GSE77181-GSM2045609-GPL14548-PMID:26872352.tsv
3.57 KB
"strain: K-12 MG1655" "characteristics_ch1.1"
"genotype: lacZ::χχχ mhpR::χχχ proA::ISceIcs tsx::ISceIcs PBAD-sbcDC lacZ+ cynX::GmR lacIq lacZχ-" "characteristics_ch1.2"
"Adaptor Sequences were removed using fastx_clipper. (http://hannonlab.cshl.edu/fastx_toolkit/index.html) - Example: fastx_clipper -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATG -i DL4900_raw.fasta -o DL4900_clipped.fasta" "data_processing.1"
"Data collapsed using fastx collapser to remove identical sequencing reads (http://hannonlab.cshl.edu/fastx_toolkit/index.html) - Example: fastx_collapser -i DL4900_clipped.fasta -o DL4900_clip_clp.fasta" "data_processing.2"
"reads were mapped to the E. coli K12 MG1655 (NC000913.3) genome using Novoalign version 2.07 (www.novocraft.com) - Example: (novoalign -f DL4900_clip_clp.fasta -d NC000913.3.nix -r Random > DL4900.novo)" "data_processing.3"
"yPileup was used to generate count data for the whole genome - Example: pyPileup.py --file_type=novo -f DL4184.novo --tab=NC000913.3.tab --chr=Wholechom.txt -- ignorestrand" "data_processing.4"
"Genome_build: Escherichia coli K12 MG1655 NC000913.3" "data_processing.5"
"Supplementary_files_format_and_content: txt files including count data for the whole genome" "data_processing.6"
"Cells were collected by centrifugation and washed three times in ice-cold 1X PBS. The pellet was then re-suspended in 250 μl ChIP buffer (200 mM Tris-HCl (pH 8.0), 600 mM NaCl 4% Triton X, Complete protease inhibitor cocktail EDTA-free (Roche)). Sonication of crosslinked samples was performed using the Diagenode Bioruptor® at 30s intervals for 10 min at high amplitude. After sonication, 350 μl of ChIP buffer was added to each sample, the samples were mixed by gentle pipetting and 100 μl of each lysate was removed and stored as ‘input’. Immunoprecipitation was performed overnight at 4°C using 1/100 anti-RecA antibody (Abcam, ab63797). IP samples were then incubated with Protein G Dynabeads® (Life Technologies) for 2 h at room temperature. All samples were washed 3 times with 1 X PBS + 0.02% Tween-20 before re-suspending the Protein G dynabeads in 200 μl of TE buffer (10 mM Tris (pH 7.4), 1 mM EDTA) + 1% SDS. 100 μl of TE buffer was added to the input samples and all samples were then incubated at 65°C for 10 h to reverse formaldehyde crosslinks. DNA was isolated using the MinElute PCR purification kit (Qiagen). DNA was eluted in 50 μl of TE buffer using a 2-step elution. Samples were stored at -20°C." "extract_protocol_ch1.1"
"All samples were processed following NEB’s protocol from the NEBNext® ChIP-Seq library preparation kit." "extract_protocol_ch1.2"
"Cells were grown in LB media supplemented with 0.2% arabinose at 37°C to and OD600nm of 0.2-0.25" "growth_protocol_ch1.1"
"Escherichia coli" "organism_ch1.1"
"Bacterial Cell Lysates" "source_name_ch1.1"
"DL4201C_ChIP-seq" "title.1"
"Protein DNA interactions were crosslinked for 10 min at 22.5C with 1% formaldehyde and quenched using glycine to a final concentration of 0.5M" "treatment_protocol_ch1.1"
"ChIP-Seq" "library_strategy.1"
"strain: K-12 MG1655" "characteristics_ch1.1"
"genotype: lacZ::χχχ mhpR::χχχ proA::ISceIcs tsx::ISceIcs PBAD-sbcDC lacZ+ cynX::GmR lacIq lacZχ-" "characteristics_ch1.2"
"Cells were grown in LB media supplemented with 0.2% arabinose at 37°C to and OD600nm of 0.2-0.25" "growth_protocol_ch1.1"
"Escherichia coli" "organism_ch1.1"
"Bacterial Cell Lysates" "source_name_ch1.1"
"Protein DNA interactions were crosslinked for 10 min at 22.5C with 1% formaldehyde and quenched using glycine to a final concentration of 0.5M" "treatment_protocol_ch1.1"