"genotype: dnaC2"	"characteristics_ch1.1"
"treatment: DpnI digested DNA"	"characteristics_ch1.2"
"strain: MG1655dnaC2"	"characteristics_ch1.3"
"genotype: dnaC2"	"characteristics_ch2.1"
"treatment: control"	"characteristics_ch2.2"
"strain: MG1655dnaC2"	"characteristics_ch2.3"
"Spot intensities were extracted using the Feature Extraction software 10.5.1.1 from Applied Biosystems with a linear dye normalization correction method. The gProcessedSignal and rProcessedSignal was used for further analysis with the statistics software R. Ratios of g (sample) to r (control) were calculated after background substraction. Data points with a value below 0 after background subtraction were set 'null'. Data points form non-unique regions on the chromosome were excluded from analysis."	"data_processing.1"
"500 ng chrom. DNA was digested with 10U of MseI (NEB) in 10μL volume for 3h at 37°C and heat inactivated for 20 min at 65°C. To prepare adapters 100pmol of MseIlong (AGTGGGATTCCGCATGCTAGT) and MseIshortnewNo (TAACTAGCATGC)  were annealed in 8µl ddH2O by heating to 95°C for 3 min and than cooling to 70°C and subsequently to 15°C with 1°C per min. At 15°C 10µl MseI digested DNA, 2µl ligase buffer and 400U T4-ligase (NEB) were added and ligated over night. Ligase was inactivated at 65°C for 10 min. One halve of the ligation mix was digested with 20 U DpnI for 2h at 37°C in a volume of 50µl and the other halve treated similar with water instead of DpnI as control. 5µl of the DNA was amplified in a 50 µl PCR reaction with 0.2mM dNTPs, 0.5µM primer MseIlong, 10µl Phusion HF buffer and 1U Phusion DNA polymerase (Finnzymes) with the program 30sec 98°C, 20x(30sec 98°C, 30 sec 62°C, 60sec 72°C), 10 min 72°C. DNA was purified with a Qiagen PCR cleanup kit."	"extract_protocol_ch1.1"
"500 ng chrom. DNA was digested with 10U of MseI (NEB) in 10μL volume for 3h at 37°C and heat inactivated for 20 min at 65°C. To prepare adapters 100pmol of MseIlong (AGTGGGATTCCGCATGCTAGT) and MseIshortnewNo (TAACTAGCATGC)  were annealed in 8µl ddH2O by heating to 95°C for 3 min and than cooling to 70°C and subsequently to 15°C with 1°C per min. At 15°C 10µl MseI digested DNA, 2µl ligase buffer and 400U T4-ligase (NEB) were added and ligated over night. Ligase was inactivated at 65°C for 10 min. One halve of the ligation mix was digested with 20 U DpnI for 2h at 37°C in a volume of 50µl and the other halve treated similar with water instead of DpnI as control. 5µl of the DNA was amplified in a 50 µl PCR reaction with 0.2mM dNTPs, 0.5µM primer MseIlong, 10µl Phusion HF buffer and 1U Phusion DNA polymerase (Finnzymes) with the program 30sec 98°C, 20x(30sec 98°C, 30 sec 62°C, 60sec 72°C), 10 min 72°C. DNA was purified with a Qiagen PCR cleanup kit."	"extract_protocol_ch2.1"
"Cells were grown at 30 °C to an OD450 of about 0.07 in AB glucose CAA medium, shifted to 39 °C for 70min and back to 30°C for 0min before crosslinking."	"growth_protocol_ch1.1"
"Escherichia coli str. K-12 substr. MG1655"	"organism_ch1.1"
"Escherichia coli"	"organism_ch2.1"
"Methylation in 0 min dnaC2 rep2"	"source_name_ch1.1"
"untreated control"	"source_name_ch2.1"
"Methylation in 0 min dnaC2 rep2"	"title.1"
"Cell cultures were cross linked by addition of 27 µl of formaldehyde (37%) per ml medium (final concentration 1%). Crosslinking was performed at slow shaking (100 rpm) for 20 min followed by quenching with 0.2 ml of 2.5 M glycine per ml medium (final concentration 0.5 M). Cells were collected from 15 ml by centrifugation and washed twice with cold TBS (pH7.5).The pellet wa resuspended in 300μL TE with 40 μl 10% SDS and 3 μl 0.5 M EDTA. After incubation for 5 min at 65°C 750μl isopropanole was added before centrifugation at 15600 rcf for 5 min. The pellet was resuspended in 500μL TE and 3μL RNase A (25mg/ml) was added and incubated for 30 min at 65°C. Subsequently, 100μL proteinase K (25 mg/ml) was added and samples incubated at  42°C for 2 h and 65°C for 6 h to reverse the crosslink followed by phenol extraction and precipitation with ethanol and Na-acetate. Precipitated DNA was resuspended in 50μL dH2O."	"treatment_protocol_ch1.1"
"genotype: dnaC2"	"characteristics_ch1.1"
"treatment: DpnI digested DNA"	"characteristics_ch1.2"
"strain: MG1655dnaC2"	"characteristics_ch1.3"
"genotype: dnaC2"	"characteristics_ch2.1"
"treatment: control"	"characteristics_ch2.2"
"strain: MG1655dnaC2"	"characteristics_ch2.3"
"Cells were grown at 30 °C to an OD450 of about 0.07 in AB glucose CAA medium, shifted to 39 °C for 70min and back to 30°C for 0min before crosslinking."	"growth_protocol_ch1.1"
"Escherichia coli str. K-12 substr. MG1655"	"organism_ch1.1"
"Escherichia coli"	"organism_ch2.1"
"Methylation in 0 min dnaC2 rep2"	"source_name_ch1.1"
"untreated control"	"source_name_ch2.1"
"Cell cultures were cross linked by addition of 27 µl of formaldehyde (37%) per ml medium (final concentration 1%). Crosslinking was performed at slow shaking (100 rpm) for 20 min followed by quenching with 0.2 ml of 2.5 M glycine per ml medium (final concentration 0.5 M). Cells were collected from 15 ml by centrifugation and washed twice with cold TBS (pH7.5).The pellet wa resuspended in 300μL TE with 40 μl 10% SDS and 3 μl 0.5 M EDTA. After incubation for 5 min at 65°C 750μl isopropanole was added before centrifugation at 15600 rcf for 5 min. The pellet was resuspended in 500μL TE and 3μL RNase A (25mg/ml) was added and incubated for 30 min at 65°C. Subsequently, 100μL proteinase K (25 mg/ml) was added and samples incubated at  42°C for 2 h and 65°C for 6 h to reverse the crosslink followed by phenol extraction and precipitation with ethanol and Na-acetate. Precipitated DNA was resuspended in 50μL dH2O."	"treatment_protocol_ch1.1"