"treatment: N/A"	"characteristics_ch1.1"
"sample type: plasmid pool"	"characteristics_ch1.2"
"reporter: IFNB multi-hit"	"characteristics_ch1.3"
"To infer the tag copy numbers in each Tag-Seq library, all sequence reads were examined, regardless of their quality scores. If the first ten nucleotides of a read perfectly matched one of the 13,000 or 27,000 designed tags and the remaining nucleotides matched the expected upstream MPRA construct sequence, this was counted as one occurrence of that tag. All reads that did not meet this criterion were discarded."	"data_processing.1"
"Total RNA was isolated from cell lysates using RNeasy kits (Qiagen). mRNA was extracted from total RNA using MicroPoly(A)Purist™ kits (Ambion) and treated with DNase I using the Turbo DNA-free™ kit (Ambion). First-strand cDNA was synthesized from 400-700 ng mRNA using High Capacity RNA-to-cDNA kits (Applied Biosystems).  Tag-Seq sequencing libraries were generated directly from 12% of a cDNA reaction or 50 ng plasmid DNA by 26 cycle PCR using Pfu Ultra HS DNA polymerase 2x master mix (Agilent) and primers AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGAGGTGCCTAAAGG (where XXXXXXXX is a library-specific index sequence). The resultant PCR products were size-selected using 2% agarose E-Gel EX (Invitrogen)."	"extract_protocol_ch1.1"
"HEK293T/17 cells (ATCC CRL-11268) were cultured in DMEM (Mediatech) supplemented with 10% FBS and L-glutamine/penicillin/streptomycin."	"growth_protocol_ch1.1"
"Escherichia coli"	"organism_ch1.1"
"Plasmid pool"	"source_name_ch1.1"
"IFNB Multi SeV10 Rep1 Plasmid"	"title.1"
"RNA-Seq"	"library_strategy.1"
"treatment: N/A"	"characteristics_ch1.1"
"sample type: plasmid pool"	"characteristics_ch1.2"
"reporter: IFNB multi-hit"	"characteristics_ch1.3"
"HEK293T/17 cells (ATCC CRL-11268) were cultured in DMEM (Mediatech) supplemented with 10% FBS and L-glutamine/penicillin/streptomycin."	"growth_protocol_ch1.1"
"Escherichia coli"	"organism_ch1.1"
"Plasmid pool"	"source_name_ch1.1"