soft.gz				0	0	False
SRR8164477	GSE122211	GSM3461157	GPL17024-GPL17439-GPL18995-GPL25769	31797920	MG_no_te_2	Expression profiling of E. coli K-12 MG1655	GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655). GPL18995: Illumina MiSeq (Escherichia coli BW25113). GPL25769: Illumina Genome Analyzer IIx (Escherichia coli BW25113)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122211/GSE122211.soft.gz				0	0	False
SRR8164477	GSE122211	GSM3461157	GPL17024-GPL17439-GPL18995-GPL25769	31797920	MG_no_te_2	Expression profiling of E. coli K-12 MG1655	GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655). GPL18995: Illumina MiSeq (Escherichia coli BW25113). GPL25769: Illumina Genome Analyzer IIx (Escherichia coli BW25113)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122211/GSE122211.soft.gz				0	0	False
SRR8164484	GSE122211	GSM3461164	GPL17024-GPL17439-GPL18995-GPL25769	31797920	MG_glu_1	Expression profiling of E. coli K-12 MG1655	GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655). GPL18995: Illumina MiSeq (Escherichia coli BW25113). GPL25769: Illumina Genome Analyzer IIx (Escherichia coli BW25113)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122211/GSE122211.soft.gz				0	0	False
SRR8164484	GSE122211	GSM3461164	GPL17024-GPL17439-GPL18995-GPL25769	31797920	MG_glu_1	Expression profiling of E. coli K-12 MG1655	GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655). GPL18995: Illumina MiSeq (Escherichia coli BW25113). GPL25769: Illumina Genome Analyzer IIx (Escherichia coli BW25113)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122211/GSE122211.soft.gz				0	0	False
SRR8164485	GSE122211	GSM3461165	GPL17024-GPL17439-GPL18995-GPL25769	31797920	MG_glu_2	Expression profiling of E. coli K-12 MG1655	GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655). GPL18995: Illumina MiSeq (Escherichia coli BW25113). GPL25769: Illumina Genome Analyzer IIx (Escherichia coli BW25113)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122211/GSE122211.soft.gz				0	0	False
SRR8164485	GSE122211	GSM3461165	GPL17024-GPL17439-GPL18995-GPL25769	31797920	MG_glu_2	Expression profiling of E. coli K-12 MG1655	GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655). GPL18995: Illumina MiSeq (Escherichia coli BW25113). GPL25769: Illumina Genome Analyzer IIx (Escherichia coli BW25113)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122211/GSE122211.soft.gz				0	0	False
SRR8164486	GSE122211	GSM3461166	GPL17024-GPL17439-GPL18995-GPL25769	31797920	MG_glc	Expression profiling of E. coli K-12 MG1655	GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655). GPL18995: Illumina MiSeq (Escherichia coli BW25113). GPL25769: Illumina Genome Analyzer IIx (Escherichia coli BW25113)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122211/GSE122211.soft.gz				0	0	False
SRR8164486	GSE122211	GSM3461166	GPL17024-GPL17439-GPL18995-GPL25769	31797920	MG_glc	Expression profiling of E. coli K-12 MG1655	GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655). GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655). GPL18995: Illumina MiSeq (Escherichia coli BW25113). GPL25769: Illumina Genome Analyzer IIx (Escherichia coli BW25113)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122211/GSE122211.soft.gz				0	0	False
SRR8173227	GSE122295	GSM3463565	GPL21433	31797920	wt_glc__1	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173228	GSE122295	GSM3463566	GPL21433	31797920	wt_glc__2	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173229	GSE122295	GSM3463567	GPL21433	31797920	wt_glc__3	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173230	GSE122295	GSM3463568	GPL21433	31797920	wt_glc__4	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173231	GSE122295	GSM3463569	GPL21433	31797920	arg_sbt__1	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173232	GSE122295	GSM3463570	GPL21433	31797920	arg_sbt__2	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173233	GSE122295	GSM3463571	GPL21433	31797920	cytd_rib__1	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173234	GSE122295	GSM3463572	GPL21433	31797920	cytd_rib__2	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173235	GSE122295	GSM3463573	GPL21433	31797920	gth__1	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173236	GSE122295	GSM3463574	GPL21433	31797920	gth__2	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173237	GSE122295	GSM3463575	GPL21433	31797920	leu_glcr__1	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173238	GSE122295	GSM3463576	GPL21433	31797920	leu_glcr__2	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173239	GSE122295	GSM3463577	GPL21433	31797920	met_glc__1	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173240	GSE122295	GSM3463578	GPL21433	31797920	met_glc__2	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173241	GSE122295	GSM3463579	GPL21433	31797920	no3_anaero__1	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173242	GSE122295	GSM3463580	GPL21433	31797920	no3_anaero__2	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173243	GSE122295	GSM3463581	GPL21433	31797920	phe_acgam__1	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173244	GSE122295	GSM3463582	GPL21433	31797920	phe_acgam__2	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173245	GSE122295	GSM3463583	GPL21433	31797920	thm_gal__1	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173246	GSE122295	GSM3463584	GPL21433	31797920	thm_gal__2	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173247	GSE122295	GSM3463585	GPL21433	31797920	tyr_glcn__1	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173248	GSE122295	GSM3463586	GPL21433	31797920	tyr_glcn__2	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173249	GSE122295	GSM3463587	GPL21433	31797920	ura_pyr__1	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173249	GSE122295	GSM3463587	GPL21433	31797920	ura_pyr__1	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	characteristics	media: M9 minimal media w/ 3.3g/L pyruvate PGCGROWTHCONDITIONS	media : <Med> M9 minimal media w / 3.3 g/L pyruvate </Med> 	M9 minimal media w / 3.3 g/L pyruvate	Medium	0.9939223172860352	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173250	GSE122295	GSM3463588	GPL21433	31797920	ura_pyr__2	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8173250	GSE122295	GSM3463588	GPL21433	31797920	ura_pyr__2	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	characteristics	media: M9 minimal media w/ 3.3g/L pyruvate PGCGROWTHCONDITIONS	media : <Med> M9 minimal media w / 3.3 g/L pyruvate </Med> 	M9 minimal media w / 3.3 g/L pyruvate	Medium	0.9939223172860352	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR9204648	GSE122295	GSM3854833	GPL21433	31797920	wt_glc_5__1	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR9204649	GSE122295	GSM3854834	GPL21433	31797920	wt_glc_6__1	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR9204650	GSE122295	GSM3854835	GPL21433	31797920	bw_delpurR_cytd__1	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR9204651	GSE122295	GSM3854836	GPL21433	31797920	bw_delpurR_cytd__2	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR9204652	GSE122295	GSM3854837	GPL21433	31797920	ade_glc__1	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR9204653	GSE122295	GSM3854838	GPL21433	31797920	ade_glc__2	Expression profiling to identify independent regulatory signals in Escherichia coli	GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). For nitrate respiration cultures, a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate. PGCGROWTHCONDITIONS	glycerol stocks of E. coli strains were inoculated into M9 minimal media with sample-specific carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . For nitrate respiration cultures , a 35:50 ratio of carbon dioxide to nitrogen was bubbled through hte media to deoxygenate . 	media	Medium	0.937625280345169	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE122295/GSE122295.soft.gz				0	0	False
SRR8309841	GSE123554	GSM3507068	GPL18133		delta-fis rep1	Reconstruction of transcriptional regulatory networks of Fis and H-NS in Escherichia coli from genome wide data analysis	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli K-12 MG1655 WT, Δfis and Δhns were grown in Luria-Bertani (LB) broth and agar (15g/l). Where needed, kanamycin was used at final concentration of 50µg/ml. For RNA extraction, E. coli cultures were grown to mid-exponential growth phase aerobically at 37°C in M9 minimal media supplemented with 40% (w/v) glucose. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT , Δfis and Δhns were grown in Luria-Bertani ( LB ) broth and agar ( 15g/l ) . Where needed , kanamycin was used at final concentration of 50µg/ml . For RNA extraction , E. coli cultures were grown to mid-exponential growth phase <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with 40 % ( w/v ) glucose . 	aerobically	Aeration	0.989105328345672	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz				0	0	False
SRR8309841	GSE123554	GSM3507068	GPL18133		delta-fis rep1	Reconstruction of transcriptional regulatory networks of Fis and H-NS in Escherichia coli from genome wide data analysis	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	strain: str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Supp> str </Supp> . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900621338440077	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz				0	0	False
SRR8309841	GSE123554	GSM3507068	GPL18133		delta-fis rep1	Reconstruction of transcriptional regulatory networks of Fis and H-NS in Escherichia coli from genome wide data analysis	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	strain: str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Supp> str </Supp> . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913350552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz				0	0	False
SRR8309841	GSE123554	GSM3507068	GPL18133		delta-fis rep1	Reconstruction of transcriptional regulatory networks of Fis and H-NS in Escherichia coli from genome wide data analysis	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	material type: whole organism PGCGROWTHCONDITIONS	<Gtype> material type </Gtype> : <Gtype> whole organism </Gtype> 	material type	Genetic background	0.9698714391317996	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz				0	0	False
SRR8309842	GSE123554	GSM3507069	GPL18133		delta-fis rep2	Reconstruction of transcriptional regulatory networks of Fis and H-NS in Escherichia coli from genome wide data analysis	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli K-12 MG1655 WT, Δfis and Δhns were grown in Luria-Bertani (LB) broth and agar (15g/l). Where needed, kanamycin was used at final concentration of 50µg/ml. For RNA extraction, E. coli cultures were grown to mid-exponential growth phase aerobically at 37°C in M9 minimal media supplemented with 40% (w/v) glucose. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT , Δfis and Δhns were grown in Luria-Bertani ( LB ) broth and agar ( 15g/l ) . Where needed , kanamycin was used at final concentration of 50µg/ml . For RNA extraction , E. coli cultures were grown to mid-exponential growth phase <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with 40 % ( w/v ) glucose . 	aerobically	Aeration	0.989105328345672	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz				0	0	False
SRR8309842	GSE123554	GSM3507069	GPL18133		delta-fis rep2	Reconstruction of transcriptional regulatory networks of Fis and H-NS in Escherichia coli from genome wide data analysis	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	strain: str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Supp> str </Supp> . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900621338440077	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz				0	0	False
SRR8309842	GSE123554	GSM3507069	GPL18133		delta-fis rep2	Reconstruction of transcriptional regulatory networks of Fis and H-NS in Escherichia coli from genome wide data analysis	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	strain: str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Supp> str </Supp> . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913350552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz				0	0	False
SRR8309842	GSE123554	GSM3507069	GPL18133		delta-fis rep2	Reconstruction of transcriptional regulatory networks of Fis and H-NS in Escherichia coli from genome wide data analysis	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	material type: whole organism PGCGROWTHCONDITIONS	<Gtype> material type </Gtype> : <Gtype> whole organism </Gtype> 	material type	Genetic background	0.9698714391317996	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz				0	0	False
SRR8309843	GSE123554	GSM3507070	GPL18133		delta-hns rep1	Reconstruction of transcriptional regulatory networks of Fis and H-NS in Escherichia coli from genome wide data analysis	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli K-12 MG1655 WT, Δfis and Δhns were grown in Luria-Bertani (LB) broth and agar (15g/l). Where needed, kanamycin was used at final concentration of 50µg/ml. For RNA extraction, E. coli cultures were grown to mid-exponential growth phase aerobically at 37°C in M9 minimal media supplemented with 40% (w/v) glucose. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT , Δfis and Δhns were grown in Luria-Bertani ( LB ) broth and agar ( 15g/l ) . Where needed , kanamycin was used at final concentration of 50µg/ml . For RNA extraction , E. coli cultures were grown to mid-exponential growth phase <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with 40 % ( w/v ) glucose . 	aerobically	Aeration	0.989105328345672	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz				0	0	False
SRR8309843	GSE123554	GSM3507070	GPL18133		delta-hns rep1	Reconstruction of transcriptional regulatory networks of Fis and H-NS in Escherichia coli from genome wide data analysis	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	strain: str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Supp> str </Supp> . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900621338440077	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz				0	0	False
SRR8309843	GSE123554	GSM3507070	GPL18133		delta-hns rep1	Reconstruction of transcriptional regulatory networks of Fis and H-NS in Escherichia coli from genome wide data analysis	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	strain: str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Supp> str </Supp> . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913350552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz				0	0	False
SRR8309843	GSE123554	GSM3507070	GPL18133		delta-hns rep1	Reconstruction of transcriptional regulatory networks of Fis and H-NS in Escherichia coli from genome wide data analysis	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	material type: whole organism PGCGROWTHCONDITIONS	<Gtype> material type </Gtype> : <Gtype> whole organism </Gtype> 	material type	Genetic background	0.9698714391317996	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz				0	0	False
SRR8309844	GSE123554	GSM3507071	GPL18133		delta-hns rep2	Reconstruction of transcriptional regulatory networks of Fis and H-NS in Escherichia coli from genome wide data analysis	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	E. coli K-12 MG1655 WT, Δfis and Δhns were grown in Luria-Bertani (LB) broth and agar (15g/l). Where needed, kanamycin was used at final concentration of 50µg/ml. For RNA extraction, E. coli cultures were grown to mid-exponential growth phase aerobically at 37°C in M9 minimal media supplemented with 40% (w/v) glucose. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT , Δfis and Δhns were grown in Luria-Bertani ( LB ) broth and agar ( 15g/l ) . Where needed , kanamycin was used at final concentration of 50µg/ml . For RNA extraction , E. coli cultures were grown to mid-exponential growth phase <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with 40 % ( w/v ) glucose . 	aerobically	Aeration	0.989105328345672	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz				0	0	False
SRR8309844	GSE123554	GSM3507071	GPL18133		delta-hns rep2	Reconstruction of transcriptional regulatory networks of Fis and H-NS in Escherichia coli from genome wide data analysis	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	strain: str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Supp> str </Supp> . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900621338440077	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz				0	0	False
SRR8309844	GSE123554	GSM3507071	GPL18133		delta-hns rep2	Reconstruction of transcriptional regulatory networks of Fis and H-NS in Escherichia coli from genome wide data analysis	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	strain: str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	strain : <Supp> str </Supp> . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913350552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz				0	0	False
SRR8309844	GSE123554	GSM3507071	GPL18133		delta-hns rep2	Reconstruction of transcriptional regulatory networks of Fis and H-NS in Escherichia coli from genome wide data analysis	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	material type: whole organism PGCGROWTHCONDITIONS	<Gtype> material type </Gtype> : <Gtype> whole organism </Gtype> 	material type	Genetic background	0.9698714391317996	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE123554/GSE123554.soft.gz				0	0	False
SRR8587784	GSE126710	GSM3611666	GPL26204	31208335	E. coli K-12 MG1655_R1 [MG_1]	RNA-seq of Escherichia coli K-12 MG1655 and Stx2 phage lysogens	GPL26204: NextSeq 550 (Escherichia coli K-12)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE126710/GSE126710.soft.gz				0	0	False
SRR8587785	GSE126710	GSM3611667	GPL26204	31208335	E. coli K-12 MG1655_R2 [MG_2]	RNA-seq of Escherichia coli K-12 MG1655 and Stx2 phage lysogens	GPL26204: NextSeq 550 (Escherichia coli K-12)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE126710/GSE126710.soft.gz				0	0	False
SRR8587786	GSE126710	GSM3611668	GPL26204	31208335	E. coli K-12 MG1655_R3 [MG_3]	RNA-seq of Escherichia coli K-12 MG1655 and Stx2 phage lysogens	GPL26204: NextSeq 550 (Escherichia coli K-12)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE126710/GSE126710.soft.gz				0	0	False
SRR8587787	GSE126710	GSM3611669	GPL26204	31208335	E. coli K-12 MG1655::φO104_R1 [O104_1]	RNA-seq of Escherichia coli K-12 MG1655 and Stx2 phage lysogens	GPL26204: NextSeq 550 (Escherichia coli K-12)	characteristics	genotype/variation: phageO104 in the wrbA gene PGCGROWTHCONDITIONS	genotype/variation : <Gtype> phageO104 in the wrbA gene </Gtype> 	phageO104 in the wrbA gene	Genetic background	0.9958704196409436	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE126710/GSE126710.soft.gz				0	0	False
SRR8587788	GSE126710	GSM3611670	GPL26204	31208335	E. coli K-12 MG1655::φO104_R2 [O104_2]	RNA-seq of Escherichia coli K-12 MG1655 and Stx2 phage lysogens	GPL26204: NextSeq 550 (Escherichia coli K-12)	characteristics	genotype/variation: phageO104 in the wrbA gene PGCGROWTHCONDITIONS	genotype/variation : <Gtype> phageO104 in the wrbA gene </Gtype> 	phageO104 in the wrbA gene	Genetic background	0.9958704196409436	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE126710/GSE126710.soft.gz				0	0	False
SRR8587789	GSE126710	GSM3611671	GPL26204	31208335	E. coli K-12 MG1655::φO104_R3 [O104_3]	RNA-seq of Escherichia coli K-12 MG1655 and Stx2 phage lysogens	GPL26204: NextSeq 550 (Escherichia coli K-12)	characteristics	genotype/variation: phageO104 in the wrbA gene PGCGROWTHCONDITIONS	genotype/variation : <Gtype> phageO104 in the wrbA gene </Gtype> 	phageO104 in the wrbA gene	Genetic background	0.9958704196409436	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE126710/GSE126710.soft.gz				0	0	False
SRR8587790	GSE126710	GSM3611672	GPL26204	31208335	E. coli K-12 MG1655_φPA8_R1 [PA8_1]	RNA-seq of Escherichia coli K-12 MG1655 and Stx2 phage lysogens	GPL26204: NextSeq 550 (Escherichia coli K-12)	characteristics	genotype/variation: phagePA8 in the argW gene PGCGROWTHCONDITIONS	genotype/variation : <Gtype> phagePA8 in the argW gene </Gtype> 	phagePA8 in the argW gene	Genetic background	0.9958704196409436	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE126710/GSE126710.soft.gz				0	0	False
SRR8587791	GSE126710	GSM3611673	GPL26204	31208335	E. coli K-12 MG1655_φPA8_R2 [PA8_2]	RNA-seq of Escherichia coli K-12 MG1655 and Stx2 phage lysogens	GPL26204: NextSeq 550 (Escherichia coli K-12)	characteristics	genotype/variation: phagePA8 in the argW gene PGCGROWTHCONDITIONS	genotype/variation : <Gtype> phagePA8 in the argW gene </Gtype> 	phagePA8 in the argW gene	Genetic background	0.9958704196409436	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE126710/GSE126710.soft.gz				0	0	False
SRR8587792	GSE126710	GSM3611674	GPL26204	31208335	E. coli K-12 MG1655_fastφPA8_R3 [PA8_3]	RNA-seq of Escherichia coli K-12 MG1655 and Stx2 phage lysogens	GPL26204: NextSeq 550 (Escherichia coli K-12)	characteristics	genotype/variation: phagePA8 in the argW gene PGCGROWTHCONDITIONS	genotype/variation : <Gtype> phagePA8 in the argW gene </Gtype> 	phagePA8 in the argW gene	Genetic background	0.9958704196409436	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE126710/GSE126710.soft.gz				0	0	False
SRR9919224	GSE135516	GSM4013462	GPL24377	31651953	WT_1	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR9919225	GSE135516	GSM4013463	GPL24377	31651953	WT_2	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR9919226	GSE135516	GSM4013464	GPL24377	31651953	WT_H2O2_1	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR9919227	GSE135516	GSM4013465	GPL24377	31651953	WT_H2O2_2	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR9919228	GSE135516	GSM4013466	GPL24377	31651953	GMOS_1	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR9919229	GSE135516	GSM4013467	GPL24377	31651953	GMOS_2	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR9919230	GSE135516	GSM4013468	GPL24377	31651953	GMOS_H2O2_1	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR9919232	GSE135516	GSM4013470	GPL24377	31651953	EC ALE-1_1	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR9919233	GSE135516	GSM4013471	GPL24377	31651953	EC ALE-1_2	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR9919234	GSE135516	GSM4013472	GPL24377	31651953	EC ALE-1_H2O2_1	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR9919235	GSE135516	GSM4013473	GPL24377	31651953	EC ALE-1_H2O2_2	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR9919236	GSE135516	GSM4013474	GPL24377	31651953	EC ALE-2_1	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR9919237	GSE135516	GSM4013475	GPL24377	31651953	EC ALE-2_2	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR9919238	GSE135516	GSM4013476	GPL24377	31651953	EC ALE-2_H2O2_1	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR9919239	GSE135516	GSM4013477	GPL24377	31651953	EC ALE-2_H2O2_2	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR9919240	GSE135516	GSM4013478	GPL24377	31651953	EC ALE-3_1	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR9919241	GSE135516	GSM4013479	GPL24377	31651953	EC ALE-3_2	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR9919242	GSE135516	GSM4013480	GPL24377	31651953	EC ALE-3_H2O2_1	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR9919243	GSE135516	GSM4013481	GPL24377	31651953	EC ALE-3_H2O2_2	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR9919244	GSE135516	GSM4013482	GPL24377	31651953	EC ALE-4_1	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR9919245	GSE135516	GSM4013483	GPL24377	31651953	EC ALE-4_2	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR9919246	GSE135516	GSM4013484	GPL24377	31651953	EC ALE-4_H2O2_1	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR9919247	GSE135516	GSM4013485	GPL24377	31651953	EC ALE-4_H2O2_2	OxyR is a convergent target for mutations acquired during adaptation to oxidative stress-prone metabolic states	GPL24377: Illumina HiSeq 4000 (Escherichia coli K-12)	growth_protocol	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source, supplemented with 1 ml trace element solution (100X). The culture was incubated at 37C overnight with agitation, and then was used to inoculate the fresh media. The fresh culture was incubated at 37C with agitation to the mid-log phase (OD600 ≈ 0.5). PGCGROWTHCONDITIONS	Glycerol stocks of E. coli strains were inoculated into M9 minimal media with glucose as carbon source , supplemented with 1 ml trace element solution ( 100X ) . The culture was incubated at 37C overnight with agitation , and then was used to inoculate the fresh <Med> media </Med> . The fresh culture was incubated at 37C with agitation to the <Phase> mid-log phase </Phase> ( OD600 ≈ 0.5 ) . 	media	Medium	0.9376252803451676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE135516/GSE135516.soft.gz				0	0	False
SRR10907640	GSE143855	GSM4275442	GPL24659	33172971	WT_LB_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907640	GSE143855	GSM4275442	GPL24659	33172971	WT_LB_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907640	GSE143855	GSM4275442	GPL24659	33172971	WT_LB_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907640	GSE143855	GSM4275442	GPL24659	33172971	WT_LB_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907641	GSE143855	GSM4275443	GPL24659	33172971	WT_LB_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907641	GSE143855	GSM4275443	GPL24659	33172971	WT_LB_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907641	GSE143855	GSM4275443	GPL24659	33172971	WT_LB_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907641	GSE143855	GSM4275443	GPL24659	33172971	WT_LB_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907642	GSE143855	GSM4275444	GPL24659	33172971	WT_EtOH_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907642	GSE143855	GSM4275444	GPL24659	33172971	WT_EtOH_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907642	GSE143855	GSM4275444	GPL24659	33172971	WT_EtOH_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907642	GSE143855	GSM4275444	GPL24659	33172971	WT_EtOH_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907644	GSE143855	GSM4275446	GPL24659	33172971	BaeR_KO_LB_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907644	GSE143855	GSM4275446	GPL24659	33172971	BaeR_KO_LB_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907644	GSE143855	GSM4275446	GPL24659	33172971	BaeR_KO_LB_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907644	GSE143855	GSM4275446	GPL24659	33172971	BaeR_KO_LB_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907644	GSE143855	GSM4275446	GPL24659	33172971	BaeR_KO_LB_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: {delta}baeR PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- baeR </Gtype> 	-LCB- delta -RCB- baeR	Genetic background	0.9996321218501696	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907645	GSE143855	GSM4275447	GPL24659	33172971	BaeR_KO_ LB_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907645	GSE143855	GSM4275447	GPL24659	33172971	BaeR_KO_ LB_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907645	GSE143855	GSM4275447	GPL24659	33172971	BaeR_KO_ LB_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907645	GSE143855	GSM4275447	GPL24659	33172971	BaeR_KO_ LB_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907645	GSE143855	GSM4275447	GPL24659	33172971	BaeR_KO_ LB_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: {delta}baeR PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- baeR </Gtype> 	-LCB- delta -RCB- baeR	Genetic background	0.9996321218501696	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907646	GSE143855	GSM4275448	GPL24659	33172971	BaeR_KO_EtOH_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907646	GSE143855	GSM4275448	GPL24659	33172971	BaeR_KO_EtOH_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907646	GSE143855	GSM4275448	GPL24659	33172971	BaeR_KO_EtOH_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907646	GSE143855	GSM4275448	GPL24659	33172971	BaeR_KO_EtOH_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907646	GSE143855	GSM4275448	GPL24659	33172971	BaeR_KO_EtOH_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: {delta}baeR PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- baeR </Gtype> 	-LCB- delta -RCB- baeR	Genetic background	0.9996321218501696	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907648	GSE143855	GSM4275450	GPL24659	33172971	CpxR_KO_LB_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907648	GSE143855	GSM4275450	GPL24659	33172971	CpxR_KO_LB_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907648	GSE143855	GSM4275450	GPL24659	33172971	CpxR_KO_LB_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907648	GSE143855	GSM4275450	GPL24659	33172971	CpxR_KO_LB_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907648	GSE143855	GSM4275450	GPL24659	33172971	CpxR_KO_LB_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: {delta}cpxR PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- cpxR </Gtype> 	-LCB- delta -RCB- cpxR	Genetic background	0.9996321218501696	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907649	GSE143855	GSM4275451	GPL24659	33172971	CpxR_KO_LB_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907649	GSE143855	GSM4275451	GPL24659	33172971	CpxR_KO_LB_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907649	GSE143855	GSM4275451	GPL24659	33172971	CpxR_KO_LB_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907649	GSE143855	GSM4275451	GPL24659	33172971	CpxR_KO_LB_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907649	GSE143855	GSM4275451	GPL24659	33172971	CpxR_KO_LB_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: {delta}cpxR PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- cpxR </Gtype> 	-LCB- delta -RCB- cpxR	Genetic background	0.9996321218501696	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907652	GSE143855	GSM4275454	GPL24659	33172971	KdpE_KO_01-KCl_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907652	GSE143855	GSM4275454	GPL24659	33172971	KdpE_KO_01-KCl_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907652	GSE143855	GSM4275454	GPL24659	33172971	KdpE_KO_01-KCl_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907652	GSE143855	GSM4275454	GPL24659	33172971	KdpE_KO_01-KCl_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907652	GSE143855	GSM4275454	GPL24659	33172971	KdpE_KO_01-KCl_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	media: TMA + 0.1 mM KCl PGCGROWTHCONDITIONS	media : <Supp> TMA + 0.1 mM KCl </Supp> 	TMA + 0.1 mM KCl	Medium supplement	0.9524318031050912	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907652	GSE143855	GSM4275454	GPL24659	33172971	KdpE_KO_01-KCl_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: {delta}kdpE PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- kdpE </Gtype> 	-LCB- delta -RCB- kdpE	Genetic background	0.9996321218501696	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907653	GSE143855	GSM4275455	GPL24659	33172971	KdpE_KO_01-KCl_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907653	GSE143855	GSM4275455	GPL24659	33172971	KdpE_KO_01-KCl_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907653	GSE143855	GSM4275455	GPL24659	33172971	KdpE_KO_01-KCl_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907653	GSE143855	GSM4275455	GPL24659	33172971	KdpE_KO_01-KCl_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907653	GSE143855	GSM4275455	GPL24659	33172971	KdpE_KO_01-KCl_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	media: TMA + 0.1 mM KCl PGCGROWTHCONDITIONS	media : <Supp> TMA + 0.1 mM KCl </Supp> 	TMA + 0.1 mM KCl	Medium supplement	0.9524318031050912	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907653	GSE143855	GSM4275455	GPL24659	33172971	KdpE_KO_01-KCl_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: {delta}kdpE PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- kdpE </Gtype> 	-LCB- delta -RCB- kdpE	Genetic background	0.9996321218501696	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907654	GSE143855	GSM4275456	GPL24659	33172971	KdpE_KO_115-KCl_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907654	GSE143855	GSM4275456	GPL24659	33172971	KdpE_KO_115-KCl_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907654	GSE143855	GSM4275456	GPL24659	33172971	KdpE_KO_115-KCl_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907654	GSE143855	GSM4275456	GPL24659	33172971	KdpE_KO_115-KCl_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907654	GSE143855	GSM4275456	GPL24659	33172971	KdpE_KO_115-KCl_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	media: TMA + 115 mM KCl PGCGROWTHCONDITIONS	media : <Supp> TMA + 115 mM KCl </Supp> 	TMA + 115 mM KCl	Medium supplement	0.9524606588961508	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907654	GSE143855	GSM4275456	GPL24659	33172971	KdpE_KO_115-KCl_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: {delta}kdpE PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- kdpE </Gtype> 	-LCB- delta -RCB- kdpE	Genetic background	0.9996321218501696	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907655	GSE143855	GSM4275457	GPL24659	33172971	KdpE_KO_115-KCl_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907655	GSE143855	GSM4275457	GPL24659	33172971	KdpE_KO_115-KCl_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907655	GSE143855	GSM4275457	GPL24659	33172971	KdpE_KO_115-KCl_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907655	GSE143855	GSM4275457	GPL24659	33172971	KdpE_KO_115-KCl_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907655	GSE143855	GSM4275457	GPL24659	33172971	KdpE_KO_115-KCl_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	media: TMA + 115 mM KCl PGCGROWTHCONDITIONS	media : <Supp> TMA + 115 mM KCl </Supp> 	TMA + 115 mM KCl	Medium supplement	0.9524606588961508	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907655	GSE143855	GSM4275457	GPL24659	33172971	KdpE_KO_115-KCl_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: {delta}kdpE PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- kdpE </Gtype> 	-LCB- delta -RCB- kdpE	Genetic background	0.9996321218501696	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907656	GSE143855	GSM4275458	GPL24659	33172971	WT_01-KCl_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907656	GSE143855	GSM4275458	GPL24659	33172971	WT_01-KCl_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907656	GSE143855	GSM4275458	GPL24659	33172971	WT_01-KCl_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907656	GSE143855	GSM4275458	GPL24659	33172971	WT_01-KCl_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907656	GSE143855	GSM4275458	GPL24659	33172971	WT_01-KCl_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	media: TMA + 0.1 mM KCl PGCGROWTHCONDITIONS	media : <Supp> TMA + 0.1 mM KCl </Supp> 	TMA + 0.1 mM KCl	Medium supplement	0.9524318031050912	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907657	GSE143855	GSM4275459	GPL24659	33172971	WT_01-KCl_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907657	GSE143855	GSM4275459	GPL24659	33172971	WT_01-KCl_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907657	GSE143855	GSM4275459	GPL24659	33172971	WT_01-KCl_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907657	GSE143855	GSM4275459	GPL24659	33172971	WT_01-KCl_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907657	GSE143855	GSM4275459	GPL24659	33172971	WT_01-KCl_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	media: TMA + 0.1 mM KCl PGCGROWTHCONDITIONS	media : <Supp> TMA + 0.1 mM KCl </Supp> 	TMA + 0.1 mM KCl	Medium supplement	0.9524318031050912	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907658	GSE143855	GSM4275460	GPL24659	33172971	WT_115-KCl_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907658	GSE143855	GSM4275460	GPL24659	33172971	WT_115-KCl_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907658	GSE143855	GSM4275460	GPL24659	33172971	WT_115-KCl_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907658	GSE143855	GSM4275460	GPL24659	33172971	WT_115-KCl_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907658	GSE143855	GSM4275460	GPL24659	33172971	WT_115-KCl_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	media: TMA + 115 mM KCl PGCGROWTHCONDITIONS	media : <Supp> TMA + 115 mM KCl </Supp> 	TMA + 115 mM KCl	Medium supplement	0.9524606588961508	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907659	GSE143855	GSM4275461	GPL24659	33172971	WT_115-KCl_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907659	GSE143855	GSM4275461	GPL24659	33172971	WT_115-KCl_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907659	GSE143855	GSM4275461	GPL24659	33172971	WT_115-KCl_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907659	GSE143855	GSM4275461	GPL24659	33172971	WT_115-KCl_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907659	GSE143855	GSM4275461	GPL24659	33172971	WT_115-KCl_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	media: TMA + 115 mM KCl PGCGROWTHCONDITIONS	media : <Supp> TMA + 115 mM KCl </Supp> 	TMA + 115 mM KCl	Medium supplement	0.9524606588961508	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907660	GSE143855	GSM4275462	GPL24659	33172971	PhoB_KO_M9_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907660	GSE143855	GSM4275462	GPL24659	33172971	PhoB_KO_M9_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907660	GSE143855	GSM4275462	GPL24659	33172971	PhoB_KO_M9_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907660	GSE143855	GSM4275462	GPL24659	33172971	PhoB_KO_M9_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907660	GSE143855	GSM4275462	GPL24659	33172971	PhoB_KO_M9_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: {delta}phoB PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- phoB </Gtype> 	-LCB- delta -RCB- phoB	Genetic background	0.9996321218501696	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907661	GSE143855	GSM4275463	GPL24659	33172971	PhoB_KO_M9_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907661	GSE143855	GSM4275463	GPL24659	33172971	PhoB_KO_M9_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907661	GSE143855	GSM4275463	GPL24659	33172971	PhoB_KO_M9_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907661	GSE143855	GSM4275463	GPL24659	33172971	PhoB_KO_M9_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907661	GSE143855	GSM4275463	GPL24659	33172971	PhoB_KO_M9_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: {delta}phoB PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- phoB </Gtype> 	-LCB- delta -RCB- phoB	Genetic background	0.9996321218501696	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907662	GSE143855	GSM4275464	GPL24659	33172971	PhoB_KO_M9-P_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907662	GSE143855	GSM4275464	GPL24659	33172971	PhoB_KO_M9-P_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907662	GSE143855	GSM4275464	GPL24659	33172971	PhoB_KO_M9-P_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907662	GSE143855	GSM4275464	GPL24659	33172971	PhoB_KO_M9-P_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907662	GSE143855	GSM4275464	GPL24659	33172971	PhoB_KO_M9-P_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: {delta}phoB PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- phoB </Gtype> 	-LCB- delta -RCB- phoB	Genetic background	0.9996321218501696	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907663	GSE143855	GSM4275465	GPL24659	33172971	PhoB_KO_M9-P_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907663	GSE143855	GSM4275465	GPL24659	33172971	PhoB_KO_M9-P_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907663	GSE143855	GSM4275465	GPL24659	33172971	PhoB_KO_M9-P_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907663	GSE143855	GSM4275465	GPL24659	33172971	PhoB_KO_M9-P_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907663	GSE143855	GSM4275465	GPL24659	33172971	PhoB_KO_M9-P_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: {delta}phoB PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- phoB </Gtype> 	-LCB- delta -RCB- phoB	Genetic background	0.9996321218501696	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907664	GSE143855	GSM4275466	GPL24659	33172971	WT_M9-P_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907664	GSE143855	GSM4275466	GPL24659	33172971	WT_M9-P_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907664	GSE143855	GSM4275466	GPL24659	33172971	WT_M9-P_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907664	GSE143855	GSM4275466	GPL24659	33172971	WT_M9-P_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907665	GSE143855	GSM4275467	GPL24659	33172971	WT_M9-P_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907665	GSE143855	GSM4275467	GPL24659	33172971	WT_M9-P_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907665	GSE143855	GSM4275467	GPL24659	33172971	WT_M9-P_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907665	GSE143855	GSM4275467	GPL24659	33172971	WT_M9-P_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907667	GSE143855	GSM4275469	GPL24659	33172971	ZraR_KO_LB_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907667	GSE143855	GSM4275469	GPL24659	33172971	ZraR_KO_LB_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907667	GSE143855	GSM4275469	GPL24659	33172971	ZraR_KO_LB_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907667	GSE143855	GSM4275469	GPL24659	33172971	ZraR_KO_LB_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907667	GSE143855	GSM4275469	GPL24659	33172971	ZraR_KO_LB_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: {delta}zraR PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- zraR </Gtype> 	-LCB- delta -RCB- zraR	Genetic background	0.9996321218501696	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907668	GSE143855	GSM4275470	GPL24659	33172971	ZraR_KO_ZnCl2_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907668	GSE143855	GSM4275470	GPL24659	33172971	ZraR_KO_ZnCl2_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907668	GSE143855	GSM4275470	GPL24659	33172971	ZraR_KO_ZnCl2_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907668	GSE143855	GSM4275470	GPL24659	33172971	ZraR_KO_ZnCl2_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907668	GSE143855	GSM4275470	GPL24659	33172971	ZraR_KO_ZnCl2_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: {delta}zraR PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- zraR </Gtype> 	-LCB- delta -RCB- zraR	Genetic background	0.9996321218501696	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907669	GSE143855	GSM4275471	GPL24659	33172971	ZraR_KO_ZnCl2_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907669	GSE143855	GSM4275471	GPL24659	33172971	ZraR_KO_ZnCl2_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907669	GSE143855	GSM4275471	GPL24659	33172971	ZraR_KO_ZnCl2_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907669	GSE143855	GSM4275471	GPL24659	33172971	ZraR_KO_ZnCl2_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907669	GSE143855	GSM4275471	GPL24659	33172971	ZraR_KO_ZnCl2_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: {delta}zraR PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- zraR </Gtype> 	-LCB- delta -RCB- zraR	Genetic background	0.9996321218501696	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907670	GSE143855	GSM4275472	GPL24659	33172971	WT_ZnCl2_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907670	GSE143855	GSM4275472	GPL24659	33172971	WT_ZnCl2_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907670	GSE143855	GSM4275472	GPL24659	33172971	WT_ZnCl2_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907670	GSE143855	GSM4275472	GPL24659	33172971	WT_ZnCl2_R1	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907671	GSE143855	GSM4275473	GPL24659	33172971	WT_ZnCl2_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	30 min	Medium supplement	0.9977032519582552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907671	GSE143855	GSM4275473	GPL24659	33172971	WT_ZnCl2_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	For ethanol sensors (BaeR and CpxR): Cells were grown at 37 °C in liquid LB medium to an OD600=0.5, then ethanol was added to a final concentration of 5%. Cells were grown for 30 min in the presence of ethanol before being collected for ChIP-exo and RNA-seq. For KdpDE: Cells were grown at 37 °C overnight in liquid Tris maleic acid minimal medium (TMA) supplemented with 115 mM KCl and 0.4 % w/v Glucose, then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose. Cells were inoculated in TMA with 0.1 mM KCl and 0.4 % w/v Glucose and collected at an OD600=0.5 for ChIP-exo and RNA-seq analysis. For PhoRB: cells were grown in liquid M9 minimal medium until OD600=0.5. Then cells were washed three times with M9 minimal medium without phosphate (M9-P; without Na2HPO4 and KH2PO4) and incubated in M9-P for 60 min (about the doubling time of MG1655 in M9 minimal medium) at 37 °C. For ZraSR: Cells were grown at 37 °C in liquid LB medium containing 1 mM ZnCl2. PGCGROWTHCONDITIONS	For ethanol sensors ( BaeR and CpxR ) : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium to an OD600 = 0.5 , then ethanol was added to a final concentration of 5 % . Cells were grown for <Supp> 30 min </Supp> in the presence of ethanol before being collected for <Technique> ChIP-exo </Technique> and RNA-seq . For KdpDE : Cells were grown at <Temp> 37 °C </Temp> overnight in liquid Tris maleic <Med> acid minimal medium </Med> ( TMA ) supplemented with 115 mM KCl and 0.4 % w/v Glucose , then washed twice with TMA containing 0.1 mM KCl and 0.4 % w/v Glucose . Cells were inoculated in TMA with <Supp> 0.1 mM KCl </Supp> and 0.4 % w/v Glucose and collected at an OD600 = 0.5 for <Technique> ChIP-exo </Technique> and RNA-seq analysis . For PhoRB : cells were grown in liquid <Med> M9 minimal medium </Med> until OD600 = 0.5 . Then cells were washed three times with M9 minimal medium without phosphate ( M9-P ; without Na2HPO4 and KH2PO4 ) and incubated in M9-P for 60 min ( about the doubling time of MG1655 in <Med> M9 minimal medium </Med> ) at <Temp> 37 °C </Temp> . For ZraSR : Cells were grown at <Temp> 37 °C </Temp> in liquid LB medium containing 1 mM ZnCl2 . 	0.1 mM KCl	Medium supplement	0.9933870801765676	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907671	GSE143855	GSM4275473	GPL24659	33172971	WT_ZnCl2_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR10907671	GSE143855	GSM4275473	GPL24659	33172971	WT_ZnCl2_R2	Validated transcriptional regulatory roles for five two-component systems in E. coli (RNA-seq dataset)	GPL24659: Illumina HiSeq 4000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE143855/GSE143855.soft.gz				0	0	False
SRR11431046	GSE147611	GSM4435425	GPL23030-GPL28314	33568644	sigma70WT_RNA-seq_rep1	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655, NC_000913.2 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NC _ 000913.2 	K-12	Organism	0.9900556610455188	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431046	GSE147611	GSM4435425	GPL23030-GPL28314	33568644	sigma70WT_RNA-seq_rep1	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	extract_protocol	Cells were resuspended in TRIzol (Invitrogen) and incubated for 4 min at 95 ºC to disrupt the cells. The total RNA was purified by PCI extraction and chloroform extraction. After centrifugation, equal volume of isopropanol was added to the top water phase to precipitate the total RNA. The genomic DNA was digested by 50 U DNase I for 30 min at room temperature. The RNA was then purified by RNeasy Mini Kit (Qiagen). PGCGROWTHCONDITIONS	Cells were resuspended in TRIzol ( Invitrogen ) and incubated for 4 min at 95 ºC to disrupt the cells . The total RNA was purified by PCI extraction and chloroform extraction . After centrifugation , equal volume of isopropanol was added to the top water phase to precipitate the total RNA . The genomic DNA was digested by 50 U DNase I for <Supp> 30 min </Supp> at room temperature . The RNA was then purified by RNeasy Mini Kit ( Qiagen ) . 	30 min	Medium supplement	0.99831357743955	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431046	GSE147611	GSM4435425	GPL23030-GPL28314	33568644	sigma70WT_RNA-seq_rep1	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	organism	Escherichia coli str. K-12 substr. W3110 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . W3110 	K-12	Organism	0.9900589497592464	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431046	GSE147611	GSM4435425	GPL23030-GPL28314	33568644	sigma70WT_RNA-seq_rep1	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	characteristics	strain: sigma70 WT PGCGROWTHCONDITIONS	strain : <Gtype> sigma70 WT </Gtype> 	sigma70 WT	Genetic background	0.980608098255098	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431046	GSE147611	GSM4435425	GPL23030-GPL28314	33568644	sigma70WT_RNA-seq_rep1	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	characteristics	genotype: W3110 6xHis-rpoD PGCGROWTHCONDITIONS	genotype : <Gtype> W3110 6xHis-rpoD </Gtype> 	W3110 6xHis-rpoD	Genetic background	0.9452273350032782	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431047	GSE147611	GSM4435426	GPL23030-GPL28314	33568644	sigma70WT_RNA-seq_rep2	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655, NC_000913.2 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NC _ 000913.2 	K-12	Organism	0.9900556610455188	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431047	GSE147611	GSM4435426	GPL23030-GPL28314	33568644	sigma70WT_RNA-seq_rep2	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	extract_protocol	Cells were resuspended in TRIzol (Invitrogen) and incubated for 4 min at 95 ºC to disrupt the cells. The total RNA was purified by PCI extraction and chloroform extraction. After centrifugation, equal volume of isopropanol was added to the top water phase to precipitate the total RNA. The genomic DNA was digested by 50 U DNase I for 30 min at room temperature. The RNA was then purified by RNeasy Mini Kit (Qiagen). PGCGROWTHCONDITIONS	Cells were resuspended in TRIzol ( Invitrogen ) and incubated for 4 min at 95 ºC to disrupt the cells . The total RNA was purified by PCI extraction and chloroform extraction . After centrifugation , equal volume of isopropanol was added to the top water phase to precipitate the total RNA . The genomic DNA was digested by 50 U DNase I for <Supp> 30 min </Supp> at room temperature . The RNA was then purified by RNeasy Mini Kit ( Qiagen ) . 	30 min	Medium supplement	0.99831357743955	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431047	GSE147611	GSM4435426	GPL23030-GPL28314	33568644	sigma70WT_RNA-seq_rep2	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	organism	Escherichia coli str. K-12 substr. W3110 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . W3110 	K-12	Organism	0.9900589497592464	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431047	GSE147611	GSM4435426	GPL23030-GPL28314	33568644	sigma70WT_RNA-seq_rep2	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	characteristics	strain: sigma70 WT PGCGROWTHCONDITIONS	strain : <Gtype> sigma70 WT </Gtype> 	sigma70 WT	Genetic background	0.980608098255098	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431047	GSE147611	GSM4435426	GPL23030-GPL28314	33568644	sigma70WT_RNA-seq_rep2	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	characteristics	genotype: W3110 6xHis-rpoD PGCGROWTHCONDITIONS	genotype : <Gtype> W3110 6xHis-rpoD </Gtype> 	W3110 6xHis-rpoD	Genetic background	0.9452273350032782	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431048	GSE147611	GSM4435427	GPL23030-GPL28314	33568644	sigma70WT_RNA-seq_rep3	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655, NC_000913.2 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NC _ 000913.2 	K-12	Organism	0.9900556610455188	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431048	GSE147611	GSM4435427	GPL23030-GPL28314	33568644	sigma70WT_RNA-seq_rep3	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	extract_protocol	Cells were resuspended in TRIzol (Invitrogen) and incubated for 4 min at 95 ºC to disrupt the cells. The total RNA was purified by PCI extraction and chloroform extraction. After centrifugation, equal volume of isopropanol was added to the top water phase to precipitate the total RNA. The genomic DNA was digested by 50 U DNase I for 30 min at room temperature. The RNA was then purified by RNeasy Mini Kit (Qiagen). PGCGROWTHCONDITIONS	Cells were resuspended in TRIzol ( Invitrogen ) and incubated for 4 min at 95 ºC to disrupt the cells . The total RNA was purified by PCI extraction and chloroform extraction . After centrifugation , equal volume of isopropanol was added to the top water phase to precipitate the total RNA . The genomic DNA was digested by 50 U DNase I for <Supp> 30 min </Supp> at room temperature . The RNA was then purified by RNeasy Mini Kit ( Qiagen ) . 	30 min	Medium supplement	0.99831357743955	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431048	GSE147611	GSM4435427	GPL23030-GPL28314	33568644	sigma70WT_RNA-seq_rep3	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	organism	Escherichia coli str. K-12 substr. W3110 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . W3110 	K-12	Organism	0.9900589497592464	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431048	GSE147611	GSM4435427	GPL23030-GPL28314	33568644	sigma70WT_RNA-seq_rep3	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	characteristics	strain: sigma70 WT PGCGROWTHCONDITIONS	strain : <Gtype> sigma70 WT </Gtype> 	sigma70 WT	Genetic background	0.980608098255098	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431048	GSE147611	GSM4435427	GPL23030-GPL28314	33568644	sigma70WT_RNA-seq_rep3	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	characteristics	genotype: W3110 6xHis-rpoD PGCGROWTHCONDITIONS	genotype : <Gtype> W3110 6xHis-rpoD </Gtype> 	W3110 6xHis-rpoD	Genetic background	0.9452273350032782	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431049	GSE147611	GSM4435428	GPL23030-GPL28314	33568644	sigma70greAB-_RNA-seq_rep1	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655, NC_000913.2 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NC _ 000913.2 	K-12	Organism	0.9900556610455188	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431049	GSE147611	GSM4435428	GPL23030-GPL28314	33568644	sigma70greAB-_RNA-seq_rep1	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	extract_protocol	Cells were resuspended in TRIzol (Invitrogen) and incubated for 4 min at 95 ºC to disrupt the cells. The total RNA was purified by PCI extraction and chloroform extraction. After centrifugation, equal volume of isopropanol was added to the top water phase to precipitate the total RNA. The genomic DNA was digested by 50 U DNase I for 30 min at room temperature. The RNA was then purified by RNeasy Mini Kit (Qiagen). PGCGROWTHCONDITIONS	Cells were resuspended in TRIzol ( Invitrogen ) and incubated for 4 min at 95 ºC to disrupt the cells . The total RNA was purified by PCI extraction and chloroform extraction . After centrifugation , equal volume of isopropanol was added to the top water phase to precipitate the total RNA . The genomic DNA was digested by 50 U DNase I for <Supp> 30 min </Supp> at room temperature . The RNA was then purified by RNeasy Mini Kit ( Qiagen ) . 	30 min	Medium supplement	0.99831357743955	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431049	GSE147611	GSM4435428	GPL23030-GPL28314	33568644	sigma70greAB-_RNA-seq_rep1	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	organism	Escherichia coli str. K-12 substr. W3110 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . W3110 	K-12	Organism	0.9900589497592464	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431049	GSE147611	GSM4435428	GPL23030-GPL28314	33568644	sigma70greAB-_RNA-seq_rep1	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	characteristics	genotype: W3110 6xHis-rpoD greA::tet greB::amp PGCGROWTHCONDITIONS	genotype : <Gtype> W3110 6xHis-rpoD greA : : tet greB : : amp </Gtype> 	W3110 6xHis-rpoD greA : : tet greB : : amp	Genetic background	0.9982590510214198	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431050	GSE147611	GSM4435429	GPL23030-GPL28314	33568644	sigma70greAB-_RNA-seq_rep2	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655, NC_000913.2 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NC _ 000913.2 	K-12	Organism	0.9900556610455188	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431050	GSE147611	GSM4435429	GPL23030-GPL28314	33568644	sigma70greAB-_RNA-seq_rep2	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	extract_protocol	Cells were resuspended in TRIzol (Invitrogen) and incubated for 4 min at 95 ºC to disrupt the cells. The total RNA was purified by PCI extraction and chloroform extraction. After centrifugation, equal volume of isopropanol was added to the top water phase to precipitate the total RNA. The genomic DNA was digested by 50 U DNase I for 30 min at room temperature. The RNA was then purified by RNeasy Mini Kit (Qiagen). PGCGROWTHCONDITIONS	Cells were resuspended in TRIzol ( Invitrogen ) and incubated for 4 min at 95 ºC to disrupt the cells . The total RNA was purified by PCI extraction and chloroform extraction . After centrifugation , equal volume of isopropanol was added to the top water phase to precipitate the total RNA . The genomic DNA was digested by 50 U DNase I for <Supp> 30 min </Supp> at room temperature . The RNA was then purified by RNeasy Mini Kit ( Qiagen ) . 	30 min	Medium supplement	0.99831357743955	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431050	GSE147611	GSM4435429	GPL23030-GPL28314	33568644	sigma70greAB-_RNA-seq_rep2	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	organism	Escherichia coli str. K-12 substr. W3110 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . W3110 	K-12	Organism	0.9900589497592464	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431050	GSE147611	GSM4435429	GPL23030-GPL28314	33568644	sigma70greAB-_RNA-seq_rep2	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	characteristics	genotype: W3110 6xHis-rpoD greA::tet greB::amp PGCGROWTHCONDITIONS	genotype : <Gtype> W3110 6xHis-rpoD greA : : tet greB : : amp </Gtype> 	W3110 6xHis-rpoD greA : : tet greB : : amp	Genetic background	0.9982590510214198	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431051	GSE147611	GSM4435430	GPL23030-GPL28314	33568644	sigma70greAB-_RNA-seq_rep3	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655, NC_000913.2 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NC _ 000913.2 	K-12	Organism	0.9900556610455188	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431051	GSE147611	GSM4435430	GPL23030-GPL28314	33568644	sigma70greAB-_RNA-seq_rep3	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	extract_protocol	Cells were resuspended in TRIzol (Invitrogen) and incubated for 4 min at 95 ºC to disrupt the cells. The total RNA was purified by PCI extraction and chloroform extraction. After centrifugation, equal volume of isopropanol was added to the top water phase to precipitate the total RNA. The genomic DNA was digested by 50 U DNase I for 30 min at room temperature. The RNA was then purified by RNeasy Mini Kit (Qiagen). PGCGROWTHCONDITIONS	Cells were resuspended in TRIzol ( Invitrogen ) and incubated for 4 min at 95 ºC to disrupt the cells . The total RNA was purified by PCI extraction and chloroform extraction . After centrifugation , equal volume of isopropanol was added to the top water phase to precipitate the total RNA . The genomic DNA was digested by 50 U DNase I for <Supp> 30 min </Supp> at room temperature . The RNA was then purified by RNeasy Mini Kit ( Qiagen ) . 	30 min	Medium supplement	0.99831357743955	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431051	GSE147611	GSM4435430	GPL23030-GPL28314	33568644	sigma70greAB-_RNA-seq_rep3	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	organism	Escherichia coli str. K-12 substr. W3110 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . W3110 	K-12	Organism	0.9900589497592464	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR11431051	GSE147611	GSM4435430	GPL23030-GPL28314	33568644	sigma70greAB-_RNA-seq_rep3	Nascent RNA sequencing identifies a widespread sigma70-dependent pausing regulated by Gre factors in bacteria	GPL23030: Illumina MiSeq (Escherichia coli str. K-12 substr. W3110). GPL28314: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. W3110)	characteristics	genotype: W3110 6xHis-rpoD greA::tet greB::amp PGCGROWTHCONDITIONS	genotype : <Gtype> W3110 6xHis-rpoD greA : : tet greB : : amp </Gtype> 	W3110 6xHis-rpoD greA : : tet greB : : amp	Genetic background	0.9982590510214198	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE147611/GSE147611.soft.gz				0	0	False
SRR057747	GSE21341	GSM533304	GPL10328	20671182	time point 0	genome-wide measurement of mRNA lifetime in Escherichia coli	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	characteristics	strain: DY330 (W3110) PGCGROWTHCONDITIONS	strain : <Med> DY330 ( W3110 ) </Med> 	DY330 ( W3110 )	Medium	0.9017568219824774	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE21341/GSE21341.soft.gz				0	0	False
SRR057748	GSE21341	GSM533305	GPL10328	20671182	time point 2	genome-wide measurement of mRNA lifetime in Escherichia coli	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	characteristics	strain: DY330 (W3110) PGCGROWTHCONDITIONS	strain : <Med> DY330 ( W3110 ) </Med> 	DY330 ( W3110 )	Medium	0.9017568219824774	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE21341/GSE21341.soft.gz				0	0	False
SRR057749	GSE21341	GSM533306	GPL10328	20671182	time point 4	genome-wide measurement of mRNA lifetime in Escherichia coli	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	characteristics	strain: DY330 (W3110) PGCGROWTHCONDITIONS	strain : <Med> DY330 ( W3110 ) </Med> 	DY330 ( W3110 )	Medium	0.9017568219824774	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE21341/GSE21341.soft.gz				0	0	False
SRR057750	GSE21341	GSM533307	GPL10328	20671182	time point 6	genome-wide measurement of mRNA lifetime in Escherichia coli	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	characteristics	strain: DY330 (W3110) PGCGROWTHCONDITIONS	strain : <Med> DY330 ( W3110 ) </Med> 	DY330 ( W3110 )	Medium	0.9017568219824774	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE21341/GSE21341.soft.gz				0	0	False
SRR057751	GSE21341	GSM533308	GPL10328	20671182	time point 8	genome-wide measurement of mRNA lifetime in Escherichia coli	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	characteristics	strain: DY330 (W3110) PGCGROWTHCONDITIONS	strain : <Med> DY330 ( W3110 ) </Med> 	DY330 ( W3110 )	Medium	0.9017568219824774	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE21341/GSE21341.soft.gz				0	0	False
SRR364363	GSE33671	GSM832606	GPL10328	22153074	DSP1_AP	Selective ribosome profiling reveals the co-translational chaperone action of trigger factor in vivo	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	growth_protocol	An overnight culture was diluted to an OD600 of 0.02 in LB media supplemented with 100 µg/ml of carbenicillin, 40 µg/ml biotin, and 70 µM IPTG. The back diluted culture was grown at 37°C until reaching an OD600 of 0.45. PGCGROWTHCONDITIONS	An overnight culture was diluted to an <OD> OD600 of 0.02 </OD> in <Med> LB media </Med> supplemented with 100 µg/ml of carbenicillin , 40 µg/ml biotin , and <Supp> 70 µM IPTG </Supp> . The back diluted culture was grown at <Temp> 37 °C </Temp> until reaching an OD600 of 0.45 . 	70 µM IPTG	Medium supplement	0.9611665935639404	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz				0	0	False
SRR364363	GSE33671	GSM832606	GPL10328	22153074	DSP1_AP	Selective ribosome profiling reveals the co-translational chaperone action of trigger factor in vivo	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	characteristics	genotype/variation: MC4100 ∆tig::kan pTig-TEV-Avi PGCGROWTHCONDITIONS	genotype/variation : <Gtype> MC4100 ∆ tig : : kan pTig-TEV-Avi </Gtype> 	MC4100 ∆ tig : : kan pTig-TEV-Avi	Genetic background	0.998811911774524	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz				0	0	False
SRR364364	GSE33671	GSM832607	GPL10328	22153074	DSP1_Total	Selective ribosome profiling reveals the co-translational chaperone action of trigger factor in vivo	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	growth_protocol	An overnight culture was diluted to an OD600 of 0.02 in LB media supplemented with 100 µg/ml of carbenicillin, 40 µg/ml biotin, and 70 µM IPTG. The back diluted culture was grown at 37°C until reaching an OD600 of 0.45. PGCGROWTHCONDITIONS	An overnight culture was diluted to an <OD> OD600 of 0.02 </OD> in <Med> LB media </Med> supplemented with 100 µg/ml of carbenicillin , 40 µg/ml biotin , and <Supp> 70 µM IPTG </Supp> . The back diluted culture was grown at <Temp> 37 °C </Temp> until reaching an OD600 of 0.45 . 	70 µM IPTG	Medium supplement	0.9611665935639404	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz				0	0	False
SRR364364	GSE33671	GSM832607	GPL10328	22153074	DSP1_Total	Selective ribosome profiling reveals the co-translational chaperone action of trigger factor in vivo	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	characteristics	genotype/variation: MC4100 ∆tig::kan pTig-TEV-Avi PGCGROWTHCONDITIONS	genotype/variation : <Gtype> MC4100 ∆ tig : : kan pTig-TEV-Avi </Gtype> 	MC4100 ∆ tig : : kan pTig-TEV-Avi	Genetic background	0.998811911774524	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz				0	0	False
SRR364365	GSE33671	GSM832608	GPL10328	22153074	DSP2_AP	Selective ribosome profiling reveals the co-translational chaperone action of trigger factor in vivo	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	growth_protocol	An overnight culture was diluted to an OD600 of 0.02 in LB media supplemented with 100 µg/ml of carbenicillin, 40 µg/ml biotin, and 70 µM IPTG. The back diluted culture was grown at 37°C until reaching an OD600 of 0.45. PGCGROWTHCONDITIONS	An overnight culture was diluted to an <OD> OD600 of 0.02 </OD> in <Med> LB media </Med> supplemented with 100 µg/ml of carbenicillin , 40 µg/ml biotin , and <Supp> 70 µM IPTG </Supp> . The back diluted culture was grown at <Temp> 37 °C </Temp> until reaching an OD600 of 0.45 . 	70 µM IPTG	Medium supplement	0.9611665935639404	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz				0	0	False
SRR364365	GSE33671	GSM832608	GPL10328	22153074	DSP2_AP	Selective ribosome profiling reveals the co-translational chaperone action of trigger factor in vivo	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	characteristics	genotype/variation: MC4100 ∆tig::kan pTig-TEV-Avi PGCGROWTHCONDITIONS	genotype/variation : <Gtype> MC4100 ∆ tig : : kan pTig-TEV-Avi </Gtype> 	MC4100 ∆ tig : : kan pTig-TEV-Avi	Genetic background	0.998811911774524	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz				0	0	False
SRR364366	GSE33671	GSM832609	GPL10328	22153074	DSP2_Total	Selective ribosome profiling reveals the co-translational chaperone action of trigger factor in vivo	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	growth_protocol	An overnight culture was diluted to an OD600 of 0.02 in LB media supplemented with 100 µg/ml of carbenicillin, 40 µg/ml biotin, and 70 µM IPTG. The back diluted culture was grown at 37°C until reaching an OD600 of 0.45. PGCGROWTHCONDITIONS	An overnight culture was diluted to an <OD> OD600 of 0.02 </OD> in <Med> LB media </Med> supplemented with 100 µg/ml of carbenicillin , 40 µg/ml biotin , and <Supp> 70 µM IPTG </Supp> . The back diluted culture was grown at <Temp> 37 °C </Temp> until reaching an OD600 of 0.45 . 	70 µM IPTG	Medium supplement	0.9611665935639404	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz				0	0	False
SRR364366	GSE33671	GSM832609	GPL10328	22153074	DSP2_Total	Selective ribosome profiling reveals the co-translational chaperone action of trigger factor in vivo	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	characteristics	genotype/variation: MC4100 ∆tig::kan pTig-TEV-Avi PGCGROWTHCONDITIONS	genotype/variation : <Gtype> MC4100 ∆ tig : : kan pTig-TEV-Avi </Gtype> 	MC4100 ∆ tig : : kan pTig-TEV-Avi	Genetic background	0.998811911774524	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz				0	0	False
SRR364367	GSE33671	GSM832610	GPL10328	22153074	DSP3_AP	Selective ribosome profiling reveals the co-translational chaperone action of trigger factor in vivo	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	growth_protocol	An overnight culture was diluted to an OD600 of 0.02 in LB media supplemented with 100 µg/ml of carbenicillin, 40 µg/ml biotin, and 70 µM IPTG. The back diluted culture was grown at 37°C until reaching an OD600 of 0.45. PGCGROWTHCONDITIONS	An overnight culture was diluted to an <OD> OD600 of 0.02 </OD> in <Med> LB media </Med> supplemented with 100 µg/ml of carbenicillin , 40 µg/ml biotin , and <Supp> 70 µM IPTG </Supp> . The back diluted culture was grown at <Temp> 37 °C </Temp> until reaching an OD600 of 0.45 . 	70 µM IPTG	Medium supplement	0.9611665935639404	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz				0	0	False
SRR364367	GSE33671	GSM832610	GPL10328	22153074	DSP3_AP	Selective ribosome profiling reveals the co-translational chaperone action of trigger factor in vivo	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	characteristics	genotype/variation: MC4100 ∆tig::kan pTig-TEV-Avi PGCGROWTHCONDITIONS	genotype/variation : <Gtype> MC4100 ∆ tig : : kan pTig-TEV-Avi </Gtype> 	MC4100 ∆ tig : : kan pTig-TEV-Avi	Genetic background	0.998811911774524	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz				0	0	False
SRR364368	GSE33671	GSM832611	GPL10328	22153074	DSP3_Total	Selective ribosome profiling reveals the co-translational chaperone action of trigger factor in vivo	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	growth_protocol	An overnight culture was diluted to an OD600 of 0.02 in LB media supplemented with 100 µg/ml of carbenicillin, 40 µg/ml biotin, and 70 µM IPTG. The back diluted culture was grown at 37°C until reaching an OD600 of 0.45. PGCGROWTHCONDITIONS	An overnight culture was diluted to an <OD> OD600 of 0.02 </OD> in <Med> LB media </Med> supplemented with 100 µg/ml of carbenicillin , 40 µg/ml biotin , and <Supp> 70 µM IPTG </Supp> . The back diluted culture was grown at <Temp> 37 °C </Temp> until reaching an OD600 of 0.45 . 	70 µM IPTG	Medium supplement	0.9611665935639404	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz				0	0	False
SRR364368	GSE33671	GSM832611	GPL10328	22153074	DSP3_Total	Selective ribosome profiling reveals the co-translational chaperone action of trigger factor in vivo	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	characteristics	genotype/variation: MC4100 ∆tig::kan pTig-TEV-Avi PGCGROWTHCONDITIONS	genotype/variation : <Gtype> MC4100 ∆ tig : : kan pTig-TEV-Avi </Gtype> 	MC4100 ∆ tig : : kan pTig-TEV-Avi	Genetic background	0.998811911774524	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz				0	0	False
SRR364369	GSE33671	GSM832612	GPL10328	22153074	EDC1_AP	Selective ribosome profiling reveals the co-translational chaperone action of trigger factor in vivo	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	growth_protocol	An overnight culture was diluted to an OD600 of 0.02 in LB media supplemented with 100 µg/ml of carbenicillin, 40 µg/ml biotin, and 70 µM IPTG. The back diluted culture was grown at 37°C until reaching an OD600 of 0.45. PGCGROWTHCONDITIONS	An overnight culture was diluted to an <OD> OD600 of 0.02 </OD> in <Med> LB media </Med> supplemented with 100 µg/ml of carbenicillin , 40 µg/ml biotin , and <Supp> 70 µM IPTG </Supp> . The back diluted culture was grown at <Temp> 37 °C </Temp> until reaching an OD600 of 0.45 . 	70 µM IPTG	Medium supplement	0.9611665935639404	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz				0	0	False
SRR364369	GSE33671	GSM832612	GPL10328	22153074	EDC1_AP	Selective ribosome profiling reveals the co-translational chaperone action of trigger factor in vivo	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	characteristics	genotype/variation: MC4100 ∆tig::kan pTig-TEV-Avi PGCGROWTHCONDITIONS	genotype/variation : <Gtype> MC4100 ∆ tig : : kan pTig-TEV-Avi </Gtype> 	MC4100 ∆ tig : : kan pTig-TEV-Avi	Genetic background	0.998811911774524	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz				0	0	False
SRR364370	GSE33671	GSM832613	GPL10328	22153074	EDC1_Total	Selective ribosome profiling reveals the co-translational chaperone action of trigger factor in vivo	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	growth_protocol	An overnight culture was diluted to an OD600 of 0.02 in LB media supplemented with 100 µg/ml of carbenicillin, 40 µg/ml biotin, and 70 µM IPTG. The back diluted culture was grown at 37°C until reaching an OD600 of 0.45. PGCGROWTHCONDITIONS	An overnight culture was diluted to an <OD> OD600 of 0.02 </OD> in <Med> LB media </Med> supplemented with 100 µg/ml of carbenicillin , 40 µg/ml biotin , and <Supp> 70 µM IPTG </Supp> . The back diluted culture was grown at <Temp> 37 °C </Temp> until reaching an OD600 of 0.45 . 	70 µM IPTG	Medium supplement	0.9611665935639404	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz				0	0	False
SRR364370	GSE33671	GSM832613	GPL10328	22153074	EDC1_Total	Selective ribosome profiling reveals the co-translational chaperone action of trigger factor in vivo	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	characteristics	genotype/variation: MC4100 ∆tig::kan pTig-TEV-Avi PGCGROWTHCONDITIONS	genotype/variation : <Gtype> MC4100 ∆ tig : : kan pTig-TEV-Avi </Gtype> 	MC4100 ∆ tig : : kan pTig-TEV-Avi	Genetic background	0.998811911774524	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE33671/GSE33671.soft.gz				0	0	False
SRR389819	GSE34449	GSM849370	GPL15010	22232676	E_coli_transcriptome_1	Digital RNA Sequencing Minimizes Sequence-Dependent Bias and Amplification Noise with Optimized Single Molecule Barcodes	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome build: E. coli [K-12 MG1655 strain (U00096.2) PGCGROWTHCONDITIONS	Genome build : E. coli [ K-12 MG1655 strain ( <Gversion> U00096 .2 ) </Gversion> 	U00096 .2 )	Gversion	0.9949523502833696	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz				0	0	False
SRR389819	GSE34449	GSM849370	GPL15010	22232676	E_coli_transcriptome_1	Digital RNA Sequencing Minimizes Sequence-Dependent Bias and Amplification Noise with Optimized Single Molecule Barcodes	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli [K-12 MG1655 strain (U00096.2)] was grown overnight at 30 °C in LB medium.  The resulting culture was diluted 500-fold in fresh LB medium and grown at 30 °C for 3.5 hours such that O.D. at 600 nm became 0.30-0.35. PGCGROWTHCONDITIONS	E. coli [ K-12 MG1655 strain ( <Gversion> U00096 .2 </Gversion> ) ] was grown overnight at <Temp> 30 °C </Temp> in LB medium . The resulting culture was diluted 500-fold in fresh LB medium and grown at 30 °C for 3.5 hours such that O.D. at 600 nm became 0.30-0.35 . 	U00096 .2	Gversion	0.9894337871754992	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz				0	0	False
SRR389819	GSE34449	GSM849370	GPL15010	22232676	E_coli_transcriptome_1	Digital RNA Sequencing Minimizes Sequence-Dependent Bias and Amplification Noise with Optimized Single Molecule Barcodes	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz				0	0	False
SRR389819	GSE34449	GSM849370	GPL15010	22232676	E_coli_transcriptome_1	Digital RNA Sequencing Minimizes Sequence-Dependent Bias and Amplification Noise with Optimized Single Molecule Barcodes	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz				0	0	False
SRR389819	GSE34449	GSM849370	GPL15010	22232676	E_coli_transcriptome_1	Digital RNA Sequencing Minimizes Sequence-Dependent Bias and Amplification Noise with Optimized Single Molecule Barcodes	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	reference genome: U00096.2 PGCGROWTHCONDITIONS	reference genome : <Gversion> U00096 .2 </Gversion> 	U00096 .2	Gversion	0.9999407485708462	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz				0	0	False
SRR389819	GSE34449	GSM849370	GPL15010	22232676	E_coli_transcriptome_1	Digital RNA Sequencing Minimizes Sequence-Dependent Bias and Amplification Noise with Optimized Single Molecule Barcodes	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz				0	0	False
SRR389819	GSE34449	GSM849370	GPL15010	22232676	E_coli_transcriptome_1	Digital RNA Sequencing Minimizes Sequence-Dependent Bias and Amplification Noise with Optimized Single Molecule Barcodes	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli [K-12 MG1655 strain (U00096.2)] was grown overnight at 30 °C in LB medium.  The resulting culture was diluted 500-fold in fresh LB medium and grown at 30 °C for 3.5 hours such that O.D. at 600 nm became 0.30-0.35. PGCGROWTHCONDITIONS	E. coli [ K-12 MG1655 strain ( <Gversion> U00096 .2 </Gversion> ) ] was grown overnight at <Temp> 30 °C </Temp> in LB medium . The resulting culture was diluted 500-fold in fresh LB medium and grown at 30 °C for 3.5 hours such that O.D. at 600 nm became 0.30-0.35 . 	U00096 .2	Gversion	0.9894337890335201	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz				0	0	False
SRR389820	GSE34449	GSM849371	GPL15010	22232676	E_coli_transcriptome_2	Digital RNA Sequencing Minimizes Sequence-Dependent Bias and Amplification Noise with Optimized Single Molecule Barcodes	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome build: E. coli [K-12 MG1655 strain (U00096.2) PGCGROWTHCONDITIONS	Genome build : E. coli [ K-12 MG1655 strain ( <Gversion> U00096 .2 ) </Gversion> 	U00096 .2 )	Gversion	0.9949523502833696	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz				0	0	False
SRR389820	GSE34449	GSM849371	GPL15010	22232676	E_coli_transcriptome_2	Digital RNA Sequencing Minimizes Sequence-Dependent Bias and Amplification Noise with Optimized Single Molecule Barcodes	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli [K-12 MG1655 strain (U00096.2)] was grown overnight at 30 °C in LB medium.  The resulting culture was diluted 500-fold in fresh LB medium and grown at 30 °C for 3.5 hours such that O.D. at 600 nm became 0.30-0.35. PGCGROWTHCONDITIONS	E. coli [ K-12 MG1655 strain ( <Gversion> U00096 .2 </Gversion> ) ] was grown overnight at <Temp> 30 °C </Temp> in LB medium . The resulting culture was diluted 500-fold in fresh LB medium and grown at 30 °C for 3.5 hours such that O.D. at 600 nm became 0.30-0.35 . 	U00096 .2	Gversion	0.9894337871754992	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz				0	0	False
SRR389820	GSE34449	GSM849371	GPL15010	22232676	E_coli_transcriptome_2	Digital RNA Sequencing Minimizes Sequence-Dependent Bias and Amplification Noise with Optimized Single Molecule Barcodes	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz				0	0	False
SRR389820	GSE34449	GSM849371	GPL15010	22232676	E_coli_transcriptome_2	Digital RNA Sequencing Minimizes Sequence-Dependent Bias and Amplification Noise with Optimized Single Molecule Barcodes	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz				0	0	False
SRR389820	GSE34449	GSM849371	GPL15010	22232676	E_coli_transcriptome_2	Digital RNA Sequencing Minimizes Sequence-Dependent Bias and Amplification Noise with Optimized Single Molecule Barcodes	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	reference genome: U00096.2 PGCGROWTHCONDITIONS	reference genome : <Gversion> U00096 .2 </Gversion> 	U00096 .2	Gversion	0.9999407485708462	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz				0	0	False
SRR389820	GSE34449	GSM849371	GPL15010	22232676	E_coli_transcriptome_2	Digital RNA Sequencing Minimizes Sequence-Dependent Bias and Amplification Noise with Optimized Single Molecule Barcodes	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz				0	0	False
SRR389820	GSE34449	GSM849371	GPL15010	22232676	E_coli_transcriptome_2	Digital RNA Sequencing Minimizes Sequence-Dependent Bias and Amplification Noise with Optimized Single Molecule Barcodes	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli [K-12 MG1655 strain (U00096.2)] was grown overnight at 30 °C in LB medium.  The resulting culture was diluted 500-fold in fresh LB medium and grown at 30 °C for 3.5 hours such that O.D. at 600 nm became 0.30-0.35. PGCGROWTHCONDITIONS	E. coli [ K-12 MG1655 strain ( <Gversion> U00096 .2 </Gversion> ) ] was grown overnight at <Temp> 30 °C </Temp> in LB medium . The resulting culture was diluted 500-fold in fresh LB medium and grown at 30 °C for 3.5 hours such that O.D. at 600 nm became 0.30-0.35 . 	U00096 .2	Gversion	0.9894337890335201	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE34449/GSE34449.soft.gz				0	0	False
SRR534267SRR534268	GSE39926	GSM981539	GPL10328	23385483	G500_1	Evolutionary potential, cross-stress behavior and the genetic basis of acquired stress resistance in Escherichia coli	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	data_processing	preprocessed RNA-Seq reads were mapped to the reference Escherichia coli strain K12 sub-strain MG1655 genome (GenBank accession no. U00096.2) by BWA toolkit version 0.5.9-r16 with the following options: bwa aln -q 20 PGCGROWTHCONDITIONS	preprocessed RNA-Seq reads were mapped to the reference Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 </Gversion> ) by BWA toolkit version 0.5.9-r16 with the following options : bwa aln - q 20 	U00096 .2	Gversion	0.9897280293228626	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz				0	0	False
SRR534267SRR534268	GSE39926	GSM981539	GPL10328	23385483	G500_1	Evolutionary potential, cross-stress behavior and the genetic basis of acquired stress resistance in Escherichia coli	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	data_processing	Genome_build: Escherichia coli strain K12 sub-strain MG1655 genome (GenBank accession no. U00096.2) PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 ) </Gversion> 	U00096 .2 )	Gversion	0.995078522027934	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz				0	0	False
SRR534269SRR534270	GSE39926	GSM981540	GPL10328	23385483	B500_1	Evolutionary potential, cross-stress behavior and the genetic basis of acquired stress resistance in Escherichia coli	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	data_processing	preprocessed RNA-Seq reads were mapped to the reference Escherichia coli strain K12 sub-strain MG1655 genome (GenBank accession no. U00096.2) by BWA toolkit version 0.5.9-r16 with the following options: bwa aln -q 20 PGCGROWTHCONDITIONS	preprocessed RNA-Seq reads were mapped to the reference Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 </Gversion> ) by BWA toolkit version 0.5.9-r16 with the following options : bwa aln - q 20 	U00096 .2	Gversion	0.9897280293228626	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz				0	0	False
SRR534269SRR534270	GSE39926	GSM981540	GPL10328	23385483	B500_1	Evolutionary potential, cross-stress behavior and the genetic basis of acquired stress resistance in Escherichia coli	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	data_processing	Genome_build: Escherichia coli strain K12 sub-strain MG1655 genome (GenBank accession no. U00096.2) PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 ) </Gversion> 	U00096 .2 )	Gversion	0.995078522027934	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz				0	0	False
SRR534271SRR534272	GSE39926	GSM981541	GPL10328	23385483	H500_1	Evolutionary potential, cross-stress behavior and the genetic basis of acquired stress resistance in Escherichia coli	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	data_processing	preprocessed RNA-Seq reads were mapped to the reference Escherichia coli strain K12 sub-strain MG1655 genome (GenBank accession no. U00096.2) by BWA toolkit version 0.5.9-r16 with the following options: bwa aln -q 20 PGCGROWTHCONDITIONS	preprocessed RNA-Seq reads were mapped to the reference Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 </Gversion> ) by BWA toolkit version 0.5.9-r16 with the following options : bwa aln - q 20 	U00096 .2	Gversion	0.9897280293228626	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz				0	0	False
SRR534271SRR534272	GSE39926	GSM981541	GPL10328	23385483	H500_1	Evolutionary potential, cross-stress behavior and the genetic basis of acquired stress resistance in Escherichia coli	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	data_processing	Genome_build: Escherichia coli strain K12 sub-strain MG1655 genome (GenBank accession no. U00096.2) PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 ) </Gversion> 	U00096 .2 )	Gversion	0.995078522027934	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz				0	0	False
SRR534273SRR534274	GSE39926	GSM981542	GPL10328	23385483	O500_1	Evolutionary potential, cross-stress behavior and the genetic basis of acquired stress resistance in Escherichia coli	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	data_processing	preprocessed RNA-Seq reads were mapped to the reference Escherichia coli strain K12 sub-strain MG1655 genome (GenBank accession no. U00096.2) by BWA toolkit version 0.5.9-r16 with the following options: bwa aln -q 20 PGCGROWTHCONDITIONS	preprocessed RNA-Seq reads were mapped to the reference Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 </Gversion> ) by BWA toolkit version 0.5.9-r16 with the following options : bwa aln - q 20 	U00096 .2	Gversion	0.9897280293228626	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz				0	0	False
SRR534273SRR534274	GSE39926	GSM981542	GPL10328	23385483	O500_1	Evolutionary potential, cross-stress behavior and the genetic basis of acquired stress resistance in Escherichia coli	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	data_processing	Genome_build: Escherichia coli strain K12 sub-strain MG1655 genome (GenBank accession no. U00096.2) PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 ) </Gversion> 	U00096 .2 )	Gversion	0.995078522027934	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz				0	0	False
SRR534275SRR534276	GSE39926	GSM981543	GPL10328	23385483	O500_2	Evolutionary potential, cross-stress behavior and the genetic basis of acquired stress resistance in Escherichia coli	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	data_processing	preprocessed RNA-Seq reads were mapped to the reference Escherichia coli strain K12 sub-strain MG1655 genome (GenBank accession no. U00096.2) by BWA toolkit version 0.5.9-r16 with the following options: bwa aln -q 20 PGCGROWTHCONDITIONS	preprocessed RNA-Seq reads were mapped to the reference Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 </Gversion> ) by BWA toolkit version 0.5.9-r16 with the following options : bwa aln - q 20 	U00096 .2	Gversion	0.9897280293228626	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz				0	0	False
SRR534275SRR534276	GSE39926	GSM981543	GPL10328	23385483	O500_2	Evolutionary potential, cross-stress behavior and the genetic basis of acquired stress resistance in Escherichia coli	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	data_processing	Genome_build: Escherichia coli strain K12 sub-strain MG1655 genome (GenBank accession no. U00096.2) PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 ) </Gversion> 	U00096 .2 )	Gversion	0.995078522027934	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz				0	0	False
SRR534278	GSE39926	GSM981544	GPL10328	23385483	P500_1	Evolutionary potential, cross-stress behavior and the genetic basis of acquired stress resistance in Escherichia coli	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	data_processing	preprocessed RNA-Seq reads were mapped to the reference Escherichia coli strain K12 sub-strain MG1655 genome (GenBank accession no. U00096.2) by BWA toolkit version 0.5.9-r16 with the following options: bwa aln -q 20 PGCGROWTHCONDITIONS	preprocessed RNA-Seq reads were mapped to the reference Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 </Gversion> ) by BWA toolkit version 0.5.9-r16 with the following options : bwa aln - q 20 	U00096 .2	Gversion	0.9897280293228626	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz				0	0	False
SRR534278	GSE39926	GSM981544	GPL10328	23385483	P500_1	Evolutionary potential, cross-stress behavior and the genetic basis of acquired stress resistance in Escherichia coli	GPL10328: Illumina Genome Analyzer II (Escherichia coli)	data_processing	Genome_build: Escherichia coli strain K12 sub-strain MG1655 genome (GenBank accession no. U00096.2) PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli strain K12 sub-strain MG1655 genome ( GenBank accession no . <Gversion> U00096 .2 ) </Gversion> 	U00096 .2 )	Gversion	0.995078522027934	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE39926/GSE39926.soft.gz				0	0	False
SRR958658	GSE43408	GSM1217967	GPL14548	23856776	pHerd30T CK+aerobic	Quantitative Different Analysis of antimicrobial peptide LL37 expressed in E.coli Top 10 under aerobic and anaerobic condition.	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	treatment_protocol	Total RNA was isolated with TRIzol (invitrogen, Carlsbad, CA) according to the manufacture[linebreak]s instruction. DNA was removed from RNA extracts with RNase-free DNase I (New England Biolabs, Beverly, MA, USA) by incubation at 37°C for 30 min. The quality of total RNA was assessed by using 2100 Bioanalyzer (Agilent, Santa Clara, USA) and also checked by agarose gel electrophoresis. rRNAs was subsquently removed from the total mRNA following the instruction of the Ribo-Zero rRNATM Removal kit (Epicentre, Madison, WI, USA). PGCGROWTHCONDITIONS	Total RNA was isolated with TRIzol ( invitrogen , Carlsbad , CA ) according to the manufacture [ linebreak ] s instruction . DNA was removed from RNA extracts with RNase-free DNase I ( New England Biolabs , Beverly , MA , USA ) by incubation at <Temp> 37 °C </Temp> for <Supp> 30 min </Supp> . The quality of total RNA was assessed by using 2100 Bioanalyzer ( Agilent , Santa Clara , USA ) and also checked by agarose gel electrophoresis . rRNAs was subsquently removed from the total mRNA following the instruction of the Ribo-Zero rRNATM Removal kit ( Epicentre , Madison , WI , USA ) . 	30 min	Medium supplement	0.9889988712889268	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE43408/GSE43408.soft.gz				0	0	False
SRR958659	GSE43408	GSM1217968	GPL14548	23856776	pHerd30T-LL37 induced+aerobic	Quantitative Different Analysis of antimicrobial peptide LL37 expressed in E.coli Top 10 under aerobic and anaerobic condition.	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	treatment_protocol	Total RNA was isolated with TRIzol (invitrogen, Carlsbad, CA) according to the manufacture[linebreak]s instruction. DNA was removed from RNA extracts with RNase-free DNase I (New England Biolabs, Beverly, MA, USA) by incubation at 37°C for 30 min. The quality of total RNA was assessed by using 2100 Bioanalyzer (Agilent, Santa Clara, USA) and also checked by agarose gel electrophoresis. rRNAs was subsquently removed from the total mRNA following the instruction of the Ribo-Zero rRNATM Removal kit (Epicentre, Madison, WI, USA). PGCGROWTHCONDITIONS	Total RNA was isolated with TRIzol ( invitrogen , Carlsbad , CA ) according to the manufacture [ linebreak ] s instruction . DNA was removed from RNA extracts with RNase-free DNase I ( New England Biolabs , Beverly , MA , USA ) by incubation at <Temp> 37 °C </Temp> for <Supp> 30 min </Supp> . The quality of total RNA was assessed by using 2100 Bioanalyzer ( Agilent , Santa Clara , USA ) and also checked by agarose gel electrophoresis . rRNAs was subsquently removed from the total mRNA following the instruction of the Ribo-Zero rRNATM Removal kit ( Epicentre , Madison , WI , USA ) . 	30 min	Medium supplement	0.9889988712889268	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE43408/GSE43408.soft.gz				0	0	False
SRR958660	GSE43408	GSM1217969	GPL14548	23856776	pHerd30T-LL37 CK+ anaerobic	Quantitative Different Analysis of antimicrobial peptide LL37 expressed in E.coli Top 10 under aerobic and anaerobic condition.	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	treatment_protocol	Total RNA was isolated with TRIzol (invitrogen, Carlsbad, CA) according to the manufacture[linebreak]s instruction. DNA was removed from RNA extracts with RNase-free DNase I (New England Biolabs, Beverly, MA, USA) by incubation at 37°C for 30 min. The quality of total RNA was assessed by using 2100 Bioanalyzer (Agilent, Santa Clara, USA) and also checked by agarose gel electrophoresis. rRNAs was subsquently removed from the total mRNA following the instruction of the Ribo-Zero rRNATM Removal kit (Epicentre, Madison, WI, USA). PGCGROWTHCONDITIONS	Total RNA was isolated with TRIzol ( invitrogen , Carlsbad , CA ) according to the manufacture [ linebreak ] s instruction . DNA was removed from RNA extracts with RNase-free DNase I ( New England Biolabs , Beverly , MA , USA ) by incubation at <Temp> 37 °C </Temp> for <Supp> 30 min </Supp> . The quality of total RNA was assessed by using 2100 Bioanalyzer ( Agilent , Santa Clara , USA ) and also checked by agarose gel electrophoresis . rRNAs was subsquently removed from the total mRNA following the instruction of the Ribo-Zero rRNATM Removal kit ( Epicentre , Madison , WI , USA ) . 	30 min	Medium supplement	0.9889988712889268	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE43408/GSE43408.soft.gz				0	0	False
SRR958661	GSE43408	GSM1217970	GPL14548	23856776	pHerd30T-LL37 induced +anaerobic	Quantitative Different Analysis of antimicrobial peptide LL37 expressed in E.coli Top 10 under aerobic and anaerobic condition.	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	treatment_protocol	Total RNA was isolated with TRIzol (invitrogen, Carlsbad, CA) according to the manufacture[linebreak]s instruction. DNA was removed from RNA extracts with RNase-free DNase I (New England Biolabs, Beverly, MA, USA) by incubation at 37°C for 30 min. The quality of total RNA was assessed by using 2100 Bioanalyzer (Agilent, Santa Clara, USA) and also checked by agarose gel electrophoresis. rRNAs was subsquently removed from the total mRNA following the instruction of the Ribo-Zero rRNATM Removal kit (Epicentre, Madison, WI, USA). PGCGROWTHCONDITIONS	Total RNA was isolated with TRIzol ( invitrogen , Carlsbad , CA ) according to the manufacture [ linebreak ] s instruction . DNA was removed from RNA extracts with RNase-free DNase I ( New England Biolabs , Beverly , MA , USA ) by incubation at <Temp> 37 °C </Temp> for <Supp> 30 min </Supp> . The quality of total RNA was assessed by using 2100 Bioanalyzer ( Agilent , Santa Clara , USA ) and also checked by agarose gel electrophoresis . rRNAs was subsquently removed from the total mRNA following the instruction of the Ribo-Zero rRNATM Removal kit ( Epicentre , Madison , WI , USA ) . 	30 min	Medium supplement	0.9889988712889268	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE43408/GSE43408.soft.gz				0	0	False
SRR771533	GSE44928	GSM1094082	GPL16760		BL21_2	Physiology study of Escherichia coli harboring high intracellular ATP driven by artificial Pck expression	GPL16760: Illumina Genome Analyzer II (Escherichia coli BL21(DE3))	characteristics	strain: BL21(DE3) PGCGROWTHCONDITIONS	strain : <Med> BL21 ( DE3 ) </Med> 	BL21 ( DE3 )	Medium	0.9017568219824774	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE44928/GSE44928.soft.gz				0	0	False
SRR771534	GSE44928	GSM1094083	GPL16760		PCK over	Physiology study of Escherichia coli harboring high intracellular ATP driven by artificial Pck expression	GPL16760: Illumina Genome Analyzer II (Escherichia coli BL21(DE3))	characteristics	strain: BL21(DE3) PGCGROWTHCONDITIONS	strain : <Med> BL21 ( DE3 ) </Med> 	BL21 ( DE3 )	Medium	0.9017568219824774	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE44928/GSE44928.soft.gz				0	0	False
SRR771534	GSE44928	GSM1094083	GPL16760		PCK over	Physiology study of Escherichia coli harboring high intracellular ATP driven by artificial Pck expression	GPL16760: Illumina Genome Analyzer II (Escherichia coli BL21(DE3))	characteristics	condition: LB+3g/L Glc +0.1mM IPTG + 50μg/ml Amp PGCGROWTHCONDITIONS	condition : <Gtype> LB </Gtype> +3 g/L Glc +0.1 <Supp> mM IPTG + 50μg/ml Amp </Supp> 	mM IPTG + 50μg/ml Amp	Medium supplement	0.9893711041664028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE44928/GSE44928.soft.gz				0	0	False
SRR794827	GSE45443	GSM1104381	GPL15010	23716638	pHDB3_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794827	GSE45443	GSM1104381	GPL15010	23716638	pHDB3_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794827	GSE45443	GSM1104381	GPL15010	23716638	pHDB3_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794827	GSE45443	GSM1104381	GPL15010	23716638	pHDB3_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794832	GSE45443	GSM1104386	GPL15010	23716638	pLCV1_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794832	GSE45443	GSM1104386	GPL15010	23716638	pLCV1_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794832	GSE45443	GSM1104386	GPL15010	23716638	pLCV1_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794832	GSE45443	GSM1104386	GPL15010	23716638	pLCV1_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794833	GSE45443	GSM1104387	GPL15010	23716638	MG1655-aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794833	GSE45443	GSM1104387	GPL15010	23716638	MG1655-aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794833	GSE45443	GSM1104387	GPL15010	23716638	MG1655-aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794833	GSE45443	GSM1104387	GPL15010	23716638	MG1655-aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794834	GSE45443	GSM1104388	GPL15010	23716638	MG1655-aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794834	GSE45443	GSM1104388	GPL15010	23716638	MG1655-aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794834	GSE45443	GSM1104388	GPL15010	23716638	MG1655-aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794834	GSE45443	GSM1104388	GPL15010	23716638	MG1655-aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794835	GSE45443	GSM1104389	GPL15010	23716638	MG1655-aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794835	GSE45443	GSM1104389	GPL15010	23716638	MG1655-aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794835	GSE45443	GSM1104389	GPL15010	23716638	MG1655-aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794835	GSE45443	GSM1104389	GPL15010	23716638	MG1655-aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794836	GSE45443	GSM1104390	GPL15010	23716638	MG1655+aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794836	GSE45443	GSM1104390	GPL15010	23716638	MG1655+aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794836	GSE45443	GSM1104390	GPL15010	23716638	MG1655+aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794836	GSE45443	GSM1104390	GPL15010	23716638	MG1655+aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794837	GSE45443	GSM1104391	GPL15010	23716638	MG1655+aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794837	GSE45443	GSM1104391	GPL15010	23716638	MG1655+aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794837	GSE45443	GSM1104391	GPL15010	23716638	MG1655+aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794837	GSE45443	GSM1104391	GPL15010	23716638	MG1655+aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794838	GSE45443	GSM1104392	GPL15010	23716638	MG1655+aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794838	GSE45443	GSM1104392	GPL15010	23716638	MG1655+aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794838	GSE45443	GSM1104392	GPL15010	23716638	MG1655+aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794838	GSE45443	GSM1104392	GPL15010	23716638	MG1655+aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794839	GSE45443	GSM1104393	GPL15010	23716638	SgrR_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794839	GSE45443	GSM1104393	GPL15010	23716638	SgrR_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794839	GSE45443	GSM1104393	GPL15010	23716638	SgrR_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794839	GSE45443	GSM1104393	GPL15010	23716638	SgrR_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794840	GSE45443	GSM1104394	GPL15010	23716638	SgrR_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794840	GSE45443	GSM1104394	GPL15010	23716638	SgrR_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794840	GSE45443	GSM1104394	GPL15010	23716638	SgrR_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794840	GSE45443	GSM1104394	GPL15010	23716638	SgrR_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794841	GSE45443	GSM1104395	GPL15010	23716638	SgrR_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794841	GSE45443	GSM1104395	GPL15010	23716638	SgrR_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794841	GSE45443	GSM1104395	GPL15010	23716638	SgrR_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794841	GSE45443	GSM1104395	GPL15010	23716638	SgrR_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794842	GSE45443	GSM1104396	GPL15010	23716638	sgrS_T_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794842	GSE45443	GSM1104396	GPL15010	23716638	sgrS_T_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794842	GSE45443	GSM1104396	GPL15010	23716638	sgrS_T_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794842	GSE45443	GSM1104396	GPL15010	23716638	sgrS_T_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794843	GSE45443	GSM1104397	GPL15010	23716638	sgrS_T_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794843	GSE45443	GSM1104397	GPL15010	23716638	sgrS_T_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794843	GSE45443	GSM1104397	GPL15010	23716638	sgrS_T_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794843	GSE45443	GSM1104397	GPL15010	23716638	sgrS_T_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794844	GSE45443	GSM1104398	GPL15010	23716638	sgrS_T_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794844	GSE45443	GSM1104398	GPL15010	23716638	sgrS_T_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794844	GSE45443	GSM1104398	GPL15010	23716638	sgrS_T_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794844	GSE45443	GSM1104398	GPL15010	23716638	sgrS_T_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794845	GSE45443	GSM1104399	GPL15010	23716638	sgrS_un_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794845	GSE45443	GSM1104399	GPL15010	23716638	sgrS_un_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794845	GSE45443	GSM1104399	GPL15010	23716638	sgrS_un_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794845	GSE45443	GSM1104399	GPL15010	23716638	sgrS_un_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794846	GSE45443	GSM1104400	GPL15010	23716638	sgrS_un_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794846	GSE45443	GSM1104400	GPL15010	23716638	sgrS_un_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794846	GSE45443	GSM1104400	GPL15010	23716638	sgrS_un_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794846	GSE45443	GSM1104400	GPL15010	23716638	sgrS_un_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794847	GSE45443	GSM1104401	GPL15010	23716638	sgrS_un_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794847	GSE45443	GSM1104401	GPL15010	23716638	sgrS_un_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794847	GSE45443	GSM1104401	GPL15010	23716638	sgrS_un_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794847	GSE45443	GSM1104401	GPL15010	23716638	sgrS_un_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794848	GSE45443	GSM1104402	GPL15010	23716638	WT_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794848	GSE45443	GSM1104402	GPL15010	23716638	WT_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794848	GSE45443	GSM1104402	GPL15010	23716638	WT_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794848	GSE45443	GSM1104402	GPL15010	23716638	WT_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794849	GSE45443	GSM1104403	GPL15010	23716638	WT_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794849	GSE45443	GSM1104403	GPL15010	23716638	WT_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794849	GSE45443	GSM1104403	GPL15010	23716638	WT_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794849	GSE45443	GSM1104403	GPL15010	23716638	WT_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794850	GSE45443	GSM1104404	GPL15010	23716638	WT_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794850	GSE45443	GSM1104404	GPL15010	23716638	WT_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794850	GSE45443	GSM1104404	GPL15010	23716638	WT_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794850	GSE45443	GSM1104404	GPL15010	23716638	WT_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794851	GSE45443	GSM1104405	GPL15010	23716638	wt_T_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794851	GSE45443	GSM1104405	GPL15010	23716638	wt_T_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794851	GSE45443	GSM1104405	GPL15010	23716638	wt_T_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794851	GSE45443	GSM1104405	GPL15010	23716638	wt_T_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794852	GSE45443	GSM1104406	GPL15010	23716638	wt_T_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794852	GSE45443	GSM1104406	GPL15010	23716638	wt_T_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794852	GSE45443	GSM1104406	GPL15010	23716638	wt_T_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794852	GSE45443	GSM1104406	GPL15010	23716638	wt_T_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794853	GSE45443	GSM1104407	GPL15010	23716638	wt_T_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794853	GSE45443	GSM1104407	GPL15010	23716638	wt_T_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794853	GSE45443	GSM1104407	GPL15010	23716638	wt_T_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794853	GSE45443	GSM1104407	GPL15010	23716638	wt_T_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794854	GSE45443	GSM1104408	GPL15010	23716638	wt_un_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794854	GSE45443	GSM1104408	GPL15010	23716638	wt_un_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794854	GSE45443	GSM1104408	GPL15010	23716638	wt_un_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794854	GSE45443	GSM1104408	GPL15010	23716638	wt_un_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794856	GSE45443	GSM1104410	GPL15010	23716638	wt_un_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794856	GSE45443	GSM1104410	GPL15010	23716638	wt_un_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794856	GSE45443	GSM1104410	GPL15010	23716638	wt_un_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794856	GSE45443	GSM1104410	GPL15010	23716638	wt_un_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794857	GSE45443	GSM1104411	GPL15010	23716638	CV108_minus_aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794857	GSE45443	GSM1104411	GPL15010	23716638	CV108_minus_aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794857	GSE45443	GSM1104411	GPL15010	23716638	CV108_minus_aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794857	GSE45443	GSM1104411	GPL15010	23716638	CV108_minus_aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794858	GSE45443	GSM1104412	GPL15010	23716638	CV108_minus_aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794858	GSE45443	GSM1104412	GPL15010	23716638	CV108_minus_aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794858	GSE45443	GSM1104412	GPL15010	23716638	CV108_minus_aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794858	GSE45443	GSM1104412	GPL15010	23716638	CV108_minus_aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794859	GSE45443	GSM1104413	GPL15010	23716638	CV108_minus_aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794859	GSE45443	GSM1104413	GPL15010	23716638	CV108_minus_aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794859	GSE45443	GSM1104413	GPL15010	23716638	CV108_minus_aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794859	GSE45443	GSM1104413	GPL15010	23716638	CV108_minus_aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794860	GSE45443	GSM1104414	GPL15010	23716638	CV108_plus_aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794860	GSE45443	GSM1104414	GPL15010	23716638	CV108_plus_aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794860	GSE45443	GSM1104414	GPL15010	23716638	CV108_plus_aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794860	GSE45443	GSM1104414	GPL15010	23716638	CV108_plus_aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794861	GSE45443	GSM1104415	GPL15010	23716638	CV108_plus_aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794861	GSE45443	GSM1104415	GPL15010	23716638	CV108_plus_aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794861	GSE45443	GSM1104415	GPL15010	23716638	CV108_plus_aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794861	GSE45443	GSM1104415	GPL15010	23716638	CV108_plus_aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794862	GSE45443	GSM1104416	GPL15010	23716638	CV108_plus_aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794862	GSE45443	GSM1104416	GPL15010	23716638	CV108_plus_aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794862	GSE45443	GSM1104416	GPL15010	23716638	CV108_plus_aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794862	GSE45443	GSM1104416	GPL15010	23716638	CV108_plus_aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794863	GSE45443	GSM1104417	GPL15010	23716638	MG1655_minus_aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794863	GSE45443	GSM1104417	GPL15010	23716638	MG1655_minus_aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794863	GSE45443	GSM1104417	GPL15010	23716638	MG1655_minus_aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794863	GSE45443	GSM1104417	GPL15010	23716638	MG1655_minus_aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794864	GSE45443	GSM1104418	GPL15010	23716638	MG1655_minus_aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794864	GSE45443	GSM1104418	GPL15010	23716638	MG1655_minus_aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794864	GSE45443	GSM1104418	GPL15010	23716638	MG1655_minus_aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794864	GSE45443	GSM1104418	GPL15010	23716638	MG1655_minus_aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794865	GSE45443	GSM1104419	GPL15010	23716638	MG1655_minus_aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794865	GSE45443	GSM1104419	GPL15010	23716638	MG1655_minus_aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794865	GSE45443	GSM1104419	GPL15010	23716638	MG1655_minus_aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794865	GSE45443	GSM1104419	GPL15010	23716638	MG1655_minus_aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794866	GSE45443	GSM1104420	GPL15010	23716638	MG1655_plus_aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794866	GSE45443	GSM1104420	GPL15010	23716638	MG1655_plus_aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794866	GSE45443	GSM1104420	GPL15010	23716638	MG1655_plus_aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794866	GSE45443	GSM1104420	GPL15010	23716638	MG1655_plus_aMG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794867	GSE45443	GSM1104421	GPL15010	23716638	MG1655_plus_aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794867	GSE45443	GSM1104421	GPL15010	23716638	MG1655_plus_aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794867	GSE45443	GSM1104421	GPL15010	23716638	MG1655_plus_aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794867	GSE45443	GSM1104421	GPL15010	23716638	MG1655_plus_aMG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794868	GSE45443	GSM1104422	GPL15010	23716638	MG1655_plus_aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794868	GSE45443	GSM1104422	GPL15010	23716638	MG1655_plus_aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794868	GSE45443	GSM1104422	GPL15010	23716638	MG1655_plus_aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794868	GSE45443	GSM1104422	GPL15010	23716638	MG1655_plus_aMG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794869	GSE45443	GSM1104423	GPL15010	23716638	WT_minus_2DG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794869	GSE45443	GSM1104423	GPL15010	23716638	WT_minus_2DG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794869	GSE45443	GSM1104423	GPL15010	23716638	WT_minus_2DG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794869	GSE45443	GSM1104423	GPL15010	23716638	WT_minus_2DG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794870	GSE45443	GSM1104424	GPL15010	23716638	WT_minus_2DG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794870	GSE45443	GSM1104424	GPL15010	23716638	WT_minus_2DG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794870	GSE45443	GSM1104424	GPL15010	23716638	WT_minus_2DG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794870	GSE45443	GSM1104424	GPL15010	23716638	WT_minus_2DG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794871	GSE45443	GSM1104425	GPL15010	23716638	WT_minus_2DG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794871	GSE45443	GSM1104425	GPL15010	23716638	WT_minus_2DG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794871	GSE45443	GSM1104425	GPL15010	23716638	WT_minus_2DG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794871	GSE45443	GSM1104425	GPL15010	23716638	WT_minus_2DG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794872	GSE45443	GSM1104426	GPL15010	23716638	WT_plus_2DG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794872	GSE45443	GSM1104426	GPL15010	23716638	WT_plus_2DG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794872	GSE45443	GSM1104426	GPL15010	23716638	WT_plus_2DG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794872	GSE45443	GSM1104426	GPL15010	23716638	WT_plus_2DG_1	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794873	GSE45443	GSM1104427	GPL15010	23716638	WT_plus_2DG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794873	GSE45443	GSM1104427	GPL15010	23716638	WT_plus_2DG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794873	GSE45443	GSM1104427	GPL15010	23716638	WT_plus_2DG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794873	GSE45443	GSM1104427	GPL15010	23716638	WT_plus_2DG_2	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794874	GSE45443	GSM1104428	GPL15010	23716638	WT_plus_2DG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> substr . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9999903490711765	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794874	GSE45443	GSM1104428	GPL15010	23716638	WT_plus_2DG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794874	GSE45443	GSM1104428	GPL15010	23716638	WT_plus_2DG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR794874	GSE45443	GSM1104428	GPL15010	23716638	WT_plus_2DG_3	RNA-seq analysis of Escherichia coli str. K-12 substr. MG1655	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE45443/GSE45443.soft.gz				0	0	False
SRR836184	GSE46507	GSM1131348	GPL15206-GPL17096		E. coli - TAP	Comparison of the nucleotide-resolution, genome-wide, 5'-end maps of the transcriptomes of Escherichia coli K12 strain BW25113 and Streptomyces coelicolor A3(2) strain M145	GPL15206: Illumina HiSeq 2000 (Escherichia coli BW25113). GPL17096: Illumina HiSeq 2000 (Streptomyces coelicolor A3(2))	data_processing	Genome_build: The reference genomes used for E. coli K12 strain BW25113 and S. coelicolor A3(2) strain M145 were U00096.2 and AL645882, respectively. PGCGROWTHCONDITIONS	Genome _ build : <Gtype> The </Gtype> reference genomes used for E. coli K12 strain BW25113 and S. coelicolor A3 ( 2 ) strain M145 were <Gversion> U00096 .2 </Gversion> and AL645882 , respectively . 	U00096 .2	Gversion	0.9435367289140814	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46507/GSE46507.soft.gz				0	0	False
SRR836185	GSE46507	GSM1131349	GPL15206-GPL17096		E. coli + TAP	Comparison of the nucleotide-resolution, genome-wide, 5'-end maps of the transcriptomes of Escherichia coli K12 strain BW25113 and Streptomyces coelicolor A3(2) strain M145	GPL15206: Illumina HiSeq 2000 (Escherichia coli BW25113). GPL17096: Illumina HiSeq 2000 (Streptomyces coelicolor A3(2))	data_processing	Genome_build: The reference genomes used for E. coli K12 strain BW25113 and S. coelicolor A3(2) strain M145 were U00096.2 and AL645882, respectively. PGCGROWTHCONDITIONS	Genome _ build : <Gtype> The </Gtype> reference genomes used for E. coli K12 strain BW25113 and S. coelicolor A3 ( 2 ) strain M145 were <Gversion> U00096 .2 </Gversion> and AL645882 , respectively . 	U00096 .2	Gversion	0.9435367289140814	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46507/GSE46507.soft.gz				0	0	False
SRR847728	GSE46737	GSM1137316	GPL17137	24461193	E. coli stationary 1	Genome-scale reconstruction of the sigma factor network in E. coli	GPL17137: Illumina Genome Analyzer (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46737/GSE46737.soft.gz				0	0	False
SRR847728	GSE46737	GSM1137316	GPL17137	24461193	E. coli stationary 1	Genome-scale reconstruction of the sigma factor network in E. coli	GPL17137: Illumina Genome Analyzer (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46737/GSE46737.soft.gz				0	0	False
SRR847730	GSE46737	GSM1137318	GPL17137	24461193	E. coli glutamine 1	Genome-scale reconstruction of the sigma factor network in E. coli	GPL17137: Illumina Genome Analyzer (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46737/GSE46737.soft.gz				0	0	False
SRR847730	GSE46737	GSM1137318	GPL17137	24461193	E. coli glutamine 1	Genome-scale reconstruction of the sigma factor network in E. coli	GPL17137: Illumina Genome Analyzer (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46737/GSE46737.soft.gz				0	0	False
SRR847731	GSE46737	GSM1137319	GPL17137	24461193	E. coli glutamine 2	Genome-scale reconstruction of the sigma factor network in E. coli	GPL17137: Illumina Genome Analyzer (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46737/GSE46737.soft.gz				0	0	False
SRR847731	GSE46737	GSM1137319	GPL17137	24461193	E. coli glutamine 2	Genome-scale reconstruction of the sigma factor network in E. coli	GPL17137: Illumina Genome Analyzer (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46737/GSE46737.soft.gz				0	0	False
SRR847732	GSE46737	GSM1137320	GPL17137	24461193	E. coli heatshock 1	Genome-scale reconstruction of the sigma factor network in E. coli	GPL17137: Illumina Genome Analyzer (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46737/GSE46737.soft.gz				0	0	False
SRR847732	GSE46737	GSM1137320	GPL17137	24461193	E. coli heatshock 1	Genome-scale reconstruction of the sigma factor network in E. coli	GPL17137: Illumina Genome Analyzer (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46737/GSE46737.soft.gz				0	0	False
SRR847733	GSE46737	GSM1137321	GPL17137	24461193	E. coli heatshock 2	Genome-scale reconstruction of the sigma factor network in E. coli	GPL17137: Illumina Genome Analyzer (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46737/GSE46737.soft.gz				0	0	False
SRR847733	GSE46737	GSM1137321	GPL17137	24461193	E. coli heatshock 2	Genome-scale reconstruction of the sigma factor network in E. coli	GPL17137: Illumina Genome Analyzer (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE46737/GSE46737.soft.gz				0	0	False
SRR915687	GSE48151	GSM1170026	GPL10328-GPL14548	23899370	HS15min_r1_HiSeq	Directional RNA-seq reveals highly complex condition-dependent transcriptomes in E. coliK12 through accurate full-length transcripts assembling	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	culture/growth condition: Heatshock 15min PGCGROWTHCONDITIONS	culture/growth condition : <Supp> Heatshock 15 min </Supp> 	Heatshock 15 min	Medium supplement	0.9231204502906428	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48151/GSE48151.soft.gz				0	0	False
SRR915688	GSE48151	GSM1170027	GPL10328-GPL14548	23899370	HS15min_r2_HiSeq	Directional RNA-seq reveals highly complex condition-dependent transcriptomes in E. coliK12 through accurate full-length transcripts assembling	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	culture/growth condition: Heatshock 15min PGCGROWTHCONDITIONS	culture/growth condition : <Supp> Heatshock 15 min </Supp> 	Heatshock 15 min	Medium supplement	0.9231204502906428	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48151/GSE48151.soft.gz				0	0	False
SRR915690	GSE48151	GSM1170029	GPL10328-GPL14548	23899370	HS30min_r1_HiSeq	Directional RNA-seq reveals highly complex condition-dependent transcriptomes in E. coliK12 through accurate full-length transcripts assembling	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	culture/growth condition: Heatshock 30min PGCGROWTHCONDITIONS	culture/growth condition : <Supp> Heatshock 30 min </Supp> 	Heatshock 30 min	Medium supplement	0.9012941760528212	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48151/GSE48151.soft.gz				0	0	False
SRR915691	GSE48151	GSM1170030	GPL10328-GPL14548	23899370	HS30min_r2_HiSeq	Directional RNA-seq reveals highly complex condition-dependent transcriptomes in E. coliK12 through accurate full-length transcripts assembling	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	culture/growth condition: Heatshock 30min PGCGROWTHCONDITIONS	culture/growth condition : <Supp> Heatshock 30 min </Supp> 	Heatshock 30 min	Medium supplement	0.9012941760528212	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48151/GSE48151.soft.gz				0	0	False
SRR915694	GSE48151	GSM1170033	GPL10328-GPL14548	23899370	M-P0h_r1_HiSeq	Directional RNA-seq reveals highly complex condition-dependent transcriptomes in E. coliK12 through accurate full-length transcripts assembling	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli)	source_name	E. coli cells_M-P0h PGCGROWTHCONDITIONS	E. coli cells _ <Gtype> M-P0h </Gtype> 	M-P0h	Genetic background	0.9654643420114698	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48151/GSE48151.soft.gz				0	0	False
SRR915695	GSE48151	GSM1170034	GPL10328-GPL14548	23899370	M-P0h_r2_HiSeq	Directional RNA-seq reveals highly complex condition-dependent transcriptomes in E. coliK12 through accurate full-length transcripts assembling	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli)	source_name	E. coli cells_M-P0h PGCGROWTHCONDITIONS	E. coli cells _ <Gtype> M-P0h </Gtype> 	M-P0h	Genetic background	0.9654643420114698	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48151/GSE48151.soft.gz				0	0	False
SRR915696	GSE48151	GSM1170035	GPL10328-GPL14548	23899370	M-P2h_r1_HiSeq	Directional RNA-seq reveals highly complex condition-dependent transcriptomes in E. coliK12 through accurate full-length transcripts assembling	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli)	source_name	E. coli cells_M-P2h PGCGROWTHCONDITIONS	E. coli cells _ <Gtype> M-P2h </Gtype> 	M-P2h	Genetic background	0.9654643420114698	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48151/GSE48151.soft.gz				0	0	False
SRR915697	GSE48151	GSM1170036	GPL10328-GPL14548	23899370	M-P2h_r2_HiSeq	Directional RNA-seq reveals highly complex condition-dependent transcriptomes in E. coliK12 through accurate full-length transcripts assembling	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli)	source_name	E. coli cells_M-P2h PGCGROWTHCONDITIONS	E. coli cells _ <Gtype> M-P2h </Gtype> 	M-P2h	Genetic background	0.9654643420114698	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48151/GSE48151.soft.gz				0	0	False
SRR915698	GSE48151	GSM1170037	GPL10328-GPL14548	23899370	M-P4h_r1_HiSeq	Directional RNA-seq reveals highly complex condition-dependent transcriptomes in E. coliK12 through accurate full-length transcripts assembling	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli)	source_name	E. coli cells_M-P4h PGCGROWTHCONDITIONS	E. coli cells _ <Gtype> M-P4h </Gtype> 	M-P4h	Genetic background	0.9654643420114698	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48151/GSE48151.soft.gz				0	0	False
SRR915699	GSE48151	GSM1170038	GPL10328-GPL14548	23899370	M-P4h_r2_HiSeq	Directional RNA-seq reveals highly complex condition-dependent transcriptomes in E. coliK12 through accurate full-length transcripts assembling	GPL10328: Illumina Genome Analyzer II (Escherichia coli). GPL14548: Illumina HiSeq 2000 (Escherichia coli)	source_name	E. coli cells_M-P4h PGCGROWTHCONDITIONS	E. coli cells _ <Gtype> M-P4h </Gtype> 	M-P4h	Genetic background	0.9654643420114698	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48151/GSE48151.soft.gz				0	0	False
SRR922260	GSE48324	GSM1174823	GPL16227	24987116	Mid log_wildtype_glc minimal media_aerobic rep1	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	FPKM were calculated using Cufflinks v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554792	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922260	GSE48324	GSM1174823	GPL16227	24987116	Mid log_wildtype_glc minimal media_aerobic rep1	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	Differential expression analysis was carried out using cuffdiff v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554794	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922260	GSE48324	GSM1174823	GPL16227	24987116	Mid log_wildtype_glc minimal media_aerobic rep1	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922261	GSE48324	GSM1174824	GPL16227	24987116	Mid log_wildtype_glc minimal media_aerobic rep2	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	FPKM were calculated using Cufflinks v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554792	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922261	GSE48324	GSM1174824	GPL16227	24987116	Mid log_wildtype_glc minimal media_aerobic rep2	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	Differential expression analysis was carried out using cuffdiff v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554794	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922261	GSE48324	GSM1174824	GPL16227	24987116	Mid log_wildtype_glc minimal media_aerobic rep2	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922262	GSE48324	GSM1174825	GPL16227	24987116	Mid log_wildtype_glc minimal media_aerobic rep3	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	FPKM were calculated using Cufflinks v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554792	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922262	GSE48324	GSM1174825	GPL16227	24987116	Mid log_wildtype_glc minimal media_aerobic rep3	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	Differential expression analysis was carried out using cuffdiff v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554794	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922262	GSE48324	GSM1174825	GPL16227	24987116	Mid log_wildtype_glc minimal media_aerobic rep3	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922263	GSE48324	GSM1174826	GPL16227	24987116	Mid log_wildtype_glc minimal media + adenine_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	FPKM were calculated using Cufflinks v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554792	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922263	GSE48324	GSM1174826	GPL16227	24987116	Mid log_wildtype_glc minimal media + adenine_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	Differential expression analysis was carried out using cuffdiff v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554794	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922263	GSE48324	GSM1174826	GPL16227	24987116	Mid log_wildtype_glc minimal media + adenine_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	source_name	WT + ade PGCGROWTHCONDITIONS	<Gtype> WT + </Gtype> <Supp> ade </Supp> 	ade	Medium supplement	0.9422225160051976	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922263	GSE48324	GSM1174826	GPL16227	24987116	Mid log_wildtype_glc minimal media + adenine_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922264	GSE48324	GSM1174827	GPL16227	24987116	Mid log_wildtype_glc minimal media + L-tryptophan_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	FPKM were calculated using Cufflinks v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554792	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922264	GSE48324	GSM1174827	GPL16227	24987116	Mid log_wildtype_glc minimal media + L-tryptophan_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	Differential expression analysis was carried out using cuffdiff v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554794	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922264	GSE48324	GSM1174827	GPL16227	24987116	Mid log_wildtype_glc minimal media + L-tryptophan_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	source_name	WT + L-trp PGCGROWTHCONDITIONS	<Gtype> WT + </Gtype> <Supp> L-trp </Supp> 	L-trp	Medium supplement	0.9421073634644812	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922264	GSE48324	GSM1174827	GPL16227	24987116	Mid log_wildtype_glc minimal media + L-tryptophan_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922265	GSE48324	GSM1174828	GPL16227	24987116	Mid log_wildtype_glc minimal media_anaerobic rep1	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	FPKM were calculated using Cufflinks v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554792	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922265	GSE48324	GSM1174828	GPL16227	24987116	Mid log_wildtype_glc minimal media_anaerobic rep1	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	Differential expression analysis was carried out using cuffdiff v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554794	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922265	GSE48324	GSM1174828	GPL16227	24987116	Mid log_wildtype_glc minimal media_anaerobic rep1	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922266	GSE48324	GSM1174829	GPL16227	24987116	Mid log_wildtype_glc minimal media_anaerobic rep2	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	FPKM were calculated using Cufflinks v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554792	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922266	GSE48324	GSM1174829	GPL16227	24987116	Mid log_wildtype_glc minimal media_anaerobic rep2	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	Differential expression analysis was carried out using cuffdiff v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554794	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922266	GSE48324	GSM1174829	GPL16227	24987116	Mid log_wildtype_glc minimal media_anaerobic rep2	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922267	GSE48324	GSM1174830	GPL16227	24987116	Mid log_wildtype_glc minimal media_anaerobic rep3	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	FPKM were calculated using Cufflinks v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554792	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922267	GSE48324	GSM1174830	GPL16227	24987116	Mid log_wildtype_glc minimal media_anaerobic rep3	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	Differential expression analysis was carried out using cuffdiff v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554794	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922267	GSE48324	GSM1174830	GPL16227	24987116	Mid log_wildtype_glc minimal media_anaerobic rep3	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922268	GSE48324	GSM1174831	GPL16227	24987116	Mid log_nac KO_glc minimal media_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	FPKM were calculated using Cufflinks v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554792	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922268	GSE48324	GSM1174831	GPL16227	24987116	Mid log_nac KO_glc minimal media_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	Differential expression analysis was carried out using cuffdiff v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554794	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922268	GSE48324	GSM1174831	GPL16227	24987116	Mid log_nac KO_glc minimal media_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	characteristics	genotype/variation: nac KO; BW25113 Dnac PGCGROWTHCONDITIONS	genotype/variation : <Gtype> nac KO ; BW25113 Dnac </Gtype> 	nac KO ; BW25113 Dnac	Genetic background	0.9917092464638552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922268	GSE48324	GSM1174831	GPL16227	24987116	Mid log_nac KO_glc minimal media_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922269	GSE48324	GSM1174832	GPL16227	24987116	Mid log_nac KO_glc minimal media + adenine_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	FPKM were calculated using Cufflinks v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554792	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922269	GSE48324	GSM1174832	GPL16227	24987116	Mid log_nac KO_glc minimal media + adenine_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	Differential expression analysis was carried out using cuffdiff v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554794	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922269	GSE48324	GSM1174832	GPL16227	24987116	Mid log_nac KO_glc minimal media + adenine_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	characteristics	genotype/variation: nac KO; BW25113 Dnac PGCGROWTHCONDITIONS	genotype/variation : <Gtype> nac KO ; BW25113 Dnac </Gtype> 	nac KO ; BW25113 Dnac	Genetic background	0.9917092464638552	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922269	GSE48324	GSM1174832	GPL16227	24987116	Mid log_nac KO_glc minimal media + adenine_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922270	GSE48324	GSM1174833	GPL16227	24987116	Mid log_cra KO_glc minimal media_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	FPKM were calculated using Cufflinks v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554792	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922270	GSE48324	GSM1174833	GPL16227	24987116	Mid log_cra KO_glc minimal media_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	Differential expression analysis was carried out using cuffdiff v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554794	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922270	GSE48324	GSM1174833	GPL16227	24987116	Mid log_cra KO_glc minimal media_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	characteristics	genotype/variation: cra KO; BW25113 Dcra PGCGROWTHCONDITIONS	genotype/variation : <Gtype> cra KO ; BW25113 Dcra </Gtype> 	cra KO ; BW25113 Dcra	Genetic background	0.99961003967061	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922270	GSE48324	GSM1174833	GPL16227	24987116	Mid log_cra KO_glc minimal media_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922271	GSE48324	GSM1174834	GPL16227	24987116	Mid log_cra KO_glc minimal media + L-tryptophan_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	FPKM were calculated using Cufflinks v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554792	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922271	GSE48324	GSM1174834	GPL16227	24987116	Mid log_cra KO_glc minimal media + L-tryptophan_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	Differential expression analysis was carried out using cuffdiff v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554794	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922271	GSE48324	GSM1174834	GPL16227	24987116	Mid log_cra KO_glc minimal media + L-tryptophan_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	characteristics	genotype/variation: cra KO; BW25113 Dcra PGCGROWTHCONDITIONS	genotype/variation : <Gtype> cra KO ; BW25113 Dcra </Gtype> 	cra KO ; BW25113 Dcra	Genetic background	0.99961003967061	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922271	GSE48324	GSM1174834	GPL16227	24987116	Mid log_cra KO_glc minimal media + L-tryptophan_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922272	GSE48324	GSM1174835	GPL16227	24987116	Mid log_mntR KO_glc minimal media_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	FPKM were calculated using Cufflinks v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554792	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922272	GSE48324	GSM1174835	GPL16227	24987116	Mid log_mntR KO_glc minimal media_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	Differential expression analysis was carried out using cuffdiff v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554794	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922272	GSE48324	GSM1174835	GPL16227	24987116	Mid log_mntR KO_glc minimal media_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	characteristics	genotype/variation: mntR KO; BW25113 DmntR PGCGROWTHCONDITIONS	genotype/variation : <Gtype> mntR KO ; BW25113 DmntR </Gtype> 	mntR KO ; BW25113 DmntR	Genetic background	0.9973673286120964	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922272	GSE48324	GSM1174835	GPL16227	24987116	Mid log_mntR KO_glc minimal media_aerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922273	GSE48324	GSM1174836	GPL16227	24987116	Mid log_mntR KO_glc minimal media_anaerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	FPKM were calculated using Cufflinks v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	FPKM were calculated using Cufflinks v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554792	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922273	GSE48324	GSM1174836	GPL16227	24987116	Mid log_mntR KO_glc minimal media_anaerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	data_processing	Differential expression analysis was carried out using cuffdiff v.2.0.2 with upper-quartile normalization and fr-firststrand for library type PGCGROWTHCONDITIONS	Differential expression analysis was carried out using cuffdiff v. 2.0.2 with upper-quartile normalization and fr-firststrand for <Gtype> library type </Gtype> 	library type	Genetic background	0.9846165844554794	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922273	GSE48324	GSM1174836	GPL16227	24987116	Mid log_mntR KO_glc minimal media_anaerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	characteristics	genotype/variation: mntR KO; BW25113 DmntR PGCGROWTHCONDITIONS	genotype/variation : <Gtype> mntR KO ; BW25113 DmntR </Gtype> 	mntR KO ; BW25113 DmntR	Genetic background	0.9973673286120964	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR922273	GSE48324	GSM1174836	GPL16227	24987116	Mid log_mntR KO_glc minimal media_anaerobic	Minimal metabolic pathway structure is consistent with associated macromolecular interactions.	GPL16227: Illumina Genome Analyzer IIx (Escherichia coli K-12)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48324/GSE48324.soft.gz				0	0	False
SRR933983	GSE48829	GSM1185369	GPL17439	24214998	23A1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to Escherichia coli str. K-12 substr. MG1655, complete genome using bowtie2 version 2.0.5 with default parameters. PGCGROWTHCONDITIONS	Sequenced reads were trimmed for adaptor sequence , and masked for low-complexity or low-quality sequence , then mapped to Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , complete genome using bowtie2 version 2.0.5 with default parameters . 	K-12	Organism	0.9900556902671118	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933983	GSE48829	GSM1185369	GPL17439	24214998	23A1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933983	GSE48829	GSM1185369	GPL17439	24214998	23A1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933983	GSE48829	GSM1185369	GPL17439	24214998	23A1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933984	GSE48829	GSM1185370	GPL17439	24214998	23B1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to Escherichia coli str. K-12 substr. MG1655, complete genome using bowtie2 version 2.0.5 with default parameters. PGCGROWTHCONDITIONS	Sequenced reads were trimmed for adaptor sequence , and masked for low-complexity or low-quality sequence , then mapped to Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , complete genome using bowtie2 version 2.0.5 with default parameters . 	K-12	Organism	0.9900556902671118	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933984	GSE48829	GSM1185370	GPL17439	24214998	23B1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933984	GSE48829	GSM1185370	GPL17439	24214998	23B1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933984	GSE48829	GSM1185370	GPL17439	24214998	23B1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933985	GSE48829	GSM1185371	GPL17439	24214998	23C3	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to Escherichia coli str. K-12 substr. MG1655, complete genome using bowtie2 version 2.0.5 with default parameters. PGCGROWTHCONDITIONS	Sequenced reads were trimmed for adaptor sequence , and masked for low-complexity or low-quality sequence , then mapped to Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , complete genome using bowtie2 version 2.0.5 with default parameters . 	K-12	Organism	0.9900556902671118	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933985	GSE48829	GSM1185371	GPL17439	24214998	23C3	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933985	GSE48829	GSM1185371	GPL17439	24214998	23C3	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933985	GSE48829	GSM1185371	GPL17439	24214998	23C3	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933986	GSE48829	GSM1185372	GPL17439	24214998	39A1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to Escherichia coli str. K-12 substr. MG1655, complete genome using bowtie2 version 2.0.5 with default parameters. PGCGROWTHCONDITIONS	Sequenced reads were trimmed for adaptor sequence , and masked for low-complexity or low-quality sequence , then mapped to Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , complete genome using bowtie2 version 2.0.5 with default parameters . 	K-12	Organism	0.9900556902671118	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933986	GSE48829	GSM1185372	GPL17439	24214998	39A1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933986	GSE48829	GSM1185372	GPL17439	24214998	39A1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933986	GSE48829	GSM1185372	GPL17439	24214998	39A1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933987	GSE48829	GSM1185373	GPL17439	24214998	39B1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to Escherichia coli str. K-12 substr. MG1655, complete genome using bowtie2 version 2.0.5 with default parameters. PGCGROWTHCONDITIONS	Sequenced reads were trimmed for adaptor sequence , and masked for low-complexity or low-quality sequence , then mapped to Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , complete genome using bowtie2 version 2.0.5 with default parameters . 	K-12	Organism	0.9900556902671118	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933987	GSE48829	GSM1185373	GPL17439	24214998	39B1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933987	GSE48829	GSM1185373	GPL17439	24214998	39B1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933987	GSE48829	GSM1185373	GPL17439	24214998	39B1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933988	GSE48829	GSM1185374	GPL17439	24214998	39C1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to Escherichia coli str. K-12 substr. MG1655, complete genome using bowtie2 version 2.0.5 with default parameters. PGCGROWTHCONDITIONS	Sequenced reads were trimmed for adaptor sequence , and masked for low-complexity or low-quality sequence , then mapped to Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , complete genome using bowtie2 version 2.0.5 with default parameters . 	K-12	Organism	0.9900556902671118	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933988	GSE48829	GSM1185374	GPL17439	24214998	39C1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933988	GSE48829	GSM1185374	GPL17439	24214998	39C1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933988	GSE48829	GSM1185374	GPL17439	24214998	39C1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933989	GSE48829	GSM1185375	GPL17439	24214998	WTA1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to Escherichia coli str. K-12 substr. MG1655, complete genome using bowtie2 version 2.0.5 with default parameters. PGCGROWTHCONDITIONS	Sequenced reads were trimmed for adaptor sequence , and masked for low-complexity or low-quality sequence , then mapped to Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , complete genome using bowtie2 version 2.0.5 with default parameters . 	K-12	Organism	0.9900556902671118	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933989	GSE48829	GSM1185375	GPL17439	24214998	WTA1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933989	GSE48829	GSM1185375	GPL17439	24214998	WTA1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933989	GSE48829	GSM1185375	GPL17439	24214998	WTA1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933990	GSE48829	GSM1185376	GPL17439	24214998	WTB1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to Escherichia coli str. K-12 substr. MG1655, complete genome using bowtie2 version 2.0.5 with default parameters. PGCGROWTHCONDITIONS	Sequenced reads were trimmed for adaptor sequence , and masked for low-complexity or low-quality sequence , then mapped to Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , complete genome using bowtie2 version 2.0.5 with default parameters . 	K-12	Organism	0.9900556902671118	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933990	GSE48829	GSM1185376	GPL17439	24214998	WTB1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933990	GSE48829	GSM1185376	GPL17439	24214998	WTB1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933990	GSE48829	GSM1185376	GPL17439	24214998	WTB1	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933991	GSE48829	GSM1185377	GPL17439	24214998	WTC3	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to Escherichia coli str. K-12 substr. MG1655, complete genome using bowtie2 version 2.0.5 with default parameters. PGCGROWTHCONDITIONS	Sequenced reads were trimmed for adaptor sequence , and masked for low-complexity or low-quality sequence , then mapped to Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , complete genome using bowtie2 version 2.0.5 with default parameters . 	K-12	Organism	0.9900556902671118	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933991	GSE48829	GSM1185377	GPL17439	24214998	WTC3	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933991	GSE48829	GSM1185377	GPL17439	24214998	WTC3	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR933991	GSE48829	GSM1185377	GPL17439	24214998	WTC3	Escherichia coli RNA-Seq	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE48829/GSE48829.soft.gz				0	0	False
SRR1067773SRR1067774	GSE53767	GSM1300282	GPL14548-GPL18133	24766808	mRNA-seq in rich defined media	Absolute quantification of protein production reveals principles underlying protein synthesis rates	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE53767/GSE53767.soft.gz				0	0	False
SRR1067773SRR1067774	GSE53767	GSM1300282	GPL14548-GPL18133	24766808	mRNA-seq in rich defined media	Absolute quantification of protein production reveals principles underlying protein synthesis rates	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	All cultures were based on MOPS media with 0.2% glucose (Teknova), with either full supplement (Neidhardt et al., 1974). An overnight liquid culture was diluted 400-fold into 200 ml fresh media. The culture was kept in a 2.8-liter flask at 37C with aeration (180 rpm) until OD600 reached 0.3. PGCGROWTHCONDITIONS	All cultures were based on MOPS media with <Supp> 0.2 % glucose </Supp> ( Teknova ) , with either full supplement ( Neidhardt et al. , 1974 ) . An overnight liquid culture was diluted 400-fold into 200 ml <Med> fresh media </Med> . The culture was kept in a 2.8-liter flask at 37C with aeration ( 180 rpm ) until OD600 reached 0.3 . 	fresh media	Medium	0.9122546228742974	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE53767/GSE53767.soft.gz				0	0	False
SRR1067773SRR1067774	GSE53767	GSM1300282	GPL14548-GPL18133	24766808	mRNA-seq in rich defined media	Absolute quantification of protein production reveals principles underlying protein synthesis rates	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18133: Illumina HiSeq 2500 (Escherichia coli)	growth_protocol	All cultures were based on MOPS media with 0.2% glucose (Teknova), with either full supplement (Neidhardt et al., 1974). An overnight liquid culture was diluted 400-fold into 200 ml fresh media. The culture was kept in a 2.8-liter flask at 37C with aeration (180 rpm) until OD600 reached 0.3. PGCGROWTHCONDITIONS	All cultures were based on MOPS media with <Supp> 0.2 % glucose </Supp> ( Teknova ) , with either full supplement ( Neidhardt et al. , 1974 ) . An overnight liquid culture was diluted 400-fold into 200 ml <Med> fresh media </Med> . The culture was kept in a 2.8-liter flask at 37C with aeration ( 180 rpm ) until OD600 reached 0.3 . 	fresh media	Medium	0.9122546228789022	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE53767/GSE53767.soft.gz				0	0	False
SRR1168133	GSE54900	GSM1326347	GPL17439	25222563	WT with Fe 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168133	GSE54900	GSM1326347	GPL17439	25222563	WT with Fe 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli K-12 MG1655 WT and Δfur were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. For iron treated cells, 0.1mM of FeCl2 were treated from the beginning of culture, and for DPD treated cells, 0.2mM of DPD were added at early-log phase and continued to culture for additional 2h. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT and Δfur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . 	0.2 mM of DPD	Medium supplement	0.9163856147817324	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168133	GSE54900	GSM1326347	GPL17439	25222563	WT with Fe 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli K-12 MG1655 WT and Δfur were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. For iron treated cells, 0.1mM of FeCl2 were treated from the beginning of culture, and for DPD treated cells, 0.2mM of DPD were added at early-log phase and continued to culture for additional 2h. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT and Δfur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . 	2h	Medium supplement	0.9163856147817324	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168133	GSE54900	GSM1326347	GPL17439	25222563	WT with Fe 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168133	GSE54900	GSM1326347	GPL17439	25222563	WT with Fe 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168133	GSE54900	GSM1326347	GPL17439	25222563	WT with Fe 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	agent: Fe PGCGROWTHCONDITIONS	agent : <Supp> Fe </Supp> 	Fe	Medium supplement	0.9949662369236588	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168134	GSE54900	GSM1326348	GPL17439	25222563	WT with Fe 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168134	GSE54900	GSM1326348	GPL17439	25222563	WT with Fe 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli K-12 MG1655 WT and Δfur were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. For iron treated cells, 0.1mM of FeCl2 were treated from the beginning of culture, and for DPD treated cells, 0.2mM of DPD were added at early-log phase and continued to culture for additional 2h. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT and Δfur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . 	0.2 mM of DPD	Medium supplement	0.9163856147817324	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168134	GSE54900	GSM1326348	GPL17439	25222563	WT with Fe 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli K-12 MG1655 WT and Δfur were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. For iron treated cells, 0.1mM of FeCl2 were treated from the beginning of culture, and for DPD treated cells, 0.2mM of DPD were added at early-log phase and continued to culture for additional 2h. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT and Δfur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . 	2h	Medium supplement	0.9163856147817324	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168134	GSE54900	GSM1326348	GPL17439	25222563	WT with Fe 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168134	GSE54900	GSM1326348	GPL17439	25222563	WT with Fe 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168134	GSE54900	GSM1326348	GPL17439	25222563	WT with Fe 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	agent: Fe PGCGROWTHCONDITIONS	agent : <Supp> Fe </Supp> 	Fe	Medium supplement	0.9949662369236588	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168135	GSE54900	GSM1326349	GPL17439	25222563	WT with DPD 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168135	GSE54900	GSM1326349	GPL17439	25222563	WT with DPD 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli K-12 MG1655 WT and Δfur were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. For iron treated cells, 0.1mM of FeCl2 were treated from the beginning of culture, and for DPD treated cells, 0.2mM of DPD were added at early-log phase and continued to culture for additional 2h. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT and Δfur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . 	0.2 mM of DPD	Medium supplement	0.9163856147817324	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168135	GSE54900	GSM1326349	GPL17439	25222563	WT with DPD 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli K-12 MG1655 WT and Δfur were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. For iron treated cells, 0.1mM of FeCl2 were treated from the beginning of culture, and for DPD treated cells, 0.2mM of DPD were added at early-log phase and continued to culture for additional 2h. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT and Δfur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . 	2h	Medium supplement	0.9163856147817324	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168135	GSE54900	GSM1326349	GPL17439	25222563	WT with DPD 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168135	GSE54900	GSM1326349	GPL17439	25222563	WT with DPD 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168135	GSE54900	GSM1326349	GPL17439	25222563	WT with DPD 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	agent: DPD PGCGROWTHCONDITIONS	agent : <Supp> DPD </Supp> 	DPD	Medium supplement	0.9870617721711	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168136	GSE54900	GSM1326350	GPL17439	25222563	WT with DPD 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168136	GSE54900	GSM1326350	GPL17439	25222563	WT with DPD 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli K-12 MG1655 WT and Δfur were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. For iron treated cells, 0.1mM of FeCl2 were treated from the beginning of culture, and for DPD treated cells, 0.2mM of DPD were added at early-log phase and continued to culture for additional 2h. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT and Δfur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . 	0.2 mM of DPD	Medium supplement	0.9163856147817324	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168136	GSE54900	GSM1326350	GPL17439	25222563	WT with DPD 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli K-12 MG1655 WT and Δfur were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. For iron treated cells, 0.1mM of FeCl2 were treated from the beginning of culture, and for DPD treated cells, 0.2mM of DPD were added at early-log phase and continued to culture for additional 2h. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT and Δfur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . 	2h	Medium supplement	0.9163856147817324	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168136	GSE54900	GSM1326350	GPL17439	25222563	WT with DPD 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168136	GSE54900	GSM1326350	GPL17439	25222563	WT with DPD 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168136	GSE54900	GSM1326350	GPL17439	25222563	WT with DPD 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	agent: DPD PGCGROWTHCONDITIONS	agent : <Supp> DPD </Supp> 	DPD	Medium supplement	0.9870617721711	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168137	GSE54900	GSM1326351	GPL17439	25222563	Δfur with Fe 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168137	GSE54900	GSM1326351	GPL17439	25222563	Δfur with Fe 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli K-12 MG1655 WT and Δfur were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. For iron treated cells, 0.1mM of FeCl2 were treated from the beginning of culture, and for DPD treated cells, 0.2mM of DPD were added at early-log phase and continued to culture for additional 2h. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT and Δfur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . 	0.2 mM of DPD	Medium supplement	0.9163856147817324	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168137	GSE54900	GSM1326351	GPL17439	25222563	Δfur with Fe 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli K-12 MG1655 WT and Δfur were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. For iron treated cells, 0.1mM of FeCl2 were treated from the beginning of culture, and for DPD treated cells, 0.2mM of DPD were added at early-log phase and continued to culture for additional 2h. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT and Δfur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . 	2h	Medium supplement	0.9163856147817324	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168137	GSE54900	GSM1326351	GPL17439	25222563	Δfur with Fe 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168137	GSE54900	GSM1326351	GPL17439	25222563	Δfur with Fe 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168137	GSE54900	GSM1326351	GPL17439	25222563	Δfur with Fe 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype/variation: Δfur PGCGROWTHCONDITIONS	genotype/variation : <Gtype> Δfur </Gtype> 	Δfur	Genetic background	0.9494307068719732	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168137	GSE54900	GSM1326351	GPL17439	25222563	Δfur with Fe 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	agent: Fe PGCGROWTHCONDITIONS	agent : <Supp> Fe </Supp> 	Fe	Medium supplement	0.9949662369236588	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168138	GSE54900	GSM1326352	GPL17439	25222563	Δfur with Fe 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168138	GSE54900	GSM1326352	GPL17439	25222563	Δfur with Fe 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli K-12 MG1655 WT and Δfur were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. For iron treated cells, 0.1mM of FeCl2 were treated from the beginning of culture, and for DPD treated cells, 0.2mM of DPD were added at early-log phase and continued to culture for additional 2h. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT and Δfur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . 	0.2 mM of DPD	Medium supplement	0.9163856147817324	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168138	GSE54900	GSM1326352	GPL17439	25222563	Δfur with Fe 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli K-12 MG1655 WT and Δfur were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. For iron treated cells, 0.1mM of FeCl2 were treated from the beginning of culture, and for DPD treated cells, 0.2mM of DPD were added at early-log phase and continued to culture for additional 2h. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT and Δfur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . 	2h	Medium supplement	0.9163856147817324	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168138	GSE54900	GSM1326352	GPL17439	25222563	Δfur with Fe 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168138	GSE54900	GSM1326352	GPL17439	25222563	Δfur with Fe 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168138	GSE54900	GSM1326352	GPL17439	25222563	Δfur with Fe 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype/variation: Δfur PGCGROWTHCONDITIONS	genotype/variation : <Gtype> Δfur </Gtype> 	Δfur	Genetic background	0.9494307068719732	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168138	GSE54900	GSM1326352	GPL17439	25222563	Δfur with Fe 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	agent: Fe PGCGROWTHCONDITIONS	agent : <Supp> Fe </Supp> 	Fe	Medium supplement	0.9949662369236588	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168139	GSE54900	GSM1326353	GPL17439	25222563	Δfur with DPD 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168139	GSE54900	GSM1326353	GPL17439	25222563	Δfur with DPD 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli K-12 MG1655 WT and Δfur were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. For iron treated cells, 0.1mM of FeCl2 were treated from the beginning of culture, and for DPD treated cells, 0.2mM of DPD were added at early-log phase and continued to culture for additional 2h. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT and Δfur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . 	0.2 mM of DPD	Medium supplement	0.9163856147817324	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168139	GSE54900	GSM1326353	GPL17439	25222563	Δfur with DPD 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli K-12 MG1655 WT and Δfur were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. For iron treated cells, 0.1mM of FeCl2 were treated from the beginning of culture, and for DPD treated cells, 0.2mM of DPD were added at early-log phase and continued to culture for additional 2h. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT and Δfur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . 	2h	Medium supplement	0.9163856147817324	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168139	GSE54900	GSM1326353	GPL17439	25222563	Δfur with DPD 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168139	GSE54900	GSM1326353	GPL17439	25222563	Δfur with DPD 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168139	GSE54900	GSM1326353	GPL17439	25222563	Δfur with DPD 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype/variation: Δfur PGCGROWTHCONDITIONS	genotype/variation : <Gtype> Δfur </Gtype> 	Δfur	Genetic background	0.9494307068719732	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168139	GSE54900	GSM1326353	GPL17439	25222563	Δfur with DPD 1 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	agent: DPD PGCGROWTHCONDITIONS	agent : <Supp> DPD </Supp> 	DPD	Medium supplement	0.9870617721711	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168140	GSE54900	GSM1326354	GPL17439	25222563	Δfur with DPD 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168140	GSE54900	GSM1326354	GPL17439	25222563	Δfur with DPD 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli K-12 MG1655 WT and Δfur were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. For iron treated cells, 0.1mM of FeCl2 were treated from the beginning of culture, and for DPD treated cells, 0.2mM of DPD were added at early-log phase and continued to culture for additional 2h. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT and Δfur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . 	0.2 mM of DPD	Medium supplement	0.9163856147817324	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168140	GSE54900	GSM1326354	GPL17439	25222563	Δfur with DPD 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli K-12 MG1655 WT and Δfur were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. For iron treated cells, 0.1mM of FeCl2 were treated from the beginning of culture, and for DPD treated cells, 0.2mM of DPD were added at early-log phase and continued to culture for additional 2h. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT and Δfur were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . For iron treated cells , 0.1 mM of FeCl2 were treated from the beginning of culture , and for DPD treated cells , <Supp> 0.2 mM of DPD </Supp> were added at early-log phase and continued to culture for additional <Supp> 2h </Supp> . 	2h	Medium supplement	0.9163856147817324	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168140	GSE54900	GSM1326354	GPL17439	25222563	Δfur with DPD 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168140	GSE54900	GSM1326354	GPL17439	25222563	Δfur with DPD 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168140	GSE54900	GSM1326354	GPL17439	25222563	Δfur with DPD 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype/variation: Δfur PGCGROWTHCONDITIONS	genotype/variation : <Gtype> Δfur </Gtype> 	Δfur	Genetic background	0.9494307068719732	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1168140	GSE54900	GSM1326354	GPL17439	25222563	Δfur with DPD 2 (RNA-seq)	Deciphering the Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	agent: DPD PGCGROWTHCONDITIONS	agent : <Supp> DPD </Supp> 	DPD	Medium supplement	0.9870617721711	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE54900/GSE54900.soft.gz				0	0	False
SRR1173965	GSE55199	GSM1331409	GPL15010-GPL17024	25266388	LB 0.4 B1 TEX neg L1 GA	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173965	GSE55199	GSM1331409	GPL15010-GPL17024	25266388	LB 0.4 B1 TEX neg L1 GA	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173966	GSE55199	GSM1331410	GPL15010-GPL17024	25266388	LB 0.4 B1 TEX pos L1 GA	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173966	GSE55199	GSM1331410	GPL15010-GPL17024	25266388	LB 0.4 B1 TEX pos L1 GA	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173967	GSE55199	GSM1331411	GPL15010-GPL17024	25266388	LB 0.4 B2 TEX neg L1 HS1	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173967	GSE55199	GSM1331411	GPL15010-GPL17024	25266388	LB 0.4 B2 TEX neg L1 HS1	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173968	GSE55199	GSM1331412	GPL15010-GPL17024	25266388	LB 0.4 B2 TEX neg L1 HS2	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173968	GSE55199	GSM1331412	GPL15010-GPL17024	25266388	LB 0.4 B2 TEX neg L1 HS2	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173969	GSE55199	GSM1331413	GPL15010-GPL17024	25266388	LB 0.4 B2 TEX pos L1 HS1	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173969	GSE55199	GSM1331413	GPL15010-GPL17024	25266388	LB 0.4 B2 TEX pos L1 HS1	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173970	GSE55199	GSM1331414	GPL15010-GPL17024	25266388	LB 0.4 B2 TEX pos L1 HS2	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173970	GSE55199	GSM1331414	GPL15010-GPL17024	25266388	LB 0.4 B2 TEX pos L1 HS2	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173971	GSE55199	GSM1331415	GPL15010-GPL17024	25266388	LB 2.0 B1 TEX neg L1 GA	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173971	GSE55199	GSM1331415	GPL15010-GPL17024	25266388	LB 2.0 B1 TEX neg L1 GA	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173972	GSE55199	GSM1331416	GPL15010-GPL17024	25266388	LB 2.0 B1 TEX neg L2 HS2	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173972	GSE55199	GSM1331416	GPL15010-GPL17024	25266388	LB 2.0 B1 TEX neg L2 HS2	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173973	GSE55199	GSM1331417	GPL15010-GPL17024	25266388	LB 2.0 B1 TEX pos L1 GA	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173973	GSE55199	GSM1331417	GPL15010-GPL17024	25266388	LB 2.0 B1 TEX pos L1 GA	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173974	GSE55199	GSM1331418	GPL15010-GPL17024	25266388	LB 2.0 B1 TEX pos L2 HS2	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173974	GSE55199	GSM1331418	GPL15010-GPL17024	25266388	LB 2.0 B1 TEX pos L2 HS2	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173975	GSE55199	GSM1331419	GPL15010-GPL17024	25266388	LB 2.0 B2 TEX neg L1 HS1	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173975	GSE55199	GSM1331419	GPL15010-GPL17024	25266388	LB 2.0 B2 TEX neg L1 HS1	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173976	GSE55199	GSM1331420	GPL15010-GPL17024	25266388	LB 2.0 B2 TEX neg L1 HS2	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173976	GSE55199	GSM1331420	GPL15010-GPL17024	25266388	LB 2.0 B2 TEX neg L1 HS2	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173977	GSE55199	GSM1331421	GPL15010-GPL17024	25266388	LB 2.0 B2 TEX neg L2 HS2	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173977	GSE55199	GSM1331421	GPL15010-GPL17024	25266388	LB 2.0 B2 TEX neg L2 HS2	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173978	GSE55199	GSM1331422	GPL15010-GPL17024	25266388	LB 2.0 B2 TEX pos L1 HS1	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173978	GSE55199	GSM1331422	GPL15010-GPL17024	25266388	LB 2.0 B2 TEX pos L1 HS1	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173979	GSE55199	GSM1331423	GPL15010-GPL17024	25266388	LB 2.0 B2 TEX pos L1 HS2	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173979	GSE55199	GSM1331423	GPL15010-GPL17024	25266388	LB 2.0 B2 TEX pos L1 HS2	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173980	GSE55199	GSM1331424	GPL15010-GPL17024	25266388	LB 2.0 B2 TEX pos L2 HS2	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173980	GSE55199	GSM1331424	GPL15010-GPL17024	25266388	LB 2.0 B2 TEX pos L2 HS2	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173982	GSE55199	GSM1331426	GPL15010-GPL17024	25266388	M63 0.4 B1 TEX pos L1 GA	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173982	GSE55199	GSM1331426	GPL15010-GPL17024	25266388	M63 0.4 B1 TEX pos L1 GA	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173983	GSE55199	GSM1331427	GPL15010-GPL17024	25266388	M63 0.4 B2 TEX neg L1 HS1	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173983	GSE55199	GSM1331427	GPL15010-GPL17024	25266388	M63 0.4 B2 TEX neg L1 HS1	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173984	GSE55199	GSM1331428	GPL15010-GPL17024	25266388	M63 0.4 B2 TEX neg L1 HS2	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173984	GSE55199	GSM1331428	GPL15010-GPL17024	25266388	M63 0.4 B2 TEX neg L1 HS2	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173985	GSE55199	GSM1331429	GPL15010-GPL17024	25266388	M63 0.4 B2 TEX pos L1 HS1	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173985	GSE55199	GSM1331429	GPL15010-GPL17024	25266388	M63 0.4 B2 TEX pos L1 HS1	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173986	GSE55199	GSM1331430	GPL15010-GPL17024	25266388	M63 0.4 B2 TEX pos L1 HS2	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1173986	GSE55199	GSM1331430	GPL15010-GPL17024	25266388	M63 0.4 B2 TEX pos L1 HS2	Identification and validation of antisense RNAs in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL17024: Illumina Genome Analyzer IIx (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE55199/GSE55199.soft.gz				0	0	False
SRR1363864	GSE58285	GSM1405877	GPL14548	25237058	rne wild-type	Direct entry by RNase E is a major pathway for the degradation and processing of RNA in Escherichia coli	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	data_processing	Genome_build: U00096.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> U00096 .2 </Gversion> 	U00096 .2	Gversion	0.9999403078579352	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE58285/GSE58285.soft.gz				0	0	False
SRR1363865	GSE58285	GSM1405878	GPL14548	25237058	rne-3071 ts	Direct entry by RNase E is a major pathway for the degradation and processing of RNA in Escherichia coli	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	data_processing	Genome_build: U00096.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> U00096 .2 </Gversion> 	U00096 .2	Gversion	0.9999403078579352	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE58285/GSE58285.soft.gz				0	0	False
SRR1363866	GSE58285	GSM1405879	GPL14548	25237058	T170V 0 min	Direct entry by RNase E is a major pathway for the degradation and processing of RNA in Escherichia coli	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	data_processing	Genome_build: U00096.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> U00096 .2 </Gversion> 	U00096 .2	Gversion	0.9999403078579352	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE58285/GSE58285.soft.gz				0	0	False
SRR1363866	GSE58285	GSM1405879	GPL14548	25237058	T170V 0 min	Direct entry by RNase E is a major pathway for the degradation and processing of RNA in Escherichia coli	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	incubation time: 0 min PGCGROWTHCONDITIONS	incubation time : <Supp> 0 min </Supp> 	0 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE58285/GSE58285.soft.gz				0	0	False
SRR1363867	GSE58285	GSM1405880	GPL14548	25237058	T170V 10 min	Direct entry by RNase E is a major pathway for the degradation and processing of RNA in Escherichia coli	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	data_processing	Genome_build: U00096.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> U00096 .2 </Gversion> 	U00096 .2	Gversion	0.9999403078579352	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE58285/GSE58285.soft.gz				0	0	False
SRR1363867	GSE58285	GSM1405880	GPL14548	25237058	T170V 10 min	Direct entry by RNase E is a major pathway for the degradation and processing of RNA in Escherichia coli	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	incubation time: 10 min PGCGROWTHCONDITIONS	incubation time : <Supp> 10 min </Supp> 	10 min	Medium supplement	0.994877810696014	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE58285/GSE58285.soft.gz				0	0	False
SRR1363869	GSE58285	GSM1405882	GPL14548	25237058	rng mutant	Direct entry by RNase E is a major pathway for the degradation and processing of RNA in Escherichia coli	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	data_processing	Genome_build: U00096.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> U00096 .2 </Gversion> 	U00096 .2	Gversion	0.9999403078579352	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE58285/GSE58285.soft.gz				0	0	False
SRR1411272	GSE58556	GSM1413874	GPL18814	25483350	WT_glucose_log	RNA sequencing based analysis of the bacterial transcriptome	GPL18814: Illumina HiSeq 2000 (Escherichia coli BW38028)	characteristics	sample type: no RNA treatment PGCGROWTHCONDITIONS	<Gtype> sample type </Gtype> : <Anti> no RNA treatment </Anti> 	sample type	Genetic background	0.995132430744548	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE58556/GSE58556.soft.gz				0	0	False
SRR1425203	GSE58637	GSM1415871	GPL14548	25030700	ribosome profiling MicL t0	MicL, a new σE-dependent sRNA, combats envelope stress by repressing synthesis of Lpp, the major outer membrane lipoprotein	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE58637/GSE58637.soft.gz				0	0	False
SRR1425204	GSE58637	GSM1415872	GPL14548	25030700	ribosome profiling MicL t20	MicL, a new σE-dependent sRNA, combats envelope stress by repressing synthesis of Lpp, the major outer membrane lipoprotein	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE58637/GSE58637.soft.gz				0	0	False
SRR1514602	GSE59397	GSM1436266	GPL14548-GPL18945		SynH_Exp_CBYS	Aromatic inhibitors derived from ammonia-pretreated lignocellulose hinder bacterial ethanologenesis by activating regulatory circuits controlling inhibitor efflux and detoxification (V)	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz				0	0	False
SRR1514603	GSE59397	GSM1436267	GPL14548-GPL18945		SynH_Exp_BXHU	Aromatic inhibitors derived from ammonia-pretreated lignocellulose hinder bacterial ethanologenesis by activating regulatory circuits controlling inhibitor efflux and detoxification (V)	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz				0	0	False
SRR1514606	GSE59397	GSM1436270	GPL14548-GPL18945		SynH_LT_Exp_CBYU	Aromatic inhibitors derived from ammonia-pretreated lignocellulose hinder bacterial ethanologenesis by activating regulatory circuits controlling inhibitor efflux and detoxification (V)	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz				0	0	False
SRR1514608	GSE59397	GSM1436272	GPL14548-GPL18945		ACSH_Exp_CIYS	Aromatic inhibitors derived from ammonia-pretreated lignocellulose hinder bacterial ethanologenesis by activating regulatory circuits controlling inhibitor efflux and detoxification (V)	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz				0	0	False
SRR1514609	GSE59397	GSM1436273	GPL14548-GPL18945		SynH_Trans_CUNZ	Aromatic inhibitors derived from ammonia-pretreated lignocellulose hinder bacterial ethanologenesis by activating regulatory circuits controlling inhibitor efflux and detoxification (V)	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz				0	0	False
SRR1514610	GSE59397	GSM1436274	GPL14548-GPL18945		SynH_Trans_CUOB	Aromatic inhibitors derived from ammonia-pretreated lignocellulose hinder bacterial ethanologenesis by activating regulatory circuits controlling inhibitor efflux and detoxification (V)	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz				0	0	False
SRR1514611	GSE59397	GSM1436275	GPL14548-GPL18945		SynH_LT_Trans_BXNC	Aromatic inhibitors derived from ammonia-pretreated lignocellulose hinder bacterial ethanologenesis by activating regulatory circuits controlling inhibitor efflux and detoxification (V)	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz				0	0	False
SRR1514612	GSE59397	GSM1436276	GPL14548-GPL18945		SynH_LT_Trans_BXXC	Aromatic inhibitors derived from ammonia-pretreated lignocellulose hinder bacterial ethanologenesis by activating regulatory circuits controlling inhibitor efflux and detoxification (V)	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz				0	0	False
SRR1514613	GSE59397	GSM1436277	GPL14548-GPL18945		SynH_LT_Trans_CBYW	Aromatic inhibitors derived from ammonia-pretreated lignocellulose hinder bacterial ethanologenesis by activating regulatory circuits controlling inhibitor efflux and detoxification (V)	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz				0	0	False
SRR1514616	GSE59397	GSM1436280	GPL14548-GPL18945		SynH_Stat1_CBYN	Aromatic inhibitors derived from ammonia-pretreated lignocellulose hinder bacterial ethanologenesis by activating regulatory circuits controlling inhibitor efflux and detoxification (V)	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz				0	0	False
SRR1514617	GSE59397	GSM1436281	GPL14548-GPL18945		SynH_Stat1_CUOC	Aromatic inhibitors derived from ammonia-pretreated lignocellulose hinder bacterial ethanologenesis by activating regulatory circuits controlling inhibitor efflux and detoxification (V)	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz				0	0	False
SRR1514618	GSE59397	GSM1436282	GPL14548-GPL18945		SynH_LT_Stat1_BXNB	Aromatic inhibitors derived from ammonia-pretreated lignocellulose hinder bacterial ethanologenesis by activating regulatory circuits controlling inhibitor efflux and detoxification (V)	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz				0	0	False
SRR1514619	GSE59397	GSM1436283	GPL14548-GPL18945		SynH_LT_Stat1_BXNZ	Aromatic inhibitors derived from ammonia-pretreated lignocellulose hinder bacterial ethanologenesis by activating regulatory circuits controlling inhibitor efflux and detoxification (V)	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz				0	0	False
SRR1514620	GSE59397	GSM1436284	GPL14548-GPL18945		SynH_LT_Stat1_CHBW	Aromatic inhibitors derived from ammonia-pretreated lignocellulose hinder bacterial ethanologenesis by activating regulatory circuits controlling inhibitor efflux and detoxification (V)	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE59397/GSE59397.soft.gz				0	0	False
SRR1536586	GSE60107	GSM1465035	GPL14548	2575788830486791	WT_RNA-Seq	Next generation sequencing analysis reveals that the ribonucleases RNase II, RNase R and PNPase affect bacterial motility and biofilm formation in E. coli	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE60107/GSE60107.soft.gz				0	0	False
SRR1536587	GSE60107	GSM1465036	GPL14548	2575788830486791	∆rnb_RNA-Seq	Next generation sequencing analysis reveals that the ribonucleases RNase II, RNase R and PNPase affect bacterial motility and biofilm formation in E. coli	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE60107/GSE60107.soft.gz				0	0	False
SRR1536588	GSE60107	GSM1465037	GPL14548	2575788830486791	∆rnr_RNA-Seq	Next generation sequencing analysis reveals that the ribonucleases RNase II, RNase R and PNPase affect bacterial motility and biofilm formation in E. coli	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE60107/GSE60107.soft.gz				0	0	False
SRR1536589	GSE60107	GSM1465038	GPL14548	2575788830486791	∆pnp_RNA-Seq	Next generation sequencing analysis reveals that the ribonucleases RNase II, RNase R and PNPase affect bacterial motility and biofilm formation in E. coli	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	data_processing	Genome_build: ASM584v2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> 	ASM584v2	Gversion	0.9804230629866136	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE60107/GSE60107.soft.gz				0	0	False
SRR1603659	GSE62102	GSM1519656	GPL18945	25976475	Pause sites in E. coli wild-type strain identified by RNET-seq	Genome-wide assessments of transcriptional pauses and errors by nascent transcript sequencing combined with RNase footprinting (RNET-seq)	GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	characteristics	genotype/variation: W3110 rpoC-6xHis::kan gal490 PGCGROWTHCONDITIONS	genotype/variation : <Gtype> W3110 rpoC-6xHis : : kan gal490 </Gtype> 	W3110 rpoC-6xHis : : kan gal490	Genetic background	0.990726628258309	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE62102/GSE62102.soft.gz				0	0	False
SRR1603660	GSE62102	GSM1519657	GPL18945	25976475	Pause sites in E. coli ΔgreAB strain identified by RNET-seq	Genome-wide assessments of transcriptional pauses and errors by nascent transcript sequencing combined with RNase footprinting (RNET-seq)	GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	source_name	W3110 rpoC-6xHis::kan greA::tet, greB::amp PGCGROWTHCONDITIONS	W3110 rpoC-6xHis : <Gtype> : kan greA : : tet , greB : : amp </Gtype> 	: kan greA : : tet , greB : : amp	Genetic background	0.9917750829047932	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE62102/GSE62102.soft.gz				0	0	False
SRR1603660	GSE62102	GSM1519657	GPL18945	25976475	Pause sites in E. coli ΔgreAB strain identified by RNET-seq	Genome-wide assessments of transcriptional pauses and errors by nascent transcript sequencing combined with RNase footprinting (RNET-seq)	GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	characteristics	genotype/variation: W3110 rpoC-6xHis::kan greA::tet, greB::amp PGCGROWTHCONDITIONS	genotype/variation : <Gtype> W3110 rpoC-6xHis : : kan greA : : tet , greB : : amp </Gtype> 	W3110 rpoC-6xHis : : kan greA : : tet , greB : : amp	Genetic background	0.9970412300670148	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE62102/GSE62102.soft.gz				0	0	False
SRR1613487	GSE62394	GSM1526511	GPL14548	27578754	con_RNAA	Transcriptomic analysis of VBNC Escherichia coli O157:H7 induced by HPCD by high-throughput Illumina sequencing technology	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	strain: O157:H7 NCTC 12900 PGCGROWTHCONDITIONS	strain : <Gtype> O157 : H7 NCTC 12900 </Gtype> 	O157 : H7 NCTC 12900	Genetic background	0.97520558677397	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE62394/GSE62394.soft.gz				0	0	False
SRR1613488	GSE62394	GSM1526512	GPL14548	27578754	cas_RNAA	Transcriptomic analysis of VBNC Escherichia coli O157:H7 induced by HPCD by high-throughput Illumina sequencing technology	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	strain: O157:H7 NCTC 12900 PGCGROWTHCONDITIONS	strain : <Gtype> O157 : H7 NCTC 12900 </Gtype> 	O157 : H7 NCTC 12900	Genetic background	0.97520558677397	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE62394/GSE62394.soft.gz				0	0	False
SRR1692166	GSE63817	GSM1558079	GPL14548-GPL18945	26495981	LB RPF	Secondary structure across the bacterial transcriptome reveals versatile roles in mRNA regulation and function	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	characteristics	sample type: ribosome protected PGCGROWTHCONDITIONS	<Gtype> sample type </Gtype> : <Supp> ribosome protected </Supp> 	sample type	Genetic background	0.9943517312375272	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE63817/GSE63817.soft.gz				0	0	False
SRR1692166	GSE63817	GSM1558079	GPL14548-GPL18945	26495981	LB RPF	Secondary structure across the bacterial transcriptome reveals versatile roles in mRNA regulation and function	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	characteristics	sample type: ribosome protected PGCGROWTHCONDITIONS	<Gtype> sample type </Gtype> : <Supp> ribosome protected </Supp> 	ribosome protected	Medium supplement	0.9943517312375272	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE63817/GSE63817.soft.gz				0	0	False
SRR1692168	GSE63817	GSM1558081	GPL14548-GPL18945	26495981	LB RPF biological replicate	Secondary structure across the bacterial transcriptome reveals versatile roles in mRNA regulation and function	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	characteristics	sample type: ribosome protected PGCGROWTHCONDITIONS	<Gtype> sample type </Gtype> : <Supp> ribosome protected </Supp> 	sample type	Genetic background	0.9943517312375272	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE63817/GSE63817.soft.gz				0	0	False
SRR1692168	GSE63817	GSM1558081	GPL14548-GPL18945	26495981	LB RPF biological replicate	Secondary structure across the bacterial transcriptome reveals versatile roles in mRNA regulation and function	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	characteristics	sample type: ribosome protected PGCGROWTHCONDITIONS	<Gtype> sample type </Gtype> : <Supp> ribosome protected </Supp> 	ribosome protected	Medium supplement	0.9943517312375272	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE63817/GSE63817.soft.gz				0	0	False
SRR1692173	GSE63817	GSM1558086	GPL14548-GPL18945	26495981	AT1 biological replicate	Secondary structure across the bacterial transcriptome reveals versatile roles in mRNA regulation and function	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	characteristics	sample type: AT1 digested total RNA PGCGROWTHCONDITIONS	<Gtype> sample type </Gtype> : <Gtype> AT1 digested total RNA </Gtype> 	sample type	Genetic background	0.9951175022966464	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE63817/GSE63817.soft.gz				0	0	False
SRR1692173	GSE63817	GSM1558086	GPL14548-GPL18945	26495981	AT1 biological replicate	Secondary structure across the bacterial transcriptome reveals versatile roles in mRNA regulation and function	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL18945: Illumina Genome Analyzer IIx (Escherichia coli)	characteristics	sample type: AT1 digested total RNA PGCGROWTHCONDITIONS	<Gtype> sample type </Gtype> : <Gtype> AT1 digested total RNA </Gtype> 	AT1 digested total RNA	Genetic background	0.9951175022966464	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE63817/GSE63817.soft.gz				0	0	False
SRR1787596	GSE65642	GSM1602353	GPL16085	29394395	Δcra glucose 1	Systems approach elucidates convoluted transcriptional regulation on carbon metabolism [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	Δcra_glucose PGCGROWTHCONDITIONS	<Gtype> Δcra </Gtype> _ <Supp> glucose </Supp> 	Δcra	Genetic background	0.9984800278282644	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz				0	0	False
SRR1787596	GSE65642	GSM1602353	GPL16085	29394395	Δcra glucose 1	Systems approach elucidates convoluted transcriptional regulation on carbon metabolism [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	genotype/variation: delta_cra PGCGROWTHCONDITIONS	genotype/variation : <Gtype> delta _ cra </Gtype> 	delta _ cra	Genetic background	0.9919145476495104	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz				0	0	False
SRR1787597	GSE65642	GSM1602354	GPL16085	29394395	Δcra glucose 2	Systems approach elucidates convoluted transcriptional regulation on carbon metabolism [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	Δcra_glucose PGCGROWTHCONDITIONS	<Gtype> Δcra </Gtype> _ <Supp> glucose </Supp> 	Δcra	Genetic background	0.9984800278282644	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz				0	0	False
SRR1787597	GSE65642	GSM1602354	GPL16085	29394395	Δcra glucose 2	Systems approach elucidates convoluted transcriptional regulation on carbon metabolism [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	genotype/variation: delta_cra PGCGROWTHCONDITIONS	genotype/variation : <Gtype> delta _ cra </Gtype> 	delta _ cra	Genetic background	0.9919145476495104	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz				0	0	False
SRR1787598	GSE65642	GSM1602355	GPL16085	29394395	Δcra fructose 1	Systems approach elucidates convoluted transcriptional regulation on carbon metabolism [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	Δcra_fructose PGCGROWTHCONDITIONS	<Gtype> Δcra </Gtype> _ <Supp> fructose </Supp> 	Δcra	Genetic background	0.9987998071100834	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz				0	0	False
SRR1787598	GSE65642	GSM1602355	GPL16085	29394395	Δcra fructose 1	Systems approach elucidates convoluted transcriptional regulation on carbon metabolism [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	genotype/variation: delta_cra PGCGROWTHCONDITIONS	genotype/variation : <Gtype> delta _ cra </Gtype> 	delta _ cra	Genetic background	0.9919145476495104	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz				0	0	False
SRR1787599	GSE65642	GSM1602356	GPL16085	29394395	Δcra fructose 2	Systems approach elucidates convoluted transcriptional regulation on carbon metabolism [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	Δcra_fructose PGCGROWTHCONDITIONS	<Gtype> Δcra </Gtype> _ <Supp> fructose </Supp> 	Δcra	Genetic background	0.9987998071100834	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz				0	0	False
SRR1787599	GSE65642	GSM1602356	GPL16085	29394395	Δcra fructose 2	Systems approach elucidates convoluted transcriptional regulation on carbon metabolism [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	genotype/variation: delta_cra PGCGROWTHCONDITIONS	genotype/variation : <Gtype> delta _ cra </Gtype> 	delta _ cra	Genetic background	0.9919145476495104	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz				0	0	False
SRR1787600	GSE65642	GSM1602357	GPL16085	29394395	Δcra acetate 1	Systems approach elucidates convoluted transcriptional regulation on carbon metabolism [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	Δcra_acetate PGCGROWTHCONDITIONS	<Gtype> Δcra </Gtype> _ <Supp> acetate </Supp> 	Δcra	Genetic background	0.9988295172819318	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz				0	0	False
SRR1787600	GSE65642	GSM1602357	GPL16085	29394395	Δcra acetate 1	Systems approach elucidates convoluted transcriptional regulation on carbon metabolism [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	genotype/variation: delta_cra PGCGROWTHCONDITIONS	genotype/variation : <Gtype> delta _ cra </Gtype> 	delta _ cra	Genetic background	0.9919145476495104	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz				0	0	False
SRR1787601	GSE65642	GSM1602358	GPL16085	29394395	Δcra acetate 2	Systems approach elucidates convoluted transcriptional regulation on carbon metabolism [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	Δcra_acetate PGCGROWTHCONDITIONS	<Gtype> Δcra </Gtype> _ <Supp> acetate </Supp> 	Δcra	Genetic background	0.9988295172819318	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz				0	0	False
SRR1787601	GSE65642	GSM1602358	GPL16085	29394395	Δcra acetate 2	Systems approach elucidates convoluted transcriptional regulation on carbon metabolism [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	genotype/variation: delta_cra PGCGROWTHCONDITIONS	genotype/variation : <Gtype> delta _ cra </Gtype> 	delta _ cra	Genetic background	0.9919145476495104	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65642/GSE65642.soft.gz				0	0	False
SRR1796598	GSE65711	GSM1603386	GPL16085	26279566	WT PQ 1	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	WT PQ PGCGROWTHCONDITIONS	<Gtype> WT </Gtype> <Supp> PQ </Supp> 	PQ	Medium supplement	0.9989534470521982	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796598	GSE65711	GSM1603386	GPL16085	26279566	WT PQ 1	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	treated with: 250 uM of paraquat at mid-log pahse for 20 min PGCGROWTHCONDITIONS	treated with : <Supp> 250 uM of paraquat </Supp> at mid-log pahse for <Supp> 20 min </Supp> 	20 min	Medium supplement	0.9153173676430576	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796599	GSE65711	GSM1603387	GPL16085	26279566	WT PQ 2	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	WT PQ PGCGROWTHCONDITIONS	<Gtype> WT </Gtype> <Supp> PQ </Supp> 	PQ	Medium supplement	0.9989534470521982	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796599	GSE65711	GSM1603387	GPL16085	26279566	WT PQ 2	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	treated with: 250 uM of paraquat at mid-log pahse for 20 min PGCGROWTHCONDITIONS	treated with : <Supp> 250 uM of paraquat </Supp> at mid-log pahse for <Supp> 20 min </Supp> 	20 min	Medium supplement	0.9153173676430576	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796600	GSE65711	GSM1603388	GPL16085	26279566	ΔoxyR PQ 1	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	ΔoxyR PQ PGCGROWTHCONDITIONS	<Gtype> ΔoxyR </Gtype> <Supp> PQ </Supp> 	ΔoxyR	Genetic background	0.9865934038895116	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796600	GSE65711	GSM1603388	GPL16085	26279566	ΔoxyR PQ 1	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	ΔoxyR PQ PGCGROWTHCONDITIONS	<Gtype> ΔoxyR </Gtype> <Supp> PQ </Supp> 	PQ	Medium supplement	0.9950306162256752	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796600	GSE65711	GSM1603388	GPL16085	26279566	ΔoxyR PQ 1	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	genotype/variation: delta-oxyR PGCGROWTHCONDITIONS	genotype/variation : <Gtype> delta-oxyR </Gtype> 	delta-oxyR	Genetic background	0.9851988129416002	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796600	GSE65711	GSM1603388	GPL16085	26279566	ΔoxyR PQ 1	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	treated with: 250 uM of paraquat at mid-log pahse for 20 min PGCGROWTHCONDITIONS	treated with : <Supp> 250 uM of paraquat </Supp> at mid-log pahse for <Supp> 20 min </Supp> 	20 min	Medium supplement	0.9153173676430576	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796601	GSE65711	GSM1603389	GPL16085	26279566	ΔoxyR PQ 2	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	ΔoxyR PQ PGCGROWTHCONDITIONS	<Gtype> ΔoxyR </Gtype> <Supp> PQ </Supp> 	ΔoxyR	Genetic background	0.9865934038895116	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796601	GSE65711	GSM1603389	GPL16085	26279566	ΔoxyR PQ 2	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	ΔoxyR PQ PGCGROWTHCONDITIONS	<Gtype> ΔoxyR </Gtype> <Supp> PQ </Supp> 	PQ	Medium supplement	0.9950306162256752	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796601	GSE65711	GSM1603389	GPL16085	26279566	ΔoxyR PQ 2	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	genotype/variation: delta-oxyR PGCGROWTHCONDITIONS	genotype/variation : <Gtype> delta-oxyR </Gtype> 	delta-oxyR	Genetic background	0.9851988129416002	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796601	GSE65711	GSM1603389	GPL16085	26279566	ΔoxyR PQ 2	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	treated with: 250 uM of paraquat at mid-log pahse for 20 min PGCGROWTHCONDITIONS	treated with : <Supp> 250 uM of paraquat </Supp> at mid-log pahse for <Supp> 20 min </Supp> 	20 min	Medium supplement	0.9153173676430576	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796603	GSE65711	GSM1603391	GPL16085	26279566	ΔsoxR PQ 2	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	ΔsoxR PQ PGCGROWTHCONDITIONS	<Gtype> ΔsoxR </Gtype> <Supp> PQ </Supp> 	ΔsoxR	Genetic background	0.9684055062251112	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796603	GSE65711	GSM1603391	GPL16085	26279566	ΔsoxR PQ 2	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	ΔsoxR PQ PGCGROWTHCONDITIONS	<Gtype> ΔsoxR </Gtype> <Supp> PQ </Supp> 	PQ	Medium supplement	0.9950326974701604	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796603	GSE65711	GSM1603391	GPL16085	26279566	ΔsoxR PQ 2	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	genotype/variation: delta-soxR PGCGROWTHCONDITIONS	genotype/variation : <Gtype> delta-soxR </Gtype> 	delta-soxR	Genetic background	0.9851988129416002	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796603	GSE65711	GSM1603391	GPL16085	26279566	ΔsoxR PQ 2	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	treated with: 250 uM of paraquat at mid-log pahse for 20 min PGCGROWTHCONDITIONS	treated with : <Supp> 250 uM of paraquat </Supp> at mid-log pahse for <Supp> 20 min </Supp> 	20 min	Medium supplement	0.9153173676430576	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796604	GSE65711	GSM1603392	GPL16085	26279566	ΔsoxS PQ 1	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	ΔsoxS PQ PGCGROWTHCONDITIONS	<Gtype> ΔsoxS </Gtype> <Supp> PQ </Supp> 	ΔsoxS	Genetic background	0.9807742004620774	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796604	GSE65711	GSM1603392	GPL16085	26279566	ΔsoxS PQ 1	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	ΔsoxS PQ PGCGROWTHCONDITIONS	<Gtype> ΔsoxS </Gtype> <Supp> PQ </Supp> 	PQ	Medium supplement	0.9950312821181968	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796604	GSE65711	GSM1603392	GPL16085	26279566	ΔsoxS PQ 1	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	genotype/variation: delta-soxS PGCGROWTHCONDITIONS	genotype/variation : <Gtype> delta-soxS </Gtype> 	delta-soxS	Genetic background	0.9851988129416002	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796604	GSE65711	GSM1603392	GPL16085	26279566	ΔsoxS PQ 1	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	treated with: 250 uM of paraquat at mid-log pahse for 20 min PGCGROWTHCONDITIONS	treated with : <Supp> 250 uM of paraquat </Supp> at mid-log pahse for <Supp> 20 min </Supp> 	20 min	Medium supplement	0.9153173676430576	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796605	GSE65711	GSM1603393	GPL16085	26279566	ΔsoxS PQ 2	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	ΔsoxS PQ PGCGROWTHCONDITIONS	<Gtype> ΔsoxS </Gtype> <Supp> PQ </Supp> 	ΔsoxS	Genetic background	0.9807742004620774	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796605	GSE65711	GSM1603393	GPL16085	26279566	ΔsoxS PQ 2	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	ΔsoxS PQ PGCGROWTHCONDITIONS	<Gtype> ΔsoxS </Gtype> <Supp> PQ </Supp> 	PQ	Medium supplement	0.9950312821181968	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796605	GSE65711	GSM1603393	GPL16085	26279566	ΔsoxS PQ 2	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	genotype/variation: delta-soxS PGCGROWTHCONDITIONS	genotype/variation : <Gtype> delta-soxS </Gtype> 	delta-soxS	Genetic background	0.9851988129416002	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1796605	GSE65711	GSM1603393	GPL16085	26279566	ΔsoxS PQ 2	Genome-wide OxyR and SoxRS transcriptional regulatory networks coordinate complex cellular responses to oxidative stress [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	treated with: 250 uM of paraquat at mid-log pahse for 20 min PGCGROWTHCONDITIONS	treated with : <Supp> 250 uM of paraquat </Supp> at mid-log pahse for <Supp> 20 min </Supp> 	20 min	Medium supplement	0.9153173676430576	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE65711/GSE65711.soft.gz				0	0	False
SRR1824557	GSE66481	GSM1623160	GPL16085	26258987	WT pH5.5 1	Decoding genome-wide GadEWX transcriptional regulatory networks reveals a multifaceted cellular response to acid stress in Escherichia coli [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	WT pH5.5 PGCGROWTHCONDITIONS	<Gtype> WT </Gtype> <pH> pH5 .5 </pH> 	pH5 .5	pH	0.996851877306959	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz				0	0	False
SRR1824558	GSE66481	GSM1623161	GPL16085	26258987	WT pH5.5 2	Decoding genome-wide GadEWX transcriptional regulatory networks reveals a multifaceted cellular response to acid stress in Escherichia coli [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	WT pH5.5 PGCGROWTHCONDITIONS	<Gtype> WT </Gtype> <pH> pH5 .5 </pH> 	pH5 .5	pH	0.996851877306959	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz				0	0	False
SRR1824559	GSE66481	GSM1623162	GPL16085	26258987	ΔgadE pH5.5 1	Decoding genome-wide GadEWX transcriptional regulatory networks reveals a multifaceted cellular response to acid stress in Escherichia coli [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	ΔgadE pH5.5 PGCGROWTHCONDITIONS	<Gtype> ΔgadE </Gtype> <pH> pH5 .5 </pH> 	ΔgadE	Genetic background	0.9914557981731402	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz				0	0	False
SRR1824559	GSE66481	GSM1623162	GPL16085	26258987	ΔgadE pH5.5 1	Decoding genome-wide GadEWX transcriptional regulatory networks reveals a multifaceted cellular response to acid stress in Escherichia coli [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	ΔgadE pH5.5 PGCGROWTHCONDITIONS	<Gtype> ΔgadE </Gtype> <pH> pH5 .5 </pH> 	pH5 .5	pH	0.9985488349177052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz				0	0	False
SRR1824559	GSE66481	GSM1623162	GPL16085	26258987	ΔgadE pH5.5 1	Decoding genome-wide GadEWX transcriptional regulatory networks reveals a multifaceted cellular response to acid stress in Escherichia coli [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	genotype/variation: delta-gadE PGCGROWTHCONDITIONS	genotype/variation : <Gtype> delta-gadE </Gtype> 	delta-gadE	Genetic background	0.9851988129416002	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz				0	0	False
SRR1824560	GSE66481	GSM1623163	GPL16085	26258987	ΔgadE pH5.5 2	Decoding genome-wide GadEWX transcriptional regulatory networks reveals a multifaceted cellular response to acid stress in Escherichia coli [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	ΔgadE pH5.5 PGCGROWTHCONDITIONS	<Gtype> ΔgadE </Gtype> <pH> pH5 .5 </pH> 	ΔgadE	Genetic background	0.9914557981731402	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz				0	0	False
SRR1824560	GSE66481	GSM1623163	GPL16085	26258987	ΔgadE pH5.5 2	Decoding genome-wide GadEWX transcriptional regulatory networks reveals a multifaceted cellular response to acid stress in Escherichia coli [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	ΔgadE pH5.5 PGCGROWTHCONDITIONS	<Gtype> ΔgadE </Gtype> <pH> pH5 .5 </pH> 	pH5 .5	pH	0.9985488349177052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz				0	0	False
SRR1824560	GSE66481	GSM1623163	GPL16085	26258987	ΔgadE pH5.5 2	Decoding genome-wide GadEWX transcriptional regulatory networks reveals a multifaceted cellular response to acid stress in Escherichia coli [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	genotype/variation: delta-gadE PGCGROWTHCONDITIONS	genotype/variation : <Gtype> delta-gadE </Gtype> 	delta-gadE	Genetic background	0.9851988129416002	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz				0	0	False
SRR1824561	GSE66481	GSM1623164	GPL16085	26258987	ΔgadW pH5.5 1	Decoding genome-wide GadEWX transcriptional regulatory networks reveals a multifaceted cellular response to acid stress in Escherichia coli [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	ΔgadW pH5.5 PGCGROWTHCONDITIONS	<Gtype> ΔgadW </Gtype> <pH> pH5 .5 </pH> 	ΔgadW	Genetic background	0.9887739478165708	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz				0	0	False
SRR1824561	GSE66481	GSM1623164	GPL16085	26258987	ΔgadW pH5.5 1	Decoding genome-wide GadEWX transcriptional regulatory networks reveals a multifaceted cellular response to acid stress in Escherichia coli [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	ΔgadW pH5.5 PGCGROWTHCONDITIONS	<Gtype> ΔgadW </Gtype> <pH> pH5 .5 </pH> 	pH5 .5	pH	0.99855134891445	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz				0	0	False
SRR1824561	GSE66481	GSM1623164	GPL16085	26258987	ΔgadW pH5.5 1	Decoding genome-wide GadEWX transcriptional regulatory networks reveals a multifaceted cellular response to acid stress in Escherichia coli [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	genotype/variation: delta-gadW PGCGROWTHCONDITIONS	genotype/variation : <Gtype> delta-gadW </Gtype> 	delta-gadW	Genetic background	0.9851988129416002	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz				0	0	False
SRR1824562	GSE66481	GSM1623165	GPL16085	26258987	ΔgadW pH5.5 2	Decoding genome-wide GadEWX transcriptional regulatory networks reveals a multifaceted cellular response to acid stress in Escherichia coli [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	ΔgadW pH5.5 PGCGROWTHCONDITIONS	<Gtype> ΔgadW </Gtype> <pH> pH5 .5 </pH> 	ΔgadW	Genetic background	0.9887739478165708	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz				0	0	False
SRR1824562	GSE66481	GSM1623165	GPL16085	26258987	ΔgadW pH5.5 2	Decoding genome-wide GadEWX transcriptional regulatory networks reveals a multifaceted cellular response to acid stress in Escherichia coli [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	ΔgadW pH5.5 PGCGROWTHCONDITIONS	<Gtype> ΔgadW </Gtype> <pH> pH5 .5 </pH> 	pH5 .5	pH	0.99855134891445	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz				0	0	False
SRR1824562	GSE66481	GSM1623165	GPL16085	26258987	ΔgadW pH5.5 2	Decoding genome-wide GadEWX transcriptional regulatory networks reveals a multifaceted cellular response to acid stress in Escherichia coli [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	genotype/variation: delta-gadW PGCGROWTHCONDITIONS	genotype/variation : <Gtype> delta-gadW </Gtype> 	delta-gadW	Genetic background	0.9851988129416002	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz				0	0	False
SRR1824563	GSE66481	GSM1623166	GPL16085	26258987	ΔgadX pH5.5 1	Decoding genome-wide GadEWX transcriptional regulatory networks reveals a multifaceted cellular response to acid stress in Escherichia coli [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	ΔgadX pH5.5 PGCGROWTHCONDITIONS	<Gtype> ΔgadX </Gtype> <pH> pH5 .5 </pH> 	ΔgadX	Genetic background	0.9887739478165708	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz				0	0	False
SRR1824563	GSE66481	GSM1623166	GPL16085	26258987	ΔgadX pH5.5 1	Decoding genome-wide GadEWX transcriptional regulatory networks reveals a multifaceted cellular response to acid stress in Escherichia coli [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	ΔgadX pH5.5 PGCGROWTHCONDITIONS	<Gtype> ΔgadX </Gtype> <pH> pH5 .5 </pH> 	pH5 .5	pH	0.99855134891445	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz				0	0	False
SRR1824563	GSE66481	GSM1623166	GPL16085	26258987	ΔgadX pH5.5 1	Decoding genome-wide GadEWX transcriptional regulatory networks reveals a multifaceted cellular response to acid stress in Escherichia coli [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	genotype/variation: delta-gadX PGCGROWTHCONDITIONS	genotype/variation : <Gtype> delta-gadX </Gtype> 	delta-gadX	Genetic background	0.9851988129416002	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz				0	0	False
SRR1824564	GSE66481	GSM1623167	GPL16085	26258987	ΔgadX pH5.5 2	Decoding genome-wide GadEWX transcriptional regulatory networks reveals a multifaceted cellular response to acid stress in Escherichia coli [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	ΔgadX pH5.5 PGCGROWTHCONDITIONS	<Gtype> ΔgadX </Gtype> <pH> pH5 .5 </pH> 	ΔgadX	Genetic background	0.9887739478165708	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz				0	0	False
SRR1824564	GSE66481	GSM1623167	GPL16085	26258987	ΔgadX pH5.5 2	Decoding genome-wide GadEWX transcriptional regulatory networks reveals a multifaceted cellular response to acid stress in Escherichia coli [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	source_name	ΔgadX pH5.5 PGCGROWTHCONDITIONS	<Gtype> ΔgadX </Gtype> <pH> pH5 .5 </pH> 	pH5 .5	pH	0.99855134891445	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz				0	0	False
SRR1824564	GSE66481	GSM1623167	GPL16085	26258987	ΔgadX pH5.5 2	Decoding genome-wide GadEWX transcriptional regulatory networks reveals a multifaceted cellular response to acid stress in Escherichia coli [RNA-seq]	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	genotype/variation: delta-gadX PGCGROWTHCONDITIONS	genotype/variation : <Gtype> delta-gadX </Gtype> 	delta-gadX	Genetic background	0.9851988129416002	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE66481/GSE66481.soft.gz				0	0	False
SRR1927169	GSE67218	GSM1642593	GPL17439		RNA-seq 37C LB rep1	Transcriptional expression level of E. coli at 37 ℃ in LB media	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz				0	0	False
SRR1927169	GSE67218	GSM1642593	GPL17439		RNA-seq 37C LB rep1	Transcriptional expression level of E. coli at 37 ℃ in LB media	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz				0	0	False
SRR1927169	GSE67218	GSM1642593	GPL17439		RNA-seq 37C LB rep1	Transcriptional expression level of E. coli at 37 ℃ in LB media	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz				0	0	False
SRR1927169	GSE67218	GSM1642593	GPL17439		RNA-seq 37C LB rep1	Transcriptional expression level of E. coli at 37 ℃ in LB media	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz				0	0	False
SRR1927169	GSE67218	GSM1642593	GPL17439		RNA-seq 37C LB rep1	Transcriptional expression level of E. coli at 37 ℃ in LB media	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	cell type: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	<Gtype> cell type </Gtype> : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9108451632358671	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz				0	0	False
SRR1927169	GSE67218	GSM1642593	GPL17439		RNA-seq 37C LB rep1	Transcriptional expression level of E. coli at 37 ℃ in LB media	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	cell type: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	<Gtype> cell type </Gtype> : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9900611541995576	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz				0	0	False
SRR1927170	GSE67218	GSM1642594	GPL17439		RNA-seq 37C LB rep2	Transcriptional expression level of E. coli at 37 ℃ in LB media	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz				0	0	False
SRR1927170	GSE67218	GSM1642594	GPL17439		RNA-seq 37C LB rep2	Transcriptional expression level of E. coli at 37 ℃ in LB media	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz				0	0	False
SRR1927170	GSE67218	GSM1642594	GPL17439		RNA-seq 37C LB rep2	Transcriptional expression level of E. coli at 37 ℃ in LB media	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz				0	0	False
SRR1927170	GSE67218	GSM1642594	GPL17439		RNA-seq 37C LB rep2	Transcriptional expression level of E. coli at 37 ℃ in LB media	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	source_name	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz				0	0	False
SRR1927170	GSE67218	GSM1642594	GPL17439		RNA-seq 37C LB rep2	Transcriptional expression level of E. coli at 37 ℃ in LB media	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	cell type: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	<Gtype> cell type </Gtype> : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9108451632358671	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz				0	0	False
SRR1927170	GSE67218	GSM1642594	GPL17439		RNA-seq 37C LB rep2	Transcriptional expression level of E. coli at 37 ℃ in LB media	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	cell type: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	<Gtype> cell type </Gtype> : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9900611541995576	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67218/GSE67218.soft.gz				0	0	False
SRR1945181	GSE67402	GSM1646283	GPL14548	26275208	Glucose time course, 3 hour time point, biological replicate 1	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 3 hours PGCGROWTHCONDITIONS	time point : <Supp> 3 hours </Supp> 	3 hours	Medium supplement	0.998768577173624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945182	GSE67402	GSM1646284	GPL14548	26275208	Glucose time course, 4 hour time point, biological replicate 1	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 4 hours PGCGROWTHCONDITIONS	time point : <Supp> 4 hours </Supp> 	4 hours	Medium supplement	0.9994489837819708	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945183SRR1945184SRR1945185	GSE67402	GSM1646285	GPL14548	26275208	Glucose time course, 5 hour time point, biological replicate 1	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 5 hours PGCGROWTHCONDITIONS	time point : <Supp> 5 hours </Supp> 	5 hours	Medium supplement	0.9995209861400952	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945187	GSE67402	GSM1646287	GPL14548	26275208	Glucose time course, 8 hour time point, biological replicate 1	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 8 hours PGCGROWTHCONDITIONS	time point : <Supp> 8 hours </Supp> 	8 hours	Medium supplement	0.9995514343770028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945188	GSE67402	GSM1646288	GPL14548	26275208	Glucose time course, 24 hour time point, biological replicate 1	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 24 hours PGCGROWTHCONDITIONS	time point : <Supp> 24 hours </Supp> 	24 hours	Medium supplement	0.9995514343770028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945189SRR1945190	GSE67402	GSM1646289	GPL14548	26275208	Glucose time course, 48 hour time point, biological replicate 1	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 48 hours PGCGROWTHCONDITIONS	time point : <Supp> 48 hours </Supp> 	48 hours	Medium supplement	0.9995514343770028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945191SRR1945193	GSE67402	GSM1646290	GPL14548	26275208	Glucose time course, 168 hour time point, biological replicate 1	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 168 hours PGCGROWTHCONDITIONS	time point : <Supp> 168 hours </Supp> 	168 hours	Medium supplement	0.9995514343770028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945194SRR1945196	GSE67402	GSM1646291	GPL14548	26275208	Glucose time course, 336 hour time point, biological replicate 1	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 336 hours PGCGROWTHCONDITIONS	time point : <Supp> 336 hours </Supp> 	336 hours	Medium supplement	0.9995514343770028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945197	GSE67402	GSM1646292	GPL14548	26275208	Glucose time course, 3 hour time point, biological replicate 2	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 3 hours PGCGROWTHCONDITIONS	time point : <Supp> 3 hours </Supp> 	3 hours	Medium supplement	0.998768577173624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945198	GSE67402	GSM1646293	GPL14548	26275208	Glucose time course, 4 hour time point, biological replicate 2	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 4 hours PGCGROWTHCONDITIONS	time point : <Supp> 4 hours </Supp> 	4 hours	Medium supplement	0.9994489837819708	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945199	GSE67402	GSM1646294	GPL14548	26275208	Glucose time course, 5 hour time point, biological replicate 2	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 5 hours PGCGROWTHCONDITIONS	time point : <Supp> 5 hours </Supp> 	5 hours	Medium supplement	0.9995209861400952	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945200	GSE67402	GSM1646295	GPL14548	26275208	Glucose time course, 6 hour time point, biological replicate 2	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 6 hours PGCGROWTHCONDITIONS	time point : <Supp> 6 hours </Supp> 	6 hours	Medium supplement	0.9995514343770028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945201	GSE67402	GSM1646296	GPL14548	26275208	Glucose time course, 8 hour time point, biological replicate 2	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 8 hours PGCGROWTHCONDITIONS	time point : <Supp> 8 hours </Supp> 	8 hours	Medium supplement	0.9995514343770028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945202	GSE67402	GSM1646297	GPL14548	26275208	Glucose time course, 24 hour time point, biological replicate 2	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 24 hours PGCGROWTHCONDITIONS	time point : <Supp> 24 hours </Supp> 	24 hours	Medium supplement	0.9995514343770028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945204	GSE67402	GSM1646298	GPL14548	26275208	Glucose time course, 48 hour time point, biological replicate 2	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 48 hours PGCGROWTHCONDITIONS	time point : <Supp> 48 hours </Supp> 	48 hours	Medium supplement	0.9995514343770028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945206	GSE67402	GSM1646300	GPL14548	26275208	Glucose time course, 336 hour time point, biological replicate 2	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 336 hours PGCGROWTHCONDITIONS	time point : <Supp> 336 hours </Supp> 	336 hours	Medium supplement	0.9995514343770028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945207SRR1945208	GSE67402	GSM1646301	GPL14548	26275208	Glucose time course, 3 hour time point, biological replicate 3	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 3 hours PGCGROWTHCONDITIONS	time point : <Supp> 3 hours </Supp> 	3 hours	Medium supplement	0.998768577173624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945210SRR1945211	GSE67402	GSM1646302	GPL14548	26275208	Glucose time course, 4 hour time point, biological replicate 3	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 4 hours PGCGROWTHCONDITIONS	time point : <Supp> 4 hours </Supp> 	4 hours	Medium supplement	0.9994489837819708	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945213SRR1945214	GSE67402	GSM1646303	GPL14548	26275208	Glucose time course, 5 hour time point, biological replicate 3	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 5 hours PGCGROWTHCONDITIONS	time point : <Supp> 5 hours </Supp> 	5 hours	Medium supplement	0.9995209861400952	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945218	GSE67402	GSM1646304	GPL14548	26275208	Glucose time course, 6 hour time point, biological replicate 3	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 6 hours PGCGROWTHCONDITIONS	time point : <Supp> 6 hours </Supp> 	6 hours	Medium supplement	0.9995514343770028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945219SRR1945220SRR1945221	GSE67402	GSM1646305	GPL14548	26275208	Glucose time course, 8 hourt ime point, biological replicate 3	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 8 hours PGCGROWTHCONDITIONS	time point : <Supp> 8 hours </Supp> 	8 hours	Medium supplement	0.9995514343770028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945222SRR1945223SRR1945224	GSE67402	GSM1646306	GPL14548	26275208	Glucose time course, 24 hour time point, biological replicate 3	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 24 hours PGCGROWTHCONDITIONS	time point : <Supp> 24 hours </Supp> 	24 hours	Medium supplement	0.9995514343770028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945227SRR1945228	GSE67402	GSM1646307	GPL14548	26275208	Glucose time course, 48 hour time point, biological replicate 3	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 48 hours PGCGROWTHCONDITIONS	time point : <Supp> 48 hours </Supp> 	48 hours	Medium supplement	0.9995514343770028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945229SRR1945230SRR1945231SRR1945232SRR1945233	GSE67402	GSM1646308	GPL14548	26275208	Glucose time course, 168 hour time point, biological replicate 3	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 168 hours PGCGROWTHCONDITIONS	time point : <Supp> 168 hours </Supp> 	168 hours	Medium supplement	0.9995514343770028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945234SRR1945235SRR1945236SRR1945237SRR1945238SRR1945239	GSE67402	GSM1646309	GPL14548	26275208	Glucose time course, 336 hour time point, biological replicate 3	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 336 hours PGCGROWTHCONDITIONS	time point : <Supp> 336 hours </Supp> 	336 hours	Medium supplement	0.9995514343770028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945240SRR1945241	GSE67402	GSM1646310	GPL14548	26275208	Glucose time course, 3 hour time point, biological replicate 3, rRNA not depleted	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 3 hours PGCGROWTHCONDITIONS	time point : <Supp> 3 hours </Supp> 	3 hours	Medium supplement	0.998768577173624	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945242SRR1945243	GSE67402	GSM1646311	GPL14548	26275208	Glucose time course, 4 hour time point, biological replicate 3, rRNA not depleted	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 4 hours PGCGROWTHCONDITIONS	time point : <Supp> 4 hours </Supp> 	4 hours	Medium supplement	0.9994489837819708	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945244SRR1945245	GSE67402	GSM1646312	GPL14548	26275208	Glucose time course, 5 hour time point, biological replicate 3, rRNA not depleted	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 5 hours PGCGROWTHCONDITIONS	time point : <Supp> 5 hours </Supp> 	5 hours	Medium supplement	0.9995209861400952	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945246SRR1945247	GSE67402	GSM1646313	GPL14548	26275208	Glucose time course, 6 hour time point, biological replicate 3, rRNA not depleted	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 6 hours PGCGROWTHCONDITIONS	time point : <Supp> 6 hours </Supp> 	6 hours	Medium supplement	0.9995514343770028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945248SRR1945249	GSE67402	GSM1646314	GPL14548	26275208	Glucose time course, 8 hourt ime point, biological replicate 3, rRNA not depleted	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 8 hours PGCGROWTHCONDITIONS	time point : <Supp> 8 hours </Supp> 	8 hours	Medium supplement	0.9995514343770028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945250SRR1945251	GSE67402	GSM1646315	GPL14548	26275208	Glucose time course, 24 hour time point, biological replicate 3, rRNA not depleted	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 24 hours PGCGROWTHCONDITIONS	time point : <Supp> 24 hours </Supp> 	24 hours	Medium supplement	0.9995514343770028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945252SRR1945253	GSE67402	GSM1646316	GPL14548	26275208	Glucose time course, 48 hour time point, biological replicate 3, rRNA not depleted	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 48 hours PGCGROWTHCONDITIONS	time point : <Supp> 48 hours </Supp> 	48 hours	Medium supplement	0.9995514343770028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945255	GSE67402	GSM1646317	GPL14548	26275208	Glucose time course, 168 hour time point, biological replicate 3, rRNA not depleted	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 168 hours PGCGROWTHCONDITIONS	time point : <Supp> 168 hours </Supp> 	168 hours	Medium supplement	0.9995514343770028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR1945256SRR1945257	GSE67402	GSM1646318	GPL14548	26275208	Glucose time course, 336 hour time point, biological replicate 3, rRNA not depleted	Controlled measurement and comparative analysis of cellular components in E. coli reveals broad regulatory changes under long-term starvation	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	time point: 336 hours PGCGROWTHCONDITIONS	time point : <Supp> 336 hours </Supp> 	336 hours	Medium supplement	0.9995514343770028	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE67402/GSE67402.soft.gz				0	0	False
SRR2135663	GSE71562	GSM1838496	GPL18133	273849562826451232246034	batch culture rep1, 0 min	RNA-Seq of Escherichia coli after anaerobic-aerobic transition	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 0 min PGCGROWTHCONDITIONS	time : <Supp> 0 min </Supp> 	0 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz				0	0	False
SRR2135664	GSE71562	GSM1838497	GPL18133	273849562826451232246034	batch culture rep1, 0.5 min	RNA-Seq of Escherichia coli after anaerobic-aerobic transition	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 0.5 min PGCGROWTHCONDITIONS	time : <Supp> 0.5 min </Supp> 	0.5 min	Medium supplement	0.9018131091704332	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz				0	0	False
SRR2135665	GSE71562	GSM1838498	GPL18133	273849562826451232246034	batch culture rep1, 1 min	RNA-Seq of Escherichia coli after anaerobic-aerobic transition	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 1 min PGCGROWTHCONDITIONS	time : <Supp> 1 min </Supp> 	1 min	Medium supplement	0.9963662255216618	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz				0	0	False
SRR2135666	GSE71562	GSM1838499	GPL18133	273849562826451232246034	batch culture rep1, 2 min	RNA-Seq of Escherichia coli after anaerobic-aerobic transition	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 2 min PGCGROWTHCONDITIONS	time : <Supp> 2 min </Supp> 	2 min	Medium supplement	0.9974893193795434	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz				0	0	False
SRR2135667	GSE71562	GSM1838500	GPL18133	273849562826451232246034	batch culture rep1, 5 min	RNA-Seq of Escherichia coli after anaerobic-aerobic transition	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 5 min PGCGROWTHCONDITIONS	time : <Supp> 5 min </Supp> 	5 min	Medium supplement	0.9925997083726088	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz				0	0	False
SRR2135668	GSE71562	GSM1838501	GPL18133	273849562826451232246034	batch culture rep1, 10 min	RNA-Seq of Escherichia coli after anaerobic-aerobic transition	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 10 min PGCGROWTHCONDITIONS	time : <Supp> 10 min </Supp> 	10 min	Medium supplement	0.994867209487664	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz				0	0	False
SRR2135669	GSE71562	GSM1838502	GPL18133	273849562826451232246034	batch culture rep2, 0 min	RNA-Seq of Escherichia coli after anaerobic-aerobic transition	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 0 min PGCGROWTHCONDITIONS	time : <Supp> 0 min </Supp> 	0 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz				0	0	False
SRR2135670	GSE71562	GSM1838503	GPL18133	273849562826451232246034	batch culture rep2, 0.5 min	RNA-Seq of Escherichia coli after anaerobic-aerobic transition	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 0.5 min PGCGROWTHCONDITIONS	time : <Supp> 0.5 min </Supp> 	0.5 min	Medium supplement	0.9018131091704332	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz				0	0	False
SRR2135673	GSE71562	GSM1838506	GPL18133	273849562826451232246034	batch culture rep2, 5 min	RNA-Seq of Escherichia coli after anaerobic-aerobic transition	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 5 min PGCGROWTHCONDITIONS	time : <Supp> 5 min </Supp> 	5 min	Medium supplement	0.9925997083726088	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz				0	0	False
SRR2135674	GSE71562	GSM1838507	GPL18133	273849562826451232246034	batch culture rep2, 10 min	RNA-Seq of Escherichia coli after anaerobic-aerobic transition	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 10 min PGCGROWTHCONDITIONS	time : <Supp> 10 min </Supp> 	10 min	Medium supplement	0.994867209487664	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz				0	0	False
SRR2135675	GSE71562	GSM1838508	GPL18133	273849562826451232246034	batch culture rep3, 0 min	RNA-Seq of Escherichia coli after anaerobic-aerobic transition	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 0 min PGCGROWTHCONDITIONS	time : <Supp> 0 min </Supp> 	0 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz				0	0	False
SRR2135676	GSE71562	GSM1838509	GPL18133	273849562826451232246034	batch culture rep3, 0.5 min	RNA-Seq of Escherichia coli after anaerobic-aerobic transition	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 0.5 min PGCGROWTHCONDITIONS	time : <Supp> 0.5 min </Supp> 	0.5 min	Medium supplement	0.9018131091704332	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz				0	0	False
SRR2135677	GSE71562	GSM1838510	GPL18133	273849562826451232246034	batch culture rep3, 1 min	RNA-Seq of Escherichia coli after anaerobic-aerobic transition	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 1 min PGCGROWTHCONDITIONS	time : <Supp> 1 min </Supp> 	1 min	Medium supplement	0.9963662255216618	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz				0	0	False
SRR2135678	GSE71562	GSM1838511	GPL18133	273849562826451232246034	batch culture rep3, 2 min	RNA-Seq of Escherichia coli after anaerobic-aerobic transition	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 2 min PGCGROWTHCONDITIONS	time : <Supp> 2 min </Supp> 	2 min	Medium supplement	0.9974893193795434	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz				0	0	False
SRR2135679	GSE71562	GSM1838512	GPL18133	273849562826451232246034	batch culture rep3, 5 min	RNA-Seq of Escherichia coli after anaerobic-aerobic transition	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 5 min PGCGROWTHCONDITIONS	time : <Supp> 5 min </Supp> 	5 min	Medium supplement	0.9925997083726088	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz				0	0	False
SRR2135680	GSE71562	GSM1838513	GPL18133	273849562826451232246034	batch culture rep3, 10 min	RNA-Seq of Escherichia coli after anaerobic-aerobic transition	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 10 min PGCGROWTHCONDITIONS	time : <Supp> 10 min </Supp> 	10 min	Medium supplement	0.994867209487664	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE71562/GSE71562.soft.gz				0	0	False
SRR2637697	GSE73969	GSM1906889	GPL21021	2717363528288207	hns_1	RNA-seq to profile the H-NS transcriptome in EHEC O157:H7 strain EDL933	GPL21021: Illumina HiSeq 2500 (Escherichia coli O157:H7 str. EDL933)	characteristics	genotype: {delta}hns PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- hns </Gtype> 	-LCB- delta -RCB- hns	Genetic background	0.9780596614313508	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE73969/GSE73969.soft.gz				0	0	False
SRR2637698	GSE73969	GSM1906890	GPL21021	2717363528288207	hns_2	RNA-seq to profile the H-NS transcriptome in EHEC O157:H7 strain EDL933	GPL21021: Illumina HiSeq 2500 (Escherichia coli O157:H7 str. EDL933)	characteristics	genotype: {delta}hns PGCGROWTHCONDITIONS	genotype : <Gtype> -LCB- delta -RCB- hns </Gtype> 	-LCB- delta -RCB- hns	Genetic background	0.9780596614313508	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE73969/GSE73969.soft.gz				0	0	False
SRR2932665	GSE74809	GSM1933982	GPL15982	29686109	rpoS_TS_1	Growth-phase dependent regulation of transcription by Rsd and 6S RNA	GPL15982: Illumina HiSeq 1000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE74809/GSE74809.soft.gz				0	0	False
SRR2932665	GSE74809	GSM1933982	GPL15982	29686109	rpoS_TS_1	Growth-phase dependent regulation of transcription by Rsd and 6S RNA	GPL15982: Illumina HiSeq 1000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE74809/GSE74809.soft.gz				0	0	False
SRR2932682	GSE74809	GSM1933999	GPL15982	29686109	ssrS_LS_2	Growth-phase dependent regulation of transcription by Rsd and 6S RNA	GPL15982: Illumina HiSeq 1000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE74809/GSE74809.soft.gz				0	0	False
SRR2932682	GSE74809	GSM1933999	GPL15982	29686109	ssrS_LS_2	Growth-phase dependent regulation of transcription by Rsd and 6S RNA	GPL15982: Illumina HiSeq 1000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE74809/GSE74809.soft.gz				0	0	False
SRR2982421	GSE75818	GSM1968346	GPL14548-GPL21222	27198188	WTRep1_0min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 0 min PGCGROWTHCONDITIONS	time point : <Supp> 0 min </Supp> 	0 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982422	GSE75818	GSM1968347	GPL14548-GPL21222	27198188	WTRep1_2min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 2 min PGCGROWTHCONDITIONS	time point : <Supp> 2 min </Supp> 	2 min	Medium supplement	0.9965702950341796	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982423	GSE75818	GSM1968348	GPL14548-GPL21222	27198188	WTRep1_4min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 4 min PGCGROWTHCONDITIONS	time point : <Supp> 4 min </Supp> 	4 min	Medium supplement	0.9911176659068429	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982424	GSE75818	GSM1968349	GPL14548-GPL21222	27198188	WTRep1_6min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 6 min PGCGROWTHCONDITIONS	time point : <Supp> 6 min </Supp> 	6 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982425	GSE75818	GSM1968350	GPL14548-GPL21222	27198188	WTRep1_8min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 8 min PGCGROWTHCONDITIONS	time point : <Supp> 8 min </Supp> 	8 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982426	GSE75818	GSM1968351	GPL14548-GPL21222	27198188	WTRep1_10min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 10 min PGCGROWTHCONDITIONS	time point : <Supp> 10 min </Supp> 	10 min	Medium supplement	0.994877810696014	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982427	GSE75818	GSM1968352	GPL14548-GPL21222	27198188	WTRep1_15min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 15 min PGCGROWTHCONDITIONS	time point : <Supp> 15 min </Supp> 	15 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982428	GSE75818	GSM1968353	GPL14548-GPL21222	27198188	WTRep1_20min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 20 min PGCGROWTHCONDITIONS	time point : <Supp> 20 min </Supp> 	20 min	Medium supplement	0.9994514328837144	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982429	GSE75818	GSM1968354	GPL14548-GPL21222	27198188	WTRep2_0min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 0 min PGCGROWTHCONDITIONS	time point : <Supp> 0 min </Supp> 	0 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982430	GSE75818	GSM1968355	GPL14548-GPL21222	27198188	WTRep2_2min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 2 min PGCGROWTHCONDITIONS	time point : <Supp> 2 min </Supp> 	2 min	Medium supplement	0.9965702950341796	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982431	GSE75818	GSM1968356	GPL14548-GPL21222	27198188	WTRep2_4min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 4 min PGCGROWTHCONDITIONS	time point : <Supp> 4 min </Supp> 	4 min	Medium supplement	0.9911176659068429	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982432	GSE75818	GSM1968357	GPL14548-GPL21222	27198188	WTRep2_6min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 6 min PGCGROWTHCONDITIONS	time point : <Supp> 6 min </Supp> 	6 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982433	GSE75818	GSM1968358	GPL14548-GPL21222	27198188	WTRep2_8min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 8 min PGCGROWTHCONDITIONS	time point : <Supp> 8 min </Supp> 	8 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982434	GSE75818	GSM1968359	GPL14548-GPL21222	27198188	WTRep2_10min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 10 min PGCGROWTHCONDITIONS	time point : <Supp> 10 min </Supp> 	10 min	Medium supplement	0.994877810696014	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982435	GSE75818	GSM1968360	GPL14548-GPL21222	27198188	WTRep2_15min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 15 min PGCGROWTHCONDITIONS	time point : <Supp> 15 min </Supp> 	15 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982436	GSE75818	GSM1968361	GPL14548-GPL21222	27198188	WTRep2_20min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 20 min PGCGROWTHCONDITIONS	time point : <Supp> 20 min </Supp> 	20 min	Medium supplement	0.9994514328837144	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982437	GSE75818	GSM1968362	GPL14548-GPL21222	27198188	WTKasRep1_0min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 0 min PGCGROWTHCONDITIONS	time point : <Supp> 0 min </Supp> 	0 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982439	GSE75818	GSM1968364	GPL14548-GPL21222	27198188	WTKasRep1_4min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 4 min PGCGROWTHCONDITIONS	time point : <Supp> 4 min </Supp> 	4 min	Medium supplement	0.9911176659068429	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982443	GSE75818	GSM1968368	GPL14548-GPL21222	27198188	WTKasRep1_15min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 15 min PGCGROWTHCONDITIONS	time point : <Supp> 15 min </Supp> 	15 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982444	GSE75818	GSM1968369	GPL14548-GPL21222	27198188	WTKasRep1_20min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 20 min PGCGROWTHCONDITIONS	time point : <Supp> 20 min </Supp> 	20 min	Medium supplement	0.9994514328837144	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982445	GSE75818	GSM1968370	GPL14548-GPL21222	27198188	WTKasRep2_0min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 0 min PGCGROWTHCONDITIONS	time point : <Supp> 0 min </Supp> 	0 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982446	GSE75818	GSM1968371	GPL14548-GPL21222	27198188	WTKasRep2_2min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 2 min PGCGROWTHCONDITIONS	time point : <Supp> 2 min </Supp> 	2 min	Medium supplement	0.9965702950341796	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982447	GSE75818	GSM1968372	GPL14548-GPL21222	27198188	WTKasRep2_4min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 4 min PGCGROWTHCONDITIONS	time point : <Supp> 4 min </Supp> 	4 min	Medium supplement	0.9911176659068429	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982449	GSE75818	GSM1968374	GPL14548-GPL21222	27198188	WTKasRep2_8min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 8 min PGCGROWTHCONDITIONS	time point : <Supp> 8 min </Supp> 	8 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982452	GSE75818	GSM1968377	GPL14548-GPL21222	27198188	WTKasRep2_20min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 20 min PGCGROWTHCONDITIONS	time point : <Supp> 20 min </Supp> 	20 min	Medium supplement	0.9994514328837144	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982453	GSE75818	GSM1968378	GPL14548-GPL21222	27198188	MutRep1_0min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 0 min PGCGROWTHCONDITIONS	time point : <Supp> 0 min </Supp> 	0 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982454	GSE75818	GSM1968379	GPL14548-GPL21222	27198188	MutRep1_2min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 2 min PGCGROWTHCONDITIONS	time point : <Supp> 2 min </Supp> 	2 min	Medium supplement	0.9965702950341796	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982455	GSE75818	GSM1968380	GPL14548-GPL21222	27198188	MutRep1_4min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 4 min PGCGROWTHCONDITIONS	time point : <Supp> 4 min </Supp> 	4 min	Medium supplement	0.9911176659068429	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982456	GSE75818	GSM1968381	GPL14548-GPL21222	27198188	MutRep1_6min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 6 min PGCGROWTHCONDITIONS	time point : <Supp> 6 min </Supp> 	6 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982457	GSE75818	GSM1968382	GPL14548-GPL21222	27198188	MutRep1_8min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 8 min PGCGROWTHCONDITIONS	time point : <Supp> 8 min </Supp> 	8 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982458	GSE75818	GSM1968383	GPL14548-GPL21222	27198188	MutRep1_10min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 10 min PGCGROWTHCONDITIONS	time point : <Supp> 10 min </Supp> 	10 min	Medium supplement	0.994877810696014	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982459	GSE75818	GSM1968384	GPL14548-GPL21222	27198188	MutRep1_15min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 15 min PGCGROWTHCONDITIONS	time point : <Supp> 15 min </Supp> 	15 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982460	GSE75818	GSM1968385	GPL14548-GPL21222	27198188	MutRep1_20min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 20 min PGCGROWTHCONDITIONS	time point : <Supp> 20 min </Supp> 	20 min	Medium supplement	0.9994514328837144	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982461	GSE75818	GSM1968386	GPL14548-GPL21222	27198188	MutRep2_0min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 0 min PGCGROWTHCONDITIONS	time point : <Supp> 0 min </Supp> 	0 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982462	GSE75818	GSM1968387	GPL14548-GPL21222	27198188	MutRep2_2min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 2 min PGCGROWTHCONDITIONS	time point : <Supp> 2 min </Supp> 	2 min	Medium supplement	0.9965702950341796	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982463	GSE75818	GSM1968388	GPL14548-GPL21222	27198188	MutRep2_4min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 4 min PGCGROWTHCONDITIONS	time point : <Supp> 4 min </Supp> 	4 min	Medium supplement	0.9911176659068429	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982464	GSE75818	GSM1968389	GPL14548-GPL21222	27198188	MutRep2_6min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 6 min PGCGROWTHCONDITIONS	time point : <Supp> 6 min </Supp> 	6 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982465	GSE75818	GSM1968390	GPL14548-GPL21222	27198188	MutRep2_8min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 8 min PGCGROWTHCONDITIONS	time point : <Supp> 8 min </Supp> 	8 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982466	GSE75818	GSM1968391	GPL14548-GPL21222	27198188	MutRep2_10min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 10 min PGCGROWTHCONDITIONS	time point : <Supp> 10 min </Supp> 	10 min	Medium supplement	0.994877810696014	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982467	GSE75818	GSM1968392	GPL14548-GPL21222	27198188	MutRep2_15min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 15 min PGCGROWTHCONDITIONS	time point : <Supp> 15 min </Supp> 	15 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982468	GSE75818	GSM1968393	GPL14548-GPL21222	27198188	MutRep2_20min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 20 min PGCGROWTHCONDITIONS	time point : <Supp> 20 min </Supp> 	20 min	Medium supplement	0.9994514328837144	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982469	GSE75818	GSM1968394	GPL14548-GPL21222	27198188	neo_0min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 0 min PGCGROWTHCONDITIONS	time point : <Supp> 0 min </Supp> 	0 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982470	GSE75818	GSM1968395	GPL14548-GPL21222	27198188	neo_1min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 1 min PGCGROWTHCONDITIONS	time point : <Supp> 1 min </Supp> 	1 min	Medium supplement	0.9955876529641112	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982471	GSE75818	GSM1968396	GPL14548-GPL21222	27198188	neo_2min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 2 min PGCGROWTHCONDITIONS	time point : <Supp> 2 min </Supp> 	2 min	Medium supplement	0.9965702950341796	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982472	GSE75818	GSM1968397	GPL14548-GPL21222	27198188	neo_4min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 4 min PGCGROWTHCONDITIONS	time point : <Supp> 4 min </Supp> 	4 min	Medium supplement	0.9911176659068429	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982473	GSE75818	GSM1968398	GPL14548-GPL21222	27198188	neo_6min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 6 min PGCGROWTHCONDITIONS	time point : <Supp> 6 min </Supp> 	6 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982474	GSE75818	GSM1968399	GPL14548-GPL21222	27198188	neo_8min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 8 min PGCGROWTHCONDITIONS	time point : <Supp> 8 min </Supp> 	8 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982475	GSE75818	GSM1968400	GPL14548-GPL21222	27198188	neo_10min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 10 min PGCGROWTHCONDITIONS	time point : <Supp> 10 min </Supp> 	10 min	Medium supplement	0.994877810696014	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982476	GSE75818	GSM1968401	GPL14548-GPL21222	27198188	neo_15min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 15 min PGCGROWTHCONDITIONS	time point : <Supp> 15 min </Supp> 	15 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982477	GSE75818	GSM1968402	GPL14548-GPL21222	27198188	bla_0min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 0 min PGCGROWTHCONDITIONS	time point : <Supp> 0 min </Supp> 	0 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982478	GSE75818	GSM1968403	GPL14548-GPL21222	27198188	bla_1min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 1 min PGCGROWTHCONDITIONS	time point : <Supp> 1 min </Supp> 	1 min	Medium supplement	0.9955876529641112	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982479	GSE75818	GSM1968404	GPL14548-GPL21222	27198188	bla_2min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 2 min PGCGROWTHCONDITIONS	time point : <Supp> 2 min </Supp> 	2 min	Medium supplement	0.9965702950341796	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982480	GSE75818	GSM1968405	GPL14548-GPL21222	27198188	bla_4min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 4 min PGCGROWTHCONDITIONS	time point : <Supp> 4 min </Supp> 	4 min	Medium supplement	0.9911176659068429	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982481	GSE75818	GSM1968406	GPL14548-GPL21222	27198188	bla_6min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 6 min PGCGROWTHCONDITIONS	time point : <Supp> 6 min </Supp> 	6 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982482	GSE75818	GSM1968407	GPL14548-GPL21222	27198188	bla_8min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 8 min PGCGROWTHCONDITIONS	time point : <Supp> 8 min </Supp> 	8 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982483	GSE75818	GSM1968408	GPL14548-GPL21222	27198188	bla_10min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 10 min PGCGROWTHCONDITIONS	time point : <Supp> 10 min </Supp> 	10 min	Medium supplement	0.994877810696014	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982484	GSE75818	GSM1968409	GPL14548-GPL21222	27198188	bla_15min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 15 min PGCGROWTHCONDITIONS	time point : <Supp> 15 min </Supp> 	15 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982485	GSE75818	GSM1968410	GPL14548-GPL21222	27198188	mMaple3_0min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 0 min PGCGROWTHCONDITIONS	time point : <Supp> 0 min </Supp> 	0 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982486	GSE75818	GSM1968411	GPL14548-GPL21222	27198188	mMaple3_1min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 1 min PGCGROWTHCONDITIONS	time point : <Supp> 1 min </Supp> 	1 min	Medium supplement	0.9955876529641112	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982487	GSE75818	GSM1968412	GPL14548-GPL21222	27198188	mMaple3_2min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 2 min PGCGROWTHCONDITIONS	time point : <Supp> 2 min </Supp> 	2 min	Medium supplement	0.9965702950341796	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982488	GSE75818	GSM1968413	GPL14548-GPL21222	27198188	mMaple3_4min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 4 min PGCGROWTHCONDITIONS	time point : <Supp> 4 min </Supp> 	4 min	Medium supplement	0.9911176659068429	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982489	GSE75818	GSM1968414	GPL14548-GPL21222	27198188	mMaple3_6min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 6 min PGCGROWTHCONDITIONS	time point : <Supp> 6 min </Supp> 	6 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982490	GSE75818	GSM1968415	GPL14548-GPL21222	27198188	mMaple3_8min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 8 min PGCGROWTHCONDITIONS	time point : <Supp> 8 min </Supp> 	8 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982491	GSE75818	GSM1968416	GPL14548-GPL21222	27198188	mMaple3_10min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 10 min PGCGROWTHCONDITIONS	time point : <Supp> 10 min </Supp> 	10 min	Medium supplement	0.994877810696014	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982492	GSE75818	GSM1968417	GPL14548-GPL21222	27198188	mMaple3_15min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 15 min PGCGROWTHCONDITIONS	time point : <Supp> 15 min </Supp> 	15 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982493	GSE75818	GSM1968418	GPL14548-GPL21222	27198188	phoA_0min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 0 min PGCGROWTHCONDITIONS	time point : <Supp> 0 min </Supp> 	0 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982494	GSE75818	GSM1968419	GPL14548-GPL21222	27198188	phoA_1min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 1 min PGCGROWTHCONDITIONS	time point : <Supp> 1 min </Supp> 	1 min	Medium supplement	0.9955876529641112	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982495	GSE75818	GSM1968420	GPL14548-GPL21222	27198188	phoA_2min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 2 min PGCGROWTHCONDITIONS	time point : <Supp> 2 min </Supp> 	2 min	Medium supplement	0.9965702950341796	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982496	GSE75818	GSM1968421	GPL14548-GPL21222	27198188	phoA_4min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 4 min PGCGROWTHCONDITIONS	time point : <Supp> 4 min </Supp> 	4 min	Medium supplement	0.9911176659068429	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982497	GSE75818	GSM1968422	GPL14548-GPL21222	27198188	phoA_6min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 6 min PGCGROWTHCONDITIONS	time point : <Supp> 6 min </Supp> 	6 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982498	GSE75818	GSM1968423	GPL14548-GPL21222	27198188	phoA_8min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 8 min PGCGROWTHCONDITIONS	time point : <Supp> 8 min </Supp> 	8 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982499	GSE75818	GSM1968424	GPL14548-GPL21222	27198188	phoA_10min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 10 min PGCGROWTHCONDITIONS	time point : <Supp> 10 min </Supp> 	10 min	Medium supplement	0.994877810696014	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982500	GSE75818	GSM1968425	GPL14548-GPL21222	27198188	phoA_15min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 15 min PGCGROWTHCONDITIONS	time point : <Supp> 15 min </Supp> 	15 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982501	GSE75818	GSM1968426	GPL14548-GPL21222	27198188	lacZ_0min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 0 min PGCGROWTHCONDITIONS	time point : <Supp> 0 min </Supp> 	0 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982502	GSE75818	GSM1968427	GPL14548-GPL21222	27198188	lacZ_1min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 1 min PGCGROWTHCONDITIONS	time point : <Supp> 1 min </Supp> 	1 min	Medium supplement	0.9955876529641112	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982503	GSE75818	GSM1968428	GPL14548-GPL21222	27198188	lacZ_2min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 2 min PGCGROWTHCONDITIONS	time point : <Supp> 2 min </Supp> 	2 min	Medium supplement	0.9965702950341796	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982504	GSE75818	GSM1968429	GPL14548-GPL21222	27198188	lacZ_4min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 4 min PGCGROWTHCONDITIONS	time point : <Supp> 4 min </Supp> 	4 min	Medium supplement	0.9911176659068429	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982505	GSE75818	GSM1968430	GPL14548-GPL21222	27198188	lacZ_6min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 6 min PGCGROWTHCONDITIONS	time point : <Supp> 6 min </Supp> 	6 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982506	GSE75818	GSM1968431	GPL14548-GPL21222	27198188	lacZ_8min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 8 min PGCGROWTHCONDITIONS	time point : <Supp> 8 min </Supp> 	8 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982507	GSE75818	GSM1968432	GPL14548-GPL21222	27198188	lacZ_10min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 10 min PGCGROWTHCONDITIONS	time point : <Supp> 10 min </Supp> 	10 min	Medium supplement	0.994877810696014	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR2982508	GSE75818	GSM1968433	GPL14548-GPL21222	27198188	lacZ_15min	Spatial organization shapes the turnover of a bacterial transcriptome	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	time point: 15 min PGCGROWTHCONDITIONS	time point : <Supp> 15 min </Supp> 	15 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE75818/GSE75818.soft.gz				0	0	False
SRR3103785	GSE76916	GSM2040687	GPL15010		Vector rep1	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	The program Rockhopper (described in Mc Clure, et al. Nucleic Acids Research. 2013, 41(14)) was used for alignment, normalization, and quantification. Genome_builg: K-12 subst. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	The program Rockhopper ( described in Mc Clure , et al. . Nucleic Acids Research . 2013 , 41 ( 14 ) ) was used for alignment , normalization , and quantification . Genome _ builg : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9226368112385166	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103785	GSE76916	GSM2040687	GPL15010		Vector rep1	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 subst. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9226376557952822	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103785	GSE76916	GSM2040687	GPL15010		Vector rep1	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103785	GSE76916	GSM2040687	GPL15010		Vector rep1	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103785	GSE76916	GSM2040687	GPL15010		Vector rep1	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: delta dicF, lacIq PGCGROWTHCONDITIONS	genotype : <Gtype> delta dicF , lacIq </Gtype> 	delta dicF , lacIq	Genetic background	0.9300878447954334	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103785	GSE76916	GSM2040687	GPL15010		Vector rep1	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	protocol: vector control PGCGROWTHCONDITIONS	protocol : <Gtype> vector control </Gtype> 	vector control	Genetic background	0.987338674585693	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103786	GSE76916	GSM2040688	GPL15010		Vector rep2	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	The program Rockhopper (described in Mc Clure, et al. Nucleic Acids Research. 2013, 41(14)) was used for alignment, normalization, and quantification. Genome_builg: K-12 subst. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	The program Rockhopper ( described in Mc Clure , et al. . Nucleic Acids Research . 2013 , 41 ( 14 ) ) was used for alignment , normalization , and quantification . Genome _ builg : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9226368112385166	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103786	GSE76916	GSM2040688	GPL15010		Vector rep2	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 subst. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9226376557952822	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103786	GSE76916	GSM2040688	GPL15010		Vector rep2	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103786	GSE76916	GSM2040688	GPL15010		Vector rep2	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103786	GSE76916	GSM2040688	GPL15010		Vector rep2	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: delta dicF, lacIq PGCGROWTHCONDITIONS	genotype : <Gtype> delta dicF , lacIq </Gtype> 	delta dicF , lacIq	Genetic background	0.9300878447954334	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103786	GSE76916	GSM2040688	GPL15010		Vector rep2	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	protocol: vector control PGCGROWTHCONDITIONS	protocol : <Gtype> vector control </Gtype> 	vector control	Genetic background	0.987338674585693	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103787	GSE76916	GSM2040689	GPL15010		Vector rep3	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	The program Rockhopper (described in Mc Clure, et al. Nucleic Acids Research. 2013, 41(14)) was used for alignment, normalization, and quantification. Genome_builg: K-12 subst. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	The program Rockhopper ( described in Mc Clure , et al. . Nucleic Acids Research . 2013 , 41 ( 14 ) ) was used for alignment , normalization , and quantification . Genome _ builg : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9226368112385166	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103787	GSE76916	GSM2040689	GPL15010		Vector rep3	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 subst. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9226376557952822	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103787	GSE76916	GSM2040689	GPL15010		Vector rep3	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103787	GSE76916	GSM2040689	GPL15010		Vector rep3	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103787	GSE76916	GSM2040689	GPL15010		Vector rep3	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: delta dicF, lacIq PGCGROWTHCONDITIONS	genotype : <Gtype> delta dicF , lacIq </Gtype> 	delta dicF , lacIq	Genetic background	0.9300878447954334	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103787	GSE76916	GSM2040689	GPL15010		Vector rep3	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	protocol: vector control PGCGROWTHCONDITIONS	protocol : <Gtype> vector control </Gtype> 	vector control	Genetic background	0.987338674585693	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103788	GSE76916	GSM2040690	GPL15010		DicF rep1	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	The program Rockhopper (described in Mc Clure, et al. Nucleic Acids Research. 2013, 41(14)) was used for alignment, normalization, and quantification. Genome_builg: K-12 subst. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	The program Rockhopper ( described in Mc Clure , et al. . Nucleic Acids Research . 2013 , 41 ( 14 ) ) was used for alignment , normalization , and quantification . Genome _ builg : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9226368112385166	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103788	GSE76916	GSM2040690	GPL15010		DicF rep1	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 subst. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9226376557952822	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103788	GSE76916	GSM2040690	GPL15010		DicF rep1	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103788	GSE76916	GSM2040690	GPL15010		DicF rep1	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103788	GSE76916	GSM2040690	GPL15010		DicF rep1	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: delta dicF, lacIq PGCGROWTHCONDITIONS	genotype : <Gtype> delta dicF , lacIq </Gtype> 	delta dicF , lacIq	Genetic background	0.9300878447954334	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103789	GSE76916	GSM2040691	GPL15010		DicF rep2	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	The program Rockhopper (described in Mc Clure, et al. Nucleic Acids Research. 2013, 41(14)) was used for alignment, normalization, and quantification. Genome_builg: K-12 subst. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	The program Rockhopper ( described in Mc Clure , et al. . Nucleic Acids Research . 2013 , 41 ( 14 ) ) was used for alignment , normalization , and quantification . Genome _ builg : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9226368112385166	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103789	GSE76916	GSM2040691	GPL15010		DicF rep2	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 subst. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9226376557952822	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103789	GSE76916	GSM2040691	GPL15010		DicF rep2	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103789	GSE76916	GSM2040691	GPL15010		DicF rep2	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103789	GSE76916	GSM2040691	GPL15010		DicF rep2	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: delta dicF, lacIq PGCGROWTHCONDITIONS	genotype : <Gtype> delta dicF , lacIq </Gtype> 	delta dicF , lacIq	Genetic background	0.9300878447954334	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103790	GSE76916	GSM2040692	GPL15010		DicF rep3	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	The program Rockhopper (described in Mc Clure, et al. Nucleic Acids Research. 2013, 41(14)) was used for alignment, normalization, and quantification. Genome_builg: K-12 subst. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	The program Rockhopper ( described in Mc Clure , et al. . Nucleic Acids Research . 2013 , 41 ( 14 ) ) was used for alignment , normalization , and quantification . Genome _ builg : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9226368112385166	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103790	GSE76916	GSM2040692	GPL15010		DicF rep3	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: K-12 subst. MG1655 genome (NC_000913.3)/ASM584v1 PGCGROWTHCONDITIONS	Genome _ build : <Strain> K-12 </Strain> subst . MG1655 genome ( NC _ <Gtype> 000913.3 ) / ASM584v1 </Gtype> 	K-12	Organism	0.9226376557952822	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103790	GSE76916	GSM2040692	GPL15010		DicF rep3	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103790	GSE76916	GSM2040692	GPL15010		DicF rep3	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR3103790	GSE76916	GSM2040692	GPL15010		DicF rep3	Gene expression changes during overexpression of bacterial small RNA, DicF	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: delta dicF, lacIq PGCGROWTHCONDITIONS	genotype : <Gtype> delta dicF , lacIq </Gtype> 	delta dicF , lacIq	Genetic background	0.9300878447954334	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE76916/GSE76916.soft.gz				0	0	False
SRR5186139	GSE77617	GSM2462936	GPL14548-GPL21433	28139975	mRNA-seq 37°C in WT with control plasmid	Operon mRNAs are organized into ORF-centric structures that predict translation efficiency	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21433: Illumina HiSeq 4000 (Escherichia coli)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE77617/GSE77617.soft.gz				0	0	False
SRR5186139	GSE77617	GSM2462936	GPL14548-GPL21433	28139975	mRNA-seq 37°C in WT with control plasmid	Operon mRNAs are organized into ORF-centric structures that predict translation efficiency	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	All cultures were based on MOPS media with 0.2% glucose (Teknova), with full supplement (Neidhardt et al., 1974) minus methionine. An overnight liquid culture was diluted 400-fold into 200 ml fresh media. The culture was kept in a 1 liter flask at 37°C with aeration until OD420 reached 0.4. PGCGROWTHCONDITIONS	All cultures were based on MOPS media with <Supp> 0.2 % glucose </Supp> ( Teknova ) , with full supplement ( Neidhardt et al. , 1974 ) minus methionine . An overnight liquid culture was diluted 400-fold into 200 ml <Med> fresh media </Med> . The culture was kept in a 1 liter flask at <Temp> 37 °C </Temp> with aeration until OD420 reached 0.4 . 	fresh media	Medium	0.912254622886743	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE77617/GSE77617.soft.gz				0	0	False
SRR5186139	GSE77617	GSM2462936	GPL14548-GPL21433	28139975	mRNA-seq 37°C in WT with control plasmid	Operon mRNAs are organized into ORF-centric structures that predict translation efficiency	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	All cultures were based on MOPS media with 0.2% glucose (Teknova), with full supplement (Neidhardt et al., 1974) minus methionine. An overnight liquid culture was diluted 400-fold into 200 ml fresh media. The culture was kept in a 1 liter flask at 37°C with aeration until OD420 reached 0.4. PGCGROWTHCONDITIONS	All cultures were based on MOPS media with <Supp> 0.2 % glucose </Supp> ( Teknova ) , with full supplement ( Neidhardt et al. , 1974 ) minus methionine . An overnight liquid culture was diluted 400-fold into 200 ml <Med> fresh media </Med> . The culture was kept in a 1 liter flask at <Temp> 37 °C </Temp> with aeration until OD420 reached 0.4 . 	fresh media	Medium	0.9122546228913468	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE77617/GSE77617.soft.gz				0	0	False
SRR5186140	GSE77617	GSM2462937	GPL14548-GPL21433	28139975	mRNA-seq 37°C in WT with plasmid expressing mini-ORF CUA	Operon mRNAs are organized into ORF-centric structures that predict translation efficiency	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21433: Illumina HiSeq 4000 (Escherichia coli)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE77617/GSE77617.soft.gz				0	0	False
SRR5186140	GSE77617	GSM2462937	GPL14548-GPL21433	28139975	mRNA-seq 37°C in WT with plasmid expressing mini-ORF CUA	Operon mRNAs are organized into ORF-centric structures that predict translation efficiency	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	All cultures were based on MOPS media with 0.2% glucose (Teknova), with full supplement (Neidhardt et al., 1974) minus methionine. An overnight liquid culture was diluted 400-fold into 200 ml fresh media. The culture was kept in a 1 liter flask at 37°C with aeration until OD420 reached 0.4. PGCGROWTHCONDITIONS	All cultures were based on MOPS media with <Supp> 0.2 % glucose </Supp> ( Teknova ) , with full supplement ( Neidhardt et al. , 1974 ) minus methionine . An overnight liquid culture was diluted 400-fold into 200 ml <Med> fresh media </Med> . The culture was kept in a 1 liter flask at <Temp> 37 °C </Temp> with aeration until OD420 reached 0.4 . 	fresh media	Medium	0.912254622886743	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE77617/GSE77617.soft.gz				0	0	False
SRR5186140	GSE77617	GSM2462937	GPL14548-GPL21433	28139975	mRNA-seq 37°C in WT with plasmid expressing mini-ORF CUA	Operon mRNAs are organized into ORF-centric structures that predict translation efficiency	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	All cultures were based on MOPS media with 0.2% glucose (Teknova), with full supplement (Neidhardt et al., 1974) minus methionine. An overnight liquid culture was diluted 400-fold into 200 ml fresh media. The culture was kept in a 1 liter flask at 37°C with aeration until OD420 reached 0.4. PGCGROWTHCONDITIONS	All cultures were based on MOPS media with <Supp> 0.2 % glucose </Supp> ( Teknova ) , with full supplement ( Neidhardt et al. , 1974 ) minus methionine . An overnight liquid culture was diluted 400-fold into 200 ml <Med> fresh media </Med> . The culture was kept in a 1 liter flask at <Temp> 37 °C </Temp> with aeration until OD420 reached 0.4 . 	fresh media	Medium	0.9122546228913468	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE77617/GSE77617.soft.gz				0	0	False
SRR5186141	GSE77617	GSM2462938	GPL14548-GPL21433	28139975	mRNA-seq 37°C in WT with plasmid expressing mini-ORF CUG	Operon mRNAs are organized into ORF-centric structures that predict translation efficiency	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21433: Illumina HiSeq 4000 (Escherichia coli)	data_processing	Genome_build: NC000913.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> NC000913 .2 </Gversion> 	NC000913 .2	Gversion	0.9567938620427808	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE77617/GSE77617.soft.gz				0	0	False
SRR5186141	GSE77617	GSM2462938	GPL14548-GPL21433	28139975	mRNA-seq 37°C in WT with plasmid expressing mini-ORF CUG	Operon mRNAs are organized into ORF-centric structures that predict translation efficiency	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	All cultures were based on MOPS media with 0.2% glucose (Teknova), with full supplement (Neidhardt et al., 1974) minus methionine. An overnight liquid culture was diluted 400-fold into 200 ml fresh media. The culture was kept in a 1 liter flask at 37°C with aeration until OD420 reached 0.4. PGCGROWTHCONDITIONS	All cultures were based on MOPS media with <Supp> 0.2 % glucose </Supp> ( Teknova ) , with full supplement ( Neidhardt et al. , 1974 ) minus methionine . An overnight liquid culture was diluted 400-fold into 200 ml <Med> fresh media </Med> . The culture was kept in a 1 liter flask at <Temp> 37 °C </Temp> with aeration until OD420 reached 0.4 . 	fresh media	Medium	0.912254622886743	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE77617/GSE77617.soft.gz				0	0	False
SRR5186141	GSE77617	GSM2462938	GPL14548-GPL21433	28139975	mRNA-seq 37°C in WT with plasmid expressing mini-ORF CUG	Operon mRNAs are organized into ORF-centric structures that predict translation efficiency	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL21433: Illumina HiSeq 4000 (Escherichia coli)	growth_protocol	All cultures were based on MOPS media with 0.2% glucose (Teknova), with full supplement (Neidhardt et al., 1974) minus methionine. An overnight liquid culture was diluted 400-fold into 200 ml fresh media. The culture was kept in a 1 liter flask at 37°C with aeration until OD420 reached 0.4. PGCGROWTHCONDITIONS	All cultures were based on MOPS media with <Supp> 0.2 % glucose </Supp> ( Teknova ) , with full supplement ( Neidhardt et al. , 1974 ) minus methionine . An overnight liquid culture was diluted 400-fold into 200 ml <Med> fresh media </Med> . The culture was kept in a 1 liter flask at <Temp> 37 °C </Temp> with aeration until OD420 reached 0.4 . 	fresh media	Medium	0.9122546228913468	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE77617/GSE77617.soft.gz				0	0	False
SRR3194453	GSE78756	GSM2075722	GPL14548-GPL15010-GPL21530-GPL21531-GPL21532-GPL21533-GPL21534	27667363	Crooks_aero	Quantifying variation within the bacterial species E. coli	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL21530: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. W3110). GPL21531: Illumina HiSeq 2000 (Escherichia coli W). GPL21532: Illumina HiSeq 2000 (Escherichia coli C). GPL21533: Illumina HiSeq 2000 (Escherichia coli BL21). GPL21534: Illumina HiSeq 2000 (Escherichia coli DH5[alpha])	growth_protocol	Escherichia coli strains E.coli C (DSMZ 4860), E. coli Crooks (DSMZ 1576), E. coli DH5α (DSMZ 6897) E. coli W (DSMZ 1116), E. coli W3110 (DSMZ 5911) were obtained from DSMZ-German Collection of Microorganism and Cell Cultures; E. coli BL21 (DE3) was purchased as competent cells from Agilent (Agilent Technologies Inc., USA), E. coli K-12 MG1655 (ATCC 700926). All strains were cultured in M9 minimal medium (1) containing Na2HPO4 x 7H2O (6.8 g), KH2PO4 (3 g), NaCl (0.5 g), NH4Cl (1 g), MgSO4 (2 mmol), CaCl2 (0.1 mmol), trace elements, Wolf’s vitamin solution (2) and glucose (2 g L-1). Anoxic M9 minimal media with glucose was obtained by flushing solution with oxygen free nitrogen (95%). Overnight cultures from single colonies of each of seven E. coli strains were diluted to a starting optical density (OD600) of 0.01. Cultures were grown in 250 ml flasks or 300 ml oxygen-free sealed bottles containing 50 ml glucose-M9 minimal media in a shaking incubator at 37°C and 250 rpm. PGCGROWTHCONDITIONS	Escherichia coli strains E.coli C ( DSMZ 4860 ) , E. coli Crooks ( DSMZ 1576 ) , E. coli DH5α ( DSMZ 6897 ) E. coli W ( DSMZ 1116 ) , E. coli W3110 ( DSMZ 5911 ) were obtained from DSMZ-German Collection of Microorganism and Cell Cultures ; E. coli BL21 ( DE3 ) was purchased as competent cells from Agilent ( Agilent Technologies Inc. , USA ) , E. coli K-12 MG1655 ( ATCC 700926 ) . All strains were cultured in <Med> M9 minimal medium </Med> ( 1 ) containing Na2HPO4 x 7H2O ( 6.8 g ) , KH2PO4 ( 3 g ) , NaCl ( 0.5 g ) , NH4Cl ( 1 g ) , MgSO4 ( 2 mmol ) , CaCl2 ( 0.1 mmol ) , trace elements , Wolf 's vitamin solution ( 2 ) and glucose ( 2 g L-1 ) . Anoxic <Med> M9 minimal media </Med> with <Supp> glucose </Supp> was obtained by flushing solution with oxygen free nitrogen ( 95 % ) . Overnight cultures from single colonies of each of seven E. coli strains were diluted to a starting optical density ( OD600 ) of 0.01 . Cultures were grown in 250 ml flasks or 300 ml oxygen-free sealed bottles containing 50 ml <Med> glucose-M9 minimal media </Med> in a shaking incubator at <Temp> 37 °C </Temp> and <Agit> 250 rpm </Agit> . 	glucose-M9 minimal media	Medium	0.978442301970166	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE78756/GSE78756.soft.gz				0	0	False
SRR3194455SRR3194456	GSE78756	GSM2075723	GPL14548-GPL15010-GPL21530-GPL21531-GPL21532-GPL21533-GPL21534	27667363	Crooks_anaero	Quantifying variation within the bacterial species E. coli	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655). GPL21530: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. W3110). GPL21531: Illumina HiSeq 2000 (Escherichia coli W). GPL21532: Illumina HiSeq 2000 (Escherichia coli C). GPL21533: Illumina HiSeq 2000 (Escherichia coli BL21). GPL21534: Illumina HiSeq 2000 (Escherichia coli DH5[alpha])	growth_protocol	Escherichia coli strains E.coli C (DSMZ 4860), E. coli Crooks (DSMZ 1576), E. coli DH5α (DSMZ 6897) E. coli W (DSMZ 1116), E. coli W3110 (DSMZ 5911) were obtained from DSMZ-German Collection of Microorganism and Cell Cultures; E. coli BL21 (DE3) was purchased as competent cells from Agilent (Agilent Technologies Inc., USA), E. coli K-12 MG1655 (ATCC 700926). All strains were cultured in M9 minimal medium (1) containing Na2HPO4 x 7H2O (6.8 g), KH2PO4 (3 g), NaCl (0.5 g), NH4Cl (1 g), MgSO4 (2 mmol), CaCl2 (0.1 mmol), trace elements, Wolf’s vitamin solution (2) and glucose (2 g L-1). Anoxic M9 minimal media with glucose was obtained by flushing solution with oxygen free nitrogen (95%). Overnight cultures from single colonies of each of seven E. coli strains were diluted to a starting optical density (OD600) of 0.01. Cultures were grown in 250 ml flasks or 300 ml oxygen-free sealed bottles containing 50 ml glucose-M9 minimal media in a shaking incubator at 37°C and 250 rpm. PGCGROWTHCONDITIONS	Escherichia coli strains E.coli C ( DSMZ 4860 ) , E. coli Crooks ( DSMZ 1576 ) , E. coli DH5α ( DSMZ 6897 ) E. coli W ( DSMZ 1116 ) , E. coli W3110 ( DSMZ 5911 ) were obtained from DSMZ-German Collection of Microorganism and Cell Cultures ; E. coli BL21 ( DE3 ) was purchased as competent cells from Agilent ( Agilent Technologies Inc. , USA ) , E. coli K-12 MG1655 ( ATCC 700926 ) . All strains were cultured in <Med> M9 minimal medium </Med> ( 1 ) containing Na2HPO4 x 7H2O ( 6.8 g ) , KH2PO4 ( 3 g ) , NaCl ( 0.5 g ) , NH4Cl ( 1 g ) , MgSO4 ( 2 mmol ) , CaCl2 ( 0.1 mmol ) , trace elements , Wolf 's vitamin solution ( 2 ) and glucose ( 2 g L-1 ) . Anoxic <Med> M9 minimal media </Med> with <Supp> glucose </Supp> was obtained by flushing solution with oxygen free nitrogen ( 95 % ) . Overnight cultures from single colonies of each of seven E. coli strains were diluted to a starting optical density ( OD600 ) of 0.01 . Cultures were grown in 250 ml flasks or 300 ml oxygen-free sealed bottles containing 50 ml <Med> glucose-M9 minimal media </Med> in a shaking incubator at <Temp> 37 °C </Temp> and <Agit> 250 rpm </Agit> . 	glucose-M9 minimal media	Medium	0.978442301970166	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE78756/GSE78756.soft.gz				0	0	False
SRR3379590	GSE80251	GSM2122743	GPL21726	27645242	Untreated_replicate_1	Genome-wide transcriptome analyses of E. coli treated with ribosome-targeting antibiotics	GPL21726: Ion Torrent Proton (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655, NCBI Reference Sequence: NC_000913.3 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NCBI Reference Sequence : <Supp> NC </Supp> _ 000913.3 	K-12	Organism	0.9900556922878109	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz				0	0	False
SRR3379590	GSE80251	GSM2122743	GPL21726	27645242	Untreated_replicate_1	Genome-wide transcriptome analyses of E. coli treated with ribosome-targeting antibiotics	GPL21726: Ion Torrent Proton (Escherichia coli)	treatment_protocol	The cells were untreated, or treated with  (100µg/mL Erythromycin or 50 µg/mL Clindamycin in 70% Ethanol). After 10 minutes at 37°C, 1 mL samples were subjected to hot phenol-chloroform extraction. Ref: Chuang SE, Daniels DL, and Blattner FR (1993) Global regulation of gene expression in Escherichia coli. J. Bacteriol. 175:2026-2036. PGCGROWTHCONDITIONS	The cells were untreated , or treated with ( 100µg/mL Erythromycin or 50 µg/mL Clindamycin in 70 % Ethanol ) . After 10 minutes at <Temp> 37 °C </Temp> , 1 mL samples were subjected to hot phenol-chloroform extraction . Ref : <Gtype> Chuang </Gtype> SE , Daniels DL , and Blattner FR ( 1993 ) Global regulation of gene expression in Escherichia coli . J. Bacteriol . 175:2026-2036 . 	Chuang	Genetic background	0.9590932068276864	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz				0	0	False
SRR3379591	GSE80251	GSM2122744	GPL21726	27645242	Untreated_replicate_2	Genome-wide transcriptome analyses of E. coli treated with ribosome-targeting antibiotics	GPL21726: Ion Torrent Proton (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655, NCBI Reference Sequence: NC_000913.3 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NCBI Reference Sequence : <Supp> NC </Supp> _ 000913.3 	K-12	Organism	0.9900556922878109	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz				0	0	False
SRR3379591	GSE80251	GSM2122744	GPL21726	27645242	Untreated_replicate_2	Genome-wide transcriptome analyses of E. coli treated with ribosome-targeting antibiotics	GPL21726: Ion Torrent Proton (Escherichia coli)	treatment_protocol	The cells were untreated, or treated with  (100µg/mL Erythromycin or 50 µg/mL Clindamycin in 70% Ethanol). After 10 minutes at 37°C, 1 mL samples were subjected to hot phenol-chloroform extraction. Ref: Chuang SE, Daniels DL, and Blattner FR (1993) Global regulation of gene expression in Escherichia coli. J. Bacteriol. 175:2026-2036. PGCGROWTHCONDITIONS	The cells were untreated , or treated with ( 100µg/mL Erythromycin or 50 µg/mL Clindamycin in 70 % Ethanol ) . After 10 minutes at <Temp> 37 °C </Temp> , 1 mL samples were subjected to hot phenol-chloroform extraction . Ref : <Gtype> Chuang </Gtype> SE , Daniels DL , and Blattner FR ( 1993 ) Global regulation of gene expression in Escherichia coli . J. Bacteriol . 175:2026-2036 . 	Chuang	Genetic background	0.9590932068276864	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz				0	0	False
SRR3379592	GSE80251	GSM2122745	GPL21726	27645242	Untreated_replicate_3	Genome-wide transcriptome analyses of E. coli treated with ribosome-targeting antibiotics	GPL21726: Ion Torrent Proton (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655, NCBI Reference Sequence: NC_000913.3 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NCBI Reference Sequence : <Supp> NC </Supp> _ 000913.3 	K-12	Organism	0.9900556922878109	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz				0	0	False
SRR3379592	GSE80251	GSM2122745	GPL21726	27645242	Untreated_replicate_3	Genome-wide transcriptome analyses of E. coli treated with ribosome-targeting antibiotics	GPL21726: Ion Torrent Proton (Escherichia coli)	treatment_protocol	The cells were untreated, or treated with  (100µg/mL Erythromycin or 50 µg/mL Clindamycin in 70% Ethanol). After 10 minutes at 37°C, 1 mL samples were subjected to hot phenol-chloroform extraction. Ref: Chuang SE, Daniels DL, and Blattner FR (1993) Global regulation of gene expression in Escherichia coli. J. Bacteriol. 175:2026-2036. PGCGROWTHCONDITIONS	The cells were untreated , or treated with ( 100µg/mL Erythromycin or 50 µg/mL Clindamycin in 70 % Ethanol ) . After 10 minutes at <Temp> 37 °C </Temp> , 1 mL samples were subjected to hot phenol-chloroform extraction . Ref : <Gtype> Chuang </Gtype> SE , Daniels DL , and Blattner FR ( 1993 ) Global regulation of gene expression in Escherichia coli . J. Bacteriol . 175:2026-2036 . 	Chuang	Genetic background	0.9590932068276864	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz				0	0	False
SRR3379593	GSE80251	GSM2122746	GPL21726	27645242	Erythromycin_replicate_1	Genome-wide transcriptome analyses of E. coli treated with ribosome-targeting antibiotics	GPL21726: Ion Torrent Proton (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655, NCBI Reference Sequence: NC_000913.3 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NCBI Reference Sequence : <Supp> NC </Supp> _ 000913.3 	K-12	Organism	0.9900556922878109	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz				0	0	False
SRR3379593	GSE80251	GSM2122746	GPL21726	27645242	Erythromycin_replicate_1	Genome-wide transcriptome analyses of E. coli treated with ribosome-targeting antibiotics	GPL21726: Ion Torrent Proton (Escherichia coli)	treatment_protocol	The cells were untreated, or treated with  (100µg/mL Erythromycin or 50 µg/mL Clindamycin in 70% Ethanol). After 10 minutes at 37°C, 1 mL samples were subjected to hot phenol-chloroform extraction. Ref: Chuang SE, Daniels DL, and Blattner FR (1993) Global regulation of gene expression in Escherichia coli. J. Bacteriol. 175:2026-2036. PGCGROWTHCONDITIONS	The cells were untreated , or treated with ( 100µg/mL Erythromycin or 50 µg/mL Clindamycin in 70 % Ethanol ) . After 10 minutes at <Temp> 37 °C </Temp> , 1 mL samples were subjected to hot phenol-chloroform extraction . Ref : <Gtype> Chuang </Gtype> SE , Daniels DL , and Blattner FR ( 1993 ) Global regulation of gene expression in Escherichia coli . J. Bacteriol . 175:2026-2036 . 	Chuang	Genetic background	0.9590932068276864	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz				0	0	False
SRR3379594	GSE80251	GSM2122747	GPL21726	27645242	Erythromycin_replicate_2	Genome-wide transcriptome analyses of E. coli treated with ribosome-targeting antibiotics	GPL21726: Ion Torrent Proton (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655, NCBI Reference Sequence: NC_000913.3 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NCBI Reference Sequence : <Supp> NC </Supp> _ 000913.3 	K-12	Organism	0.9900556922878109	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz				0	0	False
SRR3379594	GSE80251	GSM2122747	GPL21726	27645242	Erythromycin_replicate_2	Genome-wide transcriptome analyses of E. coli treated with ribosome-targeting antibiotics	GPL21726: Ion Torrent Proton (Escherichia coli)	treatment_protocol	The cells were untreated, or treated with  (100µg/mL Erythromycin or 50 µg/mL Clindamycin in 70% Ethanol). After 10 minutes at 37°C, 1 mL samples were subjected to hot phenol-chloroform extraction. Ref: Chuang SE, Daniels DL, and Blattner FR (1993) Global regulation of gene expression in Escherichia coli. J. Bacteriol. 175:2026-2036. PGCGROWTHCONDITIONS	The cells were untreated , or treated with ( 100µg/mL Erythromycin or 50 µg/mL Clindamycin in 70 % Ethanol ) . After 10 minutes at <Temp> 37 °C </Temp> , 1 mL samples were subjected to hot phenol-chloroform extraction . Ref : <Gtype> Chuang </Gtype> SE , Daniels DL , and Blattner FR ( 1993 ) Global regulation of gene expression in Escherichia coli . J. Bacteriol . 175:2026-2036 . 	Chuang	Genetic background	0.9590932068276864	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz				0	0	False
SRR3379595	GSE80251	GSM2122748	GPL21726	27645242	Erythromycin_replicate_3	Genome-wide transcriptome analyses of E. coli treated with ribosome-targeting antibiotics	GPL21726: Ion Torrent Proton (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655, NCBI Reference Sequence: NC_000913.3 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NCBI Reference Sequence : <Supp> NC </Supp> _ 000913.3 	K-12	Organism	0.9900556922878109	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz				0	0	False
SRR3379595	GSE80251	GSM2122748	GPL21726	27645242	Erythromycin_replicate_3	Genome-wide transcriptome analyses of E. coli treated with ribosome-targeting antibiotics	GPL21726: Ion Torrent Proton (Escherichia coli)	treatment_protocol	The cells were untreated, or treated with  (100µg/mL Erythromycin or 50 µg/mL Clindamycin in 70% Ethanol). After 10 minutes at 37°C, 1 mL samples were subjected to hot phenol-chloroform extraction. Ref: Chuang SE, Daniels DL, and Blattner FR (1993) Global regulation of gene expression in Escherichia coli. J. Bacteriol. 175:2026-2036. PGCGROWTHCONDITIONS	The cells were untreated , or treated with ( 100µg/mL Erythromycin or 50 µg/mL Clindamycin in 70 % Ethanol ) . After 10 minutes at <Temp> 37 °C </Temp> , 1 mL samples were subjected to hot phenol-chloroform extraction . Ref : <Gtype> Chuang </Gtype> SE , Daniels DL , and Blattner FR ( 1993 ) Global regulation of gene expression in Escherichia coli . J. Bacteriol . 175:2026-2036 . 	Chuang	Genetic background	0.9590932068276864	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz				0	0	False
SRR3379596	GSE80251	GSM2122749	GPL21726	27645242	Clindamycin_replicate_1	Genome-wide transcriptome analyses of E. coli treated with ribosome-targeting antibiotics	GPL21726: Ion Torrent Proton (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655, NCBI Reference Sequence: NC_000913.3 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NCBI Reference Sequence : <Supp> NC </Supp> _ 000913.3 	K-12	Organism	0.9900556922878109	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz				0	0	False
SRR3379596	GSE80251	GSM2122749	GPL21726	27645242	Clindamycin_replicate_1	Genome-wide transcriptome analyses of E. coli treated with ribosome-targeting antibiotics	GPL21726: Ion Torrent Proton (Escherichia coli)	treatment_protocol	The cells were untreated, or treated with  (100µg/mL Erythromycin or 50 µg/mL Clindamycin in 70% Ethanol). After 10 minutes at 37°C, 1 mL samples were subjected to hot phenol-chloroform extraction. Ref: Chuang SE, Daniels DL, and Blattner FR (1993) Global regulation of gene expression in Escherichia coli. J. Bacteriol. 175:2026-2036. PGCGROWTHCONDITIONS	The cells were untreated , or treated with ( 100µg/mL Erythromycin or 50 µg/mL Clindamycin in 70 % Ethanol ) . After 10 minutes at <Temp> 37 °C </Temp> , 1 mL samples were subjected to hot phenol-chloroform extraction . Ref : <Gtype> Chuang </Gtype> SE , Daniels DL , and Blattner FR ( 1993 ) Global regulation of gene expression in Escherichia coli . J. Bacteriol . 175:2026-2036 . 	Chuang	Genetic background	0.9590932068276864	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz				0	0	False
SRR3379597	GSE80251	GSM2122750	GPL21726	27645242	Clindamycin_replicate_2	Genome-wide transcriptome analyses of E. coli treated with ribosome-targeting antibiotics	GPL21726: Ion Torrent Proton (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655, NCBI Reference Sequence: NC_000913.3 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NCBI Reference Sequence : <Supp> NC </Supp> _ 000913.3 	K-12	Organism	0.9900556922878109	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz				0	0	False
SRR3379597	GSE80251	GSM2122750	GPL21726	27645242	Clindamycin_replicate_2	Genome-wide transcriptome analyses of E. coli treated with ribosome-targeting antibiotics	GPL21726: Ion Torrent Proton (Escherichia coli)	treatment_protocol	The cells were untreated, or treated with  (100µg/mL Erythromycin or 50 µg/mL Clindamycin in 70% Ethanol). After 10 minutes at 37°C, 1 mL samples were subjected to hot phenol-chloroform extraction. Ref: Chuang SE, Daniels DL, and Blattner FR (1993) Global regulation of gene expression in Escherichia coli. J. Bacteriol. 175:2026-2036. PGCGROWTHCONDITIONS	The cells were untreated , or treated with ( 100µg/mL Erythromycin or 50 µg/mL Clindamycin in 70 % Ethanol ) . After 10 minutes at <Temp> 37 °C </Temp> , 1 mL samples were subjected to hot phenol-chloroform extraction . Ref : <Gtype> Chuang </Gtype> SE , Daniels DL , and Blattner FR ( 1993 ) Global regulation of gene expression in Escherichia coli . J. Bacteriol . 175:2026-2036 . 	Chuang	Genetic background	0.9590932068276864	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz				0	0	False
SRR3379598	GSE80251	GSM2122751	GPL21726	27645242	Clindamycin_replicate_3	Genome-wide transcriptome analyses of E. coli treated with ribosome-targeting antibiotics	GPL21726: Ion Torrent Proton (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655, NCBI Reference Sequence: NC_000913.3 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 , NCBI Reference Sequence : <Supp> NC </Supp> _ 000913.3 	K-12	Organism	0.9900556922878109	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz				0	0	False
SRR3379598	GSE80251	GSM2122751	GPL21726	27645242	Clindamycin_replicate_3	Genome-wide transcriptome analyses of E. coli treated with ribosome-targeting antibiotics	GPL21726: Ion Torrent Proton (Escherichia coli)	treatment_protocol	The cells were untreated, or treated with  (100µg/mL Erythromycin or 50 µg/mL Clindamycin in 70% Ethanol). After 10 minutes at 37°C, 1 mL samples were subjected to hot phenol-chloroform extraction. Ref: Chuang SE, Daniels DL, and Blattner FR (1993) Global regulation of gene expression in Escherichia coli. J. Bacteriol. 175:2026-2036. PGCGROWTHCONDITIONS	The cells were untreated , or treated with ( 100µg/mL Erythromycin or 50 µg/mL Clindamycin in 70 % Ethanol ) . After 10 minutes at <Temp> 37 °C </Temp> , 1 mL samples were subjected to hot phenol-chloroform extraction . Ref : <Gtype> Chuang </Gtype> SE , Daniels DL , and Blattner FR ( 1993 ) Global regulation of gene expression in Escherichia coli . J. Bacteriol . 175:2026-2036 . 	Chuang	Genetic background	0.9590932068276864	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE80251/GSE80251.soft.gz				0	0	False
SRR3584193SRR3584194SRR3584195	GSE81584	GSM2157648	GPL14548		MG1655_1	Mfd alters global transcription patterns in undamaged Escherichia coli cells	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	extract_protocol	Cell pellets were lysed and RNA collected using Qiagen’s RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit.  RNA samples were then treated with DNase (New England Biolabs) for 30 min at 37 °C. PGCGROWTHCONDITIONS	Cell pellets were lysed and RNA collected using Qiagen 's RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit . RNA samples were then treated with DNase ( New England Biolabs ) for <Supp> 30 min </Supp> at <Temp> 37 °C </Temp> . 	30 min	Medium supplement	0.9983137235200464	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz				0	0	False
SRR3584193SRR3584194SRR3584195	GSE81584	GSM2157648	GPL14548		MG1655_1	Mfd alters global transcription patterns in undamaged Escherichia coli cells	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz				0	0	False
SRR3584196SRR3584197SRR3584198	GSE81584	GSM2157649	GPL14548		MG1655_2	Mfd alters global transcription patterns in undamaged Escherichia coli cells	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	extract_protocol	Cell pellets were lysed and RNA collected using Qiagen’s RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit.  RNA samples were then treated with DNase (New England Biolabs) for 30 min at 37 °C. PGCGROWTHCONDITIONS	Cell pellets were lysed and RNA collected using Qiagen 's RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit . RNA samples were then treated with DNase ( New England Biolabs ) for <Supp> 30 min </Supp> at <Temp> 37 °C </Temp> . 	30 min	Medium supplement	0.9983137235200464	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz				0	0	False
SRR3584196SRR3584197SRR3584198	GSE81584	GSM2157649	GPL14548		MG1655_2	Mfd alters global transcription patterns in undamaged Escherichia coli cells	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz				0	0	False
SRR3584199SRR3584200	GSE81584	GSM2157650	GPL14548		MG1655_3	Mfd alters global transcription patterns in undamaged Escherichia coli cells	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	extract_protocol	Cell pellets were lysed and RNA collected using Qiagen’s RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit.  RNA samples were then treated with DNase (New England Biolabs) for 30 min at 37 °C. PGCGROWTHCONDITIONS	Cell pellets were lysed and RNA collected using Qiagen 's RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit . RNA samples were then treated with DNase ( New England Biolabs ) for <Supp> 30 min </Supp> at <Temp> 37 °C </Temp> . 	30 min	Medium supplement	0.9983137235200464	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz				0	0	False
SRR3584199SRR3584200	GSE81584	GSM2157650	GPL14548		MG1655_3	Mfd alters global transcription patterns in undamaged Escherichia coli cells	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz				0	0	False
SRR3584201SRR3584202	GSE81584	GSM2157651	GPL14548		mfd_1	Mfd alters global transcription patterns in undamaged Escherichia coli cells	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	extract_protocol	Cell pellets were lysed and RNA collected using Qiagen’s RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit.  RNA samples were then treated with DNase (New England Biolabs) for 30 min at 37 °C. PGCGROWTHCONDITIONS	Cell pellets were lysed and RNA collected using Qiagen 's RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit . RNA samples were then treated with DNase ( New England Biolabs ) for <Supp> 30 min </Supp> at <Temp> 37 °C </Temp> . 	30 min	Medium supplement	0.9983137235200464	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz				0	0	False
SRR3584201SRR3584202	GSE81584	GSM2157651	GPL14548		mfd_1	Mfd alters global transcription patterns in undamaged Escherichia coli cells	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz				0	0	False
SRR3584203SRR3584204	GSE81584	GSM2157652	GPL14548		mfd_2	Mfd alters global transcription patterns in undamaged Escherichia coli cells	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	extract_protocol	Cell pellets were lysed and RNA collected using Qiagen’s RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit.  RNA samples were then treated with DNase (New England Biolabs) for 30 min at 37 °C. PGCGROWTHCONDITIONS	Cell pellets were lysed and RNA collected using Qiagen 's RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit . RNA samples were then treated with DNase ( New England Biolabs ) for <Supp> 30 min </Supp> at <Temp> 37 °C </Temp> . 	30 min	Medium supplement	0.9983137235200464	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz				0	0	False
SRR3584203SRR3584204	GSE81584	GSM2157652	GPL14548		mfd_2	Mfd alters global transcription patterns in undamaged Escherichia coli cells	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz				0	0	False
SRR3584205SRR3584206SRR3584207	GSE81584	GSM2157653	GPL14548		mfd_3	Mfd alters global transcription patterns in undamaged Escherichia coli cells	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	extract_protocol	Cell pellets were lysed and RNA collected using Qiagen’s RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit.  RNA samples were then treated with DNase (New England Biolabs) for 30 min at 37 °C. PGCGROWTHCONDITIONS	Cell pellets were lysed and RNA collected using Qiagen 's RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit . RNA samples were then treated with DNase ( New England Biolabs ) for <Supp> 30 min </Supp> at <Temp> 37 °C </Temp> . 	30 min	Medium supplement	0.9983137235200464	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz				0	0	False
SRR3584205SRR3584206SRR3584207	GSE81584	GSM2157653	GPL14548		mfd_3	Mfd alters global transcription patterns in undamaged Escherichia coli cells	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz				0	0	False
SRR3584208SRR3584209	GSE81584	GSM2157654	GPL14548		MG1655_vector_1	Mfd alters global transcription patterns in undamaged Escherichia coli cells	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	extract_protocol	Cell pellets were lysed and RNA collected using Qiagen’s RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit.  RNA samples were then treated with DNase (New England Biolabs) for 30 min at 37 °C. PGCGROWTHCONDITIONS	Cell pellets were lysed and RNA collected using Qiagen 's RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit . RNA samples were then treated with DNase ( New England Biolabs ) for <Supp> 30 min </Supp> at <Temp> 37 °C </Temp> . 	30 min	Medium supplement	0.9983137235200464	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz				0	0	False
SRR3584208SRR3584209	GSE81584	GSM2157654	GPL14548		MG1655_vector_1	Mfd alters global transcription patterns in undamaged Escherichia coli cells	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz				0	0	False
SRR3584210SRR3584211	GSE81584	GSM2157655	GPL14548		MG1655_vector_2	Mfd alters global transcription patterns in undamaged Escherichia coli cells	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	extract_protocol	Cell pellets were lysed and RNA collected using Qiagen’s RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit.  RNA samples were then treated with DNase (New England Biolabs) for 30 min at 37 °C. PGCGROWTHCONDITIONS	Cell pellets were lysed and RNA collected using Qiagen 's RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit . RNA samples were then treated with DNase ( New England Biolabs ) for <Supp> 30 min </Supp> at <Temp> 37 °C </Temp> . 	30 min	Medium supplement	0.9983137235200464	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz				0	0	False
SRR3584210SRR3584211	GSE81584	GSM2157655	GPL14548		MG1655_vector_2	Mfd alters global transcription patterns in undamaged Escherichia coli cells	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz				0	0	False
SRR3584212SRR3584213SRR3584214	GSE81584	GSM2157656	GPL14548		MFD++_1	Mfd alters global transcription patterns in undamaged Escherichia coli cells	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	extract_protocol	Cell pellets were lysed and RNA collected using Qiagen’s RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit.  RNA samples were then treated with DNase (New England Biolabs) for 30 min at 37 °C. PGCGROWTHCONDITIONS	Cell pellets were lysed and RNA collected using Qiagen 's RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit . RNA samples were then treated with DNase ( New England Biolabs ) for <Supp> 30 min </Supp> at <Temp> 37 °C </Temp> . 	30 min	Medium supplement	0.9983137235200464	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz				0	0	False
SRR3584212SRR3584213SRR3584214	GSE81584	GSM2157656	GPL14548		MFD++_1	Mfd alters global transcription patterns in undamaged Escherichia coli cells	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz				0	0	False
SRR3584215SRR3584216SRR3584217	GSE81584	GSM2157657	GPL14548		MFD++_2	Mfd alters global transcription patterns in undamaged Escherichia coli cells	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	extract_protocol	Cell pellets were lysed and RNA collected using Qiagen’s RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit.  RNA samples were then treated with DNase (New England Biolabs) for 30 min at 37 °C. PGCGROWTHCONDITIONS	Cell pellets were lysed and RNA collected using Qiagen 's RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit . RNA samples were then treated with DNase ( New England Biolabs ) for <Supp> 30 min </Supp> at <Temp> 37 °C </Temp> . 	30 min	Medium supplement	0.9983137235200464	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz				0	0	False
SRR3584215SRR3584216SRR3584217	GSE81584	GSM2157657	GPL14548		MFD++_2	Mfd alters global transcription patterns in undamaged Escherichia coli cells	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	source_name	MG1655 PGCGROWTHCONDITIONS	<Substrain> MG1655 </Substrain>	MG1655	Organism	0.95441409453219	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE81584/GSE81584.soft.gz				0	0	False
SRR4255368	GSE87071	GSM2321583	GPL14548		10J.0	The Escherichia coli nucleoid is shaped around replication and transcription [RNA-Seq]	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	growth_protocol	Synchronization was achieved by passaging cells through one or two rounds of stationary phase according to Cutler and Evans 1966. Briefly: Individual colonies (LB plate, 37°C, 24 h) were inoculated into M9 media and grown O/N (37°C, 200 rpm). M9 media was inoculated to a final OD600 = 0.25 (early-logarithmic phase). Cultures were grown (37°C, 200 rpm) and maintained in stationary phase (OD600 1.8) for approximately 2 hours. An appropriate amount of each culture was used to inoculate pre-warmed (37°C) M9 media to a final OD600 = 0.25 (approximate 7-fold dilution). Released cultures were grown (37°C, 200 rpm) and harvested (time = 0, 1 hr, or 2 hr) for GCC and RNA isolation. Samples (1 mL) were also taken for FACS analysis and fluorescence microscopy (t=0, 1 hr, and 2 hr). PGCGROWTHCONDITIONS	Synchronization was achieved by passaging cells through one or two rounds of stationary phase according to Cutler and Evans 1966 . Briefly : <Gtype> Individual </Gtype> colonies ( LB plate , <Temp> 37 °C </Temp> , 24 h ) were inoculated into M9 media and grown O/N ( <Temp> 37 °C </Temp> , 200 rpm ) . M9 media was inoculated to a final OD600 = 0.25 ( early-logarithmic phase ) . Cultures were grown ( <Temp> 37 °C </Temp> , 200 rpm ) and maintained in stationary phase ( OD600 1.8 ) for <Supp> approximately 2 hours </Supp> . An appropriate amount of each culture was used to inoculate pre-warmed ( <Temp> 37 °C </Temp> ) M9 media to a final OD600 = 0.25 ( approximate 7-fold dilution ) . Released cultures were grown ( <Temp> 37 °C </Temp> , 200 rpm ) and harvested ( time = 0 , 1 hr , or 2 hr ) for GCC and RNA isolation . Samples ( 1 mL ) were also taken for FACS analysis and fluorescence microscopy ( t = 0 , 1 hr , and 2 hr ) . 	approximately 2 hours	Medium supplement	0.9525643651021984	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE87071/GSE87071.soft.gz				0	0	False
SRR4255369	GSE87071	GSM2321584	GPL14548		11K.60	The Escherichia coli nucleoid is shaped around replication and transcription [RNA-Seq]	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	growth_protocol	Synchronization was achieved by passaging cells through one or two rounds of stationary phase according to Cutler and Evans 1966. Briefly: Individual colonies (LB plate, 37°C, 24 h) were inoculated into M9 media and grown O/N (37°C, 200 rpm). M9 media was inoculated to a final OD600 = 0.25 (early-logarithmic phase). Cultures were grown (37°C, 200 rpm) and maintained in stationary phase (OD600 1.8) for approximately 2 hours. An appropriate amount of each culture was used to inoculate pre-warmed (37°C) M9 media to a final OD600 = 0.25 (approximate 7-fold dilution). Released cultures were grown (37°C, 200 rpm) and harvested (time = 0, 1 hr, or 2 hr) for GCC and RNA isolation. Samples (1 mL) were also taken for FACS analysis and fluorescence microscopy (t=0, 1 hr, and 2 hr). PGCGROWTHCONDITIONS	Synchronization was achieved by passaging cells through one or two rounds of stationary phase according to Cutler and Evans 1966 . Briefly : <Gtype> Individual </Gtype> colonies ( LB plate , <Temp> 37 °C </Temp> , 24 h ) were inoculated into M9 media and grown O/N ( <Temp> 37 °C </Temp> , 200 rpm ) . M9 media was inoculated to a final OD600 = 0.25 ( early-logarithmic phase ) . Cultures were grown ( <Temp> 37 °C </Temp> , 200 rpm ) and maintained in stationary phase ( OD600 1.8 ) for <Supp> approximately 2 hours </Supp> . An appropriate amount of each culture was used to inoculate pre-warmed ( <Temp> 37 °C </Temp> ) M9 media to a final OD600 = 0.25 ( approximate 7-fold dilution ) . Released cultures were grown ( <Temp> 37 °C </Temp> , 200 rpm ) and harvested ( time = 0 , 1 hr , or 2 hr ) for GCC and RNA isolation . Samples ( 1 mL ) were also taken for FACS analysis and fluorescence microscopy ( t = 0 , 1 hr , and 2 hr ) . 	approximately 2 hours	Medium supplement	0.9525643651021984	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE87071/GSE87071.soft.gz				0	0	False
SRR4255369	GSE87071	GSM2321584	GPL14548		11K.60	The Escherichia coli nucleoid is shaped around replication and transcription [RNA-Seq]	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	biological replicate: Replicate 1 PGCGROWTHCONDITIONS	biological replicate : <Supp> Replicate 1 </Supp> 	Replicate 1	Medium supplement	0.9131390996999192	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE87071/GSE87071.soft.gz				0	0	False
SRR4255370	GSE87071	GSM2321585	GPL14548		12L.120	The Escherichia coli nucleoid is shaped around replication and transcription [RNA-Seq]	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	growth_protocol	Synchronization was achieved by passaging cells through one or two rounds of stationary phase according to Cutler and Evans 1966. Briefly: Individual colonies (LB plate, 37°C, 24 h) were inoculated into M9 media and grown O/N (37°C, 200 rpm). M9 media was inoculated to a final OD600 = 0.25 (early-logarithmic phase). Cultures were grown (37°C, 200 rpm) and maintained in stationary phase (OD600 1.8) for approximately 2 hours. An appropriate amount of each culture was used to inoculate pre-warmed (37°C) M9 media to a final OD600 = 0.25 (approximate 7-fold dilution). Released cultures were grown (37°C, 200 rpm) and harvested (time = 0, 1 hr, or 2 hr) for GCC and RNA isolation. Samples (1 mL) were also taken for FACS analysis and fluorescence microscopy (t=0, 1 hr, and 2 hr). PGCGROWTHCONDITIONS	Synchronization was achieved by passaging cells through one or two rounds of stationary phase according to Cutler and Evans 1966 . Briefly : <Gtype> Individual </Gtype> colonies ( LB plate , <Temp> 37 °C </Temp> , 24 h ) were inoculated into M9 media and grown O/N ( <Temp> 37 °C </Temp> , 200 rpm ) . M9 media was inoculated to a final OD600 = 0.25 ( early-logarithmic phase ) . Cultures were grown ( <Temp> 37 °C </Temp> , 200 rpm ) and maintained in stationary phase ( OD600 1.8 ) for <Supp> approximately 2 hours </Supp> . An appropriate amount of each culture was used to inoculate pre-warmed ( <Temp> 37 °C </Temp> ) M9 media to a final OD600 = 0.25 ( approximate 7-fold dilution ) . Released cultures were grown ( <Temp> 37 °C </Temp> , 200 rpm ) and harvested ( time = 0 , 1 hr , or 2 hr ) for GCC and RNA isolation . Samples ( 1 mL ) were also taken for FACS analysis and fluorescence microscopy ( t = 0 , 1 hr , and 2 hr ) . 	approximately 2 hours	Medium supplement	0.9525643651021984	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE87071/GSE87071.soft.gz				0	0	False
SRR4255370	GSE87071	GSM2321585	GPL14548		12L.120	The Escherichia coli nucleoid is shaped around replication and transcription [RNA-Seq]	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	source_name	Dividing t=2 hours PGCGROWTHCONDITIONS	Dividing t <Supp> = 2 hours </Supp> 	= 2 hours	Medium supplement	0.977295786141076	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE87071/GSE87071.soft.gz				0	0	False
SRR4255370	GSE87071	GSM2321585	GPL14548		12L.120	The Escherichia coli nucleoid is shaped around replication and transcription [RNA-Seq]	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	biological replicate: Replicate 1 PGCGROWTHCONDITIONS	biological replicate : <Supp> Replicate 1 </Supp> 	Replicate 1	Medium supplement	0.9131390996999192	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE87071/GSE87071.soft.gz				0	0	False
SRR4255371	GSE87071	GSM2321586	GPL14548		7G.0	The Escherichia coli nucleoid is shaped around replication and transcription [RNA-Seq]	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	growth_protocol	Synchronization was achieved by passaging cells through one or two rounds of stationary phase according to Cutler and Evans 1966. Briefly: Individual colonies (LB plate, 37°C, 24 h) were inoculated into M9 media and grown O/N (37°C, 200 rpm). M9 media was inoculated to a final OD600 = 0.25 (early-logarithmic phase). Cultures were grown (37°C, 200 rpm) and maintained in stationary phase (OD600 1.8) for approximately 2 hours. An appropriate amount of each culture was used to inoculate pre-warmed (37°C) M9 media to a final OD600 = 0.25 (approximate 7-fold dilution). Released cultures were grown (37°C, 200 rpm) and harvested (time = 0, 1 hr, or 2 hr) for GCC and RNA isolation. Samples (1 mL) were also taken for FACS analysis and fluorescence microscopy (t=0, 1 hr, and 2 hr). PGCGROWTHCONDITIONS	Synchronization was achieved by passaging cells through one or two rounds of stationary phase according to Cutler and Evans 1966 . Briefly : <Gtype> Individual </Gtype> colonies ( LB plate , <Temp> 37 °C </Temp> , 24 h ) were inoculated into M9 media and grown O/N ( <Temp> 37 °C </Temp> , 200 rpm ) . M9 media was inoculated to a final OD600 = 0.25 ( early-logarithmic phase ) . Cultures were grown ( <Temp> 37 °C </Temp> , 200 rpm ) and maintained in stationary phase ( OD600 1.8 ) for <Supp> approximately 2 hours </Supp> . An appropriate amount of each culture was used to inoculate pre-warmed ( <Temp> 37 °C </Temp> ) M9 media to a final OD600 = 0.25 ( approximate 7-fold dilution ) . Released cultures were grown ( <Temp> 37 °C </Temp> , 200 rpm ) and harvested ( time = 0 , 1 hr , or 2 hr ) for GCC and RNA isolation . Samples ( 1 mL ) were also taken for FACS analysis and fluorescence microscopy ( t = 0 , 1 hr , and 2 hr ) . 	approximately 2 hours	Medium supplement	0.9525643651021984	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE87071/GSE87071.soft.gz				0	0	False
SRR4421263	GSE88725	GSM2344783	GPL14548	28301469	WT_exp1_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	growth_protocol	All strains were grown shaking at 37°C  in 200mL cultures of MOPS complete-glucose liquid media (unless otherwise annotated) in 1L flasks and cells were harvested at OD(420nm) between 0.4 - 0.6 PGCGROWTHCONDITIONS	All strains were grown shaking at <Temp> 37 °C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 	MOPS complete-glucose liquid media	Medium	0.997703262596842	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421264	GSE88725	GSM2344784	GPL14548	28301469	WT_exp2_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	growth_protocol	All strains were grown shaking at 37°C  in 200mL cultures of MOPS complete-glucose liquid media (unless otherwise annotated) in 1L flasks and cells were harvested at OD(420nm) between 0.4 - 0.6 PGCGROWTHCONDITIONS	All strains were grown shaking at <Temp> 37 °C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 	MOPS complete-glucose liquid media	Medium	0.997703262596842	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421265SRR4421266	GSE88725	GSM2344785	GPL14548	28301469	WT_exp3_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	growth_protocol	All strains were grown shaking at 37°C  in 200mL cultures of MOPS complete-glucose liquid media (unless otherwise annotated) in 1L flasks and cells were harvested at OD(420nm) between 0.4 - 0.6 PGCGROWTHCONDITIONS	All strains were grown shaking at <Temp> 37 °C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 	MOPS complete-glucose liquid media	Medium	0.997703262596842	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421267	GSE88725	GSM2344786	GPL14548	28301469	WT_exp4_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	growth_protocol	All strains were grown shaking at 37°C  in 200mL cultures of MOPS complete-glucose liquid media (unless otherwise annotated) in 1L flasks and cells were harvested at OD(420nm) between 0.4 - 0.6 PGCGROWTHCONDITIONS	All strains were grown shaking at <Temp> 37 °C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 	MOPS complete-glucose liquid media	Medium	0.997703262596842	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421268	GSE88725	GSM2344787	GPL14548	28301469	∆RF3_exp1_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	growth_protocol	All strains were grown shaking at 37°C  in 200mL cultures of MOPS complete-glucose liquid media (unless otherwise annotated) in 1L flasks and cells were harvested at OD(420nm) between 0.4 - 0.6 PGCGROWTHCONDITIONS	All strains were grown shaking at <Temp> 37 °C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 	MOPS complete-glucose liquid media	Medium	0.997703262596842	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421268	GSE88725	GSM2344787	GPL14548	28301469	∆RF3_exp1_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	strain: K12 MG1655 deltaprfC PGCGROWTHCONDITIONS	strain : <Gtype> K12 MG1655 deltaprfC </Gtype> 	K12 MG1655 deltaprfC	Genetic background	0.9717932625344826	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421269SRR4421270	GSE88725	GSM2344788	GPL14548	28301469	∆RF3_exp3_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	growth_protocol	All strains were grown shaking at 37°C  in 200mL cultures of MOPS complete-glucose liquid media (unless otherwise annotated) in 1L flasks and cells were harvested at OD(420nm) between 0.4 - 0.6 PGCGROWTHCONDITIONS	All strains were grown shaking at <Temp> 37 °C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 	MOPS complete-glucose liquid media	Medium	0.997703262596842	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421269SRR4421270	GSE88725	GSM2344788	GPL14548	28301469	∆RF3_exp3_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	strain: K12 MG1655 deltaprfC PGCGROWTHCONDITIONS	strain : <Gtype> K12 MG1655 deltaprfC </Gtype> 	K12 MG1655 deltaprfC	Genetic background	0.9717932625344826	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421271	GSE88725	GSM2344789	GPL14548	28301469	RF2*_exp1_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	growth_protocol	All strains were grown shaking at 37°C  in 200mL cultures of MOPS complete-glucose liquid media (unless otherwise annotated) in 1L flasks and cells were harvested at OD(420nm) between 0.4 - 0.6 PGCGROWTHCONDITIONS	All strains were grown shaking at <Temp> 37 °C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 	MOPS complete-glucose liquid media	Medium	0.997703262596842	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421271	GSE88725	GSM2344789	GPL14548	28301469	RF2*_exp1_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	strain: K12 MG1655 prfB-Bstrain allele PGCGROWTHCONDITIONS	strain : <Gtype> K12 MG1655 prfB-Bstrain allele </Gtype> 	K12 MG1655 prfB-Bstrain allele	Genetic background	0.9740421992289804	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421272SRR4421273	GSE88725	GSM2344790	GPL14548	28301469	RF2*_exp3_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	growth_protocol	All strains were grown shaking at 37°C  in 200mL cultures of MOPS complete-glucose liquid media (unless otherwise annotated) in 1L flasks and cells were harvested at OD(420nm) between 0.4 - 0.6 PGCGROWTHCONDITIONS	All strains were grown shaking at <Temp> 37 °C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 	MOPS complete-glucose liquid media	Medium	0.997703262596842	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421272SRR4421273	GSE88725	GSM2344790	GPL14548	28301469	RF2*_exp3_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	strain: K12 MG1655 prfB-Bstrain allele PGCGROWTHCONDITIONS	strain : <Gtype> K12 MG1655 prfB-Bstrain allele </Gtype> 	K12 MG1655 prfB-Bstrain allele	Genetic background	0.9740421992289804	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421274	GSE88725	GSM2344791	GPL14548	28301469	RF2*∆RF3_exp2_repA_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	growth_protocol	All strains were grown shaking at 37°C  in 200mL cultures of MOPS complete-glucose liquid media (unless otherwise annotated) in 1L flasks and cells were harvested at OD(420nm) between 0.4 - 0.6 PGCGROWTHCONDITIONS	All strains were grown shaking at <Temp> 37 °C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 	MOPS complete-glucose liquid media	Medium	0.997703262596842	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421274	GSE88725	GSM2344791	GPL14548	28301469	RF2*∆RF3_exp2_repA_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	strain: K12 MG1655 prfB-Bstrain allele deltaprfC PGCGROWTHCONDITIONS	strain : <Gtype> K12 MG1655 prfB-Bstrain allele deltaprfC </Gtype> 	K12 MG1655 prfB-Bstrain allele deltaprfC	Genetic background	0.9878962145205156	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421275	GSE88725	GSM2344792	GPL14548	28301469	RF2*∆RF3_exp2_repB_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	growth_protocol	All strains were grown shaking at 37°C  in 200mL cultures of MOPS complete-glucose liquid media (unless otherwise annotated) in 1L flasks and cells were harvested at OD(420nm) between 0.4 - 0.6 PGCGROWTHCONDITIONS	All strains were grown shaking at <Temp> 37 °C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 	MOPS complete-glucose liquid media	Medium	0.997703262596842	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421275	GSE88725	GSM2344792	GPL14548	28301469	RF2*∆RF3_exp2_repB_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	strain: K12 MG1655 prfB-Bstrain allele deltaprfC PGCGROWTHCONDITIONS	strain : <Gtype> K12 MG1655 prfB-Bstrain allele deltaprfC </Gtype> 	K12 MG1655 prfB-Bstrain allele deltaprfC	Genetic background	0.9878962145205156	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421276SRR4421277	GSE88725	GSM2344793	GPL14548	28301469	RF2*∆RF3_exp3_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	growth_protocol	All strains were grown shaking at 37°C  in 200mL cultures of MOPS complete-glucose liquid media (unless otherwise annotated) in 1L flasks and cells were harvested at OD(420nm) between 0.4 - 0.6 PGCGROWTHCONDITIONS	All strains were grown shaking at <Temp> 37 °C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 	MOPS complete-glucose liquid media	Medium	0.997703262596842	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421276SRR4421277	GSE88725	GSM2344793	GPL14548	28301469	RF2*∆RF3_exp3_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	strain: K12 MG1655 prfB-Bstrain allele deltaprfC PGCGROWTHCONDITIONS	strain : <Gtype> K12 MG1655 prfB-Bstrain allele deltaprfC </Gtype> 	K12 MG1655 prfB-Bstrain allele deltaprfC	Genetic background	0.9878962145205156	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421278	GSE88725	GSM2344794	GPL14548	28301469	RF2*∆RF3_exp4_repA_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	growth_protocol	All strains were grown shaking at 37°C  in 200mL cultures of MOPS complete-glucose liquid media (unless otherwise annotated) in 1L flasks and cells were harvested at OD(420nm) between 0.4 - 0.6 PGCGROWTHCONDITIONS	All strains were grown shaking at <Temp> 37 °C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 	MOPS complete-glucose liquid media	Medium	0.997703262596842	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421278	GSE88725	GSM2344794	GPL14548	28301469	RF2*∆RF3_exp4_repA_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	strain: K12 MG1655 prfB-Bstrain allele deltaprfC PGCGROWTHCONDITIONS	strain : <Gtype> K12 MG1655 prfB-Bstrain allele deltaprfC </Gtype> 	K12 MG1655 prfB-Bstrain allele deltaprfC	Genetic background	0.9878962145205156	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421279	GSE88725	GSM2344795	GPL14548	28301469	RF2*∆RF3_exp4_repB_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	growth_protocol	All strains were grown shaking at 37°C  in 200mL cultures of MOPS complete-glucose liquid media (unless otherwise annotated) in 1L flasks and cells were harvested at OD(420nm) between 0.4 - 0.6 PGCGROWTHCONDITIONS	All strains were grown shaking at <Temp> 37 °C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 	MOPS complete-glucose liquid media	Medium	0.997703262596842	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421279	GSE88725	GSM2344795	GPL14548	28301469	RF2*∆RF3_exp4_repB_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	strain: K12 MG1655 prfB-Bstrain allele deltaprfC PGCGROWTHCONDITIONS	strain : <Gtype> K12 MG1655 prfB-Bstrain allele deltaprfC </Gtype> 	K12 MG1655 prfB-Bstrain allele deltaprfC	Genetic background	0.9878962145205156	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421297	GSE88725	GSM2344809	GPL14548	28301469	WT_minimal_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	growth_protocol	All strains were grown shaking at 37°C  in 200mL cultures of MOPS complete-glucose liquid media (unless otherwise annotated) in 1L flasks and cells were harvested at OD(420nm) between 0.4 - 0.6 PGCGROWTHCONDITIONS	All strains were grown shaking at <Temp> 37 °C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 	MOPS complete-glucose liquid media	Medium	0.997703262596842	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421298	GSE88725	GSM2344810	GPL14548	28301469	∆RF3_minimal_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	growth_protocol	All strains were grown shaking at 37°C  in 200mL cultures of MOPS complete-glucose liquid media (unless otherwise annotated) in 1L flasks and cells were harvested at OD(420nm) between 0.4 - 0.6 PGCGROWTHCONDITIONS	All strains were grown shaking at <Temp> 37 °C </Temp> in 200mL cultures of <Med> MOPS complete-glucose liquid media </Med> ( unless otherwise annotated ) in 1L flasks and cells were harvested at OD ( 420nm ) between 0.4 - 0.6 	MOPS complete-glucose liquid media	Medium	0.997703262596842	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4421298	GSE88725	GSM2344810	GPL14548	28301469	∆RF3_minimal_mRNA	Global analysis of translation termination in E. coli using release factor manipulations	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	characteristics	strain: K12 MG1655 deltaprfC PGCGROWTHCONDITIONS	strain : <Gtype> K12 MG1655 deltaprfC </Gtype> 	K12 MG1655 deltaprfC	Genetic background	0.9717932625344826	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88725/GSE88725.soft.gz				0	0	False
SRR4435464	GSE88980	GSM2356687	GPL17439	28526842	WT NaCl 1	Revealing the genome-scale transcriptional regulatory landscape of OmpR highlights its expanded regulatory roles and unexpected importance of narU under osmotic stress in Escherichia coli K-12 MG1655 [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli K-12 MG1655 WT and ΔompR were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. Then cells were treated with 0.3 M of NaCl at mid-log pahse for 30 min with agitation. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT and ΔompR were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . Then cells were treated with <Supp> 0.3 M of NaCl </Supp> at mid-log pahse for <Supp> 30 min </Supp> with agitation . 	30 min	Medium supplement	0.9163856147817329	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz				0	0	False
SRR4435464	GSE88980	GSM2356687	GPL17439	28526842	WT NaCl 1	Revealing the genome-scale transcriptional regulatory landscape of OmpR highlights its expanded regulatory roles and unexpected importance of narU under osmotic stress in Escherichia coli K-12 MG1655 [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz				0	0	False
SRR4435464	GSE88980	GSM2356687	GPL17439	28526842	WT NaCl 1	Revealing the genome-scale transcriptional regulatory landscape of OmpR highlights its expanded regulatory roles and unexpected importance of narU under osmotic stress in Escherichia coli K-12 MG1655 [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz				0	0	False
SRR4435465	GSE88980	GSM2356688	GPL17439	28526842	WT NaCl 2	Revealing the genome-scale transcriptional regulatory landscape of OmpR highlights its expanded regulatory roles and unexpected importance of narU under osmotic stress in Escherichia coli K-12 MG1655 [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli K-12 MG1655 WT and ΔompR were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. Then cells were treated with 0.3 M of NaCl at mid-log pahse for 30 min with agitation. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT and ΔompR were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . Then cells were treated with <Supp> 0.3 M of NaCl </Supp> at mid-log pahse for <Supp> 30 min </Supp> with agitation . 	30 min	Medium supplement	0.9163856147817329	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz				0	0	False
SRR4435465	GSE88980	GSM2356688	GPL17439	28526842	WT NaCl 2	Revealing the genome-scale transcriptional regulatory landscape of OmpR highlights its expanded regulatory roles and unexpected importance of narU under osmotic stress in Escherichia coli K-12 MG1655 [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz				0	0	False
SRR4435465	GSE88980	GSM2356688	GPL17439	28526842	WT NaCl 2	Revealing the genome-scale transcriptional regulatory landscape of OmpR highlights its expanded regulatory roles and unexpected importance of narU under osmotic stress in Escherichia coli K-12 MG1655 [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz				0	0	False
SRR4435466	GSE88980	GSM2356689	GPL17439	28526842	ΔompR NaCl 1	Revealing the genome-scale transcriptional regulatory landscape of OmpR highlights its expanded regulatory roles and unexpected importance of narU under osmotic stress in Escherichia coli K-12 MG1655 [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli K-12 MG1655 WT and ΔompR were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. Then cells were treated with 0.3 M of NaCl at mid-log pahse for 30 min with agitation. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT and ΔompR were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . Then cells were treated with <Supp> 0.3 M of NaCl </Supp> at mid-log pahse for <Supp> 30 min </Supp> with agitation . 	30 min	Medium supplement	0.9163856147817329	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz				0	0	False
SRR4435466	GSE88980	GSM2356689	GPL17439	28526842	ΔompR NaCl 1	Revealing the genome-scale transcriptional regulatory landscape of OmpR highlights its expanded regulatory roles and unexpected importance of narU under osmotic stress in Escherichia coli K-12 MG1655 [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz				0	0	False
SRR4435466	GSE88980	GSM2356689	GPL17439	28526842	ΔompR NaCl 1	Revealing the genome-scale transcriptional regulatory landscape of OmpR highlights its expanded regulatory roles and unexpected importance of narU under osmotic stress in Escherichia coli K-12 MG1655 [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz				0	0	False
SRR4435466	GSE88980	GSM2356689	GPL17439	28526842	ΔompR NaCl 1	Revealing the genome-scale transcriptional regulatory landscape of OmpR highlights its expanded regulatory roles and unexpected importance of narU under osmotic stress in Escherichia coli K-12 MG1655 [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: ompR deletion mutant PGCGROWTHCONDITIONS	genotype : <Gtype> ompR deletion mutant </Gtype> 	ompR deletion mutant	Genetic background	0.9845125495600732	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz				0	0	False
SRR4435467	GSE88980	GSM2356690	GPL17439	28526842	ΔompR NaCl 2	Revealing the genome-scale transcriptional regulatory landscape of OmpR highlights its expanded regulatory roles and unexpected importance of narU under osmotic stress in Escherichia coli K-12 MG1655 [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	growth_protocol	E. coli K-12 MG1655 WT and ΔompR were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. Then cells were treated with 0.3 M of NaCl at mid-log pahse for 30 min with agitation. PGCGROWTHCONDITIONS	E. coli K-12 MG1655 WT and ΔompR were grown to <Phase> mid-log phase </Phase> <Air> aerobically </Air> at <Temp> 37 °C </Temp> in <Med> M9 minimal media </Med> supplemented with <Supp> 0.2 % glucose </Supp> . Then cells were treated with <Supp> 0.3 M of NaCl </Supp> at mid-log pahse for <Supp> 30 min </Supp> with agitation . 	30 min	Medium supplement	0.9163856147817329	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz				0	0	False
SRR4435467	GSE88980	GSM2356690	GPL17439	28526842	ΔompR NaCl 2	Revealing the genome-scale transcriptional regulatory landscape of OmpR highlights its expanded regulatory roles and unexpected importance of narU under osmotic stress in Escherichia coli K-12 MG1655 [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz				0	0	False
SRR4435467	GSE88980	GSM2356690	GPL17439	28526842	ΔompR NaCl 2	Revealing the genome-scale transcriptional regulatory landscape of OmpR highlights its expanded regulatory roles and unexpected importance of narU under osmotic stress in Escherichia coli K-12 MG1655 [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz				0	0	False
SRR4435467	GSE88980	GSM2356690	GPL17439	28526842	ΔompR NaCl 2	Revealing the genome-scale transcriptional regulatory landscape of OmpR highlights its expanded regulatory roles and unexpected importance of narU under osmotic stress in Escherichia coli K-12 MG1655 [RNA-seq]	GPL17439: Illumina MiSeq (Escherichia coli str. K-12 substr. MG1655)	characteristics	genotype: ompR deletion mutant PGCGROWTHCONDITIONS	genotype : <Gtype> ompR deletion mutant </Gtype> 	ompR deletion mutant	Genetic background	0.9845125495600732	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE88980/GSE88980.soft.gz				0	0	False
SRR4896361	GSE89507	GSM2374957	GPL22638	30013537	0min minus ciprofloxacin	Identification of ciprofloxacin helper drug targets by RNA-seq	GPL22638: Illumina MiSeq (Escherichia coli O25b:H4-ST131)	treatment_protocol	E. coli ST131 UR40 was treated with ciprofloxacin (2µg/mL) and samples were taken at time points 0 min, 30 min and 90min. PGCGROWTHCONDITIONS	E. coli ST131 UR40 was treated with ciprofloxacin ( 2µg/mL ) and samples were taken at time points 0 min , <Supp> 30 min </Supp> and 90 min . 	30 min	Medium supplement	0.9565081970675215	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz				0	0	False
SRR4896361	GSE89507	GSM2374957	GPL22638	30013537	0min minus ciprofloxacin	Identification of ciprofloxacin helper drug targets by RNA-seq	GPL22638: Illumina MiSeq (Escherichia coli O25b:H4-ST131)	characteristics	time point: 0min PGCGROWTHCONDITIONS	time point : <Supp> 0 min </Supp> 	0 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz				0	0	False
SRR4896362	GSE89507	GSM2374958	GPL22638	30013537	0min plus ciprofloxacin	Identification of ciprofloxacin helper drug targets by RNA-seq	GPL22638: Illumina MiSeq (Escherichia coli O25b:H4-ST131)	treatment_protocol	E. coli ST131 UR40 was treated with ciprofloxacin (2µg/mL) and samples were taken at time points 0 min, 30 min and 90min. PGCGROWTHCONDITIONS	E. coli ST131 UR40 was treated with ciprofloxacin ( 2µg/mL ) and samples were taken at time points 0 min , <Supp> 30 min </Supp> and 90 min . 	30 min	Medium supplement	0.9565081970675215	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz				0	0	False
SRR4896362	GSE89507	GSM2374958	GPL22638	30013537	0min plus ciprofloxacin	Identification of ciprofloxacin helper drug targets by RNA-seq	GPL22638: Illumina MiSeq (Escherichia coli O25b:H4-ST131)	characteristics	time point: 0min PGCGROWTHCONDITIONS	time point : <Supp> 0 min </Supp> 	0 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz				0	0	False
SRR4896363	GSE89507	GSM2374959	GPL22638	30013537	30min minus ciprofloxacin	Identification of ciprofloxacin helper drug targets by RNA-seq	GPL22638: Illumina MiSeq (Escherichia coli O25b:H4-ST131)	source_name	Clinical isolate, minus ciprofloxacin, 30min PGCGROWTHCONDITIONS	Clinical isolate , minus ciprofloxacin , <Supp> 30 min </Supp> 	30 min	Medium supplement	0.998020807091452	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz				0	0	False
SRR4896363	GSE89507	GSM2374959	GPL22638	30013537	30min minus ciprofloxacin	Identification of ciprofloxacin helper drug targets by RNA-seq	GPL22638: Illumina MiSeq (Escherichia coli O25b:H4-ST131)	treatment_protocol	E. coli ST131 UR40 was treated with ciprofloxacin (2µg/mL) and samples were taken at time points 0 min, 30 min and 90min. PGCGROWTHCONDITIONS	E. coli ST131 UR40 was treated with ciprofloxacin ( 2µg/mL ) and samples were taken at time points 0 min , <Supp> 30 min </Supp> and 90 min . 	30 min	Medium supplement	0.9565081970675215	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz				0	0	False
SRR4896363	GSE89507	GSM2374959	GPL22638	30013537	30min minus ciprofloxacin	Identification of ciprofloxacin helper drug targets by RNA-seq	GPL22638: Illumina MiSeq (Escherichia coli O25b:H4-ST131)	characteristics	time point: 30min PGCGROWTHCONDITIONS	time point : <Supp> 30 min </Supp> 	30 min	Medium supplement	0.9998452292474532	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz				0	0	False
SRR4896364	GSE89507	GSM2374960	GPL22638	30013537	30min plus ciprofloxacin	Identification of ciprofloxacin helper drug targets by RNA-seq	GPL22638: Illumina MiSeq (Escherichia coli O25b:H4-ST131)	source_name	Clinical isolate, plus ciprofloxacin, 30min PGCGROWTHCONDITIONS	Clinical isolate , plus ciprofloxacin , <Supp> 30 min </Supp> 	30 min	Medium supplement	0.998020807091452	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz				0	0	False
SRR4896364	GSE89507	GSM2374960	GPL22638	30013537	30min plus ciprofloxacin	Identification of ciprofloxacin helper drug targets by RNA-seq	GPL22638: Illumina MiSeq (Escherichia coli O25b:H4-ST131)	treatment_protocol	E. coli ST131 UR40 was treated with ciprofloxacin (2µg/mL) and samples were taken at time points 0 min, 30 min and 90min. PGCGROWTHCONDITIONS	E. coli ST131 UR40 was treated with ciprofloxacin ( 2µg/mL ) and samples were taken at time points 0 min , <Supp> 30 min </Supp> and 90 min . 	30 min	Medium supplement	0.9565081970675215	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz				0	0	False
SRR4896364	GSE89507	GSM2374960	GPL22638	30013537	30min plus ciprofloxacin	Identification of ciprofloxacin helper drug targets by RNA-seq	GPL22638: Illumina MiSeq (Escherichia coli O25b:H4-ST131)	characteristics	time point: 30min PGCGROWTHCONDITIONS	time point : <Supp> 30 min </Supp> 	30 min	Medium supplement	0.9998452292474532	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz				0	0	False
SRR4896365	GSE89507	GSM2374961	GPL22638	30013537	90min minus ciprofloxacin	Identification of ciprofloxacin helper drug targets by RNA-seq	GPL22638: Illumina MiSeq (Escherichia coli O25b:H4-ST131)	treatment_protocol	E. coli ST131 UR40 was treated with ciprofloxacin (2µg/mL) and samples were taken at time points 0 min, 30 min and 90min. PGCGROWTHCONDITIONS	E. coli ST131 UR40 was treated with ciprofloxacin ( 2µg/mL ) and samples were taken at time points 0 min , <Supp> 30 min </Supp> and 90 min . 	30 min	Medium supplement	0.9565081970675215	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz				0	0	False
SRR4896365	GSE89507	GSM2374961	GPL22638	30013537	90min minus ciprofloxacin	Identification of ciprofloxacin helper drug targets by RNA-seq	GPL22638: Illumina MiSeq (Escherichia coli O25b:H4-ST131)	characteristics	time point: 90min PGCGROWTHCONDITIONS	time point : <Supp> 90 min </Supp> 	90 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz				0	0	False
SRR4896366	GSE89507	GSM2374962	GPL22638	30013537	90min plus ciprofloxacin	Identification of ciprofloxacin helper drug targets by RNA-seq	GPL22638: Illumina MiSeq (Escherichia coli O25b:H4-ST131)	treatment_protocol	E. coli ST131 UR40 was treated with ciprofloxacin (2µg/mL) and samples were taken at time points 0 min, 30 min and 90min. PGCGROWTHCONDITIONS	E. coli ST131 UR40 was treated with ciprofloxacin ( 2µg/mL ) and samples were taken at time points 0 min , <Supp> 30 min </Supp> and 90 min . 	30 min	Medium supplement	0.9565081970675215	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz				0	0	False
SRR4896366	GSE89507	GSM2374962	GPL22638	30013537	90min plus ciprofloxacin	Identification of ciprofloxacin helper drug targets by RNA-seq	GPL22638: Illumina MiSeq (Escherichia coli O25b:H4-ST131)	characteristics	time point: 90min PGCGROWTHCONDITIONS	time point : <Supp> 90 min </Supp> 	90 min	Medium supplement	0.9928858289861392	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE89507/GSE89507.soft.gz				0	0	False
SRR5036057	GSE90056	GSM2396709	GPL15010	29183994	ecoli_k12_pBAD_30C_m_1	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036057	GSE90056	GSM2396709	GPL15010	29183994	ecoli_k12_pBAD_30C_m_1	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036059	GSE90056	GSM2396711	GPL15010	29183994	ecoli_k12_pBADsigma32wt_30C_m_1	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036059	GSE90056	GSM2396711	GPL15010	29183994	ecoli_k12_pBADsigma32wt_30C_m_1	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036061	GSE90056	GSM2396713	GPL15010	29183994	ecoli_k12_pBAD_30C_m_2	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036061	GSE90056	GSM2396713	GPL15010	29183994	ecoli_k12_pBAD_30C_m_2	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036063	GSE90056	GSM2396715	GPL15010	29183994	ecoli_k12_pBADsigma32wt_30C_m_2	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036063	GSE90056	GSM2396715	GPL15010	29183994	ecoli_k12_pBADsigma32wt_30C_m_2	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036065	GSE90056	GSM2396717	GPL15010	29183994	ecoli_k12_pBAD_30C_m_3	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036065	GSE90056	GSM2396717	GPL15010	29183994	ecoli_k12_pBAD_30C_m_3	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036067	GSE90056	GSM2396719	GPL15010	29183994	ecoli_k12_pBADsigma32wt_30C_m_3	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036067	GSE90056	GSM2396719	GPL15010	29183994	ecoli_k12_pBADsigma32wt_30C_m_3	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036069	GSE90056	GSM2396721	GPL15010	29183994	ecoli_k12_30C_m_1	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036069	GSE90056	GSM2396721	GPL15010	29183994	ecoli_k12_30C_m_1	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036069	GSE90056	GSM2396721	GPL15010	29183994	ecoli_k12_30C_m_1	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	heat shock time: 0min PGCGROWTHCONDITIONS	heat shock time : <Supp> 0 min </Supp> 	0 min	Medium supplement	0.9928925422553888	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036071	GSE90056	GSM2396723	GPL15010	29183994	ecoli_k12_42C_10min_m_1	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036071	GSE90056	GSM2396723	GPL15010	29183994	ecoli_k12_42C_10min_m_1	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036071	GSE90056	GSM2396723	GPL15010	29183994	ecoli_k12_42C_10min_m_1	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	heat shock time: 10min PGCGROWTHCONDITIONS	heat shock time : <Supp> 10 min </Supp> 	10 min	Medium supplement	0.9948803493287448	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036073	GSE90056	GSM2396725	GPL15010	29183994	ecoli_k12_42C_20min_m_1	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036073	GSE90056	GSM2396725	GPL15010	29183994	ecoli_k12_42C_20min_m_1	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036073	GSE90056	GSM2396725	GPL15010	29183994	ecoli_k12_42C_20min_m_1	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	heat shock time: 20min PGCGROWTHCONDITIONS	heat shock time : <Supp> 20 min </Supp> 	20 min	Medium supplement	0.9994514582385332	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036075	GSE90056	GSM2396727	GPL15010	29183994	ecoli_k12_30C_m_2	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036075	GSE90056	GSM2396727	GPL15010	29183994	ecoli_k12_30C_m_2	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036075	GSE90056	GSM2396727	GPL15010	29183994	ecoli_k12_30C_m_2	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	heat shock time: 0min PGCGROWTHCONDITIONS	heat shock time : <Supp> 0 min </Supp> 	0 min	Medium supplement	0.9928925422553888	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036077	GSE90056	GSM2396729	GPL15010	29183994	ecoli_k12_42C_10min_m_2	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036077	GSE90056	GSM2396729	GPL15010	29183994	ecoli_k12_42C_10min_m_2	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036077	GSE90056	GSM2396729	GPL15010	29183994	ecoli_k12_42C_10min_m_2	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	heat shock time: 10min PGCGROWTHCONDITIONS	heat shock time : <Supp> 10 min </Supp> 	10 min	Medium supplement	0.9948803493287448	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036079	GSE90056	GSM2396731	GPL15010	29183994	ecoli_k12_42C_20min_m_2	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036079	GSE90056	GSM2396731	GPL15010	29183994	ecoli_k12_42C_20min_m_2	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036079	GSE90056	GSM2396731	GPL15010	29183994	ecoli_k12_42C_20min_m_2	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	heat shock time: 20min PGCGROWTHCONDITIONS	heat shock time : <Supp> 20 min </Supp> 	20 min	Medium supplement	0.9994514582385332	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036081	GSE90056	GSM2396733	GPL15010	29183994	ecoli_k12_30C_m_3	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036081	GSE90056	GSM2396733	GPL15010	29183994	ecoli_k12_30C_m_3	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036081	GSE90056	GSM2396733	GPL15010	29183994	ecoli_k12_30C_m_3	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	heat shock time: 0min PGCGROWTHCONDITIONS	heat shock time : <Supp> 0 min </Supp> 	0 min	Medium supplement	0.9928925422553888	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036083	GSE90056	GSM2396735	GPL15010	29183994	ecoli_k12_42C_10min_m_3	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036083	GSE90056	GSM2396735	GPL15010	29183994	ecoli_k12_42C_10min_m_3	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036083	GSE90056	GSM2396735	GPL15010	29183994	ecoli_k12_42C_10min_m_3	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	heat shock time: 10min PGCGROWTHCONDITIONS	heat shock time : <Supp> 10 min </Supp> 	10 min	Medium supplement	0.9948803493287448	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036085	GSE90056	GSM2396737	GPL15010	29183994	ecoli_k12_42C_20min_m_3	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036085	GSE90056	GSM2396737	GPL15010	29183994	ecoli_k12_42C_20min_m_3	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036085	GSE90056	GSM2396737	GPL15010	29183994	ecoli_k12_42C_20min_m_3	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	characteristics	heat shock time: 20min PGCGROWTHCONDITIONS	heat shock time : <Supp> 20 min </Supp> 	20 min	Medium supplement	0.9994514582385332	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036087	GSE90056	GSM2396739	GPL15010	29183994	ecoli_k12_pBAD_30C_m_4	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036087	GSE90056	GSM2396739	GPL15010	29183994	ecoli_k12_pBAD_30C_m_4	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036089	GSE90056	GSM2396741	GPL15010	29183994	ecoli_k12_pBADsigma32I54N_30C_m_1	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036089	GSE90056	GSM2396741	GPL15010	29183994	ecoli_k12_pBADsigma32I54N_30C_m_1	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036091	GSE90056	GSM2396743	GPL15010	29183994	ecoli_k12_pBADsigma32I54N_30C_m_2	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5036091	GSE90056	GSM2396743	GPL15010	29183994	ecoli_k12_pBADsigma32I54N_30C_m_2	Translation efficiency is maintained during heat shock in Escherichia coli	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90056/GSE90056.soft.gz				0	0	False
SRR5071589	GSE90743	GSM2411669	GPL18133	2844739128702020	chemostat STR-PFR culture STR 5min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071589	GSE90743	GSM2411669	GPL18133	2844739128702020	chemostat STR-PFR culture STR 5min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 5min PGCGROWTHCONDITIONS	time : <Supp> 5 min </Supp> 	5 min	Medium supplement	0.9925997083726088	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071590	GSE90743	GSM2411670	GPL18133	2844739128702020	chemostat STR-PFR culture STR 10min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071590	GSE90743	GSM2411670	GPL18133	2844739128702020	chemostat STR-PFR culture STR 10min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 10min PGCGROWTHCONDITIONS	time : <Supp> 10 min </Supp> 	10 min	Medium supplement	0.994867209487664	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071591	GSE90743	GSM2411671	GPL18133	2844739128702020	chemostat STR-PFR culture STR 25min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071591	GSE90743	GSM2411671	GPL18133	2844739128702020	chemostat STR-PFR culture STR 25min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 25min PGCGROWTHCONDITIONS	time : <Supp> 25 min </Supp> 	25 min	Medium supplement	0.99283140142451	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071592	GSE90743	GSM2411672	GPL18133	2844739128702020	chemostat STR-PFR culture STR 45min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071592	GSE90743	GSM2411672	GPL18133	2844739128702020	chemostat STR-PFR culture STR 45min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 45min PGCGROWTHCONDITIONS	time : <Supp> 45 min </Supp> 	45 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071593	GSE90743	GSM2411673	GPL18133	2844739128702020	chemostat STR-PFR culture STR 75min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071593	GSE90743	GSM2411673	GPL18133	2844739128702020	chemostat STR-PFR culture STR 75min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 75min PGCGROWTHCONDITIONS	time : <Supp> 75 min </Supp> 	75 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071594	GSE90743	GSM2411674	GPL18133	2844739128702020	chemostat STR-PFR culture STR 120min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071594	GSE90743	GSM2411674	GPL18133	2844739128702020	chemostat STR-PFR culture STR 120min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 120min PGCGROWTHCONDITIONS	time : <Supp> 120 min </Supp> 	120 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071595	GSE90743	GSM2411675	GPL18133	2844739128702020	chemostat STR-PFR culture STR 210min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071595	GSE90743	GSM2411675	GPL18133	2844739128702020	chemostat STR-PFR culture STR 210min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 210min PGCGROWTHCONDITIONS	time : <Supp> 210 min </Supp> 	210 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071596	GSE90743	GSM2411676	GPL18133	2844739128702020	chemostat STR-PFR culture STR 330min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071596	GSE90743	GSM2411676	GPL18133	2844739128702020	chemostat STR-PFR culture STR 330min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 330min PGCGROWTHCONDITIONS	time : <Supp> 330 min </Supp> 	330 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071597	GSE90743	GSM2411677	GPL18133	2844739128702020	chemostat STR-PFR culture STR 25h, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071598	GSE90743	GSM2411678	GPL18133	2844739128702020	chemostat STR-PFR culture STR 26h, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071599	GSE90743	GSM2411679	GPL18133	2844739128702020	chemostat STR-PFR culture STR 28h, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071600	GSE90743	GSM2411680	GPL18133	2844739128702020	chemostat STR culture STR  reference 1, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071601	GSE90743	GSM2411681	GPL18133	2844739128702020	chemostat STR culture STR  reference 2, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071602	GSE90743	GSM2411682	GPL18133	2844739128702020	chemostat STR culture STR  reference 3, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071603	GSE90743	GSM2411683	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 5min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071603	GSE90743	GSM2411683	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 5min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 5min PGCGROWTHCONDITIONS	time : <Supp> 5 min </Supp> 	5 min	Medium supplement	0.9925997083726088	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071604	GSE90743	GSM2411684	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 10min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071604	GSE90743	GSM2411684	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 10min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 10min PGCGROWTHCONDITIONS	time : <Supp> 10 min </Supp> 	10 min	Medium supplement	0.994867209487664	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071605	GSE90743	GSM2411685	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 25min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071605	GSE90743	GSM2411685	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 25min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 25min PGCGROWTHCONDITIONS	time : <Supp> 25 min </Supp> 	25 min	Medium supplement	0.99283140142451	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071606	GSE90743	GSM2411686	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P3 25min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071606	GSE90743	GSM2411686	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P3 25min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 25min PGCGROWTHCONDITIONS	time : <Supp> 25 min </Supp> 	25 min	Medium supplement	0.99283140142451	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071607	GSE90743	GSM2411687	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P1 25min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071607	GSE90743	GSM2411687	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P1 25min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 25min PGCGROWTHCONDITIONS	time : <Supp> 25 min </Supp> 	25 min	Medium supplement	0.99283140142451	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071608	GSE90743	GSM2411688	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 45min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071608	GSE90743	GSM2411688	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 45min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 45min PGCGROWTHCONDITIONS	time : <Supp> 45 min </Supp> 	45 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071609	GSE90743	GSM2411689	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 120min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071609	GSE90743	GSM2411689	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 120min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 120min PGCGROWTHCONDITIONS	time : <Supp> 120 min </Supp> 	120 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071610	GSE90743	GSM2411690	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P3 120min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071610	GSE90743	GSM2411690	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P3 120min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 120min PGCGROWTHCONDITIONS	time : <Supp> 120 min </Supp> 	120 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071611	GSE90743	GSM2411691	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P1 120min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071611	GSE90743	GSM2411691	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P1 120min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 120min PGCGROWTHCONDITIONS	time : <Supp> 120 min </Supp> 	120 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071612	GSE90743	GSM2411692	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 210min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071612	GSE90743	GSM2411692	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 210min, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 210min PGCGROWTHCONDITIONS	time : <Supp> 210 min </Supp> 	210 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071613	GSE90743	GSM2411693	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 25h, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071614	GSE90743	GSM2411694	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P3 28h, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071615	GSE90743	GSM2411695	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 28h, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071616	GSE90743	GSM2411696	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P1 28h, rep1	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071617	GSE90743	GSM2411697	GPL18133	2844739128702020	chemostat STR-PFR culture STR 5min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071617	GSE90743	GSM2411697	GPL18133	2844739128702020	chemostat STR-PFR culture STR 5min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 5min PGCGROWTHCONDITIONS	time : <Supp> 5 min </Supp> 	5 min	Medium supplement	0.9925997083726088	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071618	GSE90743	GSM2411698	GPL18133	2844739128702020	chemostat STR-PFR culture STR 10min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071618	GSE90743	GSM2411698	GPL18133	2844739128702020	chemostat STR-PFR culture STR 10min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 10min PGCGROWTHCONDITIONS	time : <Supp> 10 min </Supp> 	10 min	Medium supplement	0.994867209487664	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071619	GSE90743	GSM2411699	GPL18133	2844739128702020	chemostat STR-PFR culture STR 25min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071619	GSE90743	GSM2411699	GPL18133	2844739128702020	chemostat STR-PFR culture STR 25min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 25min PGCGROWTHCONDITIONS	time : <Supp> 25 min </Supp> 	25 min	Medium supplement	0.99283140142451	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071620	GSE90743	GSM2411700	GPL18133	2844739128702020	chemostat STR-PFR culture STR 45min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071620	GSE90743	GSM2411700	GPL18133	2844739128702020	chemostat STR-PFR culture STR 45min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 45min PGCGROWTHCONDITIONS	time : <Supp> 45 min </Supp> 	45 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071621	GSE90743	GSM2411701	GPL18133	2844739128702020	chemostat STR-PFR culture STR 75min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071621	GSE90743	GSM2411701	GPL18133	2844739128702020	chemostat STR-PFR culture STR 75min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 75min PGCGROWTHCONDITIONS	time : <Supp> 75 min </Supp> 	75 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071622	GSE90743	GSM2411702	GPL18133	2844739128702020	chemostat STR-PFR culture STR 120min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071622	GSE90743	GSM2411702	GPL18133	2844739128702020	chemostat STR-PFR culture STR 120min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 120min PGCGROWTHCONDITIONS	time : <Supp> 120 min </Supp> 	120 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071623	GSE90743	GSM2411703	GPL18133	2844739128702020	chemostat STR-PFR culture STR 210min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071623	GSE90743	GSM2411703	GPL18133	2844739128702020	chemostat STR-PFR culture STR 210min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 210min PGCGROWTHCONDITIONS	time : <Supp> 210 min </Supp> 	210 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071624	GSE90743	GSM2411704	GPL18133	2844739128702020	chemostat STR-PFR culture STR 330min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071624	GSE90743	GSM2411704	GPL18133	2844739128702020	chemostat STR-PFR culture STR 330min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 330min PGCGROWTHCONDITIONS	time : <Supp> 330 min </Supp> 	330 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071625	GSE90743	GSM2411705	GPL18133	2844739128702020	chemostat STR-PFR culture STR 25h, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071626	GSE90743	GSM2411706	GPL18133	2844739128702020	chemostat STR-PFR culture STR 26h, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071627	GSE90743	GSM2411707	GPL18133	2844739128702020	chemostat STR-PFR culture STR 28h, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071628	GSE90743	GSM2411708	GPL18133	2844739128702020	chemostat STR culture STR reference 1 , rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071629	GSE90743	GSM2411709	GPL18133	2844739128702020	chemostat STR culture STR reference 2 , rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071630	GSE90743	GSM2411710	GPL18133	2844739128702020	chemostat STR culture STR reference 3 , rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071631	GSE90743	GSM2411711	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 5min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071631	GSE90743	GSM2411711	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 5min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 5min PGCGROWTHCONDITIONS	time : <Supp> 5 min </Supp> 	5 min	Medium supplement	0.9925997083726088	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071632	GSE90743	GSM2411712	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 10min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071632	GSE90743	GSM2411712	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 10min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 10min PGCGROWTHCONDITIONS	time : <Supp> 10 min </Supp> 	10 min	Medium supplement	0.994867209487664	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071633	GSE90743	GSM2411713	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 25min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071633	GSE90743	GSM2411713	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 25min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 25min PGCGROWTHCONDITIONS	time : <Supp> 25 min </Supp> 	25 min	Medium supplement	0.99283140142451	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071634	GSE90743	GSM2411714	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P3 25min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071634	GSE90743	GSM2411714	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P3 25min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 25min PGCGROWTHCONDITIONS	time : <Supp> 25 min </Supp> 	25 min	Medium supplement	0.99283140142451	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071635	GSE90743	GSM2411715	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P1 25min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071635	GSE90743	GSM2411715	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P1 25min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 25min PGCGROWTHCONDITIONS	time : <Supp> 25 min </Supp> 	25 min	Medium supplement	0.99283140142451	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071636	GSE90743	GSM2411716	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 45min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071636	GSE90743	GSM2411716	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 45min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 45min PGCGROWTHCONDITIONS	time : <Supp> 45 min </Supp> 	45 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071637	GSE90743	GSM2411717	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 75min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071637	GSE90743	GSM2411717	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 75min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 75min PGCGROWTHCONDITIONS	time : <Supp> 75 min </Supp> 	75 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071638	GSE90743	GSM2411718	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 120min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071638	GSE90743	GSM2411718	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 120min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 120min PGCGROWTHCONDITIONS	time : <Supp> 120 min </Supp> 	120 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071639	GSE90743	GSM2411719	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P3 120min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071639	GSE90743	GSM2411719	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P3 120min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 120min PGCGROWTHCONDITIONS	time : <Supp> 120 min </Supp> 	120 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071640	GSE90743	GSM2411720	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P1 120min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071640	GSE90743	GSM2411720	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P1 120min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 120min PGCGROWTHCONDITIONS	time : <Supp> 120 min </Supp> 	120 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071641	GSE90743	GSM2411721	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 210min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071641	GSE90743	GSM2411721	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 210min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 210min PGCGROWTHCONDITIONS	time : <Supp> 210 min </Supp> 	210 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071642	GSE90743	GSM2411722	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 330min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071642	GSE90743	GSM2411722	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 330min, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	characteristics	time: 330min PGCGROWTHCONDITIONS	time : <Supp> 330 min </Supp> 	330 min	Medium supplement	0.992857750129368	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071643	GSE90743	GSM2411723	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 25h, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071644	GSE90743	GSM2411724	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 26h, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071645	GSE90743	GSM2411725	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P5 28h, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071646	GSE90743	GSM2411726	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P3 28h, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5071647	GSE90743	GSM2411727	GPL18133	2844739128702020	chemostat STR-PFR culture PFR P1 28h, rep2	RNA-seq of Escherichia coli under fluctuating ammonia availability (limitation-depletion)	GPL18133: Illumina HiSeq 2500 (Escherichia coli)	data_processing	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1)) PGCGROWTHCONDITIONS	Genome _ build : <Anti> ASM1024v1 </Anti> ( NCBI E. coli K12 subst . W3110 genome ( GenBank : <Gtype> AP009048 .1 ) ) </Gtype> 	AP009048 .1 ) )	Genetic background	0.9435779764569237	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE90743/GSE90743.soft.gz				0	0	False
SRR5085370	GSE91001	GSM2418921	GPL14548-GPL20262	28224117	ATCACG-D1	PerC manipulates metabolism and surface antigens in enteropathogenic Escherichia coli	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL20262: Illumina HiSeq 2000 (Escherichia coli O127:H6 str. E2348/69)	data_processing	Supplementary_files_format_and_content: tabular: Tabular data that informs the excel spreadsheet. The data are averaged across the three samples per strain. Both averaged strain data are presented for each gene on the same line. Data contain gene ID, gene number, locus, fragments per kilobase mapped (FPKM) for WT and mutant strains, log2(fold-change) relative epxression of WT over mutant strains, test-statistic, p-value, q-value, and significance analyzed via the cummeRbund package in R whereby a q-value of <0.05 is considered significant. PGCGROWTHCONDITIONS	<Supp> Supplementary </Supp> _ files _ format _ and _ content : <Gtype> tabular : Tabular </Gtype> data that informs the excel spreadsheet . The data are averaged across the three samples per strain . Both averaged strain data are presented for each gene on the same line . Data contain gene ID , gene number , locus , fragments per kilobase mapped ( FPKM ) for WT and mutant strains , log2 ( fold-change ) relative epxression of WT over mutant strains , test-statistic , p-value , q-value , and significance analyzed via the cummeRbund package in R whereby a q-value of < 0.05 is considered significant . 	tabular : Tabular	Genetic background	0.9771379106573036	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE91001/GSE91001.soft.gz				0	0	False
SRR5085370	GSE91001	GSM2418921	GPL14548-GPL20262	28224117	ATCACG-D1	PerC manipulates metabolism and surface antigens in enteropathogenic Escherichia coli	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL20262: Illumina HiSeq 2000 (Escherichia coli O127:H6 str. E2348/69)	characteristics	genotype/variation: {delta}perC::kanR, coisogenic to WT PGCGROWTHCONDITIONS	genotype/variation : <Gtype> -LCB- delta -RCB- perC : : kanR </Gtype> , coisogenic to <Gtype> WT </Gtype> 	-LCB- delta -RCB- perC : : kanR	Genetic background	0.9995499292401948	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE91001/GSE91001.soft.gz				0	0	False
SRR5085371	GSE91001	GSM2418922	GPL14548-GPL20262	28224117	CGATGT-D2	PerC manipulates metabolism and surface antigens in enteropathogenic Escherichia coli	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL20262: Illumina HiSeq 2000 (Escherichia coli O127:H6 str. E2348/69)	data_processing	Supplementary_files_format_and_content: tabular: Tabular data that informs the excel spreadsheet. The data are averaged across the three samples per strain. Both averaged strain data are presented for each gene on the same line. Data contain gene ID, gene number, locus, fragments per kilobase mapped (FPKM) for WT and mutant strains, log2(fold-change) relative epxression of WT over mutant strains, test-statistic, p-value, q-value, and significance analyzed via the cummeRbund package in R whereby a q-value of <0.05 is considered significant. PGCGROWTHCONDITIONS	<Supp> Supplementary </Supp> _ files _ format _ and _ content : <Gtype> tabular : Tabular </Gtype> data that informs the excel spreadsheet . The data are averaged across the three samples per strain . Both averaged strain data are presented for each gene on the same line . Data contain gene ID , gene number , locus , fragments per kilobase mapped ( FPKM ) for WT and mutant strains , log2 ( fold-change ) relative epxression of WT over mutant strains , test-statistic , p-value , q-value , and significance analyzed via the cummeRbund package in R whereby a q-value of < 0.05 is considered significant . 	tabular : Tabular	Genetic background	0.9771379106573036	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE91001/GSE91001.soft.gz				0	0	False
SRR5085371	GSE91001	GSM2418922	GPL14548-GPL20262	28224117	CGATGT-D2	PerC manipulates metabolism and surface antigens in enteropathogenic Escherichia coli	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL20262: Illumina HiSeq 2000 (Escherichia coli O127:H6 str. E2348/69)	characteristics	genotype/variation: {delta}perC::kanR, coisogenic to WT PGCGROWTHCONDITIONS	genotype/variation : <Gtype> -LCB- delta -RCB- perC : : kanR </Gtype> , coisogenic to <Gtype> WT </Gtype> 	-LCB- delta -RCB- perC : : kanR	Genetic background	0.9995499292401948	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE91001/GSE91001.soft.gz				0	0	False
SRR5085373	GSE91001	GSM2418923	GPL14548-GPL20262	28224117	TTAGGC-D3	PerC manipulates metabolism and surface antigens in enteropathogenic Escherichia coli	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL20262: Illumina HiSeq 2000 (Escherichia coli O127:H6 str. E2348/69)	data_processing	Supplementary_files_format_and_content: tabular: Tabular data that informs the excel spreadsheet. The data are averaged across the three samples per strain. Both averaged strain data are presented for each gene on the same line. Data contain gene ID, gene number, locus, fragments per kilobase mapped (FPKM) for WT and mutant strains, log2(fold-change) relative epxression of WT over mutant strains, test-statistic, p-value, q-value, and significance analyzed via the cummeRbund package in R whereby a q-value of <0.05 is considered significant. PGCGROWTHCONDITIONS	<Supp> Supplementary </Supp> _ files _ format _ and _ content : <Gtype> tabular : Tabular </Gtype> data that informs the excel spreadsheet . The data are averaged across the three samples per strain . Both averaged strain data are presented for each gene on the same line . Data contain gene ID , gene number , locus , fragments per kilobase mapped ( FPKM ) for WT and mutant strains , log2 ( fold-change ) relative epxression of WT over mutant strains , test-statistic , p-value , q-value , and significance analyzed via the cummeRbund package in R whereby a q-value of < 0.05 is considered significant . 	tabular : Tabular	Genetic background	0.9771379106573036	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE91001/GSE91001.soft.gz				0	0	False
SRR5085373	GSE91001	GSM2418923	GPL14548-GPL20262	28224117	TTAGGC-D3	PerC manipulates metabolism and surface antigens in enteropathogenic Escherichia coli	GPL14548: Illumina HiSeq 2000 (Escherichia coli). GPL20262: Illumina HiSeq 2000 (Escherichia coli O127:H6 str. E2348/69)	characteristics	genotype/variation: {delta}perC::kanR, coisogenic to WT PGCGROWTHCONDITIONS	genotype/variation : <Gtype> -LCB- delta -RCB- perC : : kanR </Gtype> , coisogenic to <Gtype> WT </Gtype> 	-LCB- delta -RCB- perC : : kanR	Genetic background	0.9995499292401948	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE91001/GSE91001.soft.gz				0	0	False
SRR5121109	GSE92601	GSM2433290	GPL18956	29807996	ORF1_1_IPTG	A bacteriophage enzyme induces bacterial metabolic perturbation that confers a novel promiscuous function.	GPL18956: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz				0	0	False
SRR5121109	GSE92601	GSM2433290	GPL18956	29807996	ORF1_1_IPTG	A bacteriophage enzyme induces bacterial metabolic perturbation that confers a novel promiscuous function.	GPL18956: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz				0	0	False
SRR5121110	GSE92601	GSM2433291	GPL18956	29807996	ORF1_1	A bacteriophage enzyme induces bacterial metabolic perturbation that confers a novel promiscuous function.	GPL18956: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz				0	0	False
SRR5121110	GSE92601	GSM2433291	GPL18956	29807996	ORF1_1	A bacteriophage enzyme induces bacterial metabolic perturbation that confers a novel promiscuous function.	GPL18956: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz				0	0	False
SRR5121111	GSE92601	GSM2433292	GPL18956	29807996	ORF1_2_IPTG	A bacteriophage enzyme induces bacterial metabolic perturbation that confers a novel promiscuous function.	GPL18956: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz				0	0	False
SRR5121111	GSE92601	GSM2433292	GPL18956	29807996	ORF1_2_IPTG	A bacteriophage enzyme induces bacterial metabolic perturbation that confers a novel promiscuous function.	GPL18956: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz				0	0	False
SRR5121111	GSE92601	GSM2433292	GPL18956	29807996	ORF1_2_IPTG	A bacteriophage enzyme induces bacterial metabolic perturbation that confers a novel promiscuous function.	GPL18956: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. MG1655)	characteristics	replicates: ORF1 replicate 2 / induced PGCGROWTHCONDITIONS	replicates : <Supp> ORF1 replicate </Supp> 2 / induced 	ORF1 replicate	Medium supplement	0.9069477609794256	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz				0	0	False
SRR5121112	GSE92601	GSM2433293	GPL18956	29807996	ORF1_2	A bacteriophage enzyme induces bacterial metabolic perturbation that confers a novel promiscuous function.	GPL18956: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz				0	0	False
SRR5121112	GSE92601	GSM2433293	GPL18956	29807996	ORF1_2	A bacteriophage enzyme induces bacterial metabolic perturbation that confers a novel promiscuous function.	GPL18956: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz				0	0	False
SRR5121113	GSE92601	GSM2433294	GPL18956	29807996	Svi3_3_1_IPTG	A bacteriophage enzyme induces bacterial metabolic perturbation that confers a novel promiscuous function.	GPL18956: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz				0	0	False
SRR5121113	GSE92601	GSM2433294	GPL18956	29807996	Svi3_3_1_IPTG	A bacteriophage enzyme induces bacterial metabolic perturbation that confers a novel promiscuous function.	GPL18956: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz				0	0	False
SRR5121114	GSE92601	GSM2433295	GPL18956	29807996	Svi3_3_1	A bacteriophage enzyme induces bacterial metabolic perturbation that confers a novel promiscuous function.	GPL18956: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz				0	0	False
SRR5121114	GSE92601	GSM2433295	GPL18956	29807996	Svi3_3_1	A bacteriophage enzyme induces bacterial metabolic perturbation that confers a novel promiscuous function.	GPL18956: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz				0	0	False
SRR5121115	GSE92601	GSM2433296	GPL18956	29807996	Svi3_3_2_IPTG	A bacteriophage enzyme induces bacterial metabolic perturbation that confers a novel promiscuous function.	GPL18956: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz				0	0	False
SRR5121115	GSE92601	GSM2433296	GPL18956	29807996	Svi3_3_2_IPTG	A bacteriophage enzyme induces bacterial metabolic perturbation that confers a novel promiscuous function.	GPL18956: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz				0	0	False
SRR5121116	GSE92601	GSM2433297	GPL18956	29807996	Svi3_3_2	A bacteriophage enzyme induces bacterial metabolic perturbation that confers a novel promiscuous function.	GPL18956: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz				0	0	False
SRR5121116	GSE92601	GSM2433297	GPL18956	29807996	Svi3_3_2	A bacteriophage enzyme induces bacterial metabolic perturbation that confers a novel promiscuous function.	GPL18956: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz				0	0	False
SRR5121117	GSE92601	GSM2433298	GPL18956	29807996	WT1_IPTG	A bacteriophage enzyme induces bacterial metabolic perturbation that confers a novel promiscuous function.	GPL18956: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz				0	0	False
SRR5121117	GSE92601	GSM2433298	GPL18956	29807996	WT1_IPTG	A bacteriophage enzyme induces bacterial metabolic perturbation that confers a novel promiscuous function.	GPL18956: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz				0	0	False
SRR5121118	GSE92601	GSM2433299	GPL18956	29807996	WT2_IPTG	A bacteriophage enzyme induces bacterial metabolic perturbation that confers a novel promiscuous function.	GPL18956: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz				0	0	False
SRR5121118	GSE92601	GSM2433299	GPL18956	29807996	WT2_IPTG	A bacteriophage enzyme induces bacterial metabolic perturbation that confers a novel promiscuous function.	GPL18956: Illumina HiSeq 2500 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE92601/GSE92601.soft.gz				0	0	False
SRR5298751SRR5298752SRR5298753SRR5298754	GSE95567	GSM2516397	GPL16085-GPL21222	28934475	3'-end RNA-seq, Cytosolic fraction, Replicate #1	In vivo probing of nascent RNA structures reveals principles of cotranscriptional folding	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	data_processing	FastQ files were examined using the FastQC tool. Reads were clipped from 3’ adapter sequences using Cutadapt v1.10, discarding reads shorter than 15 nucleotides. Escherichia coli str. K-12 substr. MG1655 (GenBank: U00096.2) was used as the reference genome. Reads were mapped to the reference genome using Bowtie v1.1.2, by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes (parameters: -n 2 -m 7 -a --best --strata -5 5). PGCGROWTHCONDITIONS	FastQ files were examined using the FastQC tool . Reads were clipped from 3 ' adapter sequences using Cutadapt v1 .10 , discarding reads shorter than 15 nucleotides . Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( GenBank : <Gversion> U00096 .2 </Gversion> ) was used as the reference genome . Reads were mapped to the reference genome using Bowtie v1 .1.2 , by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes ( parameters : - n 2 - m 7 - a -- best -- strata -5 5 ) . 	K-12	Organism	0.9900561834559364	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz				0	0	False
SRR5298751SRR5298752SRR5298753SRR5298754	GSE95567	GSM2516397	GPL16085-GPL21222	28934475	3'-end RNA-seq, Cytosolic fraction, Replicate #1	In vivo probing of nascent RNA structures reveals principles of cotranscriptional folding	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	data_processing	FastQ files were examined using the FastQC tool. Reads were clipped from 3’ adapter sequences using Cutadapt v1.10, discarding reads shorter than 15 nucleotides. Escherichia coli str. K-12 substr. MG1655 (GenBank: U00096.2) was used as the reference genome. Reads were mapped to the reference genome using Bowtie v1.1.2, by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes (parameters: -n 2 -m 7 -a --best --strata -5 5). PGCGROWTHCONDITIONS	FastQ files were examined using the FastQC tool . Reads were clipped from 3 ' adapter sequences using Cutadapt v1 .10 , discarding reads shorter than 15 nucleotides . Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( GenBank : <Gversion> U00096 .2 </Gversion> ) was used as the reference genome . Reads were mapped to the reference genome using Bowtie v1 .1.2 , by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes ( parameters : - n 2 - m 7 - a -- best -- strata -5 5 ) . 	U00096 .2	Gversion	0.999947742354404	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz				0	0	False
SRR5298751SRR5298752SRR5298753SRR5298754	GSE95567	GSM2516397	GPL16085-GPL21222	28934475	3'-end RNA-seq, Cytosolic fraction, Replicate #1	In vivo probing of nascent RNA structures reveals principles of cotranscriptional folding	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	data_processing	Genome_build: U00096.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> U00096 .2 </Gversion> 	U00096 .2	Gversion	0.9999403078579352	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz				0	0	False
SRR5298751SRR5298752SRR5298753SRR5298754	GSE95567	GSM2516397	GPL16085-GPL21222	28934475	3'-end RNA-seq, Cytosolic fraction, Replicate #1	In vivo probing of nascent RNA structures reveals principles of cotranscriptional folding	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	extract_protocol	Each bacteria pellet from a 25 ml culture (OD600 ~0.3) was homogeneously resuspended in 200 µl of Buffer A [10 mM Tris pH 8.0; 20% Sucrose; 100 mM NaCl] supplemented with 200 U SUPERase• In™ RNase Inhibitor, by pipetting. 50 µl of Buffer B [50 mM EDTA; 120 mM Tris pH 8.0] supplemented with 1 µl Ready-Lyse™ Lysozyme Solution (Epicentre, cat. R1810M) were added dropwise, and the vial was gently tilted 5 times to ensure homogenous mixing. The sample was then incubated 1 minute at room temperature. 250 µl of Buffer C [0.5% Tween-20: 0.4% NaDOC; 2 M NaCl; 10 mM EDTA] were immediately added dropwise. The sample was then incubated 5 minutes at room temperature. At this stage the solution clears considerably without increasing its viscosity, and nucleoid becomes visible. Using a cut P1000 pipette tip, the whole sample was gently layered on the top of a 5-30% w/v sucrose gradient [10 mM Tris pH 8.0; 1 M NaCl; 1 mM EDTA; 1 mM DTT], and centrifuged at 17,000 RPM in a SW55Ti rotor (Beckman Coulter, cat. 342194) for 9 minutes (4°C). After centrifugation, the nucleoid fraction was collected using a syringe with a 18G blunt fill needle, and transferred to a new centrifuge tube. The remaining gradient was assumed to represent the cytosolic fraction. The nucleoid was then resuspended in 2.5 ml Wash & Resuspension buffer [40 mM Tris pH 7.5; 150 mM KCl; 10 mM MgCl2; 1 mM DTT; 0.01% Triton X-100] supplemented with 200 U SUPERase• In™ RNase Inhibitor, pulse vortexed for 5 seconds, and then centrifuged at 28,000 RPM in a SW55Ti rotor for 30 minutes (0°C). After centrifugation the supernatant was decanted, and the nucleoid pellet was washed twice with 2 ml of Wash & Resuspension buffer, taking care not to disturb it. The nucleoid was then resuspended in 500 µl Wash & Resuspension buffer, and solubilized by addition of 0.1 gr acid-washed glass beads (Sigma, cat. G1145), and shaking for 5 minutes in a TissueLyser (QIAGEN). For each 100 µl of purified nucleoids (or cytosolic fraction), 1 ml of TRIzol® Reagent (Invitrogen, cat. 15596-018) was added, and RNA was extracted following manufacturer’s instructions. RNA was analyzed on a 2100 Bioanalyzer (Agilent). In all experiments, RNA from cytosolic fraction (corresponding to mature RNA species) had RIN > 9.5. Total RNA yield from nucleoid fraction was ~6% of the total RNA content. PGCGROWTHCONDITIONS	Each bacteria pellet from a 25 ml culture ( OD600 ~ 0.3 ) was homogeneously resuspended in 200 µl of Buffer A [ 10 mM Tris pH 8.0 ; 20 % Sucrose ; 100 mM NaCl ] supplemented with 200 U SUPERase • In ™ RNase Inhibitor , by pipetting . 50 µl of Buffer B [ 50 mM EDTA ; 120 mM Tris pH 8.0 ] supplemented with 1 µl Ready-Lyse ™ Lysozyme Solution ( Epicentre , cat . R1810M ) were added dropwise , and the vial was gently tilted 5 times to ensure homogenous mixing . The sample was then incubated 1 minute at room temperature . 250 µl of Buffer C [ 0.5 % Tween-20 : <Supp> 0.4 % NaDOC ; 2 M NaCl </Supp> ; 10 mM EDTA ] were immediately added dropwise . The sample was then incubated 5 minutes at room temperature . At this stage the solution clears considerably without increasing its viscosity , and nucleoid becomes visible . Using a cut P1000 pipette tip , the whole sample was gently layered on the top of a 5-30 % w/v sucrose gradient [ 10 mM Tris pH 8.0 <Supp> ; 1 M NaCl ; 1 mM EDTA ; 1 mM DTT </Supp> ] , and centrifuged at 17,000 RPM in a SW55Ti rotor ( Beckman Coulter , cat . 342194 ) for 9 minutes ( 4 °C ) . After centrifugation , the nucleoid fraction was collected using a syringe with a 18G blunt fill needle , and transferred to a new centrifuge tube . The remaining gradient was assumed to represent the cytosolic fraction . The nucleoid was then resuspended in 2.5 ml Wash & Resuspension buffer [ 40 mM Tris pH 7.5 ; <Supp> 150 mM KCl ; 10 mM MgCl2 ; 1 mM DTT </Supp> ; 0.01 % Triton X-100 ] supplemented with 200 U SUPERase • In ™ RNase Inhibitor , pulse vortexed for 5 seconds , and then centrifuged at 28,000 RPM in a SW55Ti rotor for 30 minutes ( 0 °C ) . After centrifugation the supernatant was decanted , and the nucleoid pellet was washed twice with 2 ml of Wash & Resuspension buffer , taking care not to disturb it . The nucleoid was then resuspended in 500 µl Wash & Resuspension buffer , and solubilized by addition of 0.1 gr acid-washed glass beads ( Sigma , cat . G1145 ) , and shaking for 5 minutes in a TissueLyser ( QIAGEN ) . For each 100 µl of purified nucleoids ( or cytosolic fraction ) , 1 ml of TRIzol ® Reagent ( Invitrogen , cat . 15596-018 ) was added , and RNA was extracted following manufacturer 's instructions . RNA was analyzed on a 2100 Bioanalyzer ( Agilent ) . In all experiments , RNA from cytosolic fraction ( corresponding to mature RNA species ) had RIN > 9.5 . Total RNA yield from nucleoid fraction was ~ 6 % of the total RNA content . 	150 mM KCl ; 10 mM MgCl2 ; 1 mM DTT	Medium supplement	0.9855023423914102	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz				0	0	False
SRR5298751SRR5298752SRR5298753SRR5298754	GSE95567	GSM2516397	GPL16085-GPL21222	28934475	3'-end RNA-seq, Cytosolic fraction, Replicate #1	In vivo probing of nascent RNA structures reveals principles of cotranscriptional folding	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz				0	0	False
SRR5298755SRR5298756SRR5298757SRR5298758	GSE95567	GSM2516400	GPL16085-GPL21222	28934475	3'-end RNA-seq, Cytosolic fraction, Replicate #2	In vivo probing of nascent RNA structures reveals principles of cotranscriptional folding	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	data_processing	FastQ files were examined using the FastQC tool. Reads were clipped from 3’ adapter sequences using Cutadapt v1.10, discarding reads shorter than 15 nucleotides. Escherichia coli str. K-12 substr. MG1655 (GenBank: U00096.2) was used as the reference genome. Reads were mapped to the reference genome using Bowtie v1.1.2, by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes (parameters: -n 2 -m 7 -a --best --strata -5 5). PGCGROWTHCONDITIONS	FastQ files were examined using the FastQC tool . Reads were clipped from 3 ' adapter sequences using Cutadapt v1 .10 , discarding reads shorter than 15 nucleotides . Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( GenBank : <Gversion> U00096 .2 </Gversion> ) was used as the reference genome . Reads were mapped to the reference genome using Bowtie v1 .1.2 , by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes ( parameters : - n 2 - m 7 - a -- best -- strata -5 5 ) . 	K-12	Organism	0.9900561834559364	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz				0	0	False
SRR5298755SRR5298756SRR5298757SRR5298758	GSE95567	GSM2516400	GPL16085-GPL21222	28934475	3'-end RNA-seq, Cytosolic fraction, Replicate #2	In vivo probing of nascent RNA structures reveals principles of cotranscriptional folding	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	data_processing	FastQ files were examined using the FastQC tool. Reads were clipped from 3’ adapter sequences using Cutadapt v1.10, discarding reads shorter than 15 nucleotides. Escherichia coli str. K-12 substr. MG1655 (GenBank: U00096.2) was used as the reference genome. Reads were mapped to the reference genome using Bowtie v1.1.2, by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes (parameters: -n 2 -m 7 -a --best --strata -5 5). PGCGROWTHCONDITIONS	FastQ files were examined using the FastQC tool . Reads were clipped from 3 ' adapter sequences using Cutadapt v1 .10 , discarding reads shorter than 15 nucleotides . Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( GenBank : <Gversion> U00096 .2 </Gversion> ) was used as the reference genome . Reads were mapped to the reference genome using Bowtie v1 .1.2 , by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes ( parameters : - n 2 - m 7 - a -- best -- strata -5 5 ) . 	U00096 .2	Gversion	0.999947742354404	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz				0	0	False
SRR5298755SRR5298756SRR5298757SRR5298758	GSE95567	GSM2516400	GPL16085-GPL21222	28934475	3'-end RNA-seq, Cytosolic fraction, Replicate #2	In vivo probing of nascent RNA structures reveals principles of cotranscriptional folding	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	data_processing	Genome_build: U00096.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> U00096 .2 </Gversion> 	U00096 .2	Gversion	0.9999403078579352	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz				0	0	False
SRR5298755SRR5298756SRR5298757SRR5298758	GSE95567	GSM2516400	GPL16085-GPL21222	28934475	3'-end RNA-seq, Cytosolic fraction, Replicate #2	In vivo probing of nascent RNA structures reveals principles of cotranscriptional folding	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	extract_protocol	Each bacteria pellet from a 25 ml culture (OD600 ~0.3) was homogeneously resuspended in 200 µl of Buffer A [10 mM Tris pH 8.0; 20% Sucrose; 100 mM NaCl] supplemented with 200 U SUPERase• In™ RNase Inhibitor, by pipetting. 50 µl of Buffer B [50 mM EDTA; 120 mM Tris pH 8.0] supplemented with 1 µl Ready-Lyse™ Lysozyme Solution (Epicentre, cat. R1810M) were added dropwise, and the vial was gently tilted 5 times to ensure homogenous mixing. The sample was then incubated 1 minute at room temperature. 250 µl of Buffer C [0.5% Tween-20: 0.4% NaDOC; 2 M NaCl; 10 mM EDTA] were immediately added dropwise. The sample was then incubated 5 minutes at room temperature. At this stage the solution clears considerably without increasing its viscosity, and nucleoid becomes visible. Using a cut P1000 pipette tip, the whole sample was gently layered on the top of a 5-30% w/v sucrose gradient [10 mM Tris pH 8.0; 1 M NaCl; 1 mM EDTA; 1 mM DTT], and centrifuged at 17,000 RPM in a SW55Ti rotor (Beckman Coulter, cat. 342194) for 9 minutes (4°C). After centrifugation, the nucleoid fraction was collected using a syringe with a 18G blunt fill needle, and transferred to a new centrifuge tube. The remaining gradient was assumed to represent the cytosolic fraction. The nucleoid was then resuspended in 2.5 ml Wash & Resuspension buffer [40 mM Tris pH 7.5; 150 mM KCl; 10 mM MgCl2; 1 mM DTT; 0.01% Triton X-100] supplemented with 200 U SUPERase• In™ RNase Inhibitor, pulse vortexed for 5 seconds, and then centrifuged at 28,000 RPM in a SW55Ti rotor for 30 minutes (0°C). After centrifugation the supernatant was decanted, and the nucleoid pellet was washed twice with 2 ml of Wash & Resuspension buffer, taking care not to disturb it. The nucleoid was then resuspended in 500 µl Wash & Resuspension buffer, and solubilized by addition of 0.1 gr acid-washed glass beads (Sigma, cat. G1145), and shaking for 5 minutes in a TissueLyser (QIAGEN). For each 100 µl of purified nucleoids (or cytosolic fraction), 1 ml of TRIzol® Reagent (Invitrogen, cat. 15596-018) was added, and RNA was extracted following manufacturer’s instructions. RNA was analyzed on a 2100 Bioanalyzer (Agilent). In all experiments, RNA from cytosolic fraction (corresponding to mature RNA species) had RIN > 9.5. Total RNA yield from nucleoid fraction was ~6% of the total RNA content. PGCGROWTHCONDITIONS	Each bacteria pellet from a 25 ml culture ( OD600 ~ 0.3 ) was homogeneously resuspended in 200 µl of Buffer A [ 10 mM Tris pH 8.0 ; 20 % Sucrose ; 100 mM NaCl ] supplemented with 200 U SUPERase • In ™ RNase Inhibitor , by pipetting . 50 µl of Buffer B [ 50 mM EDTA ; 120 mM Tris pH 8.0 ] supplemented with 1 µl Ready-Lyse ™ Lysozyme Solution ( Epicentre , cat . R1810M ) were added dropwise , and the vial was gently tilted 5 times to ensure homogenous mixing . The sample was then incubated 1 minute at room temperature . 250 µl of Buffer C [ 0.5 % Tween-20 : <Supp> 0.4 % NaDOC ; 2 M NaCl </Supp> ; 10 mM EDTA ] were immediately added dropwise . The sample was then incubated 5 minutes at room temperature . At this stage the solution clears considerably without increasing its viscosity , and nucleoid becomes visible . Using a cut P1000 pipette tip , the whole sample was gently layered on the top of a 5-30 % w/v sucrose gradient [ 10 mM Tris pH 8.0 <Supp> ; 1 M NaCl ; 1 mM EDTA ; 1 mM DTT </Supp> ] , and centrifuged at 17,000 RPM in a SW55Ti rotor ( Beckman Coulter , cat . 342194 ) for 9 minutes ( 4 °C ) . After centrifugation , the nucleoid fraction was collected using a syringe with a 18G blunt fill needle , and transferred to a new centrifuge tube . The remaining gradient was assumed to represent the cytosolic fraction . The nucleoid was then resuspended in 2.5 ml Wash & Resuspension buffer [ 40 mM Tris pH 7.5 ; <Supp> 150 mM KCl ; 10 mM MgCl2 ; 1 mM DTT </Supp> ; 0.01 % Triton X-100 ] supplemented with 200 U SUPERase • In ™ RNase Inhibitor , pulse vortexed for 5 seconds , and then centrifuged at 28,000 RPM in a SW55Ti rotor for 30 minutes ( 0 °C ) . After centrifugation the supernatant was decanted , and the nucleoid pellet was washed twice with 2 ml of Wash & Resuspension buffer , taking care not to disturb it . The nucleoid was then resuspended in 500 µl Wash & Resuspension buffer , and solubilized by addition of 0.1 gr acid-washed glass beads ( Sigma , cat . G1145 ) , and shaking for 5 minutes in a TissueLyser ( QIAGEN ) . For each 100 µl of purified nucleoids ( or cytosolic fraction ) , 1 ml of TRIzol ® Reagent ( Invitrogen , cat . 15596-018 ) was added , and RNA was extracted following manufacturer 's instructions . RNA was analyzed on a 2100 Bioanalyzer ( Agilent ) . In all experiments , RNA from cytosolic fraction ( corresponding to mature RNA species ) had RIN > 9.5 . Total RNA yield from nucleoid fraction was ~ 6 % of the total RNA content . 	150 mM KCl ; 10 mM MgCl2 ; 1 mM DTT	Medium supplement	0.9855023423914102	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz				0	0	False
SRR5298755SRR5298756SRR5298757SRR5298758	GSE95567	GSM2516400	GPL16085-GPL21222	28934475	3'-end RNA-seq, Cytosolic fraction, Replicate #2	In vivo probing of nascent RNA structures reveals principles of cotranscriptional folding	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz				0	0	False
SRR5298760	GSE95567	GSM2516401	GPL16085-GPL21222	28934475	3'-end RNA-seq, Nucleoid fraction, Replicate #1	In vivo probing of nascent RNA structures reveals principles of cotranscriptional folding	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	data_processing	FastQ files were examined using the FastQC tool. Reads were clipped from 3’ adapter sequences using Cutadapt v1.10, discarding reads shorter than 15 nucleotides. Escherichia coli str. K-12 substr. MG1655 (GenBank: U00096.2) was used as the reference genome. Reads were mapped to the reference genome using Bowtie v1.1.2, by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes (parameters: -n 2 -m 7 -a --best --strata -5 5). PGCGROWTHCONDITIONS	FastQ files were examined using the FastQC tool . Reads were clipped from 3 ' adapter sequences using Cutadapt v1 .10 , discarding reads shorter than 15 nucleotides . Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( GenBank : <Gversion> U00096 .2 </Gversion> ) was used as the reference genome . Reads were mapped to the reference genome using Bowtie v1 .1.2 , by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes ( parameters : - n 2 - m 7 - a -- best -- strata -5 5 ) . 	K-12	Organism	0.9900561834559364	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz				0	0	False
SRR5298760	GSE95567	GSM2516401	GPL16085-GPL21222	28934475	3'-end RNA-seq, Nucleoid fraction, Replicate #1	In vivo probing of nascent RNA structures reveals principles of cotranscriptional folding	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	data_processing	FastQ files were examined using the FastQC tool. Reads were clipped from 3’ adapter sequences using Cutadapt v1.10, discarding reads shorter than 15 nucleotides. Escherichia coli str. K-12 substr. MG1655 (GenBank: U00096.2) was used as the reference genome. Reads were mapped to the reference genome using Bowtie v1.1.2, by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes (parameters: -n 2 -m 7 -a --best --strata -5 5). PGCGROWTHCONDITIONS	FastQ files were examined using the FastQC tool . Reads were clipped from 3 ' adapter sequences using Cutadapt v1 .10 , discarding reads shorter than 15 nucleotides . Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( GenBank : <Gversion> U00096 .2 </Gversion> ) was used as the reference genome . Reads were mapped to the reference genome using Bowtie v1 .1.2 , by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes ( parameters : - n 2 - m 7 - a -- best -- strata -5 5 ) . 	U00096 .2	Gversion	0.999947742354404	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz				0	0	False
SRR5298760	GSE95567	GSM2516401	GPL16085-GPL21222	28934475	3'-end RNA-seq, Nucleoid fraction, Replicate #1	In vivo probing of nascent RNA structures reveals principles of cotranscriptional folding	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	data_processing	Genome_build: U00096.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> U00096 .2 </Gversion> 	U00096 .2	Gversion	0.9999403078579352	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz				0	0	False
SRR5298760	GSE95567	GSM2516401	GPL16085-GPL21222	28934475	3'-end RNA-seq, Nucleoid fraction, Replicate #1	In vivo probing of nascent RNA structures reveals principles of cotranscriptional folding	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	extract_protocol	Each bacteria pellet from a 25 ml culture (OD600 ~0.3) was homogeneously resuspended in 200 µl of Buffer A [10 mM Tris pH 8.0; 20% Sucrose; 100 mM NaCl] supplemented with 200 U SUPERase• In™ RNase Inhibitor, by pipetting. 50 µl of Buffer B [50 mM EDTA; 120 mM Tris pH 8.0] supplemented with 1 µl Ready-Lyse™ Lysozyme Solution (Epicentre, cat. R1810M) were added dropwise, and the vial was gently tilted 5 times to ensure homogenous mixing. The sample was then incubated 1 minute at room temperature. 250 µl of Buffer C [0.5% Tween-20: 0.4% NaDOC; 2 M NaCl; 10 mM EDTA] were immediately added dropwise. The sample was then incubated 5 minutes at room temperature. At this stage the solution clears considerably without increasing its viscosity, and nucleoid becomes visible. Using a cut P1000 pipette tip, the whole sample was gently layered on the top of a 5-30% w/v sucrose gradient [10 mM Tris pH 8.0; 1 M NaCl; 1 mM EDTA; 1 mM DTT], and centrifuged at 17,000 RPM in a SW55Ti rotor (Beckman Coulter, cat. 342194) for 9 minutes (4°C). After centrifugation, the nucleoid fraction was collected using a syringe with a 18G blunt fill needle, and transferred to a new centrifuge tube. The remaining gradient was assumed to represent the cytosolic fraction. The nucleoid was then resuspended in 2.5 ml Wash & Resuspension buffer [40 mM Tris pH 7.5; 150 mM KCl; 10 mM MgCl2; 1 mM DTT; 0.01% Triton X-100] supplemented with 200 U SUPERase• In™ RNase Inhibitor, pulse vortexed for 5 seconds, and then centrifuged at 28,000 RPM in a SW55Ti rotor for 30 minutes (0°C). After centrifugation the supernatant was decanted, and the nucleoid pellet was washed twice with 2 ml of Wash & Resuspension buffer, taking care not to disturb it. The nucleoid was then resuspended in 500 µl Wash & Resuspension buffer, and solubilized by addition of 0.1 gr acid-washed glass beads (Sigma, cat. G1145), and shaking for 5 minutes in a TissueLyser (QIAGEN). For each 100 µl of purified nucleoids (or cytosolic fraction), 1 ml of TRIzol® Reagent (Invitrogen, cat. 15596-018) was added, and RNA was extracted following manufacturer’s instructions. RNA was analyzed on a 2100 Bioanalyzer (Agilent). In all experiments, RNA from cytosolic fraction (corresponding to mature RNA species) had RIN > 9.5. Total RNA yield from nucleoid fraction was ~6% of the total RNA content. PGCGROWTHCONDITIONS	Each bacteria pellet from a 25 ml culture ( OD600 ~ 0.3 ) was homogeneously resuspended in 200 µl of Buffer A [ 10 mM Tris pH 8.0 ; 20 % Sucrose ; 100 mM NaCl ] supplemented with 200 U SUPERase • In ™ RNase Inhibitor , by pipetting . 50 µl of Buffer B [ 50 mM EDTA ; 120 mM Tris pH 8.0 ] supplemented with 1 µl Ready-Lyse ™ Lysozyme Solution ( Epicentre , cat . R1810M ) were added dropwise , and the vial was gently tilted 5 times to ensure homogenous mixing . The sample was then incubated 1 minute at room temperature . 250 µl of Buffer C [ 0.5 % Tween-20 : <Supp> 0.4 % NaDOC ; 2 M NaCl </Supp> ; 10 mM EDTA ] were immediately added dropwise . The sample was then incubated 5 minutes at room temperature . At this stage the solution clears considerably without increasing its viscosity , and nucleoid becomes visible . Using a cut P1000 pipette tip , the whole sample was gently layered on the top of a 5-30 % w/v sucrose gradient [ 10 mM Tris pH 8.0 <Supp> ; 1 M NaCl ; 1 mM EDTA ; 1 mM DTT </Supp> ] , and centrifuged at 17,000 RPM in a SW55Ti rotor ( Beckman Coulter , cat . 342194 ) for 9 minutes ( 4 °C ) . After centrifugation , the nucleoid fraction was collected using a syringe with a 18G blunt fill needle , and transferred to a new centrifuge tube . The remaining gradient was assumed to represent the cytosolic fraction . The nucleoid was then resuspended in 2.5 ml Wash & Resuspension buffer [ 40 mM Tris pH 7.5 ; <Supp> 150 mM KCl ; 10 mM MgCl2 ; 1 mM DTT </Supp> ; 0.01 % Triton X-100 ] supplemented with 200 U SUPERase • In ™ RNase Inhibitor , pulse vortexed for 5 seconds , and then centrifuged at 28,000 RPM in a SW55Ti rotor for 30 minutes ( 0 °C ) . After centrifugation the supernatant was decanted , and the nucleoid pellet was washed twice with 2 ml of Wash & Resuspension buffer , taking care not to disturb it . The nucleoid was then resuspended in 500 µl Wash & Resuspension buffer , and solubilized by addition of 0.1 gr acid-washed glass beads ( Sigma , cat . G1145 ) , and shaking for 5 minutes in a TissueLyser ( QIAGEN ) . For each 100 µl of purified nucleoids ( or cytosolic fraction ) , 1 ml of TRIzol ® Reagent ( Invitrogen , cat . 15596-018 ) was added , and RNA was extracted following manufacturer 's instructions . RNA was analyzed on a 2100 Bioanalyzer ( Agilent ) . In all experiments , RNA from cytosolic fraction ( corresponding to mature RNA species ) had RIN > 9.5 . Total RNA yield from nucleoid fraction was ~ 6 % of the total RNA content . 	150 mM KCl ; 10 mM MgCl2 ; 1 mM DTT	Medium supplement	0.9855023423914102	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz				0	0	False
SRR5298760	GSE95567	GSM2516401	GPL16085-GPL21222	28934475	3'-end RNA-seq, Nucleoid fraction, Replicate #1	In vivo probing of nascent RNA structures reveals principles of cotranscriptional folding	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz				0	0	False
SRR5298763SRR5298765SRR5298766	GSE95567	GSM2516402	GPL16085-GPL21222	28934475	3'-end RNA-seq, Nucleoid fraction, Replicate #2	In vivo probing of nascent RNA structures reveals principles of cotranscriptional folding	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	data_processing	FastQ files were examined using the FastQC tool. Reads were clipped from 3’ adapter sequences using Cutadapt v1.10, discarding reads shorter than 15 nucleotides. Escherichia coli str. K-12 substr. MG1655 (GenBank: U00096.2) was used as the reference genome. Reads were mapped to the reference genome using Bowtie v1.1.2, by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes (parameters: -n 2 -m 7 -a --best --strata -5 5). PGCGROWTHCONDITIONS	FastQ files were examined using the FastQC tool . Reads were clipped from 3 ' adapter sequences using Cutadapt v1 .10 , discarding reads shorter than 15 nucleotides . Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( GenBank : <Gversion> U00096 .2 </Gversion> ) was used as the reference genome . Reads were mapped to the reference genome using Bowtie v1 .1.2 , by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes ( parameters : - n 2 - m 7 - a -- best -- strata -5 5 ) . 	K-12	Organism	0.9900561834559364	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz				0	0	False
SRR5298763SRR5298765SRR5298766	GSE95567	GSM2516402	GPL16085-GPL21222	28934475	3'-end RNA-seq, Nucleoid fraction, Replicate #2	In vivo probing of nascent RNA structures reveals principles of cotranscriptional folding	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	data_processing	FastQ files were examined using the FastQC tool. Reads were clipped from 3’ adapter sequences using Cutadapt v1.10, discarding reads shorter than 15 nucleotides. Escherichia coli str. K-12 substr. MG1655 (GenBank: U00096.2) was used as the reference genome. Reads were mapped to the reference genome using Bowtie v1.1.2, by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes (parameters: -n 2 -m 7 -a --best --strata -5 5). PGCGROWTHCONDITIONS	FastQ files were examined using the FastQC tool . Reads were clipped from 3 ' adapter sequences using Cutadapt v1 .10 , discarding reads shorter than 15 nucleotides . Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 ( GenBank : <Gversion> U00096 .2 </Gversion> ) was used as the reference genome . Reads were mapped to the reference genome using Bowtie v1 .1.2 , by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes ( parameters : - n 2 - m 7 - a -- best -- strata -5 5 ) . 	U00096 .2	Gversion	0.999947742354404	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz				0	0	False
SRR5298763SRR5298765SRR5298766	GSE95567	GSM2516402	GPL16085-GPL21222	28934475	3'-end RNA-seq, Nucleoid fraction, Replicate #2	In vivo probing of nascent RNA structures reveals principles of cotranscriptional folding	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	data_processing	Genome_build: U00096.2 PGCGROWTHCONDITIONS	Genome _ build : <Gversion> U00096 .2 </Gversion> 	U00096 .2	Gversion	0.9999403078579352	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz				0	0	False
SRR5298763SRR5298765SRR5298766	GSE95567	GSM2516402	GPL16085-GPL21222	28934475	3'-end RNA-seq, Nucleoid fraction, Replicate #2	In vivo probing of nascent RNA structures reveals principles of cotranscriptional folding	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	extract_protocol	Each bacteria pellet from a 25 ml culture (OD600 ~0.3) was homogeneously resuspended in 200 µl of Buffer A [10 mM Tris pH 8.0; 20% Sucrose; 100 mM NaCl] supplemented with 200 U SUPERase• In™ RNase Inhibitor, by pipetting. 50 µl of Buffer B [50 mM EDTA; 120 mM Tris pH 8.0] supplemented with 1 µl Ready-Lyse™ Lysozyme Solution (Epicentre, cat. R1810M) were added dropwise, and the vial was gently tilted 5 times to ensure homogenous mixing. The sample was then incubated 1 minute at room temperature. 250 µl of Buffer C [0.5% Tween-20: 0.4% NaDOC; 2 M NaCl; 10 mM EDTA] were immediately added dropwise. The sample was then incubated 5 minutes at room temperature. At this stage the solution clears considerably without increasing its viscosity, and nucleoid becomes visible. Using a cut P1000 pipette tip, the whole sample was gently layered on the top of a 5-30% w/v sucrose gradient [10 mM Tris pH 8.0; 1 M NaCl; 1 mM EDTA; 1 mM DTT], and centrifuged at 17,000 RPM in a SW55Ti rotor (Beckman Coulter, cat. 342194) for 9 minutes (4°C). After centrifugation, the nucleoid fraction was collected using a syringe with a 18G blunt fill needle, and transferred to a new centrifuge tube. The remaining gradient was assumed to represent the cytosolic fraction. The nucleoid was then resuspended in 2.5 ml Wash & Resuspension buffer [40 mM Tris pH 7.5; 150 mM KCl; 10 mM MgCl2; 1 mM DTT; 0.01% Triton X-100] supplemented with 200 U SUPERase• In™ RNase Inhibitor, pulse vortexed for 5 seconds, and then centrifuged at 28,000 RPM in a SW55Ti rotor for 30 minutes (0°C). After centrifugation the supernatant was decanted, and the nucleoid pellet was washed twice with 2 ml of Wash & Resuspension buffer, taking care not to disturb it. The nucleoid was then resuspended in 500 µl Wash & Resuspension buffer, and solubilized by addition of 0.1 gr acid-washed glass beads (Sigma, cat. G1145), and shaking for 5 minutes in a TissueLyser (QIAGEN). For each 100 µl of purified nucleoids (or cytosolic fraction), 1 ml of TRIzol® Reagent (Invitrogen, cat. 15596-018) was added, and RNA was extracted following manufacturer’s instructions. RNA was analyzed on a 2100 Bioanalyzer (Agilent). In all experiments, RNA from cytosolic fraction (corresponding to mature RNA species) had RIN > 9.5. Total RNA yield from nucleoid fraction was ~6% of the total RNA content. PGCGROWTHCONDITIONS	Each bacteria pellet from a 25 ml culture ( OD600 ~ 0.3 ) was homogeneously resuspended in 200 µl of Buffer A [ 10 mM Tris pH 8.0 ; 20 % Sucrose ; 100 mM NaCl ] supplemented with 200 U SUPERase • In ™ RNase Inhibitor , by pipetting . 50 µl of Buffer B [ 50 mM EDTA ; 120 mM Tris pH 8.0 ] supplemented with 1 µl Ready-Lyse ™ Lysozyme Solution ( Epicentre , cat . R1810M ) were added dropwise , and the vial was gently tilted 5 times to ensure homogenous mixing . The sample was then incubated 1 minute at room temperature . 250 µl of Buffer C [ 0.5 % Tween-20 : <Supp> 0.4 % NaDOC ; 2 M NaCl </Supp> ; 10 mM EDTA ] were immediately added dropwise . The sample was then incubated 5 minutes at room temperature . At this stage the solution clears considerably without increasing its viscosity , and nucleoid becomes visible . Using a cut P1000 pipette tip , the whole sample was gently layered on the top of a 5-30 % w/v sucrose gradient [ 10 mM Tris pH 8.0 <Supp> ; 1 M NaCl ; 1 mM EDTA ; 1 mM DTT </Supp> ] , and centrifuged at 17,000 RPM in a SW55Ti rotor ( Beckman Coulter , cat . 342194 ) for 9 minutes ( 4 °C ) . After centrifugation , the nucleoid fraction was collected using a syringe with a 18G blunt fill needle , and transferred to a new centrifuge tube . The remaining gradient was assumed to represent the cytosolic fraction . The nucleoid was then resuspended in 2.5 ml Wash & Resuspension buffer [ 40 mM Tris pH 7.5 ; <Supp> 150 mM KCl ; 10 mM MgCl2 ; 1 mM DTT </Supp> ; 0.01 % Triton X-100 ] supplemented with 200 U SUPERase • In ™ RNase Inhibitor , pulse vortexed for 5 seconds , and then centrifuged at 28,000 RPM in a SW55Ti rotor for 30 minutes ( 0 °C ) . After centrifugation the supernatant was decanted , and the nucleoid pellet was washed twice with 2 ml of Wash & Resuspension buffer , taking care not to disturb it . The nucleoid was then resuspended in 500 µl Wash & Resuspension buffer , and solubilized by addition of 0.1 gr acid-washed glass beads ( Sigma , cat . G1145 ) , and shaking for 5 minutes in a TissueLyser ( QIAGEN ) . For each 100 µl of purified nucleoids ( or cytosolic fraction ) , 1 ml of TRIzol ® Reagent ( Invitrogen , cat . 15596-018 ) was added , and RNA was extracted following manufacturer 's instructions . RNA was analyzed on a 2100 Bioanalyzer ( Agilent ) . In all experiments , RNA from cytosolic fraction ( corresponding to mature RNA species ) had RIN > 9.5 . Total RNA yield from nucleoid fraction was ~ 6 % of the total RNA content . 	150 mM KCl ; 10 mM MgCl2 ; 1 mM DTT	Medium supplement	0.9855023423914102	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz				0	0	False
SRR5298763SRR5298765SRR5298766	GSE95567	GSM2516402	GPL16085-GPL21222	28934475	3'-end RNA-seq, Nucleoid fraction, Replicate #2	In vivo probing of nascent RNA structures reveals principles of cotranscriptional folding	GPL16085: Illumina MiSeq (Escherichia coli). GPL21222: Illumina NextSeq 500 (Escherichia coli)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95567/GSE95567.soft.gz				0	0	False
SRR5304286	GSE95575	GSM2516609	GPL15010	29338696	1A_MG_t0	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304286	GSE95575	GSM2516609	GPL15010	29338696	1A_MG_t0	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304286	GSE95575	GSM2516609	GPL15010	29338696	1A_MG_t0	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304287	GSE95575	GSM2516610	GPL15010	29338696	2A_MG_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304287	GSE95575	GSM2516610	GPL15010	29338696	2A_MG_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304287	GSE95575	GSM2516610	GPL15010	29338696	2A_MG_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304288	GSE95575	GSM2516611	GPL15010	29338696	3A_MG_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304288	GSE95575	GSM2516611	GPL15010	29338696	3A_MG_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304288	GSE95575	GSM2516611	GPL15010	29338696	3A_MG_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304289	GSE95575	GSM2516612	GPL15010	29338696	4A_MG_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304289	GSE95575	GSM2516612	GPL15010	29338696	4A_MG_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304289	GSE95575	GSM2516612	GPL15010	29338696	4A_MG_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304290	GSE95575	GSM2516613	GPL15010	29338696	5A_MG+Hg_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304290	GSE95575	GSM2516613	GPL15010	29338696	5A_MG+Hg_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304290	GSE95575	GSM2516613	GPL15010	29338696	5A_MG+Hg_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304291	GSE95575	GSM2516614	GPL15010	29338696	6A_MG+Hg_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304291	GSE95575	GSM2516614	GPL15010	29338696	6A_MG+Hg_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304291	GSE95575	GSM2516614	GPL15010	29338696	6A_MG+Hg_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304292	GSE95575	GSM2516615	GPL15010	29338696	7A_MG+Hg_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304292	GSE95575	GSM2516615	GPL15010	29338696	7A_MG+Hg_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304292	GSE95575	GSM2516615	GPL15010	29338696	7A_MG+Hg_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304293	GSE95575	GSM2516616	GPL15010	29338696	8A_MG+PMA_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304293	GSE95575	GSM2516616	GPL15010	29338696	8A_MG+PMA_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304293	GSE95575	GSM2516616	GPL15010	29338696	8A_MG+PMA_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304294	GSE95575	GSM2516617	GPL15010	29338696	9A_MG+PMA_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304294	GSE95575	GSM2516617	GPL15010	29338696	9A_MG+PMA_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304294	GSE95575	GSM2516617	GPL15010	29338696	9A_MG+PMA_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304295	GSE95575	GSM2516618	GPL15010	29338696	10A_MG+PMA_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304295	GSE95575	GSM2516618	GPL15010	29338696	10A_MG+PMA_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304295	GSE95575	GSM2516618	GPL15010	29338696	10A_MG+PMA_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304296	GSE95575	GSM2516619	GPL15010	29338696	1B_MG_t0	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304296	GSE95575	GSM2516619	GPL15010	29338696	1B_MG_t0	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304296	GSE95575	GSM2516619	GPL15010	29338696	1B_MG_t0	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304297	GSE95575	GSM2516620	GPL15010	29338696	2B_MG_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304297	GSE95575	GSM2516620	GPL15010	29338696	2B_MG_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304297	GSE95575	GSM2516620	GPL15010	29338696	2B_MG_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304298	GSE95575	GSM2516621	GPL15010	29338696	3B_MG_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304298	GSE95575	GSM2516621	GPL15010	29338696	3B_MG_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304298	GSE95575	GSM2516621	GPL15010	29338696	3B_MG_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304299	GSE95575	GSM2516622	GPL15010	29338696	4B_MG_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304299	GSE95575	GSM2516622	GPL15010	29338696	4B_MG_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304299	GSE95575	GSM2516622	GPL15010	29338696	4B_MG_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304300	GSE95575	GSM2516623	GPL15010	29338696	5B_MG+Hg_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304300	GSE95575	GSM2516623	GPL15010	29338696	5B_MG+Hg_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304300	GSE95575	GSM2516623	GPL15010	29338696	5B_MG+Hg_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304301	GSE95575	GSM2516624	GPL15010	29338696	6B_MG+Hg_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304301	GSE95575	GSM2516624	GPL15010	29338696	6B_MG+Hg_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304301	GSE95575	GSM2516624	GPL15010	29338696	6B_MG+Hg_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304302	GSE95575	GSM2516625	GPL15010	29338696	7B_MG+Hg_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304302	GSE95575	GSM2516625	GPL15010	29338696	7B_MG+Hg_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304302	GSE95575	GSM2516625	GPL15010	29338696	7B_MG+Hg_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304303	GSE95575	GSM2516626	GPL15010	29338696	8B_MG+PMA_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304303	GSE95575	GSM2516626	GPL15010	29338696	8B_MG+PMA_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304303	GSE95575	GSM2516626	GPL15010	29338696	8B_MG+PMA_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304304	GSE95575	GSM2516627	GPL15010	29338696	9B_MG+PMA_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304304	GSE95575	GSM2516627	GPL15010	29338696	9B_MG+PMA_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304304	GSE95575	GSM2516627	GPL15010	29338696	9B_MG+PMA_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304305	GSE95575	GSM2516628	GPL15010	29338696	10B_MG+PMA_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304305	GSE95575	GSM2516628	GPL15010	29338696	10B_MG+PMA_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304305	GSE95575	GSM2516628	GPL15010	29338696	10B_MG+PMA_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304306	GSE95575	GSM2516629	GPL15010	29338696	1C_MG_t0	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304306	GSE95575	GSM2516629	GPL15010	29338696	1C_MG_t0	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304306	GSE95575	GSM2516629	GPL15010	29338696	1C_MG_t0	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304307	GSE95575	GSM2516630	GPL15010	29338696	2C_MG_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304307	GSE95575	GSM2516630	GPL15010	29338696	2C_MG_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304307	GSE95575	GSM2516630	GPL15010	29338696	2C_MG_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304308	GSE95575	GSM2516631	GPL15010	29338696	3C_MG_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304308	GSE95575	GSM2516631	GPL15010	29338696	3C_MG_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304308	GSE95575	GSM2516631	GPL15010	29338696	3C_MG_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304309	GSE95575	GSM2516632	GPL15010	29338696	4C_MG_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304309	GSE95575	GSM2516632	GPL15010	29338696	4C_MG_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304309	GSE95575	GSM2516632	GPL15010	29338696	4C_MG_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304310	GSE95575	GSM2516633	GPL15010	29338696	5C_MG+Hg_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304310	GSE95575	GSM2516633	GPL15010	29338696	5C_MG+Hg_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304310	GSE95575	GSM2516633	GPL15010	29338696	5C_MG+Hg_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304311	GSE95575	GSM2516634	GPL15010	29338696	6C_MG+Hg_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304311	GSE95575	GSM2516634	GPL15010	29338696	6C_MG+Hg_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304311	GSE95575	GSM2516634	GPL15010	29338696	6C_MG+Hg_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304312	GSE95575	GSM2516635	GPL15010	29338696	7C_MG+Hg_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304312	GSE95575	GSM2516635	GPL15010	29338696	7C_MG+Hg_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304312	GSE95575	GSM2516635	GPL15010	29338696	7C_MG+Hg_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304313	GSE95575	GSM2516636	GPL15010	29338696	8C_MG+PMA_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304313	GSE95575	GSM2516636	GPL15010	29338696	8C_MG+PMA_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304313	GSE95575	GSM2516636	GPL15010	29338696	8C_MG+PMA_t10	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304314	GSE95575	GSM2516637	GPL15010	29338696	9C_MG+PMA_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304314	GSE95575	GSM2516637	GPL15010	29338696	9C_MG+PMA_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304314	GSE95575	GSM2516637	GPL15010	29338696	9C_MG+PMA_t30	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304315	GSE95575	GSM2516638	GPL15010	29338696	10C_MG+PMA_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	data_processing	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf ) PGCGROWTHCONDITIONS	Genome _ build : <Gversion> ASM584v2 </Gversion> ( Escherichia _ coli _ str _ k _ 12 _ substr _ <Gtype> mg1655.GCA </Gtype> _ 000005845.2.24 . gtf ) 	ASM584v2	Gversion	0.91352943985783	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304315	GSE95575	GSM2516638	GPL15010	29338696	10C_MG+PMA_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611518392936	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5304315	GSE95575	GSM2516638	GPL15010	29338696	10C_MG+PMA_t60	Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure	GPL15010: Illumina HiSeq 2000 (Escherichia coli str. K-12 substr. MG1655)	organism	Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327052	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE95575/GSE95575.soft.gz				0	0	False
SRR5416991	GSE97406	GSM2563999	GPL16085		AR1-/AR2- rep 2	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	The resulting reads were mapped to the reference genome of Escherichia coli str. K-12 substr. MG1655 using Tophat2 using the following parameters, --GTF --library type fr-secondstrand PGCGROWTHCONDITIONS	The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 using Tophat2 using the following parameters , -- <Gtype> GTF -- library type fr-secondstrand </Gtype> 	K-12	Organism	0.9900558194412059	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416991	GSE97406	GSM2563999	GPL16085		AR1-/AR2- rep 2	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611539837798	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416991	GSE97406	GSM2563999	GPL16085		AR1-/AR2- rep 2	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327102	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416991	GSE97406	GSM2563999	GPL16085		AR1-/AR2- rep 2	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416992	GSE97406	GSM2564000	GPL16085		AR1-/AR2- rep 3	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	The resulting reads were mapped to the reference genome of Escherichia coli str. K-12 substr. MG1655 using Tophat2 using the following parameters, --GTF --library type fr-secondstrand PGCGROWTHCONDITIONS	The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 using Tophat2 using the following parameters , -- <Gtype> GTF -- library type fr-secondstrand </Gtype> 	K-12	Organism	0.9900558194412059	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416992	GSE97406	GSM2564000	GPL16085		AR1-/AR2- rep 3	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611539837798	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416992	GSE97406	GSM2564000	GPL16085		AR1-/AR2- rep 3	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327102	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416992	GSE97406	GSM2564000	GPL16085		AR1-/AR2- rep 3	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416993	GSE97406	GSM2564001	GPL16085		WT rep 1	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	The resulting reads were mapped to the reference genome of Escherichia coli str. K-12 substr. MG1655 using Tophat2 using the following parameters, --GTF --library type fr-secondstrand PGCGROWTHCONDITIONS	The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 using Tophat2 using the following parameters , -- <Gtype> GTF -- library type fr-secondstrand </Gtype> 	K-12	Organism	0.9900558194412059	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416993	GSE97406	GSM2564001	GPL16085		WT rep 1	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611539837798	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416993	GSE97406	GSM2564001	GPL16085		WT rep 1	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327102	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416993	GSE97406	GSM2564001	GPL16085		WT rep 1	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416994	GSE97406	GSM2564002	GPL16085		WT rep 2	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	The resulting reads were mapped to the reference genome of Escherichia coli str. K-12 substr. MG1655 using Tophat2 using the following parameters, --GTF --library type fr-secondstrand PGCGROWTHCONDITIONS	The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 using Tophat2 using the following parameters , -- <Gtype> GTF -- library type fr-secondstrand </Gtype> 	K-12	Organism	0.9900558194412059	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416994	GSE97406	GSM2564002	GPL16085		WT rep 2	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611539837798	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416994	GSE97406	GSM2564002	GPL16085		WT rep 2	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327102	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416994	GSE97406	GSM2564002	GPL16085		WT rep 2	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416995	GSE97406	GSM2564003	GPL16085		WT rep 3	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	The resulting reads were mapped to the reference genome of Escherichia coli str. K-12 substr. MG1655 using Tophat2 using the following parameters, --GTF --library type fr-secondstrand PGCGROWTHCONDITIONS	The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 using Tophat2 using the following parameters , -- <Gtype> GTF -- library type fr-secondstrand </Gtype> 	K-12	Organism	0.9900558194412059	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416995	GSE97406	GSM2564003	GPL16085		WT rep 3	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611539837798	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416995	GSE97406	GSM2564003	GPL16085		WT rep 3	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327102	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416995	GSE97406	GSM2564003	GPL16085		WT rep 3	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416996	GSE97406	GSM2564004	GPL16085		K100Q rep 1	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	The resulting reads were mapped to the reference genome of Escherichia coli str. K-12 substr. MG1655 using Tophat2 using the following parameters, --GTF --library type fr-secondstrand PGCGROWTHCONDITIONS	The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 using Tophat2 using the following parameters , -- <Gtype> GTF -- library type fr-secondstrand </Gtype> 	K-12	Organism	0.9900558194412059	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416996	GSE97406	GSM2564004	GPL16085		K100Q rep 1	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611539837798	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416996	GSE97406	GSM2564004	GPL16085		K100Q rep 1	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327102	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416996	GSE97406	GSM2564004	GPL16085		K100Q rep 1	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416997	GSE97406	GSM2564005	GPL16085		K100Q rep 2	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	The resulting reads were mapped to the reference genome of Escherichia coli str. K-12 substr. MG1655 using Tophat2 using the following parameters, --GTF --library type fr-secondstrand PGCGROWTHCONDITIONS	The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 using Tophat2 using the following parameters , -- <Gtype> GTF -- library type fr-secondstrand </Gtype> 	K-12	Organism	0.9900558194412059	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416997	GSE97406	GSM2564005	GPL16085		K100Q rep 2	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611539837798	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416997	GSE97406	GSM2564005	GPL16085		K100Q rep 2	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327102	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416997	GSE97406	GSM2564005	GPL16085		K100Q rep 2	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416998	GSE97406	GSM2564006	GPL16085		K100Q rep 3	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	The resulting reads were mapped to the reference genome of Escherichia coli str. K-12 substr. MG1655 using Tophat2 using the following parameters, --GTF --library type fr-secondstrand PGCGROWTHCONDITIONS	The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 using Tophat2 using the following parameters , -- <Gtype> GTF -- library type fr-secondstrand </Gtype> 	K-12	Organism	0.9900558194412059	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416998	GSE97406	GSM2564006	GPL16085		K100Q rep 3	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611539837798	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416998	GSE97406	GSM2564006	GPL16085		K100Q rep 3	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327102	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416998	GSE97406	GSM2564006	GPL16085		K100Q rep 3	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416999	GSE97406	GSM2564007	GPL16085		K100R rep 1	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	The resulting reads were mapped to the reference genome of Escherichia coli str. K-12 substr. MG1655 using Tophat2 using the following parameters, --GTF --library type fr-secondstrand PGCGROWTHCONDITIONS	The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 using Tophat2 using the following parameters , -- <Gtype> GTF -- library type fr-secondstrand </Gtype> 	K-12	Organism	0.9900558194412059	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416999	GSE97406	GSM2564007	GPL16085		K100R rep 1	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611539837798	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416999	GSE97406	GSM2564007	GPL16085		K100R rep 1	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327102	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5416999	GSE97406	GSM2564007	GPL16085		K100R rep 1	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5417000	GSE97406	GSM2564008	GPL16085		K100R rep 2	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	The resulting reads were mapped to the reference genome of Escherichia coli str. K-12 substr. MG1655 using Tophat2 using the following parameters, --GTF --library type fr-secondstrand PGCGROWTHCONDITIONS	The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 using Tophat2 using the following parameters , -- <Gtype> GTF -- library type fr-secondstrand </Gtype> 	K-12	Organism	0.9900558194412059	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5417000	GSE97406	GSM2564008	GPL16085		K100R rep 2	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611539837798	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5417000	GSE97406	GSM2564008	GPL16085		K100R rep 2	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327102	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5417000	GSE97406	GSM2564008	GPL16085		K100R rep 2	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5417001	GSE97406	GSM2564009	GPL16085		K100R rep 3	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	The resulting reads were mapped to the reference genome of Escherichia coli str. K-12 substr. MG1655 using Tophat2 using the following parameters, --GTF --library type fr-secondstrand PGCGROWTHCONDITIONS	The resulting reads were mapped to the reference genome of Escherichia coli str . <Strain> K-12 </Strain> substr . MG1655 using Tophat2 using the following parameters , -- <Gtype> GTF -- library type fr-secondstrand </Gtype> 	K-12	Organism	0.9900558194412059	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5417001	GSE97406	GSM2564009	GPL16085		K100R rep 3	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	K-12	Organism	0.9900611539837798	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5417001	GSE97406	GSM2564009	GPL16085		K100R rep 3	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	data_processing	Genome_build: Escherichia coli str. K-12 substr. MG1655 PGCGROWTHCONDITIONS	Genome _ build : Escherichia coli str . <Strain> K-12 </Strain> substr . <Substrain> MG1655 </Substrain> 	MG1655	Organism	0.9850566913327102	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5417001	GSE97406	GSM2564009	GPL16085		K100R rep 3	Role of CRP K100 positive charge on Escherichia coli global transcriptome	GPL16085: Illumina MiSeq (Escherichia coli)	characteristics	strain: K-12 PGCGROWTHCONDITIONS	strain : <Strain> K-12 </Strain> 	K-12	Organism	0.9693206003228738	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE97406/GSE97406.soft.gz				0	0	False
SRR5516280	GSE98660	GSM2608039	GPL14548	28648779	E. coli 3' RACE Rep1	Natural RNA polymerase aptamers regulate transcription in E. coli [3' RACE]	GPL14548: Illumina HiSeq 2000 (Escherichia coli)	extract_protocol	total DNaseI treated RNA was depleted of ribosomal RNA using the Ribo-Zero™ RNA removal kit for Gram-negative bacteria (Epicentre). A 3[linebreak] RNA adapter, based on the Illumina multiplexing adapter sequence (Oligonucleotide sequences © 2007-2014 Illumina, Inc. All rights reserved) blocked at the 3[linebreak] end with an inverted dT (5[linebreak]-GAUCGGAAGAGCACACGUCU[idT]-3[linebreak]), was phosphorylated at the 5[linebreak] end using T4 PNK (New England Biolabs) per the manufacturer’s protocol. The 3[linebreak] RNA adapter was ligated to the 3[linebreak] ends of the rRNA depleted RNA using T4 RNA ligase I (New England Biolabs). 1.5 mg of RNA was incubated at 20°C for 6 hours in 1X T4 RNA ligase reaction buffer with 1 mM ATP, 30 µM 3[linebreak] RNA adapter, 10 % DMSO, 10 U of T4 RNA ligase I, and 40 U of RNasin (Promega) in a 20 ml reaction. RNA was then fragmented in equivalents of 100 ng using the RNA fragmentation reagents (Ambion®) per the manufacturer’s protocol at 70°C for 3 min and subsequently phosphorylated at the 5[linebreak] ends using T4 PNK (New England Biolabs) per the manufacturer’s protocol to allow for ligation of the 5[linebreak] adapter. RNA was size-selected (≈ 150-300 nt) and purified over a denaturing 8 % polyacrylamide/8 M urea/TBE gel. Gel slices were incubated in RNA elution buffer (10 mM Tris-HCl, pH 7.5, 2 mM EDTA, 0.1 % SDS, 0.3 M NaOAc) with vigorous shaking at 4°C overnight. The supernatant was subsequently ethanol precipitated using glycogen as a carrier molecule. The Illumina small RNA 5[linebreak] adapter (5[linebreak]-GUUCAGAGUUCUACAGUCCGACGAUC-3[linebreak]) was ligated to the RNA as described before except the concentration of the adapter was 52 mM and 20 U of T4 RNA ligase I was used in total volume of 25 µl. The ligated RNAs were size-selected (≈ 200-300 nt) and gel-purified over a denaturing 8 % polyacrylamide/8 M urea/TBE gel (as described above). The di-tagged RNA libraries were reverse-transcribed with SuperScript®II reverse transcriptase (Invitrogen) using random nonamers per the manufacturer’s protocol. RNA was removed using RNase H (Promega) per the manufacturer’s protocol and cDNA was amplified in PCR carried out using Phusion® High-Fidelity Polymerase (New England Biolabs). cDNA was amplified with modified designed Illumina-compatible PCR primers (3’ library Forward 5’-CAAGCAGAAGACGGCATACGACAGGTTCAGAGTTCTACAGTCCGA-3’; Reverse 5’-AATGATACGGCGACCACCGAGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3’) by 18 cycles of PCR. The products were purified using Agencourt AMPure XP beads (Beckman) and analyzed on an Agilent 2100 Bioanalyzer. 3’ end enriched cDNA libraries were sequenced on individual Genome Analyzer IIx lanes (36 bp, single-end) or on HiSeq 2000 lanes (50 bp, single-end) using primer based on Illumina Multiplexing Read 2 Sequencing Primer (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3’) at the CSF NGS unit http://csf.ac.at/. PGCGROWTHCONDITIONS	total DNaseI treated RNA was depleted of ribosomal RNA using the Ribo-Zero ™ RNA removal kit for Gram-negative bacteria ( Epicentre ) . A 3 [ linebreak ] RNA adapter , based on the Illumina multiplexing adapter sequence ( Oligonucleotide sequences © 2007-2014 Illumina , Inc. . All rights reserved ) blocked at the 3 [ linebreak ] end with an inverted dT ( 5 [ linebreak ] - GAUCGGAAGAGCACACGUCU [ idT ] -3 [ linebreak ] ) , was phosphorylated at the 5 [ linebreak ] end using T4 PNK ( New England Biolabs ) per the manufacturer 's protocol . The 3 [ linebreak ] RNA adapter was ligated to the 3 [ linebreak ] ends of the rRNA depleted RNA using T4 RNA ligase I ( New England Biolabs ) . 1.5 mg of RNA was incubated at 20 °C for 6 hours in 1X T4 RNA ligase reaction buffer with 1 mM ATP , <Supp> 30 µM </Supp> 3 [ linebreak ] RNA adapter , 10 % DMSO , 10 U of T4 RNA ligase I , and 40 U of RNasin ( Promega ) in a 20 ml reaction . RNA was then fragmented in equivalents of 100 ng using the RNA fragmentation reagents ( Ambion ® ) per the manufacturer 's protocol at 70 °C for 3 min and subsequently phosphorylated at the 5 [ linebreak ] ends using T4 PNK ( New England Biolabs ) per the manufacturer 's protocol to allow for ligation of the 5 [ linebreak ] adapter . RNA was size-selected ( ≈ 150-300 nt ) and purified over a denaturing 8 % polyacrylamide/8 M urea/TBE gel . Gel slices were incubated in RNA elution buffer ( 10 mM Tris-HCl , pH 7.5 , 2 mM EDTA , 0.1 % SDS , 0.3 M NaOAc ) with vigorous shaking at 4 °C overnight . The supernatant was subsequently ethanol precipitated using glycogen as a carrier molecule . The Illumina small RNA 5 [ linebreak ] adapter ( 5 [ linebreak ] - GUUCAGAGUUCUACAGUCCGACGAUC-3 [ linebreak ] ) was ligated to the RNA as described before except the concentration of the adapter was 52 mM and 20 U of T4 RNA ligase I was used in total volume of 25 µl . The ligated RNAs were size-selected ( ≈ 200-300 nt ) and gel-purified over a denaturing 8 % polyacrylamide/8 M urea/TBE gel ( as described above ) . The di-tagged RNA libraries were reverse-transcribed with SuperScript ® II reverse transcriptase ( Invitrogen ) using random nonamers per the manufacturer 's protocol . RNA was removed using RNase H ( Promega ) per the manufacturer 's protocol and cDNA was amplified in PCR carried out using Phusion ® High-Fidelity Polymerase ( New England Biolabs ) . cDNA was amplified with modified designed Illumina-compatible PCR primers ( 3 ' library Forward 5 ' - CAAGCAGAAGACGGCATACGACAGGTTCAGAGTTCTACAGTCCGA-3 ' ; Reverse 5 ' - AATGATACGGCGACCACCGAGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3 ' ) by 18 cycles of PCR . The products were purified using Agencourt AMPure XP beads ( Beckman ) and analyzed on an Agilent 2100 Bioanalyzer . 3 ' end enriched cDNA libraries were sequenced on individual Genome Analyzer IIx lanes ( 36 bp , single-end ) or on HiSeq 2000 lanes ( 50 bp , single-end ) using primer based on Illumina Multiplexing Read 2 Sequencing Primer ( 5 ' - GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3 ' ) at the CSF NGS unit http://csf.ac.at/ . 	30 µM	Medium supplement	0.998623722062798	http://pakal.ccg.unam.mx/cmendezc/automatic-extraction-growth-conditions/tree/master/extraction-geo/download/srr_htregulondb/GSE98660/GSE98660.soft.gz				0	0	False