.
\
0.15% Bile Salt Mix Stress, 90 minutes, static, 5% CO2 (EHEC strain: 86-24)
0.2 ppm deoxynivalenol
0.2 ppm nivalenol
0.5 hour expression of synthetic protein DX in E. coli
0.5mg/ml SHX for 20min
0.5MIC of CYA, biological rep1
0.5MIC of CYA, biological rep2
0.5MIC of CYA, biological rep3
0.5% (w/v) sodiumbenzoate_0min
0.5% (w/v) sodiumbenzoate_15min
0.5% (w/v) sodiumbenzoate_30min
0.5% (w/v) sodiumbenzoate_5min
0.5% (w/v) sodiumbenzoate_60min
0', before UV treatment, 25 ug total RNA, 2 ug pdN6
0' in minimal medium +0.2% glu, 25 ug total RNA
0' in min med +0.2% glu, 25ug total RNA
0' lexA, before UV 25 ug total RNA, 2 ug pdN6
0 min
0 min, 0.8% butanol
0min-1
0min-2
0min-3
0' minimal + 0.2% glu, 25 ug total RNA
0' minimal +02% glu, 25 ug total RNA
0' minimal medium + 0.2% glu, 25 ug total
0min minus ciprofloxacin
0 min Nov0 ug/ml, 2 ug Say3AI, pdN6 RT
0 min Nov0 ug/ml, dnaCacrD 30 min after synchr start
0 min Nov500 ug/ml, 2 ug Say3AI, pdN6 RT
0 min Nov500 ug/ml, dnaCacrD 30 min after synchr start
0min plus ciprofloxacin
0 min, unstressed
0% rep1
0% rep2
0% sodiumbenzoate_0min
0% sodiumbenzoate_15min
0% sodiumbenzoate_30min
0% sodiumbenzoate_5min
0% sodiumbenzoate_60min
0' wt, before UV treatment, 25 ug total RNA, 2 ug pdN6
0x58 replicate 2 state 1 (IPTG-/aTc-/Ara-)
0x58 replicate 2 state 2 (IPTG+/aTc-/Ara-)
0x58 replicate 2 state 3 (IPTG-/aTc+/Ara-)
0x58 replicate 2 state 4 (IPTG+/aTc+/Ara-)
0x58 replicate 2 state 5 (IPTG-/aTc-/Ara+)
0x58 replicate 2 state 6 (IPTG+/aTc-/Ara+)
0x58 replicate 2 state 7 (IPTG-/aTc+/Ara+)
0x58 replicate 2 state 8 (IPTG+/aTc+/Ara+)
0x58 replicate 3 state 1 (IPTG-/aTc-/Ara-)
0x58 replicate 3 state 2 (IPTG+/aTc-/Ara-)
0x58 replicate 3 state 3 (IPTG-/aTc+/Ara-)
0x58 replicate 3 state 4 (IPTG+/aTc+/Ara-)
0x58 replicate 3 state 5 (IPTG-/aTc-/Ara+)
0x58 replicate 3 state 6 (IPTG+/aTc-/Ara+)
0x58 replicate 3 state 7 (IPTG-/aTc+/Ara+)
0x58 replicate 3 state 8 (IPTG+/aTc+/Ara+)
1.
10,000U Pencillin G in media
1005 fork-blocking strain induced for Tus
1005 fork-blocking strain induced for Tus: fork5_2
1005 fork-blocking strain induced for Tus: fork5_3
1005, LB + 0.2% glucose (tus repressed)
1005, LB + 0.4% arabinose, 2.5 hr (tus induced)
1005, LB + 0.4% arabinose, 3.5 hr (tus induced)
1005, LB + 0.4% arabinose, 90' (tus induced)
100ng 16S rRNA gene amplicon of a mock community
100% rep1
100% rep2
10A_MG+PMA_t60
10B_MG+PMA_t60
10C_MG+PMA_t60
10_ESBL019 Filamented Repl 3
10.FHI9.IND.HUS
10_HF_HP_noDP_noRh [COPRO-Seq]
10-HT874-PS-60min1
10J.0
10min
10 min
10min (additional)
10min after UVtreatment 1', 40J, MG1655 in Davis+0.4%glu
10min UV treated cells, 25 ug total RNA
10 ml of cell culture was mixed with 5 ml ice cold killing buffer (20mM Tris and 5mM MgCl2 and 20mM NaN3) and cells collected by centrifugation (8000g, 4C, 3min). The supernatant was discarded and the pellet resuspended in 300μL TE with 40 μl 10% SDS and 3 μl 0.5 M EDTA. After incubation for 5 min at 65°C 750μl isopropanole was added before centrifugation at 15600 rcf for 5 min. The pellet was resuspended in 500μL TE and 2μL RNase A (25mg/ml) was added and incubated for 30 min at 65°C. Subsequently, 2μL proteinase K (25 mg/ml) was added and samples incubated at 37°C for 15 min followed by phenol extraction and precipitation with ethanol and Na-acetate. Precipitated DNA was resuspended in 50μL dH2O.
10 mM of sodium phosphate and formaldehyde to a final concentration of 1% were then added. After 10min of incubation at room temperature, the samples were incubated 30 min in ice
10 ng of DNA were submitted to the University of Wisconsin-Madison DNA Sequencing Facility for ChIP-seq library preparation.  Samples were sheared to 200-500 nt during the IP process to facilitate library preparation.  All libraries were generated using reagents from the Illumina Paired End Sample Preparation Kit (Illumina) and the Illumina protocol “Preparing Samples for ChIP Sequencing of DNA” (Illumina part # 11257047 RevA) as per the manufacturer’s instructions, except products of the ligation reaction were purified by gel electrophoresis using 2% SizeSelect agarose gels (Invitrogen) targeting 400 bp fragments.  After library construction and amplification, quality and quantity were assessed using an Agilent DNA 1000 series chip assay (Agilent) and QuantIT PicoGreen dsDNA Kit (Invitrogen), respectively, and libraries were standardized to 10μM.  Cluster generation was performed using a cBot Single Read Cluster Generation Kit (v4) and placed on the Illumina cBot.  Single read, 75 bp (rep A) or 36 bp (rep B) runs were performed, using standard SBS kits (v4) and SCS 2.6 on an Illumina Genome Analyzer IIx.   Basecalling was performed using the standard Illumina Pipeline version 1.6.
10 ng of DNA were submitted to the University of Wisconsin-Madison DNA Sequencing Facility for ChIP-seq library preparation.  Samples were sheared to 200-500 nt during the IP process to facilitate library preparation.  All libraries were generated using reagents from the Illumina Paired End Sample Preparation Kit (Illumina) and the Illumina protocol “Preparing Samples for ChIP Sequencing of DNA” (Illumina part # 11257047 RevA) as per the manufacturer’s instructions, except products of the ligation reaction were purified by gel electrophoresis using 2% SizeSelect agarose gels (Invitrogen) targeting either 275 bp fragments (s70 libraries) or 400 bp fragments (FNR libraries).  After library construction and amplification, quality and quantity were assessed using an Agilent DNA 1000 series chip assay (Agilent) and QuantIT PicoGreen dsDNA Kit (Invitrogen), respectively, and libraries were standardized to 10μM.  Cluster generation was performed using a cBot Single Read Cluster Generation Kit (v4) and placed on the Illumina cBot.  A single read, 36 bp run was performed, using standard SBS kits (v4) and SCS 2.6 on an Illumina Genome Analyzer IIx.  A paired read, 100 bp runs were used for one replicate of each s70 aerobic and anaerobic growth conditions, using standard SBS kits (v4) and SCS 2.6 on an Illumina HiSeq.  Basecalling was performed using the standard Illumina Pipeline version 1.6.
10 pmol of a pre-adenylated (rApp) adapter were ligated to 1 μg of nascent (or mature) RNA in a reaction volume of 20 μl, using 400 U T4 RNA Ligase 2, Deletion Mutant (Epicentre, cat. LR2D11310K) in the presence of 20% PEG-8000, by incubation at 25°C for 2 hours. Reaction clean-up was performed using RNA Clean & Concentrator™-5 columns, and RNA was eluted in 20 μl of Fragmentation buffer [65 mM Tris pH 8.3; 100 mM KCl; 5 mM MgCl2]. RNA was fragmented by incubation at 95°C for 8 minutes. Fragmented RNA was purified using RNA Clean & Concentrator™-5 columns, and eluted in 5.5 μl of nuclease-free water. RNA was heat-denatured at 70°C for 5 minutes, and reverse transcription was carried out in a final volume of 10 μl, in the presence of 0.5 mM dNTPs, 5 pmol of RT primer, 20 U RNaseOUT™ Recombinant Ribonuclease Inhibitor (Invitrogen, cat. 10777-019), and 100 U SuperScript® III Reverse Transcriptase (Invitrogen, cat. 18080-044), by incubation at 50°C for 50 minutes. Template RNA was degraded by adding 1 μl of 1 M NaOH, and incubating at 95°C for 5 minutes. Reaction clean-up was performed using RNA Clean & Concentrator™-5 columns, and cDNA was eluted in 6 μl nuclease-free water. cDNA fragments were resolved on a 10% TBE-Urea polyacrylamide gel, and a gel slice corresponding to fragments in the range 40-150 nt was cut. DNA was recovered by passive diffusion in Diffusion buffer for 16 hours at 37°C with moderate shaking. cDNA was precipitated by addition of 1 ml Isopropanol, and 2 μl Glycogen (20 μg/μl), and resuspended in 8.25 μl nuclease-free water. 10 pmol of a 5’-phosphorylated adapter were ligated to the 3’-OH of cDNA fragments in a final reaction volume of 25 μl, in the presence of 0.05 mM ATP, 20% PEG-4000, and 100 U CircLigase™ II ssDNA Ligase (Epicentre, cat. CL9025K), by incubation at 60°C for 4 hours, and 68°C for 2 hours. Adapter-ligated cDNA fragments were purified from excess adapter using 1.8 volumes of Agencourt AMPure XP beads (Beckman Coulter, cat. A63881), following manufacturer’s instructions. cDNA was eluted in 20 μl of nuclease-free water, and indexed sequencing adapters were introduced by 15 cycles of PCR in the presence of 25 pmol of each primer, and 25 μl NEBNext® High-Fidelity 2X PCR Master Mix (NEB, cat. M0541L).
10 pmol of a pre-adenylated (rApp) adapter were ligated to 1 μg of nascent RNA (either total, or rRNA-depleted using Ribo-Zero rRNA Removal Kit (Illumina, cat. MRZB12424)) in a reaction volume of 20 μl, using 400 U T4 RNA Ligase 2, Deletion Mutant in the presence of 20% PEG-8000, by incubation at 25°C for 2 hours. Reaction clean-up was performed using RNA Clean & Concentrator™-5 columns, and RNA was eluted in 5.5 μl nuclease-free water. RNA was heat-denatured at 70°C for 5 minutes, and reverse transcription was carried out in a final volume of 10 μl, in the presence of 0.5 mM dNTPs, 5 pmol of RT primer, 20 U RNaseOUT™ Recombinant Ribonuclease Inhibitor, and 100 U SuperScript® III Reverse Transcriptase, by incubation at 50°C for 50 minutes. Template RNA was degraded by adding 1 μl of 1 M NaOH, and incubating at 95°C for 5 minutes. Reaction clean-up was performed using RNA Clean & Concentrator™-5 columns, and cDNA was eluted in 6 μl nuclease-free water. cDNA fragments were resolved on a 10% TBE-Urea polyacrylamide gel, and three gel slices corresponding to fragments in the ranges of 40-200 nt, 200-400 nt, and 400-600 nt were cut. DNA was recovered by passive diffusion in Diffusion buffer for 16 hours at 37°C with moderate shaking. cDNA was precipitated by addition of 1 ml Isopropanol, and 2 μl Glycogen (20 μg/μl), and resuspended in 8.25 μl nuclease-free water. 10 pmol of a 5’-phosphorilated adapter were ligated to the 3’-OH of cDNA fragments in a final reaction volume of 25 μl, in the presence of 0.05 mM ATP, 20% PEG-4000, and 100 U CircLigase™ II ssDNA Ligase, by incubation at 60°C for 4 hours, and 68°C for 2 hours. Adapter-ligated cDNA fragments were purified from excess adapter using 1.8 volumes of Agencourt AMPure XP beads, following manufacturer’s instructions. cDNA was eluted in 20 μl of nuclease-free water, and indexed sequencing adapters were introduced by 15 cycles of PCR in the presence of 25 pmol of each primer, and 25 μl NEBNext® High-Fidelity 2X PCR Master Mix.
10 pmol of a pre-adenylated (rApp) adapter were ligated to rnpB nascent RNA in a reaction volume of 20 μl, using 400 U T4 RNA Ligase 2, Deletion Mutant in the presence of 20% PEG-8000, by incubation at 25°C for 2 hours. Reaction clean-up was performed using RNA Clean & Concentrator™-5 columns, and RNA was eluted in 5.5 μl nuclease-free water. RNA was heat-denatured at 70°C for 5 minutes, and reverse transcription was carried out in a final volume of 10 μl, in the presence of 0.5 mM dNTPs, 5 pmol of RT primer, 20 U RNaseOUT™ Recombinant Ribonuclease Inhibitor, and 100 U SuperScript® III Reverse Transcriptase, by incubation at 50°C for 50 minutes. Template RNA was degraded by adding 1 μl of 1 M NaOH, and incubating at 95°C for 5 minutes. Reaction clean-up was performed using RNA Clean & Concentrator™-5 columns, and cDNA was eluted in 6 μl nuclease-free water. cDNA fragments were resolved on a 10% TBE-Urea polyacrylamide gel, and a gel slice corresponding to fragments in the range of 40-300 nt was cut. DNA was recovered by passive diffusion in Diffusion buffer for 16 hours at 37°C with moderate shaking. cDNA was precipitated by addition of 1 ml Isopropanol, and 2 μl Glycogen (20 μg/μl), and resuspended in 8.25 μl nuclease-free water. 10 pmol of a 5’-phosphorilated adapter were ligated to the 3’-OH of cDNA fragments in a final reaction volume of 25 μl, in the presence of 0.05 mM ATP, 20% PEG-4000, and 100 U CircLigase™ II ssDNA Ligase, by incubation at 60°C for 4 hours, and 68°C for 2 hours. Adapter-ligated cDNA fragments were purified from excess adapter using 1.8 volumes of Agencourt AMPure XP beads, following manufacturer’s instructions. cDNA was eluted in 20 μl of nuclease-free water, and indexed sequencing adapters were introduced by 15 cycles of PCR in the presence of 25 pmol of each primer, and 25 μl NEBNext® High-Fidelity 2X PCR Master Mix.
10 μg of total RNA sample was subjected to purification for discarding rRNA via the MICROBExpress kit (Ambion) according to the manufacturer’s protocol. Following purification, the RNA was interrupted into short fragments using divalent cations under elevated temperature and the short fragments were used for the cDNA synthesis using a SuperScript Double-Stranded cDNA Synthesis Kit (Invitrogen) according to the manufacturer’s instructions. These cDNA fragments were purified with a QIAquick PCR purification kit (Qiagen), and then went through end reparation, adding poly(A) and ligation of sequencing adaptors. These products were purified with agarose gel electrophoresis and fragments in the size of 200-250 bp were selected for PCR amplification to construct the cDNA library.
1.1A
1.1A_Earth_25
11_ESBL019 Transition Repl 3
11.FHI12.nIND.HUS
11-HT874-PS-60min2
11K.60
1.2A
1.2A_Space_25
12_ESBL019  Reverted Repl 3
12.FHI12.IND.HUS
12_HF_LP_noDP [COPRO-Seq]
12-HT874-PS-60min3
12L.120
1.3A
1.3A_Earth_25
13_ESBL019 Coliform Repl 4
13.FHI24.nIND.HUS
13_HF_LP_noDP [COPRO-Seq]
1.4A
1.4A_Space_25
14_ESBL019 Filamented Repl 4
14_HF_LP_noDP [COPRO-Seq]
150 minutes growth  in LB
15' 10 ug/ml indole aa, minimal medium + 0.2% glu, 25 ug total
15' 15 ug/ml indole aa, minimal medium + 0.2% glu, 25 ug total
15'+50ug/ml Trp vs 0' in min med +0.2% glu
1.5A
1.5A_Earth_50
15degrees replicate 1
15degrees replicate 2
15degrees replicate 3
15_ESBL019 Transition Repl 4
15.FHI25.nIND.HUS
15_HF_LP_noDP [COPRO-Seq]
1.5 hour expression of synthetic protein DX in E. coli
15' in minimal medium +0.2% glu, 25 ug total RNA
15' in min med +0.2% glu+50ug/ml Trp,25ug total RNA
15min
15min (additional)
15 min after turning off oxygen
15 ml of culture was mixed with 30 ml of RNAprotect bacterial reagent (QIAGEN Ltd).
1.5' RNA Decay N-RNaseE (BZ453) in M9  0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. A
1.5' RNA Decay N-RNaseE (BZ453)  in M9  0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. A1
1.5' RNA Decay N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. B
1.5' RNA Decay N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. B1
1.5' RNA Decay of Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone, 40 mM Suc.at 30 C Mid Log Rep A
1.5' RNA Decay of Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log Rep B
1.5' RNA Decay of Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. A2
1.5' RNA Decay of Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. B2
1.5' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Replicate A
1.5' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Replicate A1
1.5' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Replicate B
1.5' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Replicate B1
1.5' RNA Decay of WT (K10) in M9  0.2% Glycerol 0.2% Tryptone, 40 mM Suc. at 30 C Mid Log Rep A
1.5' RNA Decay of WT (K10) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc.at 30 C Mid Log Rep B
1.5' RNA Decay of WT (N3433) in M9  0.2% Glycerol 0.2% Tryptone at 30 C Mid Log Rep. A2
1.5' RNA Decay of WT (N3433) in M9  0.2% Glycerol 0.2% Tryptone at 30 C Mid Log Rep. B2
1.5' RNA Decay of WT (N3433) in M9  0.2% Glycerol 0.2% Tryptone at 30 C Mid Log Replicate A1
1.5' RNA Decay of WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Replicate B1
1.5' RNA Decay of WT (SH3208) in M9  0.2% Glycerol 0.2% Tryptone at 30 C Mid Log Rep. A1
1.5' RNA Decay of WT (SH3208) in M9  0.2% Glycerol 0.2% Tryptone at 30 C Mid Log Rep. B1
15' vs 0' in minimal medium +0.2% glu
16,000 g for 40 s at room temperature.  The supernatant was discarded, and cell pellets
1.6A
1.6A_Space_50
16_ESBL019  Reverted Repl 4
16.FHI25.IND.HUS
170 μl were taken from each of four wells per time point and collected into a fresh tube were 1.360 ml of RNA protection buffer had previously been added. Samples were left for 5 minutes at RT and then centrifuged at 4°C at maximum speed. Supernatant was discarded and pellets frozen at -20°C. RNA extraction was performed using RNeasy Mini Kit from Qiagen [Cat No 74104]. To remove possible traces of genomic DNA contamination, 2 μg of each sample were treated for a second time with DNAseI from Qiagen [Cat No 79254]. Total RNA quality and integrity was assessed using Agilent 2100 Bioanalyzer and Agilent RNA 6000 Nano kit [Cat No 5067-1511]. Samples had an average RIN of 9.5. Enrichment of mRNA was performed using MicrobExpress rRNA removal kit from Thermo Scientific [Cat No AM1905].  Successful rRNA depletion was assessed with analysis on Bioanalyzer. Retrotranscription was then performed starting from 50 ng total enriched mRNA using Tetro cDNA synthesis kit from Bioline [Cat No BIO-65043] and 6 μl of Random Hexamers [Cat No BIO-38028] per reaction. Second cDNA synthesis was performed adding to the first strand synthesis mix 5 μl of Second strand synthesis buffer [Cat No B6117S], 3 μl of dNTPs [Cat No N0446S], 2μl of RNAseH [Cat No M0297L] all from NEB, 2 μl of Polymerase I from Thermo Scientific [Cat No 18010025] and 18 μl of water, per reaction. Samples were incubated at 16°C for 2.5 h. Purification of cDNA was performed using MiniElute PCR purification kit [Cat No 28004] with final elution in 10 μl of DEPC-treated free water. cDNA was quantified using a Qubit fluorometer (Invitrogen).
17.1A
17.1A_Space_25
17.2A
17.2A_Earth_25
172mM SCFA replicate 1
172mM SCFA replicate 2
17.3A
17.3A_Space_25
17.4A
17.4A_Earth_25
17.5A
17.5A_Space_50
17.6A
17.6A_Space_50
17.8A
17.8A_Earth_50
1.7A
1.7A_Earth_50
17.FHI27.nIND.HUS
17_HF_HP_noDP [COPRO-Seq]
18.2A
18.2A_Earth_75
18.3A
18.3A_Space_75
18.4A
18.4A_Earth_75
18.FHI27.IND.HUS
18_HF_HP_noDP [COPRO-Seq]
1.8 ml (ca. 3E+9 cells) were pipetted into 2.0 ml tubes and immediately centrifuged at
195 min, 0.8% butanol
195min-1
195min-2
195min-3
195 min, unstressed
19.FHI36.nIND.nHUS
19_HF_HP_noDP [COPRO-Seq]
1A 1y
1A 4y
1A_MG_t0
1A T0
1B_MG_t0
1-butanol was added at a final concentration of 0.9% (vol/vol) and cells were further incubated for 30 min.
1C_MG_t0
1_ESBL019 Coliform Repl 1
1.FHI4.nIND.HUS
1_HF_LP_noDP_noRh [COPRO-Seq]
1.Holme T, Arvidson S, Lindholm B, and Pavlu B. 1970. Enzymes: Laboratory-scale production. Process Biochemistry 62-66.
1 hour expression of synthetic protein DX in E. coli
1-HT873-PA1
1-HT873-PA1-
1. library(maanova)
1 min Nov0 ug/ml, 2 ug Say3AI, pdN6 RT
1 min Nov0 ug/ml, dnaCacrD 30 min after synchr start
1 min Nov500 ug/ml, 2 ug Say3AI, pdN6 RT
1 min Nov500 ug/ml, dnaCacrD 30 min after synchr start
1 ml aliquot of culture was transferred to pressure vessel and pressurized at 1MPa for 15 min
1mL aliquots were harvested and mixed with 0.5mL Phenol/ethanol (5% (v/v) Phenol in EtOHabs). Cells were collected by centrifugation and stored at -80°C until use.
1 ml of each culture with the mycotoxin was centrifuged and total RNA was prepared using Hybrid-RTM kit (Gene All, Seoul, Korea) according to the manufacturer’s protocols. A MICOBExpressTM bacterial mRNA enrichment kit (Ambion, Texas, USA) was used to remove bacterial rRNA from the total RNA samples.
1 ml of overnight culture was prepared for E. coli DY 330 GyrA-SPA or E. coli DY 330 GyrA-SPA MuSGS by seeding 2YT medium supplemented with antibiotics (kanamycin 50 µg/ml for DY 330 GyrA-SPA and kanamycin 50 µg/ml, chloramphenicol 15 µg/ml for DY 330 GyrA-SPA MuSGS) with cells from one isolate colony.
1 ml of VWPE extract (1 mg/ml), 1 ml of ethanol 20% and 1 ml of LB broth were added when the OD600 of each culture reached 0.4
1. Neubauer, A., J. Soini, M. Bollok, M. Zenker, J. Sandqvist, J. Myllyharju, and P. Neubauer. 2007. Fermentation process for tetrameric human collagen prolyl 4-hydroxylase in Escherichia coli: improvement by gene optimisation of the PDI/beta subunit and repeated addition of the inducer anhydrotetracycline. J Biotechnol 128:308-321.
1. Use Agilent software Feature Extraction to analyze spotted arrays.
2003, PNAS). To minimize the effect of such contributions, microarray data were
200 bp insert, rRNA depletion
200µl of prepared E.coli O157 cells within LB broth is spreaded to LB agar plate, and sterilized 6mm filtered paper disk was placed on the plate tightly, where E.coli O157 is spreaded. Each filtered fractions are injected to each paper disk and Distilled water and Ampicillin were used as negative- and positive control each and then cultured at 37℃ for 24 hours. Finally the diameter of the cleared zone arisen around the paper disk was measured.
20.FHI36.IND.nHUS
20_HF_HP_noDP [COPRO-Seq]
20min after UVtreatment 1', 40J, MG1655 in Davis+0.4%glu
20 min Nov0 ug/ml, 2 ug Say3AI, pdN6 RT
20 min Nov0 ug/ml, dnaCacrD 30 min after synchr start
20 min Nov500 ug/ml, 2 ug Say3AI, pdN6 RT
20 min Nov500 ug/ml, dnaCacrD 30 min after synchr start
20 min Nov50 ug/ml, 2 ug Say3AI, pdN6 RT
20 min Nov50 ug/ml, dnaCacrD 30 min after synchr start
20min untreatedcells, 25 ug total RNA
20min UV treated cells, 25 ug total RNA
20min UVtreatment control, MG1655 in Davis+0.4%glu
20 ug of Total RNA from MG1655 (Repaired NCM 3416) in LB at 30 degrees OD 600=0.8
20 ug of Total RNA from MG1655 (Repaired NCM 3416) in M9 at 30 degrees OD 600=0.8
2.1A
2.1A_Earth_75
21.FHI43.nIND.nHUS
22.FHI43.IND.nHUS
2.3A
23A1
2.3A_Earth_75
23B1
23C3
23.FHI48.nIND.HUS
23S
240 minutes growth  in LB
2.4A
2.4A_Space_75
252978410001_B7A_CY5_BCE001MS16_CY3.mev.refIsIB.out
252978410001_B7A_CY5_BCE022DS6_CY3.mev.refIsIB.out
252978410001_B7A_CY5_BCE063MS14_CY3.mev.refIsIB.out
252978410001_B7A_CY5_ETP98015_CY3.mev.refIsIB.out
252978410002_B7A_CY5_BCE007_CY3.mev.refIsIB.out
252978410002_B7A_CY5_BCE041_MS11_CY3.mev.refIsIB.out
252978410002_B7A_CY5_BCE063_DS4_CY3.mev.refIsIB.out
252978410002_B7A_CY5_ETP98028_CY3.mev.refIsIB.out
252978410003_B7A_CY5_C35662_CY3.mev.refIsIB.out
252978410003_B7A_CY5_ETP05_007_CY3.mev.refIsIB.out
252978410003_B7A_CY5_ETP05_017_CY3.mev.refIsIB.out
252978410003_B7A_CY5_ETP98062_CY3.mev.refIsIB.out
252978410004_B7A_CY5_BCE003_DS5_CY3.mev.refIsIB.out
252978410004_B7A_CY5_BCE058_MS13_CY3.mev.refIsIB.out
252978410004_B7A_CY5_BCE069_MS9_CY3.mev.refIsIB.out
252978410004_B7A_CY5_BCE129_DS2_CY3.mev.refIsIB.out
252978410005_B7A_CY5_BCE008_MS13_CY3.mev.refIsIB.out
252978410005_B7A_CY5_BCE013_DS1_CY3.mev.refIsIB.out
252978410005_B7A_CY5_BCE035_MS8_CY3.mev.refIsIB.out
252978410005_B7A_CY5_BCE039_DS2_CY3.mev.refIsIB.out
252978410006_B7A_CY5_ETP05_012_CY3.mev.refIsIB.out
252978410006_B7A_CY5_ETP05_019_CY3.mev.refIsIB.out
252978410006_B7A_CY5_ETP05_026_CY3.mev.refIsIB.out
252978410006_B7A_CY5_ETP05_044_CY3.mev.refIsIB.out
252978410007_B7A_CY5_BCE002_MS12_CY3.mev.refIsIB.out
252978410007_B7A_CY5_BCE021_DS7_CY3.mev.refIsIB.out
252978410007_B7A_CY5_BCE049_MS9_CY3.mev.refIsIB.out
252978410007_B7A_CY5_ETP98061_CY3.mev.refIsIB.out
252978410008_B7A_CY5_180050_CY3.mev.refIsIB.out
252978410008_B7A_CY5_ETP98103_CY3.mev.refIsIB.ou
252978410008_B7A_CY5_ETP98111_CY3.mev.refIsIB.out
252978410008_B7A_CY5_TW03741_CY3.mev.refIsIB.out
252978410009_B7A_CY5_E1787_CY3.mev.refIsIB.out
252978410009_B7A_CY5_E747_0_CY3.mev.refIsIB.out
252978410009_B7A_CY5_F595C_CY3.mev.refIsIB.out
252978410009_B7A_CY5_WS3572A1.mev.refIsIB.out
252978410010_B7A_CY5_229_1_CY3.mev.refIsIB.out
252978410010_B7A_CY5_ICDDR_B_p13_CY3.mev.refIsIB.out
252978410010_B7A_CY5_ICDDR_B_p1_CY3.mev.refIsIB.out
252978410010_B7A_CY5_ICDDR_B_p4_CY3.mev.refIsIB.out
252978410011_B7A_CY5_DS26_1_CY3.mev.refIsIB.out
252978410011_B7A_CY5_E1777_CY3.mev.refIsIB.out
252978410011_B7A_CY5_E9034A_CY3.mev.refIsIB.out
252978410011_B7A_CY5_NN_34_1_3_CY3.mev.refIsIB.out
252978410012_B7A_CY5_42_1_C1_CY3.mev.refIsIB.out
252978410012_B7A_CY5_ETEC_18_2_CY3.mev.refIsIB.out
252978410012_B7A_CY5_ICDDR_B_p12_CY3.mev.refIsIB.out
252978410012_B7A_CY5_LSN02_012560_A_CY3.mev.refIsIB.out
252978410013_B7A_CY5_180600_CY3.mev.refIsIB.out
252978410013_B7A_CY5_ETEC_10_1_CY3.mev.refIsIB.out
252978410013_B7A_CY5_TW3574_CY3.mev.refIsIB.out
252978410013_B7A_CY5_TW3585_CY3.mev.refIsIB.out
252978410014_B7A_CY5_E20738A_CY3.mev.refIsIB.out
252978410014_B7A_CY5_PUTI_O26_UMN_O26_CY3.mev.refIsIB.out
252978410014_B7A_CY5_sPRH450_CY3.mev.refIsIB.out
252978410015_B7A_CY5_E1392_75_CY3.mev.refIsIB.out
252978410015_B7A_CY5_ICDDR_B_p5_CY3.mev.refIsIB.out
252978410015_B7A_CY5_ICDDR_B_p8_CY3.mev.refIsIB.out
252978410015_B7A_CY5_sPRH613_CY3.mev.refIsIB.out
252978410016_B7A_CY5_D02_2_CY3.mev.refIsIB.out
252978410016_B7A_CY5_E1785_CY3.mev.refIsIB.out
252978410016_B7A_CY5_ETP98068_CY3.mev.refIsIB.out
252978410016_B7A_CY5_ICDDR_B_p11_CY3.mev.refIsIB.out
252978410017_B7A_CY5_C35776_CY3.mev.refIsIB.out
252978410017_B7A_CY5_E1788_CY3.mev.refIsIB.out
252978410017_B7A_CY5_ETEC_JURUA_18_11_CY3.mev.refIsIB.out
252978410017_B7A_CY5_ICDDR_B_p9_CY3.mev.refIsIB.out
252978410018_B7A_CY5_ARG3_CY3.mev.refIsIB.out
252978410018_B7A_CY5_E1792_CY3.mev.refIsIB.out
252978410018_B7A_CY5_MG1655_CY3.mev.refIsIB.out
252978410018_B7A_CY5_sPRH21_CY3.mev.refIsIB.out
252978410019_B7A_CY5_E1786_CY3.mev.refIsIB.out
252978410019_B7A_CY5_WS0115A_CY3.mev.refIsIB.out
252978410020_B7A_CY5_179550_CY3.mev.refIsIB.out
252978410020_B7A_CY5_BCE046_DS2_CY3.mev.refIsIB.out
252978410020_B7A_CY5_BCE046_DS7_CY3.mev.refIsIB.out
252978410020_B7A_CY5_ETP98114_CY3.mev.refIsIB.out
252978410021_B7A_CY5_1080200_CY3.mev.refIsIB.out
252978410021_B7A_CY5_BCE008_MS1_CY3.mev.refIsIB.out
252978410021_B7A_CY5_BCE054_MS24_CY3.mev.refIsIB.out
252978410021_B7A_CY5_ETP05_046_CY3.mev.refIsIB.out
252978410022_B7A_CY5_BCE062_DS2_CY3.mev.refIsIB.out
252978410022_B7A_CY5_BCE069_DS2_CY3.mev.refIsIB.out
252978410022_B7A_CY5_ETP98038_CY3.mev.refIsIB.out
252978410022_B7A_CY5_ETP98042_CY3.mev.refIsIB.out
252978410023_B7A_CY5_173150_CY3.mev.refIsIB.out
252978410023_B7A_CY5_174750_CY3.mev.refIsIB.out
252978410023_B7A_CY5_178850_CY3.mev.refIsIB.out
252978410023_B7A_CY5_ETP98115_CY3.mev.refIsIB.out
252978410024_B7A_CY5_BCE018_DS6_CY3.mev.refIsIB.out
252978410024_B7A_CY5_BCE019_MS16_CY3.mev.refIsIB.out
252978410024_B7A_CY5_BCE046_MS16_CY3.mev.refIsIB.out
252978410024_B7A_CY5_BCE069_MS15_CY3.mev.refIsIB.out
252978410025_B7A_CY5_BCE007_MS11_CY3.mev.refIsIB.out
252978410025_B7A_CY5_BCE039_MS13_CY3.mev.refIsIB.out
252978410025_B7A_CY5_C35959_CY3.mev.refIsIB.out
252978410025_B7A_CY5_ETP05_050_CY3.mev.refIsIB.out
252978410026_B7A_CY5_E24377A_CY3.mev.refIsIB.out
252978410026_B7A_CY5_sPRH_418_CY3.mev.refIsIB.out
252978410026_B7A_CY5_WS1896A_CY3.mev.refIsIB.out
252978410026_B7A_CY5_WS2068A_CY3.mev.refIsIB.out
252978410027_B7A_CY5_LSN03_016011_A_CY3.mev.refIsIB.out
252978410027_B7A_CY5_sPRH_414_CY3.mev.refIsIB.out
252978410027_B7A_CY5_sPRH_420_CY3.mev.refIsIB.out
252978410027_B7A_ETEC20_10_CY3.mev.refIsIB.out
252978410028_B7A_CY5_ETP98073_CY3.mev.refIsIB.out
252978410028_B7A_CY5_TW3439_CY3.mev.refIsIB.out
252978410028_B7A_CY5_TW3576_CY3.mev.refIsIB.out
252978410028_B7A_CY5_WS3080A_CY3.mev.refIsIB.out
252978410029_B7A_CY5_sPRH_403_CY3.mev.refIsIB.out
252978410029_B7A_CY5_sPRH_443_CY3.mev.refIsIB.out
252978410029_B7A_CY5_sPRH_604_CY3.mev.refIsIB.out
252978410029_B7A_CY5_sPRH_606_CY3.mev.refIsIB.out
252978410030_B7A_CY5_C36255_CY3.mev.refIsIB.out
252978410030_B7A_CY5_ETP05_008_CY3.mev.refIsIB.out
252978410030_B7A_CY5_ETP98105_CY3.mev.refIsIB.out
252978410030_B7A_ETP98066_CY3.mev.refIsIB.out
252978410031_B7A_CY5_BCE054_DS4_CY3.mev.refIsIB.out
252978410031_B7A_CY5_BCE068_MS10_CY3.mev.refIsIB.out
252978410031_B7A_CY5_BCE068_MS23.mev.refIsIB.out
252978410031_B7A_CY5_ETP05_015_CY3.mev.refIsIB.out
252978410032_B7A_CY5_BCE011_DS3_CY3.mev.refIsIB.out
252978410032_B7A_CY5_BCE049_DS3_CY3.mev.refIsIB.out
252978410032_B7A_CY5_BCE062_MS24_CY3.mev.refIsIB.out
252978410032_B7A_CY5_BCE066_DS5_CY3.mev.refIsIB.out
252978410033_B7A_CY5_BCE035_DS6_CY3.mev.refIsIB.out
252978410033_B7A_CY5_C35209_CY3.mev.refIsIB.out
252978410033_B7A_CY5_ETP_98004_CY3.mev.refIsIB.out
252978410033_B7A_CY5_ETP98056_CY3.mev.refIsIB.out
252978410034_B7A_CY5_BCE005_MS23_CY3.mev.refIsIB.out
252978410034_B7A_CY5_BCE061_DS1_CY3.mev.refIsIB.out
252978410034_B7A_CY5_ETP05_038_CY3.mev.refIsIB.out
252978410034_B7A_CY5_ETP98053_CY3.mev.refIsIB.out
252978410035_B7A_CY5_BCE055_DS1_CY3.mev.refIsIB.out
252978410035_B7A_CY5_ETP05_016_CY3.mev.refIsIB.out
252978410035_B7A_CY5_ETP05_020_CY3.mev.refIsIB.out
252978410035_B7A_CY5_ETP05_039_CY3.mev.refIsIB.out
252978410058_B7A_CY5_178900_CY3.mev.refIsIB.out
252978410058_B7A_CY5_179100_CY3.mev.refIsIB.out
252978410058_B7A_CY5_ETP05_009_CY3.mev.refIsIB.out
252978410058_B7A_CY5_ETP05_010_CY3.mev.refIsIB.out
252978410059_B7A_CY5_532_WS6866B1_CY3.mev.refIsIB.out
252978410059_B7A_CY5_ETP05_047_CY3.mev.refIsIB.out
252978410059_B7A_CY5_ETP98097_CY3.mev.refIsIB.out
252978410059_B7A_CY5_ETP98112_CY3.mev.refIsIB.out
252978410060_B7A_CY5_ARG2_CY3.mev.refIsIB.out
252978410060_B7A_CY5_C35134_CY3.mev.refIsIB.out
252978410060_B7A_CY5_E1791_CY3.mev.refIsIB.out
252978410060_B7A_CY5_WS3596_A4_CY3.mev.refIsIB.out
252978410061_B7A_CY5_COCAR07_40_CY3.mev.refIsIB.out
252978410061_B7A_CY5_COSIN07_88_CY3.mev.refIsIB.out
252978410061_B7A_CY5_COSIN07_92_CY3.mev.refIsIB.out
252978410062_B7A_CY5_DS168_1_CY3.mev.refIsIB.out
252978410062_B7A_CY5_PE360_CY3.mev.refIsIB.out
252978410062_B7A_CY5_WS4087_A1_CY3.mev.refIsIB.out
252978410062_B7A_CY5_WS7179_A2_CY3.mev.refIsIB.out
252978410063_B7A_CY5_B7A_CY3.mev.refIsIB.out
252978410063_B7A_CY5_COSIN07_14_CY3.mev.refIsIB.out
252978410063_B7A_CY5_sPRH372_CY3.mev.refIsIB.out
252978410063_B7A_CY5_TW3452_CY3.mev.refIsIB.out
252978410064_B7A_CY5_E1789_CY3.mev.refIsIB.out
252978410064_B7A_CY5_E1790_CY3.mev.refIsIB.out
252978410064_B7A_CY5_HS_CY3.mev.refIsIB.out
252978410064_B7A_CY5_sPRH609_CY3.mev.refIsIB.out
252978410065_B7A_CY5_350C1A_CY3.mev.refIsIB.out
252978410065_B7A_CY5_E2528_C1_CY3.mev.refIsIB.out
252978410065_B7A_CY5_E8775_CY3.mev.refIsIB.out
252978410065_B7A_CY5_M424_C1_CY3.mev.refIsIB.out
252978410066_B7A_CY5_2230_CY3.mev.refIsIB.out
252978410066_B7A_CY5_ICDDR_P_2_CY3.mev.refIsIB.out
252978410066_B7A_CY5_WS1933D_CY3.mev.refIsIB.out
252978410066_B7A_CY5_WS6582_A1_CY3.mev.refIsIB.out
252978410067_B7A_CY5_B2C_CY3.mev.refIsIB.out
252978410067_B7A_CY5_ETEC_8_11_CY3.mev.refIsIB.out
252978410067_B7A_CY5_F5656_C1_CY3.mev.refIsIB.out
252978410067_B7A_CY5_WS7162_A1_CY3.mev.refIsIB.out
252978410068_B7A_CY5_CFT073_CY3.mev.refIsIB.out
252978410068_B7A_CY5_ICDDR_B_p_10_CY3.mev.refIsIB.out
252978410068_B7A_CY5_M408C1_CY3.mev.refIsIB.out
252978410068_B7A_CY5_WS3294A_CY3.mev.refIsIB.out
252978410069_B7A_CY5_278485_1_CY3.mev.refIsIB.out
252978410069_B7A_CY5_sPRH25_CY3.mev.refIsIB.out
252978410069_B7A_CY5_sPRH421_CY3.mev.refIsIB.out
252978410069_B7A_CY5_sPRH610_CY3.mev.refIsIB.out
252978410070_B7A_CY5_ICDDR_B_p7_CY3.mev.refIsIB.out
252978410070_B7A_CY5_NR_12_CY3.mev.refIsIB.out
252978410070_B7A_CY5_sPRH20_CY3.mev.refIsIB.out
252978410070_B7A_CY5_sPRH612_CY3.mev.refIsIB.out
252978410071_B7A_CY5_292_1_CY3.mev.refIsIB.out
252978410071_B7A_CY5_COCAR07_043_CY3.mev.refIsIB.out
252978410071_B7A_CY5_COSIN07_61_CY3.mev.refIsIB.out
252978410071_B7A_CY5_O157_h7_CY3.mev.refIsIB.out
252978410072_B7A_CY5_COSIN07_36_CY3.mev.refIsIB.out
252978410072_B7A_CY5_ICDDR_B_p6_CY3.mev.refIsIB.out
252978410072_B7A_CY5_O63_nm_CY3.mev.refIsIB.out
252978410072_B7A_CY5_sPRH605_CY3.mev.refIsIB.out
252978410073_B7A_CY5_214_4_CY3.mev.refIsIB.out
252978410073_B7A_CY5_E7476A_CY3.mev.refIsIB.out
252978410073_B7A_CY5_WS1896_A1_CY3.mev.refIsIB.out
252978410073_B7A_CY5_WS2173A_CY3.mev.refIsIB.out
252978410075_B7A_CY5_ETP05_011_CY3.mev.refIsIB.out
252978410075_B7A_CY5_ETP05_035_CY3.mev.refIsIB.out
252978410075_B7A_CY5_O78_h11_CY3.mev.refIsIB.out
252978410075_B7A_CY5_sPRH445_CY3.mev.refIsIB.out
252978410076_B7A_CY5_178200_CY3.mev.refIsIB.out
252978410076_B7A_CY5_C35213_CY3.mev.refIsIB.out
252978410076_B7A_CY5_C35605_CY3.mev.refIsIB.out
252978410076_B7A_CY5_ETP98109_CY3.mev.refIsIB.out
252978410077_B7A_CY5_174900_CY3.mev.refIsIB.out
252978410077_B7A_CY5_C34666_CY3.mev.refIsIB.out
252978410077_B7A_CY5_ETP05_002_CY3.mev.refIsIB.out
252978410077_B7A_CY5_ETP05_003_CY3.mev.refIsIB.out
252978410078_B7A_CY5_2_1_CY3.mev.refIsIB.out
252978410078_B7A_CY5_WS2741_A1_CY3.mev.refIsIB.out
252978410078_B7A_CY5_WS4264_A1_CY3.mev.refIsIB.out
252978410078_B7A_CY5_WS5874_A1_CY3.mev.refIsIB.out
25.FHI79.nIND.HUS
25 min after turning off oxygen
26.FHI79.IND.HUS
26% rep1
26% rep2
27.FHI95.nIND.nHUS
285c/control vector at 30 C 1
285c/control vector at 30 C 2
285c/control vector at 30 C 3
28.FHI95.IND.nHUS
29.St. Olav40.nIND.nHUS
2A 1y
2A 4y
2A_MG_t10
2B_MG_t10
2C_MG_t10
2_ESBL019 Filamented Repl 1
2.FHI4.IND.HUS
2_HF_LP_noDP_noRh [COPRO-Seq]
2 hour expression of synthetic protein DX in E. coli
2-HT873-PA2
2-HT873-PA2-
2 min after turning off oxygen
2 min Nov10 ug/ml, 2 ug Sau3AI, pdN6 RT
2 min Nov10 ug/ml, dnaCacrD 30 min after synchr start
2 min Nov2 ug/ml, 2 ug Say3AI, pdN6 RT
2 min Nov2 ug/ml, dnaCacrD 30 min after synchr start
2 min Nov5 ug/ml, 2 ug Say3AI, pdN6 RT
2 min Nov5 ug/ml, dnaCacrD 30 min after synchr start
2 ppm deoxynivalenol
2 ppm nivalenol
2. Read data:
2' RNA Decay of MG1655 (Repaired NCM 3416) in LB at 30 C
2' RNA Decay of MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose Trial A
2' RNA Decay of MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose Trial B
2 ug of Genomic MG 1655 (Repaired NCM 3416) DNA
2 ug of MG1655 (Repaired NCM 3416) Genomic DNA
2. Use TM4 suite software ExpressConverter to modify Agilent Feature Extraction file into *.mev. 
2xOriT
2 μg of RNA from the cytoplasmic fraction were diluted in 20 μl of Fragmentation buffer, and fragmented by incubation at 95°C for 5 minutes. Fragmented RNA was purified using RNA Clean & Concentrator™-5 columns. End repair of RNA fragments was performed in a final volume of 20 μl, in the presence of 20 U T4 Polynucleotide Kinase (NEB, cat. M0201L), and 20 U SUPERase• In™ RNase Inhibitor, by incubation at 37°C for 1 hour. End-repaired RNA was purified again using RNA Clean & Concentrator™-5 columns, and eluted in 6 μl of nuclease-free water. 6 μl of 2X RNA Loading Dye were added to end-repaired RNA. RNA was heated to 95°C for 2 minutes, and immediately placed on ice. Samples were resolved on a 10% TBE-Urea polyacrylamide gel, and a gel slice corresponding to fragments above 200 nt was cut. The gel slice was crushed by centrifugation through a punctured 0.5 ml tube, and resuspended in 500 μl of Diffusion buffer supplemented with 60 U SUPERase• In™ RNase Inhibitor, then rotated at 4°C for 16 hours to allow passive diffusion of RNA fragments into buffer. RNA was precipitated by addition of 1 ml Isopropanol, and 2 μl Glycogen (20 μg/μl), and resuspended in 6 μl nuclease-free water. 10 pmol of a pre-adenylated (rApp) adapter were ligated to size-selected RNA fragments in a reaction volume of 20 μl, using 400 U T4 RNA Ligase 2, Deletion Mutant in the presence of 20% PEG-8000, by incubation at 25°C for 2 hours. Reaction clean-up was performed using RNA Clean & Concentrator™-5 columns, and RNA was eluted in 5.5 μl nuclease-free water. RNA was heat-denatured at 70°C for 5 minutes, and reverse transcription was carried out in a final volume of 10 μl, in the presence of 0.5 mM dNTPs, 5 pmol of RT primer, 20 U RNaseOUT™ Recombinant Ribonuclease Inhibitor, and 100 U SuperScript® III Reverse Transcriptase, by incubation at 50°C for 50 minutes. Template RNA was degraded by adding 1 μl of 1 M NaOH, and incubating at 95°C for 5 minutes. Reaction clean-up was performed using RNA Clean & Concentrator™-5 columns, and cDNA was eluted in 6 μl nuclease-free water. cDNA fragments were resolved on a 10% TBE-Urea polyacrylamide gel, and a gel slice corresponding to fragments in the range of 40-150 nt was cut (corresponding to truncated cDNA products). DNA was recovered by passive diffusion in Diffusion buffer for 16 hours at 37°C with moderate shaking. cDNA was precipitated by addition of 1 ml Isopropanol, and 2 μl Glycogen (20 μg/μl), and resuspended in 8.25 μl nuclease-free water. 10 pmol of a 5’-phosphorilated adapter were ligated to the 3’-OH of cDNA fragments in a final reaction volume of 25 μl, in the presence of 0.05 mM ATP, 20% PEG-4000, and 100 U CircLigase™ II ssDNA Ligase, by incubation at 60°C for 4 hours, and 68°C for 2 hours. Adapter-ligated cDNA fragments were purified from excess adapter using 1.8 volumes of Agencourt AMPure XP beads, following manufacturer’s instructions. cDNA was eluted in 20 μl of nuclease-free water, and indexed sequencing adapters were introduced by 15 cycles of PCR in the presence of 25 pmol of each primer, and 25 μl NEBNext® High-Fidelity 2X PCR Master Mix.
30' 10 ug/ml indole aa, minimal medium + 0.2% glu, 25 ug total
30' 15 ug/ml indole aa, 25 ug total RNA
30'+50ug/ml Trp vs 0' in min med +0.2% glu
30' in minimal medium +0.2% glu, 25 ug total RNA
30' in min med +0.2% glu+50ug/ml Trp,25ug tot RNA
30 min
30 min, 0.8% butanol
30min-1
30min-2
30min-3
30min minus ciprofloxacin
30min plus ciprofloxacin
30 min, unstressed
30mM SCFA replicate 1
30mM SCFA replicate 2
30mM SCFA replicate 3
30mM SCFA replicate 4
30' vs 0' in minimal medium +0.2% glu
31.St. Olav104.nIND.nHUS
32D
32.St. Olav104.IND.nHUS
33D
33.St. Olav157.nIND.nHUS
34.St. Olav157.IND.nHUS
35381_1
35382_2
35B
3.5 hour expression of synthetic protein DX in E. coli
35.St. Olav172.nIND.nHUS
360 minutes growth  in LB
37.St. Olav174.nIND.nHUS
38.St. Olav174.IND.nHUS
39A1
39B1
39C1
39.St. Olav178.nIND.nHUS
3A 1m
3A 1y
3A 4y
    3a). If both channels (QUERY_MEDIAN_INTENSITY and REF_MEDIAN_INTENSITY) are zero, assign the value \
3A_MG_t30
    3b). If one channel is zero and the other is not zero, substitute the zero with one (1) and then, assign the log2 ratio of QUERY_MEDIAN_INTENSITY/REF_MEDIAN_INTENSITY to VALUE
3B_MG_t30
3. Calculate the value of log2 ratio (Reference/Query) from the normalized .mev file:
    3c). If neither channel is zero, assign the log2 ratio of QUERY_MEDIAN_INTENSITY/REF_MEDIAN_INTENSITY to VALUE.
3C_MG_t30
3C-seq: 5 µg of a 3C library was suspended in water (final volume 130 µL) and sheared using a Covaris S220 instrument (Duty cycle 5, Intensity 5, cycles/burst 200, time 60 sec for 4 cycles). The DNA was purified and processed according to manufacturer instructions (Paired-End DNA sample Prep Kit – Illumina – PE-930-1001), except that DNA was ligated to custom-made adapters (see Marbouty M. et al, 2015, Mol Cell) for 4 hours at room temperature. Tubes were then incubated at 65°C for 20 minutes. DNA fragments ranging in size from 400 to 900 pb were purified using a PippinPrep apparatus (SAGE Science). For each library, four test PCR reactions were performed to determine the optimal number of PCR cycles (1 or 2 µL of the collected DNA, Illumina primers PE1.0 and PE2.0 using Taq Phusion [Finnzymes]). A large-scale PCR (8 reactions) was then set-up with the number of PCR cycles determined previously. The PCR product was finally purified on Qiagen MinElute columns and subject to paired-end sequenced on an Illumina sequencer.
3C-seq libraries were proccessed using the 3C-seq pipeline available at (https://github.com/koszullab/).
3C-seq of E. coli fis cells in exponential phase 30°C
3C-seq of E. coli fis cells in exponential phase 30°C -Replicate 1
3C-seq of E. coli hns cells in exponential phase 30°C
3C-seq of E. coli hns cells in exponential phase 30°C -Replicate 1
3C-seq of E. coli hupAB cells in exponential phase 37°C
3C-seq of E. coli hupAB cells in exponential phase 37°C -Replicate 1
3C-seq of E. coli matP cells in exponential phase 22°C
3C-seq of E. coli matP cells in exponential phase 30°C
3C-seq of E. coli matP cells in exponential phase 30°C -Replicate 1
3C-seq of E. coli matPDC20 cells harbouring plasmid pGBM2-5xmatS in exponential phase 30°C
3C-seq of E. coli matPDC20 cells harbouring plasmid pGBM2 in exponential phase 30°C
3C-seq of E. coli matPDC20 cells in exponential phase 30°C
3C-seq of E. coli mukB cells in exponential phase 22°C
3C-seq of E. coli mukB cells in exponential phase 22°C -Replicate 1
3C-seq of E. coli mukBmatP cells in exponential phase 22°C
3C-seq of E. coli wt cells harbouring plasmid pGBM2-5xmatS in exponential phase 30°C
3C-seq of E. coli wt cells harbouring plasmid pGBM2-5xmatS in exponential phase 30°C -Replicate 1
3C-seq of E. coli wt cells harbouring plasmid pGBM2 in exponential phase 30°C
3C-seq of E. coli wt cells harbouring plasmid pGBM2 in exponential phase 30°C -Replicate 1
3C-seq of E. coli wt cells in exponential phase 22°C
3C-seq of E. coli wt cells in exponential phase 22°C -Replicate 1
3C-seq of E. coli wt cells in exponential phase 30°C
3C-seq of E. coli wt cells in exponential phase 30°C -Replicate 1
3C-seq of E. coli wt cells in exponential phase 30°C -Replicate 2
3C-seq of E. coli wt cells in exponential phase 37°C
3C-seq of E. coli wt cells in exponential phase 37°C -Replicate 1
3C-seq of E. coli wt cells in exponential phase LB 30°C
3C-seq of E. coli wt cells in exponential phase LB 30°C -Replicate 1
3C-seq of E. coli wt cells in stationary phase 30°C (30h)
3C-seq of E. coli wt cells in stationary phase 30°C (30h) -Replicate 1
3C-seq of E. coli zapB cells harbouring plasmid pGBM2-5xmatS in exponential phase 30°C
3C-seq of E. coli zapB cells harbouring plasmid pGBM2 in exponential phase 30°C
3C-seq of E. coli zapB cells in exponential phase 30°C
3'-end RNA-seq, Cytosolic fraction
3'-end RNA-seq, Cytosolic fraction, Replicate #1
3'-end RNA-seq, Cytosolic fraction, Replicate #2
3'-end RNA-seq, Nucleoid fraction
3'-end RNA-seq, Nucleoid fraction, Replicate #1
3'-end RNA-seq, Nucleoid fraction, Replicate #2
3_ESBL019 Transition Repl 1
3.FHI6.nIND.HUS
3_HF_LP_noDP_noRh [COPRO-Seq]
3 hour expression of synthetic protein DX in E. coli
3-HT873-PA3
3-HT873-PA3-
3. Log transformation:
3' RNA Decay N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
3' RNA Decay N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 1
3' RNA Decay of Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log Rep A
3' RNA Decay of Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone at 40 mM Suc. 30  C Mid Log Rep B
3' RNA Decay of Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 2
3' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
3' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log1
3' RNA Decay of WT (K10) in M9 0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log
3' RNA Decay of WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log1
3' RNA Decay of WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 2
3' RNA Decay of WT (SH3208) in M9  0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 1
3XSCOTS cDNA 24 h post-infection
3XSCOTS cDNA in RPMI medium
3XSCOTS cDNA obtained 24 h post-infection
3XSCOTS cDNA obtained 2h post-infection
3XSCOTS cDNA obtained 8h post-infection
3XSCOTS cDNA obtained 8h post-infection 
3XSCOTS cDNA obtained after 8h post-infection
3XSCOTS cDNA obtained in RPMI 
3XSCOTS cDNA obtained in RPMI medium
40 hours 1
40 hours 2
40 hours 3
40 hours cultivation in continuous culture (mineral medium with 100 mg/l glucose)
40 hours of cultivation in continuous colture (mineral medium with 100 mg/l glucose)
40min after UVtreatment 1, 40J, MG1655 in Davis+0.4%glu
40 min Nov10 ug/ml, 2 ug Sau3AI, pdN6 RT
40 min Nov10 ug/ml, dnaCacrD 30 min after synchr start
40 min Nov2 ug/ml, 2 ug Say3AI, pdN6 RT
40 min Nov2 ug/ml, dnaCacrD 30 min after synchr start
40 min Nov5 ug/ml, 2 ug Sau3AI, pdN6 RT
40 min Nov5 ug/ml, dnaCacrD 30 min after synchr start
40min untreatedcells, 25 ug total RNA
40.St. Olav178.IND.nHUS
41.St. Olav179.nIND.nHUS
42.St. Olav179.IND.nHUS
43.FHI63.nIND.HUS
44.FHI63.IND.HUS
45.FHI66.nIND.nHUS
4.5' RNA Decay N-RNaseE (BZ453)  in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
4.5' RNA Decay N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 1
4.5' RNA Decay of Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30  C Mid Log
4.5' RNA Decay of Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 2
4.5' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
4.5' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log1
4.5' RNA Decay of WT (K10) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log
4.5' RNA Decay of WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log1
4.5' RNA Decay of WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 2
4.5' RNA Decay of WT (SH3208) in M9  0.2% Glycerol, .2% Tryptone at 30 C Mid Log 1
46degrees replicate 1
46degrees replicate 2
46degrees replicate 3
46.FHI66.IND.nHUS
47.FHI83.nIND.HUS
48.FHI83.IND.HUS
49.St. Olav17.nIND.nHUS
4A 1m
4A 1y
4A 4y
4A_MG_t60
4B_MG_t60
4C_MG_t60
4_ESBL019  Reverted Repl 1
4.FHI6.IND.HUS
4 hour expression of synthetic protein DX in E. coli
4-HT873-PS-60min1
4. Normalization by Glowess method:
4' RNA Decay of MG1655 (Repaired NCM 3416) in LB at 30 C
4' RNA Decay of MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose Trial A
4' RNA Decay of MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose Trial B
500 hours 1
500 hours 2
500 hours 3
500 hours of cultivation in continuous colture (mineral medium with 100 mg/l glucose)
500 ng chrom. DNA was digested with 10U of MseI (NEB) in 10μL volume for 3h at 37°C and heat inactivated for 20 min at 65°C. To prepare adapters 100pmol of MseIlong (AGTGGGATTCCGCATGCTAGT) and MseIshortnewNo (TAACTAGCATGC)  were annealed in 8µl ddH2O by heating to 95°C for 3 min and than cooling to 70°C and subsequently to 15°C with 1°C per min. At 15°C 10µl MseI digested DNA, 2µl ligase buffer and 400U T4-ligase (NEB) were added and ligated over night. Ligase was inactivated at 65°C for 10 min. One halve of the ligation mix was digested with 20 U DpnI for 2h at 37°C in a volume of 50µl and the other halve treated similar with water instead of DpnI as control. 5µl of the DNA was amplified in a 50 µl PCR reaction with 0.2mM dNTPs, 0.5µM primer MseIlong, 10µl Phusion HF buffer and 1U Phusion DNA polymerase (Finnzymes) with the program 30sec 98°C, 20x(30sec 98°C, 30 sec 62°C, 60sec 72°C), 10 min 72°C. DNA was purified with a Qiagen PCR cleanup kit.
50 bp single-end reads, were mapped to the genome with using bowtie2(Langmead and Salzberg, 2012) using default parameters. Alignments with bowtie2 mapping quality values lower than 40 were not retained for further analysis, leaving 128,413,654 and 76,508,335 reads.
50µl of total RNA of the cells affected by the Chrysanthemum herba methyl chloride fraction was isolated. The RNA extraction procedure was carried out using the RNeasy mini kit (Qiagen, Inc.) according to the manufacturer’s instructions. Briefly, 1ml of bacterial culture was added to 2ml of RNA protect bacteria reagent (Qiagen, Inc.). Centrifugation (5000 g for 10 minutes) of the mixture was performed to precipitate the cells. The harvested cells were incubated in TE buffer with 1 mg/ml lysozyme (Fisher Scientific). Total RNA was eluted in 50ml of RNase free water (Ambion Inc.) using the NanoDrop Spectrophotometer (NanoDrop Technologies, Inc.). RNA quality was examined using the RNA 6000 Nano Labchip with an Agilent 2100 Bioanalyzer (Agilent Technologies).
50 ng of the fragmented RNA was converted to sequencing library using TruSeq® Stranded mRNA Sample Prep Kit in accordance with manufacturer’s instruction (Illumina).
50 OD600 of bacteria have been grown to the desired growth stage and harvested by centrifugation. They were lysed in 500 µl of the lysis buffer (20 mM Tris-HCl, pH7.5, 150 mM KCl, 1 mM MgCl2, 1 mM DTT, 1 mM PMSF, 0.2% Triton X100, 20 U/ml DNase I, Thermo Scientific, 200 U/ml SUPERase-IN, Life Technologies). Lysis was carried out on a Retsch MM400 machine at 30 Hz for 10 min in the presence of 750 µl 0.1 mm glass beads. The lysate was cleared by centrifugation at 14,000 g  at 4°C for 10 min.  The lysate was added 35 µl of monoclonal anti-FLAG M2 antibody (Sigma, #F1804) and rocked for 30 min at 4°C. Then 75 µl of pre-washed Protein A sepharose (Sigma, #P6649) were added and the mixture was rocked for additional 30 min. Afterwards, beads were washed extensively with the lysis buffer, and similar flow-through and wash protein and RNA samples were collected.
50.St. Olav17.IND.nHUS
5' 10 ug/ml indole aa, minimal medium + 0.2% glu, 25 ug total
5' 15 ug/ml indole aa, minimal medium + 0.2% glu, 25 ug total
51.St. Olav39.IND.nHUS
52.St. Olav63.nIND.nHUS
53.St. Olav63.IND.nHUS
54.St. Olav164 .nIND.HUS
5'+50ug/ml Trp vs 0' in min med +0.2% glu
55 min after turning off oxygen
55.St. Olav164 .IND.HUS
56.St. Olav176.IND.HUS
57.St. Olav39.nIND.nHUS
59.St. Olav173.IND.nHUS
5A 1m
5A_MG+Hg_t10
5-azacytidine-treated
5B_MG+Hg_t10
5C_MG+Hg_t10
5_ESBL019 Coliform Repl 2
5.FHI7.nIND.HUS
5_HF_LP_noDP_noRh [COPRO-Seq]
5-HT873-PS-60min2
5' in minimal medium +0.2% glu, 25 ug total RNA
5' in min med +0.2% glu+50ug/ml Trp,25ug total RNA
5' linker and poly A-tail removal using READemption
5min
5min (additional)
5 min after turning off oxygen
5 min after turning off oxygen first replicate
5min after UVtreatment 1, 40J, MG1655 in Davis+0.4%glu
5min untreatedcells, 25 ug total RNA
5 ml bacterial cultures with a known inoculum of E. coli cells (1.0 × 109 cfu/ml) was added at 1:1 (v/v) to the microemulsion and incubated on a tube rotator at 200 rpm for 4 h at 37 °C for the subsequent DNA microarray analysis. In the preliminary experiment, a complete loss of E. coli viability was achieved after 8 h by the aforementioned treatment. The prepared microemulsion has an oil phase of glycerol monolaurate (5.5% w/w of the total emulsion), ethanol (5.5%), and a surfactant phase of Tween 20 (43%). Mixtures of the surfactant-oil phase were prepared in stoppered flasks and kept in a 25 °C water bath. Subsequently, the water phase was added, and the mixture was treated in an ultrasonic bath until the system became optically clear, and allowed to equilibrate at 25 °C for at least 24 h to guarantee steady-state conditions.
5 ml of cell suspension were added to 0.625 ml of pre-chilled stop solution (5 % phenol/95 % ethanol), vortexed and incubated for 5 min on ice. Cells were pelleted for 5 min at 5000 g, flash frozen in a dry ice-ethanol bath and stored at -80oC.
5mL of culture was mixed with 5mL of hot acid phenol:chloroform. Samples were held at 65ºC with periodic shaking for at least 10 minutes before centrifuging at 4000 rpm for 20 min. Supernatant was extracted again with acid-phenol:chloroform and then with chloroform:isoamyl alcohol (24.1). RNA was precipitated overnight at –80ºC in 2.5V 100% ethanol and 1/10V 3M sodium acetate pH 5.2. RNA samples were purified and treated with DNase using the Rneasy kit (Qiagen).
5 ml of the culture was mixed with 1/10V 10% phenol:ethanol buffer to stabilize the RNA, and centrifuged at 4 oC, 4300 × g for 30 min to pellet cells.  The supernatant was decanted and cell pellets were suspended in 5 ml of buffer (2 mM EDTA, 20 mM NaOAc, pH 5.2) before mixing with equal volume of hot acid-phenol:chloroform (pH 4.5 with Iso Amyl Alcohol (IAA), 125:25:1) (Ambion, Austin, TX) and incubating at 65 oC with periodic shaking for 10 min.  The samples were centrifuged at 3220 × g for 20 min and the supernatant was subjected to further extractions with phenol:chloroform and chloroform:IAA (3).  RNA was precipitated overnight at -70 oC in 2.5 volume 100% ethanol and 1/10 volume 3 M sodium acetate pH 5.2.  RNA purification and DNase treatment of RNA samples were done with the Rneasy kit (Qiagen, Valencia, CA) and RNA quality was assessed on a formaldehyde-agarose gel.
5. Save the plot files
5' vs 0' in minimal medium +0.2% glu
60' 10 ug/ml indole aa, minimal medium + 0.2% glu, 25 ug total
60' 15 ug/ml indole aa, minimal medium + 0.2% glu, 25 ug total
60' + 50 ug/ml Trp in min +.2% glu, 25 ug RNA
60'+50ug/ml Trp vs 0' in min med +0.2% glu
60' 50 ug/ml tryptophan, minimal +02% glu, 25 ug total RNA
60' in min +.2% glu, 25 ug RNA
60' in minimal medium +0.2% glu, 25 ug total RNA
60' in min med +0.2% glu+50ug/ml Trp,25ug tot RNA
60 min
60min after UVtreatment 1, 40J, MG1655 in Davis+0.4%glu
60min untreatedcells, 25 ug total RNA
60min UV treated cells, 25 ug total RNA
60min UVtreatment control, MG1655 in Davis+0.4%glu
60.St. Olav176.nIND.HUS
60' vs. 0', 50 ug/ml tryptophan, minimal +02% glu
60' vs 0' in minimal medium +0.2% glu
60' vs 0' in minimal medium +0.2% glu, II
68908
68909
68910
68911
68912
68913
68915
68916
68917
68919
68920
68921
68922
68923
68924
68925
68926
68927
68928
68929
68930
68931
68932
68933
6A 1m
6A_MG+Hg_t30
6B_MG+Hg_t30
6. close the graph:
6C_MG+Hg_t30
6_ESBL019 Filamented Repl 2
6.FHI7.IND.HUS
6_HF_HP_noDP_noRh [COPRO-Seq]
6-HT873-PS-60min3
6' RNA Decay N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. A
6' RNA Decay N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. A1
6' RNA Decay N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. B
6' RNA Decay N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. B1
6' RNA Decay of Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30  C Mid Log Rep A
6' RNA Decay of Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30  C Mid Log Rep B
6' RNA Decay of MG1655 (Repaired NCM 3416) in LB at 30 C
6' RNA Decay of MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose Trial A
6' RNA Decay of MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose Trial B
6' RNA Decay of Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. A2
6' RNA Decay of Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. B2
6' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Replicate A
6' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Replicate A1
6' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Replicate B
6' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Replicate B1
6' RNA Decay of WT (K10) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30  C Mid Log Rep A
6' RNA Decay of WT (K10) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30  C Mid Log Rep B
6' RNA Decay of WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep A2
6' RNA Decay of WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Replicate A1
6' RNA Decay of WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Replicate B1
6' RNA Decay of WT (N3433) in M9 + 0.2% Glycerol, .2% Tryptone at 30 C Mid Log Rep B2
6' RNA Decay of WT (SH3208) in M9  0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep A1
6' RNA Decay of WT (SH3208) in M9  0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep B1
72hr colony growth equiv. to wildtype colony size
75th percentile shift normalisation and baseline adjusted
7A_MG+Hg_t60
7B_MG+Hg_t60
7C_MG+Hg_t60
7_ESBL019 Transition Repl 2
7.FHI8.nIND.HUS
7G.0
7 h 7HI biofilm cells
7 h biofilm cells
7_HF_HP_noDP_noRh [COPRO-Seq]
7 h isatin biofilm cells
7 h suspension cells
7-HT874-PA1
7-HT874-PA1-
7 min Nov0 ug/ml, 2 ug Say3AI, pdN6 RT
7 min Nov0 ug/ml, dnaCacrD 30 min after synchr start
7 min Nov500 ug/ml, 2 ug Say3AI, pdN6 RT
7 min Nov500 ug/ml, dnaCacrD 30 min after synchr start
7. output:
80 min, 0.8% butanol
80min-1
80min-2
80min-3
80 min Nov10 ug/ml, 2 ug Sau3AI, pdN6 RT
80 min Nov10 ug/ml, dnaCacrD 30 min after synchr start
80 min Nov5 ug/ml, 2 ug Sau3AI, pdN6 RT
80 min Nov5 ug/ml, dnaCacrD 30 min after synchr start
80 min, unstressed
81-4420
83-2315
86-1390
86-4220
873-Con1--
873-Con2--
873-Con3--
873-PA1--
873-PA2--
873-PA3--
87-4725
875-Con1--
875-Con2--
875-Con3--
875-PA1--
875-PA2--
875-PA3--
88-1861
88-4299
89-56-196
8A_MG+PMA_t10
8B_MG+PMA_t10
8C_MG+PMA_t10
8_ESBL019  Reverted Repl 2
8.FHI8.IND.HUS
8-HT874-PA2
8-HT874-PA2-
8 ml of the culture was mixed with 1/10V 10% phenol:ethanol buffer to stabilize the RNA, and centrifuged at 4 oC, 4300 × g for 30 min to pellet cells. The supernatant was decanted and cell pellets were suspended in 5 ml of buffer (2 mM EDTA, 20 mM NaOAc, pH 5.2) before mixing with equal volume of hot acid-phenol:chloroform (pH 4.5 with Iso Amyl Alcohol (IAA), 125:25:1) (Ambion, Austin, TX) and incubating at 65 oC with periodic shaking for 10 min. The samples were centrifuged at 3220 × g for 20 min and the supernatant was subjected to further extractions with phenol:chloroform and chloroform:IAA (3). RNA was precipitated overnight at -70 oC in 2.5 volume 100% ethanol and 1/10 volume 3 M sodium acetate pH 5.2. RNA purification and DNase treatment of RNA samples were done with the Rneasy kit (Qiagen, Valencia, CA) and RNA quality was assessed on a formaldehyde-agarose gel.
8' RNA Decay of MG1655 (Repaired MCM 3416) in M9 + 0.2% Glucose Trial A
8' RNA Decay of MG1655 (Repaired NCM 3416) in LB at 30 C
8' RNA Decay of MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose Trial B
90min minus ciprofloxacin
90min plus ciprofloxacin
90 minutes growth  in LB
91-19-172
9A 3y
9A 5y
9A_MG+PMA_t30
9A T0
9B_MG+PMA_t30
9C_MG+PMA_t30
9_ESBL019 Coliform Repl 3
9.FHI9.nIND.HUS
9_HF_HP_noDP_noRh [COPRO-Seq]
9-HT874-PA3
9-HT874-PA3-
A0-A1_rep1_a
A0-A1_rep1_b
A0-A1_rep2_a
A0-A1_rep2_b
A0-A1_rep3_a
A0-A1_rep3_b
A0-E0_rep1_a
A0-E0_rep1_b
A0-E0_rep2_a
A0-E0_rep2_b
A0-E0_rep3_a
A0-E0_rep3_b
A10:LJ110 del pdhr MMAcetat
A11:LJ110 pTM30 MMAcetat
A12:LJ110 pTM30pdhr MMAcetat
A1:LJ110 LBo
A2:LJ110 del pdhr LBo
A2, osmotolerant mutant
A2 Replicate 1
A2 Replicate 2
A3:LJ110 pTM30 LBo
A4:LJ110 pTM30pdhr LBo
A4, osmotolerant mutant
A4 Replicate 1
A4 Replicate 2
A5:LJ110 MMPyruvat
A 5ml overnight culture of E. coli O157:H7 (Sakai) was grown in Neidhardt's EZ Rich Defined Medium for 18 h at 37C. The culture was diluted 1:100 into 50 ml of fresh, prewarmed Neidhardt's EZ Rich Defined Medium in a 125 ml Ehrlenmeyer flask and shaken at 37C, 150 rpm in a New Brunswick Shaking water bath until the culture density reached 0.4. Half of the culture was transferred to a second identical flask containing menadione bisulphite to a final concentration of 0.5 mg/ml. The flasks were shaken for a further 10 min before 2 volumes of RNAprotect (TM) (Qiagen Ltd) were added to stabilise the RNA. This sample corresponds to the culture that was not treated with menadione. Three independent cultures were processed on different occasions to make the 3 replicates used in this study. 
A 5ml overnight culture of E. coli O157:H7 was grown in Neidhardt's EZ Rich Defined Medium for 18 h at 37C. The culture was diluted 1:100 into 50 ml of fresh, prewarmed Neidhardt's EZ Rich Defined Medium in a 125 ml Ehrlenmeyer flask and shaken at 37C, 150 rpm in a New Brunswick Shaking water bath until the culture density reached 0.4. Half of the culture was transferred to a second identical flask containing menadione bisulphite to a final concentration of 0.5 mg/ml (this sample). The flasks were shaken for a further 10 min before 2 volumes of RNAprotect (TM) (Qiagen Ltd) were added to stabilise the RNA. Three independent cultures were processed on different occasions to make the 3 replicates used in this study.
A 5ml overnight culture of MG1655 was grown in Neidhardt's EZ Rich Defined Medium for 18 h at 37C. The culture was diluted 1:100 into 50 ml of fresh, prewarmed Neidhardt's EZ Rich Defined Medium in a 125 ml Ehrlenmeyer flask and shaken at 37C, 150 rpm in a New Brunswick Shaking water bath until the culture density reached 0.4. Half of the culture was transferred to a second identical flask containing menadione bisulphite to a final concentration of 0.5 mg/ml. The flasks were shaken for a further 10 min before 2 volumes of RNAprotect (TM) (Qiagen Ltd) were added to stabilise the RNA. This sample corresponds to the culture that was not treated with menadione. Three independent cultures were processed on different occasions to make the 3 replicates used in this study. 
A 5ml overnight culture of MG1655 was grown in Neidhardt's EZ Rich Defined Medium for 18 h at 37C. The culture was diluted 1:100 into 50 ml of fresh, prewarmed Neidhardt's EZ Rich Defined Medium in a 125 ml Ehrlenmeyer flask and shaken at 37C, 150 rpm in a New Brunswick Shaking water bath until the culture density reached 0.4. Half of the culture was transferred to a second identical flask containing menadione bisulphite to a final concentration of 0.5 mg/ml. This sample corresponds to the culture that was not treated with menadione. The flasks were shaken for a further 10 min before 2 volumes of RNAprotect (TM) (Qiagen Ltd) were added to stabilise the RNA. Three independent cultures were processed on different occasions to make the 3 replicates used in this study. 
A 5ml overnight culture of MG1655 was grown in Neidhardt's EZ Rich Defined Medium for 18 h at 37C. The culture was diluted 1:100 into 50 ml of fresh, prewarmed Neidhardt's EZ Rich Defined Medium in a 125 ml Ehrlenmeyer flask and shaken at 37C, 150 rpm in a New Brunswick Shaking water bath until the culture density reached 0.4. Half of the culture was transferred to a second identical flask containing menadione bisulphite to a final concentration of 0.5 mg/ml (this sample). The flasks were shaken for a further 10 min before 2 volumes of RNAprotect (TM) (Qiagen Ltd) were added to stabilise the RNA. Three independent cultures were processed on different occasions to make the 3 replicates used in this study.
A 5ml overnight culture of MG1655 was grown in Neidhardt's EZ Rich Defined Medium for 18 h at 37C. The culture was diluted 1:100 into 50 ml of fresh, prewarmed Neidhardt's EZ Rich Defined Medium in a 125 ml Ehrlenmeyer flask and shaken at 37C, 150 rpm in a New Brunswick Shaking water bath until the culture density reached 0.4. Half of the culture was transferred to a second identical flask containing menadione bisulphite to a final concentration of 0.5 mg/ml (this sample). The flasks were shaken for a further 10 min before 2 volumes of RNAprotect (TM) (Qiagen Ltd) were added to stabilise the RNA. Three independent cultures were processed on different occasions to make the 3 replicates used in this study. 
A 5ml overnight culture of MG1655 was grown in Neidhardt's EZ Rich Defined Medium for 18 h at 37C. The culture was diluted 1:100 into 50 ml of fresh, prewarmed Neidhardt's EZ Rich Defined Medium in a 125 ml Ehrlenmeyer flask and shaken at 37C, 150 rpm in a New Bruswick Shaking water bath until the culture density reached 0.4. Half of the culture was transferred to a second identical flask containing menadione bisulphite to a final concentration of 0.5 mg/ml. This sample corresponds to the culture that was not treated with menadione. The flasks were shaken for a further 10 min before 2 volumes of RNAprotect (TM) (Qiagen Ltd) were added to stabilise the RNA. Three independent cultures were processed on different occasions to make the 3 replicates used in this study. 
A6:LJ110 del pdhr MMPyruvat
A7:LJ110 pTM30 MMPyruvat
A8:LJ110 pTM30pdhr MMPyruvat
A9:LJ110 MMAcetat
accession: NC_000913.2+NC_000913.3
accession: U00006
According to Invitrogen PureLink Micro-to-Midi Total RNA Purification System
acetate
acetonitrile
Acid adaptation was done in DMEM at pH 5.0 at room temperature, followed by acid-stress at pH 3.0 for 30 minutes
Acidic Hot Phenol
Acid shocking was done in DMEM at pH 3.0 at room temperature for 30 minutes
Acid shocking was done in DMEM at pH 3.0 (unbuffered) at room temperature for 15 minutes
AcrA-Negative, Multidrug Efflux Mutant Strain
AcrB- and EmrAB-Negative, Multidrug Efflux Mutant Strain
AcrB-Negative, Multidrug Efflux Mutant Strain
ACSH_Exp_CIYS
ACSH_Exp_CNFT
ACSH_Stat1_CNFW
ACSH_Stat1_CNGG
ACSH_Trans_CIYT
ACSH_Trans_CNFU
A culture volume of 7ml was mixed with the same volume of boiling 2% SDS, 4mM EDTA and heated at 100°C for 3 to 5 minutes then vortexed. At this stage, the extract was either processed further or stored at -20°C.
Adapted E. coli (DST160, tolerant to high succinic acid concentration)
Adapter cutting using cutadapt, version 1.2.1, parameters -e 0.1 -O 1 -m 12
Adapter cutting using cutadapt, version 1.8.3, parameters -e 0.1 -O 1 -m 12
Adapters trimmed with Cutadapt (v1.12)
Adaptive threshold (quantitation method) uses the parameters of the spot diameter and background inner and outer dimensions to create a spot mask and background mask, then refines the mask on a pixel-by-pixel basis. Total (normalization method), uses the intensity of each spot in relation to all spots.
Adaptor Sequences were removed using fastx_clipper. (http://hannonlab.cshl.edu/fastx_toolkit/index.html) -  Example: fastx_clipper -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATG -i DL4900_raw.fasta  -o DL4900_clipped.fasta
Add 100 μl 1 mg/ml lysozyme buffer (TE buffer: 10 mM Tris-HCL, 1 mM EDTA pH=8.0 containing 1 mg/ml lysozyme). Vortex for 10 s and incubate at RT for at least 15 min. Add 350 μl Buffer RLT and vortex vigorously. Add 250 μl 100% ethanol, mix by pipetting.
Adenosine addition
Adpater sequences were clipped with CutAdapt
Aeration was initiated at 1 l/min when the culture reached an OD (600nm) of 3.
Aerobic 1
Aerobic 2
Aerobic 3
Aerobic and anaerobic cultures were grown in 600 mL aliquots of DM25 and incubated at 37°C with an orbital shaking of 150 RPM and inoculated with 1/100th volume of overnight culture. Aerobic cultures were grown for 9 h while anaerobic cultures were grown for 16 h.
Aerobic culture
Aerobic cultures
Aerobic Cultures
Aerobic E. coli exposed to CO-RMs for 15 minutes
Aerobic E. coli not exposed to CO-RMs for 15 minutes (control cells)
Aerobic growth at 37°C  in specified media
aerobic INPUT DNA
Aerobic MG1655 exposed to CO-RMs for 15 minutes
Aerobic MG1655 not exposed to CO-RMs for 15 minutes (control cells)
aerobic reference
affyexp_delta-arcA_glucose_NH4CL_anaerobic
affyexp_delta-arcA_glucose_NH4CL_anaerobic_1.CEL
affyexp_delta-arcA_glucose_NH4CL_anaerobic_2.CEL
affyexp_delta-arcA_glucose_NH4CL_anaerobic_3.CEL
affyexp_delta-arcA_glucose_NH4Cl_NO3
affyexp_delta-arcA_glucose_NH4Cl_NO3_1.CEL
affyexp_delta-arcA_glucose_NH4Cl_NO3_2.CEL
affyexp_delta-arcA_glucose_NH4Cl_NO3_3.CEL
affyexp_delta-fnr_glucose_NH4CL_anaerobic
affyexp_delta-fnr_glucose_NH4CL_anaerobic_1.CEL
affyexp_delta-fnr_glucose_NH4CL_anaerobic_2.CEL
affyexp_delta-fnr_glucose_NH4CL_anaerobic_3.CEL
affyexp_delta-fnr_glucose_NH4Cl_NO3
affyexp_delta-fnr_glucose_NH4Cl_NO3_1.CEL
affyexp_delta-fnr_glucose_NH4Cl_NO3_2.CEL
affyexp_delta-fnr_glucose_NH4Cl_NO3_3.CEL
affyexp_wt_glucose_NH4CL_anaerobic
affyexp_wt_glucose_NH4CL_anaerobic_1.CEL
affyexp_wt_glucose_NH4CL_anaerobic_2.CEL
affyexp_wt_glucose_NH4CL_anaerobic_3.CEL
affyexp_wt_glucose_NH4Cl_NO3
affyexp_wt_glucose_NH4Cl_NO3_1.CEL
affyexp_wt_glucose_NH4Cl_NO3_2.CEL
affyexp_wt_glucose_NH4Cl_NO3_3.CEL
Affymetrix .CEL files data were normalized with dChip using the array of median brightness (BS). Model method:model-base expression; background substraction: Mismatch Probe (PM/MM difference)
Affymetrix GeneChip Operating Software (GCOS) Version 1.4  Details: Intra-chip normalizations were performed using Affymetrix Gene Chip Operating Software (GCOS). Default statistical parameters were used to normalize each chip to the same target intensity (1500) as described in the Affymetrix GeneChip Expression Analysis manual. All nine possible inter-chip comparisons were performed in GCOS. The data were subsequently exported to a Microsoft Excel spreadsheet for manipulation. Consensus “detection p-value”, “change p-value”, and “signal log ratios” were calculated, and the default E. coli array p-value cutoff parameters were applied to these consensus values to estimate the transcript change between two conditions and the transcript presence under each condition. Background-subtracted data sets were used to calculate up-regulated and down-regulated genes based on fold changes of greater than 2.
Affymetrix Microarray Suite 5.0
Affymetrix Microarray Suite/GCOS
After 0.5 M NaCl treatment for 10 min of the early-exponential phase cells, samples were collected.
After 0.5 M NaCl treatment for 20 min of the early-exponential phase cells, samples were collected.
After 0.5 M NaCl treatment for 45 min of the early-exponential phase cells, samples were collected.
After 50 hours, samples (10 ml) were harvested directly into RNA Protect (Qiagen) to stabilize RNA, and total RNA was purified using Qiagen’s RNeasy Mini kit as recommended by the suppliers.  RNA was quantified using a BioPhotometer (Eppendorf).
After 5 h of NP-TiO2 (or mQ water for the control) exposure, cells were incubated for 5 min with two volumes of RNAprotect Bacteria Reagent (Qiagen SAS, France) at room temperature. Cells were then pelleted by centrifugation (7,000 g, 10 min) and the pellet stored at -80°C.
After 60 minutes into the incubation, the plate was briefly removed so inducer could be added to wells, and this time point was set as time 0. Samples were instead removed from wells at 15 and 60 minutes after induction for processing.
After 6 hours of growth both control and test strains were induced with 0.5mM IPTG and harvested 2 hours post-induction.
After backgroud correction and total intensity normalization, ratio to reference were calculated and log base 2 transformed
After chilling on ice, each 100-ml culture was mixed with 25 ml ice-cold ethanol/phenol solution (5% (v/v), water-saturated phenol in 95% (v/v) ethanol).  Cells were harvested by centrifugation at 7,000 g for 2 min at 4 °C, flash-frozen with dry ice, and stored at –80 °C. Two independent cultures for each sample were mixed together for determination of transcriptional profiles. Total RNA was extracted from the collected bacterial cells using TRIzol reagent (Thermo Fisher Scientifc).
After collecting 50 ml culture as ‘non crosslinked’ sample, the rest of the cells was crosslinked.Crosslinked and non crosslinked cells were washed and sonicated. 400 µl of the sonicated extracts were mixed with 400 µl TE buffer and incubated with 2 µl RNase A (20 mg/ml) at 42 °C for 1 h.  Next, 200 µl proteinase K (20 mg/ml) were added and samples incubated for 2 h at 42 and 6 h at 65 °C. DNA was extracted with phenol and chlorophorm
After dividing sequence runs by barcode, we mapped the reads to the relevant genomes using the ssaha2 algorithm. Minimum score thresholds for ssaha were selected based on the distribution of scores for all mapped reads of a 32nt barcoded sample and a 36-nt non-barcoded sample (29 was selected as the minimum score for 32nt barcoded samples; 33 was the minimum score used for 36-nt non-barcoded samples). Although an 18-nt read is sufficient to map more than 90% of the sequencing reads, even at 32-36nt there is a large fraction of the reads that map to multiple locations within a genome or across genomes. Reads that map non-uniquely were discarded.
After each sequenced fragments were aligned to the reference genome using Bowtie, the position of each alignment is distributed into several nucleotides in the center of the footprint. For each footprint read, the center residues that are at least 12 nucleotides away from either ends were given the same score, which is weighted by the length of the fragment [Oh et al,. Cell 147, 1295 (2011)]. More at G.W. Li, E. Oh, and J.S. Weissman, Nature (in press)
After exposed under the red light with a specific ON/OFF frequency for 10 hours, 1ml bacterial culture was sampled and the bacterial cells were collected at 4 °C. The total RNA of E. coli was extracted using RNAprep pure Cell/Bacteria Kit (TIANGEN, DP430) and preserved at -80 °C.
After normalization, the expression of a gene was calculated by a RMA-summarization procedure within each growth condition.
After normalization, the read counts were estimated in the running windows of 35 bp, and the ratios R between values obtained for experimental and control libraries were calculated. Peaks were localized requiring R≥1.5 for at least 50% positions of at least 60 bp genomic region in length.
After quality controls of data distribution the raw data (CEL files) were used to perform, normalization and probe set summarization through RMA algorithm (Robust Multiarray Analysis) by using the Affymetrix Gene Expression Console Software (www.affymetrix.com).   Normalized data were then uploaded into OneChannelGUI Software (http://www.bioinformatica.unito.it/oneChannelGUI/)  to perform a differential expression analysis. As the dataset is limited in number of samples and replicates (4 GeneChips hybridized, 2 replicates for each condition) we decided to apply a  simple non-parametric statistical method based on ranks of fold changes to perform a two-class paired differential analysis. To select only significatively differentially expressed genes we set the following parameters for the Rank Product analysis: 100 permutations and 0.1 cut-off percentage of false positives (pfp) which corresponds to a p-value<0.01.
After reaching an OD600nm of 0.9, cell cultures were placed immediately in a shaking water bath along with another BHI flask carrying a type T thermocouple connected to a MultiPaq 21 datalogger (Datapaq Inc.) for temperature profile and the process lethality values monitoring in real time. Bacteria suspension were heated at 58°C to process lethality values of 2 and 3, at 60°C to a process lethality value of 3, or until a temperature of 71°C was reached. Just after heating, cell suspension was cooled in an iced water bath under constant agitation (150 rpm) until the temperature dropped back to no less than 37°C in order to avoid cold stress. Cell suspensions were then centrifuged and the remaining cell pellets were treated with RNA protect bacteria reagent (Qiagen Inc.) prior to freezing at -80°C.
After the final wash & staining step, Affymetrix GeneChip® E.coli Genome array was scanned using Affymetrix Model 3000 G7 scanner and the image data was extracted through Affymetrix Commnad Console software. The raw .cel file generated through above procedure meant expression intensity data and was used for the next step.
AG102MB is an isogenic mutant derived from hyper-resistant AG102 (marR1).  It contains a mutation at the acrB locus (marR1, acrB::kan) resulting in a multidrug efflux negative phenotype.
AG102 was previously derived from AG100 (K-12). AG102 is drug hyper-resistant due to a mutation in marR (marR1) which increases expression of MarA, a global regulator, which in turn results in overexpression of the AcrAB-TolC multidrug efflux system.
A generalized linear model likelihood ratio test was performed to test for differential expression between groups (HUS vs. non-HUS) and condition (induced vs. non-induced), with FDR-adjusted p-values < 0.05 regarded as statistically significant
agent: 0.05 mg/ml Phloretin
agent: 0.5% honey
agent: 1x CORM2
agent: 1x vehicle
agent: 20x CORM2
agent: 20x vehicle
agent: control
agent: control (1 ml of LB broth added)
agent: CORM-401
agent: DPD
agent: DPD and rifampicin
agent: ethanol (1 ml of ethanol 20% added)
agent: Fe
agent: Fe and rifampicin
agent: glycolaldehyde
agent: H2O
agent: no triclosan
agent: polyphenols (1 ml of OVWPE diluted in ethanol 20% added)
agent: triclosan
agent: ZnSO4
Agilent Feature Extraction Software (v 10.10.1.1) was used for background subtraction and LOWESS normalization.
Agilent Feature Extraction Software (v 8.5.1.1) was used for background subtraction and LOWESS normalization.
Agilent Feature Extraction Software v. 9.5.3.1  was used for background subtraction and LOWESS normalization.
Agilent Feature Extraction Software v. 9.5.3.1 was used for background subtraction and LOWESS normalization.
Agilent Feature Extraction Software version 10.5.1.1.
Agilent Feature Extract software performed background normalization and LOWESS correction for dye bias. Non-E. coli K-12 probes were removed from the dataset, as the BW25113 strain is a K-12 strain.
Agilent Scan Control Software V.8.5 at a resolution of 3μm. The data was extracted using Agilent Feature extraction software V 10.10
agitation speed: 1200 rpm
agitation speed: 600 rpm
agno3 concentration in µm: 0
agno3 concentration in µm: 5
agno3 concentration in µm: 6.5
agno3 concentration in µm: 8.5
Alanine addition
Alert
Algorithm: ExpressionStat 5.0 (Affymetrix Microarray Suite Version 5.0)
Aligned reads were designated to top and bottom strands using Samtools
Aligned to NC_000913.3 with bwa version 0.7.7
Alignment, Quantiatino and Normalization, Differential Expression : We used the SPARTA(version 1) software package for alignment, differential expression analysis, and post-analysis diagnostics. SPARTA is an RNA-Seq package specifically designed for bacterial studies. It uses the Bowtie(version 1.1.1) short read aligner, HTSeq(version 0.6.1) to count gene features, and edgeR for differential expression.
Alignment: reads were mapped to bespoke reference sequence (DL4201_in_lab_reference_genome (available on series record)) using the default parameters of software Bowtie 2 (Langmead, B. and Salzberg, S.L. (2012) Fast gapped-read alignment with Bowtie 2. Nat Methods, 9, 357-359).
alignment: STAR 2.4.0i
Alignment to the E. coli K12 MG1655 genome sequence was performed using TMAP map4 algorithm with 5' and 3' soft-clipping and a minimum seed length of 20 nt
A Linker-1 adapter (IDT) was ligated onto the 3' end of size selected RNA fragments, either ribosome footprints or fragmented total RNA. A cDNA library was created using Superscript III (ThermoFisher). After gel purification of the cDNA library all ssDNA fragments were circularized using CircLigase (Epicentre). For ribosome profiling samples rRNA containing circles were depleted using oligo-biotin  and streptavidin coupled Dynabeads (ThermoFisher) subtraction. A PCR amplification off the circles using HF Phusion (NEB) completed the libraries by adding Illumina Tru-Seq adapters and a unique index for each sample.
All culture experiments were performed in MOPS medium supplemented with 0.2% glucose, 19 amino acids (without methionine), vitamins, bases and micronutrients (MOPS rich defined medium minus methionine, Teknova). Cells were grown in an overnight liquid culture at 37°C, diluted to an OD420 = .001 in fresh medium and grown until OD420 reached 0.4 where samples were collected.  For 10°C samples, cultures were grown to OD420 = 1.1 at 37°C and cold shock was performed by mixing 70mL of 37°C culture with 130mL of 0°C media pre-chilled in ice-water slurry, with continued growth of the culture in a 10°C shaker.
All cultures grown up to 0.6 OD600 with shaking at 200 rpm. Samples 1,2,5 and 6 were grown at 30°C whereas samples 3 and 4 were grown at 37°C.
All cultures were based on MOPS media with 0.2% glucose (Teknova), with either full supplement (Neidhardt et al., 1974). An overnight liquid culture was diluted 400-fold into 200 ml fresh media. The culture was kept in a 2.8-liter flask at 37C with aeration (180 rpm) until OD600 reached 0.3.
All cultures were based on MOPS media with 0.2% glucose (Teknova), with full supplement (Neidhardt et al., 1974) minus methionine. An overnight liquid culture was diluted 400-fold into 200 ml fresh media. The culture was kept in a 1 liter flask at 37°C with aeration until OD420 reached 0.4.
All cultures were carried out in a 5 l fermentor BIOSTAT B-DCU (Sartorius BBI Systems Inc. Melsungen) at controlled temperature 37°C, pH 7.0, and dissolved oxygen tension 30%. The culture volume was 2 l. All reagents were purchased from Sigma-Aldrich, Inc. The synthetic culture medium had the following composition (g l-1): 8, glucose; 14.6, K2HPO4; 3.6, NaH2PO4·H2O; 2.68, (NH4)2SO4; 2, Na2SO4; 1, MgSO4; 1, Na-citrate; 0.5, NH4Cl; 2 ml of 10 mg l-1 of thiamine; 3 ml of trace element solution (g l-1 20.0, Na-EDTA; 15.0, FeCl3·6H2O; 0.5, CaCl2·2H2O; 0.2, ZnSO4·7H2O; 0.2, CoCl2·6H2O; 0.2, CuSO4·5H2O; 0.2, MnSO4·4H2O). The chemostat culture was performed with adding feed medium
All cultures were grown aerobically in a thermostatically controlled 37oC culture room. Cultures (150ml culture volume) were stirred by magnetic stirrers at 330 rpm (Thermo Scientific Variomag Multipoint 6in) 1000ml Erlenmeyer flask. Starting cultures were inoculated from a single colony and grown overnight. Each experimental culture was then inoculated from such an overnight culture at a dilution of 1:20 into 150 ml fresh MOPS minimal medium in a 1000 ml flask. The minimal medium used for all experiments was a modification of MOPS (morpholinopropane sulfonate) minimal medium obtained from Teknova, CA (product number M2006) which contains 86 mM NaCl, 9.5 mM NH4Cl, 5 mM K2HPO4 and 0.2% glucose.
All cultures were grown at 37C in well-mixed minimal media modified with M63 (mM63: pH 7.0, 62 mM K2HPO4, 39 mM KH2PO4, 15 mM ammonium sulfate, 1.8 µM FeSO4-7H2O, 15 µM thiamine hydrochloride, 0.2 mM MgSO4-7H2O and 22 mM glucose). One amino acid, Ile or Leu, was added to the monoculture medium when appropriate. Prior to coculturing, at both the initial inoculation and transfer, we washed the E. coli cells with fresh mM63 without amino acids to exclude the carry-over of supplements from the pre-culture. For coculture samples, we used cell culture inserts with a pore size of 0.45 µm at a density of 10^8/cm^2, and used six-well cell culture companion plates for the inserts (BD Falcon, Franklin Lakes, NJ, USA), to separately harvest I– and L– populations from cocultures (Hosoda et al., \
all cultures were grown in 10 ml LB broth at 37C/180rpm for 24 hours and flash-frozen with liquid nitrogen.
All data analysis was performed using Rockhopper (McClure et al., 2013) and Escherichia coli str. K-12 substr. MG1655 as the reference genome.
All data was processed using Rockhopper Ver.2.03. Rockhopper is an \
All raw FastQ files generated were filtered using FASTX-Toolkit (http://hannonlab.cshl.edu/fastx_toolkit/).
All RNA data were mapped to the reference genome Xuzhou21 using SOAP2.
All samples were extracted using the hot phenol extraction with DNA digestion, following standard protocol
All samples were extracted using the Qiagen Rnasey Mini Kit, following standard protocol
All samples were processed following NEB’s protocol from the NEBNext® ChIP-Seq library preparation kit.
All sequencing reads were mapped to E. coli MG1655 reference genome (NC_000913) using CLC Genomics Workbench5 with the length fraction of 0.9 and the similarity of 0.99.
All strains used are E. coli K-12 MG1655 and its derivatives. Glycerol stock of the E. coli strain was inoculated into 3 mL Luria broth supplemented with 150 μg kanamycin and cultured overnight at 37°C with constant agitation.
All strains used in this study were E. coli K-12 MG1655 and its derivatives. The deletion mutants (Δfnr and ΔarcA) were constructed by a λ red and FLP-mediated site-specific recombination method. Glycerol stocks of E. coli strains were inoculated into M9 minimal medium containing 0.2% (w/v) carbon source (glucose) and 0.1% (w/v) nitrogen source (NH4Cl), and cultured overnight at 37 °C with constant agitation. The cultures were diluted 1:100 into fresh minimal medium and then cultured at 37 °C to an appropriate cell density with constant agitation. For the anaerobic cultures, the minimal medium were flushed with nitrogen and then continuously monitored using a polarographic-dissolved oxygen probe (Cole-Parmer Instruments) to ensure anaerobicity. For nitrate respiration 20 mmol potassium nitrate was added.
All strains were grown in M9 minimal media supplemented with 25 ug/ml streptomycin and 0.52 mM arginine. Samples were grown to OD = 0.5 @ 30 C; experimental samples were then transferred to a shaking water bath @ 42 C.
All strains were grown shaking at 37°C  in 200mL cultures of MOPS complete-glucose liquid media (unless otherwise annotated) in 1L flasks and cells were harvested at OD(420nm) between 0.4 - 0.6
All those uniquely mapped reads were used to calculate the gene expression level by the RPKM method, which is able to eliminate the influence of different gene length and sequencing discrepancy on the calculation of gene expression and thus the calculated gene expression level can be directly used for comparing the difference of gene expression among samples.
Ambion RiboPure RNA Isolation
Ambion RiboPure RNA Isolation 
A minimal growth medium as described in the study by Ihssen and Egli (2004) was used for all experiments. Bacterial stock cultures were streaked onto agar plates and incubated overnight. One colony was then transferred into 20 ml minimal medium, grown at 37 °C (250 r.p.m.) over night culture (ONC) and served as the inoculum for experiments. For continuous culture experiments we designed and constructed 500 ml bioreactors according to the study by Huwiler et al., (2012) that were half-filled with medium (0.5 g glucose per l) and incubated at 37 °C in a temperature controlled water bath. Before continuous cultivation (dilution rate=0.25), 1–2 ml of the ONC was transferred and grown in batch-mode until reactors became visibly turbid. Subsequently, cells were grown to steady-state (defined as constant optical density over time) and harvested for experimentation. For starvation experiments the medium flow was stopped during steady-state and bacteria were collected after 4 h. To avoid gene-expression signatures of stationary cells from the ONC, batch cultures (1000 ml Erlenmeyer flasks containing 100 ml of pre-warmed medium (1 g glucose per l); 37 °C; 250 r.p.m.)) were inoculated with 5 ml of an exponentially growing pre-culture that derived from the ONC.
Amino acid or nucleotide added to final concentration of 1 mM not exceeding 1/100th volume of culture. After 10 mins, samples were spun down and snap frozen in liquid nitrogen and stored at -80 C
Among potential TSSs, only TSSs with the strongest signal within 10 bp window were kept to remove possible noise signals, and TSSs with greater than or equal to 40% of the strongest signal upstream of an annotated gene were considered as multiple TSSs.
ampicilin treatment
Ampicilin_treatment_plasmidmappedreads_statistical_output.txt: NC_012692.1
Amp_Treatment_genomemappedreads_statistical_output.txt: NC_000913.2
Anaerobic 1
Anaerobic 3
Anaerobic cultures
Anaerobic Cultures
Anaerobic E. coli exposed to CO-RMs for 15 minutes
Anaerobic E. coli not exposed to CO-RMs for 15 minutes (control cells)
Anaerobic E. coli were exposed to CO-RMs for 15 minutes
anaerobic INPUT DNA
Anaerobic, Iron Deficient cultures
Anaerobic MG1655 exposed to CO-RMs for 15 minutes
Anaerobic MG1655 not exposed to CO-RMs for 15 minutes (control cells)
Anaerobic MG1655 were exposed to CO-RMs for 15 minutes
Anaerobic, minus nitrate, IP
Anaerobic, plus nitrate, IP
anaerobic reference
analysis: in vitro
analysis: in vivo
Ancestral E. coli B REL606 strain
Ancestral I- cells at amino acid starvation in monoculture
Ancestral I- cells at log phase in monoculture
Ancestral I- cells in coculture
Ancestral I- cells in coculture, a biological replicate
Ancestral L- cells at amino acid starvation in monoculture
Ancestral L- cells at log phase in monoculture
Ancestral L- cells at log phase in monoculture, a technical replicate
Ancestral L- cells in coculture
Ancestral L- cells in coculture, a biological replicate
Annotation : The reference genome (Escherichia_coli_cft073.ASM744v1.dna.chromosome.Chromosome.fa) and annotations (Escherichia_coli_cft073.ASM744v1.32.gtf ) were downloaded from EnsemblBacteria
An o/n culture of E. coli TolC was diluted to an OD600 of 0.1 and supplied with a final concentration of 0.5 µg/ml Carolacton in MeOH. Controls received the same volume MeOH. Three early time-points (t) were chosen to be analyzed by RNA-seq. Prior to addition of Carolacton (t0), t5, t15 and t30 min after addition of Carolacton. At each point, 5 ml of culture were mixed with an equal volume RNAprotect (Qiagen), incubated at room temperature (RT) for 5 min, the cells harvested by centrifugation, and the pellet frozen and stored at -80°C.
An overnight culture of E. coli O104:H4 strain LB226692 was diluted 1:10,000 in pre-warmed LB medium (10 g/L tryptone, 5 g/L yeast extract, 5 g/L NaCl) and cells were grown at 37oC, 180 rpm for 3.5 h to an OD600 of 0.52.
An overnight culture was diluted to an OD600 of 0.02 in LB media supplemented with 100 µg/ml of carbenicillin, 40 µg/ml biotin, and 70 µM IPTG. The back diluted culture was grown at 37°C until reaching an OD600 of 0.45.
An RNeasy kit (Qiagen Ltd) was used to extract the total RNA according to manufacturers’ instructions. Contaminating DNA was removed by using on-column DNase I digestion (Qiagen Ltd). The quality and quantity of the RNA preparations were determined with an Agilent 2100 Bioanalyzer by using the RNA 6000 nano assay Labchip (Agilent, Stockport, United Kingdom).
An RNeasy midikit was used to prepare total RNA according to the manufacturer’s instructions (QIAGEN Ltd.). Any contaminating DNA was removed using a DNAase column kit (QIAGEN Ltd).
An RNeasy minikit was used to prepare total RNA according to the manufacturer’s instructions (QIAGEN Ltd.). Any contaminating DNA was removed using a DNAase column kit (QIAGEN Ltd).
Antibodies for beta of RNAP - NeoClone, Cat Number: W0002, Lot Number: 2008L10-001  Antibodies for sigma70 of RNAP - NeoClone, Cat Number: W0004, Lot Number: 2008K12-001  All other antibodies (FNR, H-NS, IHF) were produced in this study and are not commercially available.
antibody: 9E10 Myc tag antibody
antibody: Affinity Purified FNR antibody
antibody: Affinity purified FNR polyclonal antibody
antibody: anti-DksA rabbit polyclonal antisera
antibody: Anti-Dps antibodies
antibody: anti-FLAG mAb
antibody: anti-RNAP b subunit NT63 monoclonal antibodies
antibody: anti-s70 monoclonal antibodies
antibody: Flag
antibody: IgG
antibody: INPUT
antibody manufacturer: Upstate
antibody: Monoclonal antibody for RNA polymerase Beta' subunit (NT73)
antibody: Monoclonal antibody for RNA polymerase Beta subunit (W0002)
antibody: Monoclonal ANTI-FLAG M2 antibody (F3165) -Sigma
antibody: None, input DNA
antibody: normal mouse IgG
antibody: normal mouse IgG (Upstate)
antibody: polyclonal antiserum was raised against His6-ArcA then Affinity Purified using purified ArcA to yield the polyclonal antibodies used for ChIP
antibody: polycolonal antiserum was raised against His6-ArcA then Affinity Purified against ArcA to yield the polyclonal antibodies used for ChIP
antibody: Pre-cleared FNR antibody
antibody: Pre-cleared H-NS polyclonal antibody
antibody: Pre-cleared IHF polyclonal antibody
antibody: rabbit pre-immune IgG
antibody: RNAP beta subunit (NT63)
antibody: RNA Polymerase ß monoclonal antibody from NeoClone (W0002)
antibody: RNA Polymerase σ70 monoclonal antibody from NeoClone (W0004)
antibody vendor/catalog#: Sigma/Cat. No. F1804
APEC strain O08
APEC strain SCI-07
A pool of 3 E. coli clones forming large colonies when plated on TTagar and derived from E. coli B REL606 after 150 days of seasonal evolution experiment in 18mm test tubes in DMga medium.
A pool of 3 E. coli clones forming small colonies when plated on TTagar and derived from E. coli B REL606 after 150 days of seasonal evolution experiment in 18mm test tubes in DMga medium.
A pool of 3 E. coli clones forming small colonies when plated on TTagar and derived from E. coli B REL606 after 150 days of seasonal evolution experiment in 18mm test tubes in DMga medium. 
AR1-/AR2-
AR1-/AR2- rep 1
AR1-/AR2- rep 2
AR1-/AR2- rep 3
ArcA - Aerobic - Affinity Purified - A
ArcA - Anaerobic - Affinity Purified - biological rep A
ArcA - Anaerobic - Affinity Purified -biological rep B
∆ArcA - Anaerobic - Affinity Purified - technical rep A
∆ArcA - Anaerobic - Affinity Purified - technical rep B
ArcA_anaerobic_ChIP-seq_IP_A.wig: U00096.2
ArcA_anaerobic_ChIP-seq_IP_B.wig: U00096.2
ArcA INPUT DNA from WT Escherchia coli MG1655 K-12, no antibody control
ArcA INPUT from WT Escherichia coli MG1655 K-12
ArcA IP ChIP-seq Anaerobic Biological replicate 1
ArcA IP ChIP-seq Anaerobic Biological replicate 2
∆arcA IP DNA from PK9416
ArcA IP DNA from WT Escherichia coli MG1655 K-12
ArcA IP from WT Escherichia coli MG1655 K-12
Archaea
Arginine addition
ArgR_Arginine_1
ArgR_Arginine_2
ArgR (-arg) rep1 and rep2
ArgR (+arg) rep1 and rep2
ArgR_NH4Cl_1
ArgR_NH4Cl_2
Arrays were processed using Nimblegen's standard protocol for Nimblescan 2.4 ChIP data extraction.
Arrays were processed using Nimblegen's standard protocol for Nimblescan ChIP data extraction..
As described in description
As described in the description
A single colony of Escherichia coli was inoculated into 250 ml of LB medium without antibiotics, and grown at 37C with shaking (150 RPM) for approximately 4 hours, until OD600 was ~0.3 (log phase). EDTA was then added to a final concentration of 1 mM, and incubated for additional 5 minutes to make bacteria permeable to Actinomycin D. Actinomycin D was then added to a final concentration of 5  g/ml, and bacteria were incubated for additional 2 minutes to block transcription. 25 ml aliquots of bacteria were then rapidly pelleted by centrifugation at 4C. After centrifugation, medium was decanted, and cells from each 25ml of culture were resuspended in 1ml of structure probing buffer [10 mM HEPES-KOH pH 7.9; 140 mM NaCl; 3 mM KCl]. DMS was diluted 1:6 in 100% Ethanol to a final concentration of 1.76 M. Diluted DMS was added to bacteria to a final concentration of ~105 mM. Samples were incubated with moderate shaking (800 RPM) at 25C for 2 minutes, after which reactions were immediately transferred to ice. DTT was added to a final concentration of 0.7 M to quench DMS, and samples were vigorously vortexed for 10 seconds. Bacteria were then pelleted by centrifugation at 10,000g for 30 seconds (4C), and the supernatant was decanted. Pellets were then washed once with 1 ml Isoamyl alcohol (Sigma Aldrich, cat. W205702) to remove traces of water-insoluble DMS. Bacteria were then pelleted by additional centrifugation at 10,000g for 30 seconds (4C), supernatant was decanted, and samples were snap-frozen in liquid nitrogen. Pellets were stored at -80C.
A single large fastq  format file of high quality reads (Q ≥ 30) was split into about 10 smaller files by using a shell script splitReads.sh
Aspartate addition
aspC KO rep1
aspC KO rep2
aspC KO rep3
Assignment to restriction fragment
Astat_chemostat
A-stat gene expression changes 0.3/0.47 h-1 dye-flip repl.3
A-stat gene expression changes 0.47/0.3 h-1 repl.1
A-stat gene expression changes 0.47/0.3 h-1 repl.2.1
A-stat gene expression changes 0.47/0.3 h-1 repl.2.2
A-stat, specific growth rate 0.48 1/h
AT1
AT1 biological replicate
At 3 h of culture, 60 mL of culture (at OD595 nm = 0.73 ± 0.07, 0.63 ± 0.02, 0.12 ± 0.01 and 0.11 ± 0.02 for cultures subjected to 0, 5.0, 6.5 and 8.5 µM AgNO3, respectively) were sampled and centrifuged (4000 rpm, 5 min, 4 °C), then the pellet was frozen in liquid nitrogen. The pellet was resuspended with 1 mL of TE buffer (Tris-HCl 10 mM, pH 8, EDTA 1 mM, 1 mg lysozyme) and incubated 5 min at room temperature. Total RNA was extracted with a RNeasy midi kit (Qiagen), including the DNase I treatment described in the manufacturer’s instructions. Total RNA quantity and integrity were checked by Nanodrop® and Agilent BioAnalyzer, respectively.
ATCACG-D1
ATCC2
ATCC3
At each time point, 15 ml of each culture was mixed with 30 ml of RNAprotect Bacteria Reagent (Qiagen), vortexed for 5s, incubated for 5 min at room temperature, and centrifuged for 10 min at 5000g.  The pellet was processed using a Qiagen RNeasy Midi kit with on-column DNase digestion using Qiagen DNase.  The final elution of RNA from the column was with 160 μl RNase-free water.
At OD ~0.3, cultures were induced with 1mM IPTG for the appropriate length of time.
At OD450 = 0.3, cultures induced with 1 mM IPTG. Cells harvested 0 min after induction
At OD450 = 0.3, cultures induced with 1 mM IPTG. Cells harvested 10 min after induction
At OD450 = 0.3, cultures induced with 1 mM IPTG. Cells harvested 15 min after induction
At OD450 = 0.3, cultures induced with 1 mM IPTG. Cells harvested 20 min after induction
At OD450 = 0.3, cultures induced with 1 mM IPTG. Cells harvested 2.5 min after induction
At OD450 = 0.3, cultures induced with 1 mM IPTG. Cells harvested 30 min after induction
At OD450 = 0.3, cultures induced with 1 mM IPTG. Cells harvested 5 min after induction
At OD450 = 0.3, cultures induced with 1 mM IPTG. Cells harvested 60 min after induction
At OD600~0.3, serine hydroxamate was added to a final concentration of 0.5mg/ml, cells were collected 40 minutes later.
At OD600 of 0.5, cell cultures were separated into two flasks. D-galactose (final 0.3%) was added to one and cells were grown for 1.5 h further.
At OD630nm = 0.1, the cultures were filtered through 47-mm diameter polycarbonate membrane filter (0.4 µm pore size; Millipore), washed with the same medium without hypoxanthine (Hx), and then resuspended at the same cell density (OD630 = 0.1) in the medium without Hx, and growth was continued as before.  The OD630 was followed closely during the next two hours, and the cells were periodically diluted with fresh, pre-warmed medium without Hx to keep OD between values 0.1 and 0.3 (low-dilution protocol).  Samples were taken for microarray analysis (see below) at 0, 15, 30, 45, 60 and 120 minutes.  In a parallel procedure, the optA1 gpt double mutant was also followed in a near-identical manner using a more highly diluted culture over a six-hour incubation period in the absence of hypoxanthine (high-dilution protocol).  The effectiveness of the latter treatment was followed microscopically by observing the extensive cellular filamentation associated with dGTP starvation.
A total of six samples were analyzed. oxyR-8myc, soxR-8myc, and soxS-8myc tagged cells were cultured in M9 minimal media with 0.2% glucose. Then cells were treated with 250 uM of paraquat at mid-log pahse for 20 min with agitation.
A total of two samples were analyzed. ompR-8myc tagged cells were cultured in M9 minimal media with 0.2% glucose. Then cells were treated with 0.3 M of NaCl at mid-log pahse for 30 min with agitation.
A, TP1
A, TP2
A, TP3
A, TP4
At the appropriate optical density, culture growth was instantaneously arrested by addition of an equal volume of chilled 100% ethanol, and the cells were stored at –80°C until they were processed for RNA extraction. The cells were lysed and total RNA was prepared by the hot phenol method essentially as described, after chromosomal DNA has been digested with RNase-free DNase.
At the appropriate phase of growth, a one-eighth volume of stop solution (95% [v/v] ethanol; 5% [v/v] phenol) was added to a culture to inhibit cell metabolism (Kime et al. 2008. In RNA Turnover in Bacteria, Archaea and Organelles, Vol 447 (ed. LE Maquat, CM Arraiano), pp. 215), and the cells were harvested by centrifugation. When necessary, cell pellets were stored frozen at -80C.
At time point 0, rifampicin was added to a final concentration of 500ug/ml. Samples were collected at 0, 2, 4, 6, and 8 minutes.
Automatic extractor in Verigene system of genomic DNA
average fitness: 0.196851676684606
average fitness: 0.296737932583603
average fitness: 0.344592279464807
average fitness: 0.353076289611459
average fitness: 0.434286415079969
average fitness: 0.502711019240335
Average Normalization using GeneChip Operating Software Version 1.4
AW1.7, steady-state continuous cultured experimental samples at 37°C
AW1.7, steady-state continuous cultured experimental samples at 37°C and then 15 minutes heatshock at 50 °C
azide treated
B10 DH10BGFP_pSB1C3_2
B10:LJ110 del pdhr MMAcetat
B11:LJ110 pTM30 MMAcetat
B12:LJ110 pTM30pdhr MMAcetat
B17 MG1655GFP_pSB1C3_2
B1:LJ110 LBo
B22 MG1655GFP_pSB1C3_H3_2
b2618_U_N0075_r1
b2618_U_N0075_r2
b2618_U_N0075_r3
b2618 upregulation, 0.075 ug/ml norfloxacin
B26 MG1655GFP_Lux_2
B2:LJ110 del pdhr LBo
B3 DH10BGFP_pSB1C3_2
B3:LJ110 pTM30 LBo
B4 DH10BGFP_pLys_2
B4:LJ110 pTM30pdhr LBo
B500_1
B5:LJ110 MMPyruvat
B6:LJ110 del pdhr MMPyruvat
B7 DH10BGFP_pD864_2
B7:LJ110 pTM30 MMPyruvat
B8:LJ110 pTM30pdhr MMPyruvat
B9 DH10BGFP_pLys_M1_2
B9:LJ110 MMAcetat
Background correction and normalization (print-tip loess and quantile) were performed using the limma R package.
Background correction, normalization and calculation of the expression measures were performed using RMA procedure with the WebArray platform (http://bioinformatics.skcc.org/webarray/). Subsequently the program EDGE (http://www.biostat.washington.edu/software/jstorey/edge/) was used to estimate the conditional false discovery rate (FDR), the expected proportion of false positives conditioned on having k 'significant' findings.
background: crp mutant background, fis flag tag
background: fis mutant background, crp flag tag
background strain: BW25113
background strain: BW27784
background strain: LJ110
Background subtractions and normalization of extracted data were performed through R using the Bioconductor package as described (Yang, Y.H. et al. Normalization for cDNA microarray data: a robust composite method addressing single and multiple slide systematic variation, Nucleic Acid Res 30, e15, 2002; Smyth, G.K. in Bioinformatics and Computational Biology Solutions using R and Bioconductor. 397-420, Springer, New York, 2005).
background: wild type, crp flag tag
background: wild type, fis flag tag
bacteria
Bacteria
Bacteria at 58°C F = 2
Bacteria at 58°C F = 3
Bacteria at 60°C F = 3
Bacteria at 71°C
Bacteria cells
bacteria grown at 37° C with shaking until log phase
bacteria grown at 37° C with shaking until log phase with ampicilin treatment
bacteria grown at 37° C with shaking until log phase with florfenicol treatment
bacteria grown at 37° C with shaking until log phase with streptomycin treatment
bacteria grown in LB in vitro
bacteria harvested from blood of chickens
Bacterial cell
bacterial cell culture
Bacterial Cell Lysates
bacterial cell lysates_input
bacterial cell lysates_RecA-ChIP-seq
Bacterial cell pellet
bacterial cells
Bacterial cells
Bacterial cells from an overnight culture were washed and diluted in fresh SILAC (stable isotope labeling with amino acids in cell culture) medium optimized for non-auxotrophic E. coli (Ping LY et al. J Proteome Res., 2013), before incubation at 37 °C with agitation until reaching an OD600 of approximately 0.3.
bacterial cells grown to OD600=0.5
Bacterial cells were grown aerobically in M9 medium supplemented with 0.2% glucose and 5% LB at 37°C under constant shaking (~120 rpm) in a water bath and harvested at OD ~0.6.
Bacterial cells were grown in dYT medium (Miller, JH (1972) Experiments in Molecular Genetics (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) supplemented with kanamycin (10 mg/L), ampicillin (100 mg/L) and IPTG (0.1mM) at 30°C in a shaking water bath. At a turbidity (measured at OD536) of approximately 0.1 bacteria were harvested by centrifugation at ambient temperature and resuspended in fresh dYT medium containing antibiotics and 0.2% arabinose. Growth was continued at 30°C and 10 hours after inducer shift 3ml sample were withdrawn, treated with RNAPROTECT (Qiagen, Ballerup), harvested by centrifugation and frozen.
Bacterial culture grown overnight at 37C, given 1% sub-culturing till OD at 600nm was 0.4
Bacterial cultures
Bacterial culture with 0.2 ppm deoxynivalenol
Bacterial culture with 0.2 ppm nivalenol
Bacterial culture with 2 ppm deoxynivalenol
Bacterial culture with 2 ppm nivalenol
Bacterial culture with acetonitrile
Bacterial liquid culture
Bacterial lysis
bacterial pellet
Bacterial pellets were resuspended in 350µl RNAwiz  (Ambion, Austin, TX) and kept at -80 °C.
Bacterial RNA was purified with Qiagen RNeasy mini kit, and the samples with RNA Integrity Number (RIN) >9 were used for labeling
Bacterial RNA was stabilized in vivo, by using RNA protect Bacteria Reagent (Qiagen). Total RNA was isolated by using RNeasy Kits for RNA purification (Qiagen) as per the manufacturer’s protocol.
Bacterial strains were grown in LB. Overnight cultures were diluted 1:100 in fresh LB and grown at 37°C with shaking to an OD600 = 0.5.
Bacteria suspension heated at 58°C to a process lethality value of 2 - Replicate 1
Bacteria suspension heated at 58°C to a process lethality value of 2 - Replicate 2
Bacteria suspension heated at 58°C to a process lethality value of 2 - Replicate 3
Bacteria suspension heated at 58°C to a process lethality value of 2 - Replicate 4
Bacteria suspension heated at 58°C to a process lethality value of 2 - Replicate 5
Bacteria suspension heated at 58°C to a process lethality value of 3 - Replicate 1
Bacteria suspension heated at 58°C to a process lethality value of 3 - Replicate 2
Bacteria suspension heated at 58°C to a process lethality value of 3 - Replicate 3
Bacteria suspension heated at 58°C to a process lethality value of 3 - Replicate 4
Bacteria suspension heated at 60°C to a process lethality value of 3 - Replicate 1
Bacteria suspension heated at 60°C to a process lethality value of 3 - Replicate 2
Bacteria suspension heated at 60°C to a process lethality value of 3 - Replicate 3
Bacteria suspension heated at 60°C to a process lethality value of 3 - Replicate 4
Bacteria suspension heated to a core temperature of 71°C                - Replicate 1
Bacteria suspension heated to a core temperature of 71°C                - Replicate 2
Bacteria suspension heated to a core temperature of 71°C                - Replicate 3
Bacteria suspension heated to a core temperature of 71°C                - Replicate 4
Bacteria suspension heated to a core temperature of 71°C                - Replicate 5
Bacteria were cultured in an M9 minimal medium supplemented with 2 g/L lactose and 5 mM phenylethylamine (PEA, M9+L+PEA). To induce ECAO expression from tynA gene, o/n culture of wt E. coli in M9-lactose medium was diluted 1:20 in M9+L+PEA with 5 μM CuSO4. The bacteria were grown aerobically at +30°C with 250 rpm shaking.
Bacteria were grown at 30C with shaking (~200 rpm) in fully supplemented MOPS glucose media (Teknova) to OD420 ~0.4. Cultures were split into 4 subcultures, and grown to OD ~0.3.
Bacteria were grown in batch or bioreactor vessels in M9 minimal media supplemented with 0.4% glucose.
Bacteria were grown in LB broth overnight and subcultured in DMEM
Bacteria were grown in LB broth overnight and subcultured in DMEM prior to acid stress
Bacteria were grown in LB broth overnight and subcultured in DMEM to OD600 of 0.4. Bacteria were then spun down, media removed and repalced with DMEM. 
Bacteria were grown in LB broth overnight and subcultured in DMEM to OD600 of 0.4. Bacteria were then spun down, media removed and repalced with DMEM plus 0.15% bile salt mix. 
Bacteria were harvested with 0.5 Vol of 5% phenol in ethanol and frozen at -80C. Total RNA was extracted from frozen cultures using RNeasy kit (Qiagen).
Bacteria were inoculated by direct injection of the mouse bladder, and kidney samples were taken at day 2 post-infection
Bacteria were lyzed with lyzozyme and sonicated to shear DNA. TopoIV-DNA complexes were isolated with antibody .
Bacterium
Bacteroides caccae ATCC 43185
Bacteroides fragilis
Bacteroides ovatus ATCC 8483
Bacteroides thetaiotaomicron VPI-5482
BAM files of each ChIP biological replicate and the input replicate samples were used in the MACS peak calling program with the -f BAMPE parameter
BAM files of the resulting assembly data were exported to JMP Genomics (SAS).  TMM normalization and ANOVA analysis of the read samples were conducted in JMP Genomics
basal media: M9 + 4 g/L glc (glucose minimal media)
Basecalling performed by MiSeq (RTA)
Base calling performed using  Illumina GA pipeline 1.6.
Basecalling was done on the sequencers using the sequencer's Real-Time Analysis (RTA) software.  CASAVA was used to process the basecalled data into FASTQ format.
Base calling was performed by the DOE Joint Genome Institute using Illumina software.
Basecalling was performed by Torrent Suite version 5 software using the default settings.
Basecalls performed using CASAVA version 1.4
Basecalls performed using CASAVA version 1.7
Basecalls performed using CASAVA version 1.8
Basecalls performed using CASAVA version 1.8.2
Basecalls performed using CASAVA version 1.8.2.
Basecalls performed using Casava versions 1.6 or 1.7.
Basecalls performed using HCS 2.0.5 and RTA 1.17.20
Basecalls performed using Illumina CASAVA.
Base calls performed with RTA v1.18.5
Base calls were made using MiSeq Reporter v. 2.6.2.1
Basecalls were performed using CASAVA.1.8
base calls with quality metrics were generated using the HiSeq 2500 Control software
batch: 10
batch: 11
batch: 12
batch: 13
batch: 14
batch: 15
batch: 16
batch: 17
batch: 18
batch: 19
batch: 20
batch: 21
batch: 22
batch: 23
batch: 24
batch: 25
batch: 26
batch: 27
batch: 7
batch: 8
batch: 9
Batch anaerobically grown cultures in hemA defined medium, exposed to 100uM CORM-3 for 10min
Batch anaerobically grown cultures in hemA defined medium, exposed to 100uM CORM-3 for 120min
Batch anaerobically grown cultures in hemA defined medium, exposed to 100uM CORM-3 for 20min
Batch anaerobically grown cultures in hemA defined medium, exposed to 100uM CORM-3 for 40min
Batch anaerobically grown cultures in hemA defined medium, exposed to 100uM CORM-3 for 60min
Batch anaerobically grown cultures in hemA defined medium, exposed to 100uM iCORM-3 for 10min
Batch anaerobically grown cultures in hemA defined medium, exposed to 100uM iCORM-3 for 120min
Batch anaerobically grown cultures in hemA defined medium, exposed to 100uM iCORM-3 for 20min
Batch anaerobically grown cultures in hemA defined medium, exposed to 100uM iCORM-3 for 40min
Batch anaerobically grown cultures in hemA defined medium, exposed to 100uM iCORM-3 for 60min
Batch anaerobically grown cultures in hemA defined medium, prior to CORM-3 addition
Batch anaerobically grown cultures in hemA defined medium, prior to CORM-3 addition (t=0)
Batch anaerobically grown cultures in hemA defined medium, prior to iCORM-3 addition
batch culture
batch culture rep1, 0.5 min
batch culture rep1, 0 min
batch culture rep1, 10 min
batch culture rep1, 1 min
batch culture rep1, 2 min
batch culture rep1, 5 min
batch culture rep2, 0.5 min
batch culture rep2, 0 min
batch culture rep2, 10 min
batch culture rep2, 1 min
batch culture rep2, 2 min
batch culture rep2, 5 min
batch culture rep3, 0.5 min
batch culture rep3, 0 min
batch culture rep3, 10 min
batch culture rep3, 1 min
batch culture rep3, 2 min
batch culture rep3, 5 min
Batch cultures of E. coli MG1655 were grown at 37°C with shaking in Luria-Bertani medium (0.1% Bacto Tryptone, 0.05% yeast extract, 0.05% NaCl).
Batch growth in mineral medium supplied with 4 g/l glucose as sole carbon source (optical density 0.4 at 546nm)
Batch growth in mineral medium supplied with 4 g/l glucose as sole carbon source (optical density of 0.4 at 546 nm)
BC-7ppm replicate 1
BC-7ppm replicate 2
BC-7ppm replicate 3
BC-9ppm replicate 1
BC-9ppm replicate 2
BC-9ppm replicate 3
bcl2fastq2 v2.15.0 (Demultiplexing), Fastqc 0.11.5 (read quality), Cutadapt-1.9.1 (adaptor trimming)
(B), column (X), and row (Y) number, red foreground (f_r) and background (b_r), green
bcp___U_N0075_r1
bcp___U_N0075_r2
bcp___U_N0075_r3
bcp upregulation, 0.075 ug/ml norfloxacin
Bear feces isolate B1
Bear feces isolate B3
Bear feces isolate B5
Bear III versus MG1655 technical replicate 1
Bear III versus MG1655 technical replicate 2
Bear II versus MG1655 technical replicate 1
Bear II versus MG1655 technical replicate 2
Bear I versus MG1655 technical replicate 1
Bear I versus MG1655 technical replicate 2
Beta_ChIP_A_cy5
Beta_ChIP_B_cy5
Beta_ChIP_control_A_cy3
Beta_ChIP_control_B_cy3
Bexp_Bstat_dyeswap1
Bexp_Bstat_dyeswap2
Bexp_Bstat_rep1
Bexp_Bstat_rep2
Bexp_Kexp_dyeswap1
Bexp_Kexp_dyeswap2
Bexp_Kexp_rep1
Bexp_Kexp_rep2
Bexp_Kstat_dyeswap1
Bexp_Kstat_dyeswap2
Bexp_Kstat_rep1
Bexp_Kstat_rep2
BGI inhouse software “filter_fq” for basecalling and trimming
Bicyclomycin (BCM, gift of Schering-Plough Animal Health) was added to the culture at the indicated dose for 20 minutes. Culture was added to 2 volumes of RNAprotect Bacterial Reagent (QIAGEN).
BigWIG files were viewed and annotated using Jbrowse and Integrated Genome Viewer.
bile+1
bile+2
bile+3
Bile salt stress was done in DMEM at pH 7.4 (unbuffered) at 37C, 5% CO2, static incubation for 90 minutes
Binning at 5kb.
Bio1 1m
Bio1 1y
Bio2 1m
Bio2 1y
Bio3 1m
Bio3 1y
Bio4 1m
Bio4 1y
Bio-6
Bio Contro
Biofilms were grown on nylon membranes using agar as the source of nutrients and water.  Aliquots of 10 ml Luria agar were transferred to petri dishes to produce layers of agar approximately 3 mm in depth.  Nylon membrane filters (47 mm diameter) with a 0.2 μm pore size (Whatman) were autoclaved in Milli-Q water, dried and placed on the agar surface.  A 100 μl aliquot of an overnight culture (approximately 108 cells) was applied to the membrane as a single spot and allowed to dry.  All of these steps were performed on a level table so as not to introduce unwanted gradients.  Dishes were then inverted and incubated at 37 oC for 24 h.
Biofilms were individually removed from the incubator and, using a small scalpel blade and sterile forceps, the distinctive outer perimeter of biofilm growth was cut away from the rest of the biofilm.  The two resulting sections of membrane were submerged in separate volumes of RNAprotect Bacteria Reagent and vortexed to release the cells.  The sections of membrane were then removed from the resulting suspension before RNA extraction.
biological replicate: 1
biological replicate: 2
biological replicate: 318
biological replicate: 320
biological replicate: 327
biological replicate: Replicate 1
Biological replicates per genotype were incubated at 1 mg/L of ciprofloxacin during 60 minutes (that means 250xMIC for E. coli ATCC 25922, 8xMIC for EC14, 2xMIC for EC19 and 1xMIC for EC24).
biological replicate: t=0 Replicate 1
biological replicate: t=0 replicate 2
biomass collected in the transition between exponential to stationary phase
Biomass was snap frozen in liquid nitrogen and stored at -80 C prior to extraction with Qiagen RNeasy Midi kits.  RNA integrity was verified with a 2100 Bioanalyzer (Agilent).
bioremediation treatment: Alert (ex situ)
bioremediation treatment: Eureka (in situ)
Biotinylated GST protein
BL21_1
BL21_2
BL21(DE3)_adhE mutant
BL21(DE3), adhE mutant
BL21(DE3) HPA 0mM
BL21(DE3) HPA 3mM
BL21(DE3) with 3 mM of heptanoic acid
BL21(DE3) without heptanoic acid
BL21 (mu=0.20) (1)
BL21 (mu=0.20) (2)
BL21 (mu=0.20) (3)
BL21 (mu=0.20) (4)
BL21(mu=0.46) (1)
BL21(mu=0.46) (2)
BL21(mu=0.46) (3)
BL21(mu=0.46) (4)
BL21/pOri1 (mu=0.20) (1)
BL21/pOri1 (mu=0.20) (2)
BL21/pOri1 (mu=0.20) (3)
BL21/pOri1 (mu=0.20) (4)
BL21/pOri1 (mu=0.39) (1)
BL21/pOri1 (mu=0.39) (2)
BL21/pOri1 (mu=0.39) (3)
BL21/pOri1 (mu=0.39) (4)
BL21/pOri2 (mu=0.20) (1)
BL21/pOri2 (mu=0.20) (2)
BL21/pOri2 (mu=0.20) (3)
BL21/pOri2 (mu=0.20) (4)
BL21/pOri2 (mu=0.29) (1)
BL21/pOri2 (mu=0.29) (2)
BL21/pOri2 (mu=0.29) (3)
BL21/pOri2 (mu=0.29) (4)
bla_0min
bla_10min
bla_15min
bla_1min
bla_2min
bla_4min
bla_6min
bla_8min
Blautia coccoides
Blautia hydrogenotrophica DSM 10507
Blood culture
Blood culture bottle
Blue_1
Blue_2
BnTR1, 37°C, replicate 1
BnTR1, 37°C, replicate 2
BnTR1, 37°C, replicate 3
BnTR1_37_rep1
BnTR1_37_rep2
BnTR1_37_rep3
BnTR1, 42°C, replicate 1
BnTR1, 42°C, replicate 2
BnTR1, 42°C, replicate 3
BnTR1_42_rep1
BnTR1_42_rep2
BnTR1_42_rep3
Bordetella sp. IITR-02
bovine-biased-1 strain grown to exponential phase of growth
bovine-biased-2 strain grown to exponential phase of growth
bovine-biased-3 strain grown to exponential phase of growth
bovine-biased-4 strain grown to exponential phase of growth
bowtie2-build final_reference_seqs/REL606.fa indexes/REL606
Bowtie 2 (Langmead B & Salzberg SL, 2012) was used with default parameters, to remove any sequence reads aligning to ribosomal RNA, transfer RNA and non-coding RNA sequences.
bowtie2 v2.2.3 was used for alignment
Bowtie alignments against the E. coli genome were converted to wiggle files. For ribosome footprints and mRNA-seq, the position of each alignment is distributed into several nucleotides in the center of each read. For each read, the center residues that are at least 10 nucleotides away from either ends were given the same score, which is weighted by the length of the fragment [Oh et al,. Cell 147, 1295 (2011)]. Scores therefore represent the number of read alignments attributed to each genomic position under each scoring scheme. For DMS-seq, the position of each alignment was the position immediately 5' of the 5' end of the read.
Bowtie alignments against the E coli genome were converted to wiggle files. The position of each alignment is distributed into several nucleotides in the center of the footprint. For each footprint read, the center residues that are at least 10 nucleotides away from either ends were given the same score, which is weighted by the length of the fragment [Oh et al,. Cell 147, 1295 (2011)]. Scores therefore represent the number of read alignments attributed to each genomic position under each scoring scheme.
Bowtie alignments against the reference genome were converted to wiggle files. The position of each alignment was mapped to the 3' end of the nascent transcript.
Briefly, hot phenol-chloroform extraction was done by mixing the cell culture in ½ volume of 99°C lysis solution (2% SDS, 16 mM EDTA, 200 mM NaCl made in RNAse-free H2O) for 10 min. The suspension was extracted twice with 1 volume of 65°C acid phenol/chloroform (pH 4.5), once in chloroform/isoamyl alcohol, and precipitated with isopropanol. Pellets were washed with 1 mL of 70% ethanol, dried and purified using QIAGEN RNeasy kit. Final RNA was eluted with 100 µL of nuclease-free water. Following purification, DNAse treatment with TURBO DNase kit was performed according to manufacturer’s manual, except that twice amount of recommended DNase inactivation reagent was used. The integrity of DNA-free RNA was analyzed on either native agarose gel or on Agilent Bioanalyzer RNA 6000 Nano chip.
Briefly, total RNA were isolated from cell culture with Total RNA Extraction Kit (RBC Bioscience) according to manufacturer's specifications. DNA was degraded by DNAse (Promega).
Broiler Fecal
BRP Induction 10 Minutes against 5 Minutes
BRP Induction -10 minutes against 60 minutes
BRP Induction 20 minutes against 10 minutes
BRP Induction 30 minutes against 20 minutes
BRP Induction 45 minutes against 30 minutes
BRP Induction 5 minutes against 2 minutes
BRP Induction 60 minutes against 45 minutes
B strain_wild type
B strain, wild type
Butanol_Challenge_Step_1-1
Butanol_Challenge_Step_1-2
Butanol_Challenge_Step_2-1
Butanol_Challenge_Step_2-2
Butanol_Challenge_Step_3-1
Butanol_Challenge_Step_3-2
Butanol_Challenge_Step_4-1
Butanol_Challenge_Step_4-2
BW25113
BW25113_adhE mutant
BW25113, adhE mutant
BW25113, H2O2
BW25113 HEPES-glu 30 min 4.5% deoxycholate
BW25113 hha deletion mutant LB 4hr biofilm cells
BW25113 hha mutant LB glu 15 hr biofilm cells
BW25113 hha mutant LB glu 24 hr biofilm cells
BW25113 hha mutant LB glu 4 hr biofilm cells
BW25113 luxS LB 30C free-living cells 100 uM AI2 3h
BW25113 luxS LB 30C free-living cells no AI2 for 3h
BW25113 luxS LB 37C free-living cells 100 uM AI2 3h
BW25113 luxS LB 37C free-living cells no AI2 3h
BW25113 mqsR mutant at OD600=0.5 LB 37C suspension cell
BW25113 mqsR/pBS(Kan)-mqsR 2-1 in LB with ampicillin
BW25113 mqsR/pBS(Kan)-mqsR in LB with ampicillin
BW25113-pCA24N
BW25113-pCA24N_arT LB 90 min 1 mM IPTG
BW25113/pCA24N at OD600=0.5 LB 37C 2 mM IPTG suspension cell
BW25113/pCA24N at OD600=0.5 LB 37C then 2 mM IPTG for 15 min short time suspension cell
BW25113-pCA24N_dosP
BW25113-pCA24N LB 90 min 1 mM IPTG
BW25113/pCA24N-mqsR at OD600=0.5 LB 37C 2 mM IPTG suspension cell
BW25113/pCA24N-mqsR at OD600=0.5 LB 37C then 2 mM IPTG for 15 min short time suspension cell
BW25113 sdiA-empty vector 12h biofilm cells at 30oC
BW25113 sdiA LB 30C OD 4.0 free-living cells
BW25113 sdiA mutant LB with 1 mM indole 7-h 30C biofilm cell
BW25113 sdiA mutant LB with DMF 7-h 30C biofilm cell
BW25113 sdiA-SdiA1E11 12h biofilm cells at 30oC
BW25113 sdiA-WTSdiA 12h biofilm cells at 30oC
BW25113 tnaA Biofilm 100 uM indole 7h LB 30C
BW25113 tnaA Biofilm 100 uM indole 7h LB 37C
BW25113 tnaA Biofilm DMF 7h LB 37C
BW25113 tnaA LB 30C biofilm cells with DMF 7h
BW25113, water (negative control)
BW25113 with deoxycholate stress
BW25113 w/t 7h LB 30C biofilm
BW25113 w/t 7h LB 30C free-living
BW25113 wt at OD600=0.5 LB 37C suspension cell
BW25113 w/t LB 30C OD 4.0 free-living cells
BW25113 w/t LB 4hr biofilm cells
BW25113 w/t LB glu 15 hr biofilm cells
BW25113 W/T LBglu 24h biofilm cells
BW25113 w/t LB glu 24 hr biofilm cells
BW25113 w/t LB glu 4 hr biofilm cells
BW25113 ychH, H2O2
BW25113 ychH, water (negative control)
BW25113 ygiW, H2O2
BW25113 ygiW, water (negative control)
BW25113 ymgB LBglu 24h biofilm cells
BW25113 ΔmqsRA HEPES-glu 30 min 4.5% deoxycholate
BW25113 ΔmqsRA with deoxycholate stress
BWG_butanol_3passages
BWG_replicated
BWY_butanol_3passages
BWY_replicated
BZNT
C1
C2
Call peaks to and FDR 0.1, MOSAiCs
CAR005
CAR005 strain
carbon source: acetate
carbon source: fructose
carbon source: gluconate
carbon source: glucose
carbon source: Glucose
carbon source: glycerol
carbon source: Glycerol
carbon source: glycerol + propionate
carbon source: lactate
CASAVA version 1.4
cas_RNAA
Cattle feces isolate C1A
Cattle feces isolate C4A
Cattle feces isolate C6D
Cattle III versus MG1655 technical replicate 1
Cattle III versus MG1655 technical replicate 2
Cattle II versus MG1655 technical replicate 1
Cattle II versus MG1655 technical replicate 2
Cattle I versus MG1655 technical replicate 1
Cattle I versus MG1655 technical replicate 2
Caulobacter crescentus and derivatives were grown at 30°C in PYE (Peptone yeast extract) or LB
CCCP-1, biological rep1
CCCP-2, biological rep2
CCCP-3, biological rep3
ccdB_K12_0_r1
ccdB_K12_120_r1
ccdB_K12_30_r1
ccdB_K12_60_r1
ccdB_K12_90_r1
ccdB_MG1063_0_r1
ccdB_MG1063_0_r2
ccdB_MG1063_120_r1
ccdB_MG1063_30_r1
ccdB_MG1063_30_r2
ccdB_MG1063_60_r1
ccdB_MG1063_60_r2
ccdB_MG1063_90_r1
ccdB_MG1063_90_r2
ccdB_W1863_0_r1
ccdB_W1863_30_r1
ccdB_W1863_60_r1
ccdB_W1863_90_r1
cDNA_A_cy3
cDNA_B_cy5
cDNA libraries for the Illumina sequencing platform were constructed by vertis Biotechnology AG, Germany, as described previously (Berezikov et al.,2006), without the RNA size-fractionation step prior to cDNA synthesis. Briefly, RNA samples were polyA-tailed using polyA polymerase. Then, the 5'-PPP termini were converted to 5'-P using tobacco acid pyrophosphatase (TAP) to allow for the ligation of the 5’ end RNA adapter. First-strand cDNA was synthesized by an oligo(dT)-adapter primer and the M-MLV reverse transcriptase. In a PCR-based amplification step using a high fidelity DNA polymerase the cDNA concentration was increased to 20-30 ng/µl. A library-specific barcode for multiplex sequencing was part of a 3'-sequencing adapter.
cDNA libraries were barcoded with the TruSeq RNA Sample Prep Kit v2 (Illumina Inc., San Diego, CA). Libraries were sequenced on the Illumina MiSeq to produce 50 bp single reads. All steps in library construction and sequencing were performed according to manufacturer’s standards.
cDNA libraries were constructed at Purdue using an adapted SOLiD Total RNA-Seq Kit. Total RNA (DNase I digested) was fragmented by RNase III. RNA samples labeled as TEX were also subsequently digested with Terminator Exonuclease (TEX). Pyrophosphate groups were removed from the 5′ terminus using tobacco acid pyrophosphatase (TAP), and an RNA adapter was ligated to the 5′ end of the RNA. First-strand synthesis was performed using standard SOLiD 4 Total RNA-Seq protocol. RNA-seq via SOLiD 4 sequencing of libraries prepared by ligation based chemistry to provide strand-specific datasets.
cDNA libraries were constructed at Vertis in Germany using a ligation based stratagey for Illumina whole transcriptome sequencing. Total RNA (DNase I digested) was fragmented by RNase III. RNA samples labeled as TEX were also subsequently digested with Terminator Exonuclease (TEX). Pyrophosphate groups were removed from the 5′ terminus using tobacco acid pyrophosphatase (TAP), and an RNA adapter was ligated to the 5′ end of the RNA. First-strand synthesis was performed using standard Illumina protocols.
cDNA library of the nascent RNA was constructed according to Churchman and Weissman, Nature 2011 (PMID: 21248844).
cDNA made from strain KMD extracted from mouse kidney on day 2 post infection
cDNA made from strain PC1012(marArobsoxS) extracted from mouse kidney on day 2 post infection
cDNA of EPEC strain
cDNA reads were trimmed so that the quality at each base position was above 30 (~15-20 bp) and then mapped either to the E. coli K-12 MG1655 published genome sequence (Genbank accession no. NC_000913) or to the pAR060302 published sequence (Genbank accession no. NC_092692) using BOWTIE.  The E. coli strain DH5α has an incomplete annotation and for this reason the E. coli K-12 annotation was used, representing an estimation of differentially expressed genes due to exposure of antimicrobials.  Mapped reads for 3 seperate sequencing runs were combined because some sequencing runs were not fully completed due to technical difficulties.  For each condition, graphs representing the number of mapped reads per nucleotide were generated and visualized using the Integrated Genome Viewer (IGV).  Images were created using XplasMap (http://www.iayork.com/XPlasMap/) and IGV.  The reads mapped per kilobase of gene per million (RPKM) reads was calculated using either the E. coli chromosome or the pAR060302 annotation and was used for global normalization.  The per kilobase cDNA length normalized the effect of different length of cDNAs such that the sequence reads have a equal chance to map on the long cDNA regions and the short cDNA regions.  After RPKM normalization, each sample is comparable to each other.  An R package, DEGseq , was used to identify differentially expressed genes between the control and each antibiotic treatment condition.
cDNA were synthesized from the reverse transcription of Total RNA using the Life Technologies SuperScript II Double-Strand Synthesis Kit
CEL files were quantified with Distribution Free Weighted method (DFW), using the statistical language R (R-2.7.2) and Bioconductor 2.2.
cell culture
Cell culture
Cell cultures were cross linked by addition of 27 µl of formaldehyde (37%) per ml medium (final concentration 1%). Crosslinking was performed at slow shaking (100 rpm) for 20 min followed by quenching with 0.2 ml of 2.5 M glycine per ml medium (final concentration 0.5 M). Cells were collected from 15 ml by centrifugation and washed twice with cold TBS (pH7.5).The pellet wa resuspended in 300μL TE with 40 μl 10% SDS and 3 μl 0.5 M EDTA. After incubation for 5 min at 65°C 750μl isopropanole was added before centrifugation at 15600 rcf for 5 min. The pellet was resuspended in 500μL TE and 3μL RNase A (25mg/ml) was added and incubated for 30 min at 65°C. Subsequently, 100μL proteinase K (25 mg/ml) was added and samples incubated at  42°C for 2 h and 65°C for 6 h to reverse the crosslink followed by phenol extraction and precipitation with ethanol and Na-acetate. Precipitated DNA was resuspended in 50μL dH2O.
Cell culture was rapidly filtered in 250 mL increments at 37 °C over 0.22 μm nitrocellulose filters (GE) and frozen in liquid nitrogen to simultaneously halt all transcriptional progress. Frozen cells (100 μg) were pulverized on a Qiagen TissueLyser II mixer mill 6 times at 15 Hz for 3 min in the presence of 500 μL frozen lysis buffer (20 mM Tris pH 8, 0.4% Triton X-100, 0.1% NP-40, 100 mM NH4Cl, 50 U/mL SUPERase•In (Ambion)) and 1X protease inhibitor cocktail (Complete, EDTA-free, Roche), supplemented with 10 mM MnCl2. The lysate was resuspended on ice by pipetting. RQ1 DNase I (110 U total, Promega) was added and incubated for 20 min on ice. The reaction was quenched with EDTA (25 mM final), which releases polysomes from the transcript and reduces contamination from ribosomal RNA and ribosome-associated tRNAs. The lysate was clarified at 4 °C by centrifugation at 20,000 g for 10 min. The lysate was loaded onto a PD MiniTrap G-25 column (GE Healthcare) and eluted with lysis buffer supplemented with 1 mM EDTA. Total RNA was purified from the clarified lysate using the miRNeasy kit (Qiagen).
Cell exposure to NP-TiO2 was conducted in 50 ml of sterile Milli-Q water supplemented with 10 mM NaCl. Briefly, 500 µl of the E. coli bacterial suspension and 500 µl of the NP-TiO2 stock suspension (or mQ water for the control) were prepared as previously described and then added to the NaCl solution to obtain final concentrations of 10E7 cells/ml and 100 mg/l of TiO2 nanoparticles. The flasks were then incubated at 20°C on a dark rotary shaker (150 rpm) for 5 h.
cell pellets
Cell pellets (from initial 250 mL of culture) were thawed and resuspended in 250 μL of IP buffer (100 mM Tris pH 8, 300 mM NaCl, 1% TritonX-100) and sonicated using a microtip sonicator set at 10% output for 20 second intervals with periods of cooling in between. Cells were then treated for one hour at 4 °C with RNase A (2 ng/ml), micrococcal nuclease (50 units), 20 μM CaCl2,1.2 mM KCl, 0.3 mM NaCl, 6 mM sucrose, and 10 μM DTT. EDTA was added to 10 mM to stop the micrococcal nuclease and the samples were spun down to remove cell debris. The lysate was then precleared through incubation with a 50/50 slurry of sepharose protein A beads in IP buffer for 2-3 hours at 4 °C. The beads were removed by centrifugation and antibody was added to the pre-cleared lysate for an overnight incubation. The next day, 30 μl of a 50/50 slurry of sepharose protein A beads in IP buffer was added to the lysate to capture antibody-protein-DNA complex for one hour at 4 °C. Beads were then washed once with 1 ml of LiCl wash buffer (100 mM Tris pH 8, 250 mM LiCl, 2% TritonX-100), twice with 600 mM NaCl wash buffer (100 mM Tris pH 8, 600 mM NaCl, 2% TritonX-100), twice with 300 mM NaCl wash buffer (100 mM Tris pH 8, 300 mM NaCl, 2% TritonX-100), and twice with TE. Elution buffer (50 mM Tris pH 8, 10 mM EDTA, 1% SDS) was added after the final wash step, and beads were incubated at 65 °C for 30 minutes to remove the crosslinked protein-DNA complexes from the beads. After centrifugation to remove the beads, the samples were incubated overnight at 65 °C to reverse the protein-DNA formaldehyde crosslinks. DNA was purified using Qiagen’s PCR Purification kit and eluted to a final volume of 50 μl with EB.
Cell pellets (from initial 50 ml of culture) were thawed and resuspended in 250ul of IP buffer (100 mM Tris pH 8, 300 mM NaCl, 2% TritonX-100) and sonicated using a microtip sonicator set at 10% output for 20 second intervals with periods of cooling in between. Cells were then treated for one hour at 4 °C with RNase A (2 ng/ml) micrococcal nuclease (50 units), 20 µM CaCl2,1.2 mM KCl, 0.3 mM NaCl, 6 mM sucrose, and 10 µM DTT. After treatment, a distribution of DNA fragments ranging from 200-600 bp was detected by agarose-gel electrophoretic separation of a small sample that was de-crosslinked by incubation at 65 °C for >4 hr. EDTA was added to 10 mM to stop the micrococcal nuclease and the samples were spun down to remove cell debris. The lysate was then incubated with a 50/50 slurry of Sepharose protein A beads and protein G beads in IP buffer for 2-3 hours at 4 °C. The beads were removed by centrifugation and antibody was added to the pre-cleared lysate for an overnight incubation. The next day, 30 µl of a 50/50 slurry of Sepharose protein A and G beads in IP buffer was added to the lysate to capture antibody-protein-DNA complex for one hour at 4 °C. Beads were then washed once with 1 ml of 250 mM LiCl wash buffer (100 mM Tris pH 8, 250 mM LiCl, 2% TritonX-100), twice with 600 mM NaCl wash buffer (100 mM Tris pH 8, 600 mM NaCl, 2%SDS), twice with 300 mM NaCl wash buffer (100 mM Tris pH 8, 300 mM NaCl, 2%SDS), and twice with TE. Elution buffer (50 mM Tris pH 8, 10 mM EDTA, 1% SDS) was added after the final wash step, and beads were incubated at 65 °C for 30 minutes toremove the crosslinked protein-DNA complexes from the beads. After centrifugation to remove the beads, the samples were incubated overnight at 65 °C to reverse the protein-DNA formaldehyde crosslinks. DNA was purified using Qiagen’s PCR Purification kit and eluted to a final volume of 50ul with EB.
Cell pellets (from initial 50 ml of culture) were thawed and resuspended in 250ul of IP buffer (100 mM Tris pH 8, 300 mM NaCl, 2% TritonX-100) and sonicated using a microtip sonicator set at 10% output for 20 second intervals with periods of cooling in between. Cells were then treated for one hour at 4 °C with RNase A (2 ng/ml) micrococcal nuclease (50 units), 20 μM CaCl2,1.2 mM KCl, 0.3 mM NaCl, 6 mM sucrose, and 10 μM DTT. After treatment, a distribution of DNA fragments ranging from 200-600 bp was detected by agarose-gel electrophoretic separation of a small sample that was de-crosslinked by incubation at 65 °C for >4 hr. EDTA was added to 10 mM to stop the micrococcal nuclease and the samples were spun down to remove cell debris. The lysate was then incubated with a 50/50 slurry of Sepharose protein A beads and protein G beads in IP buffer for 2-3 hours at 4 °C. The beads were removed by centrifugation and antibody was added to the pre-cleared lysate for an overnight incubation. The next day, 30 μl of a 50/50 slurry of Sepharose protein A and G beads in IP buffer was added to the lysate to capture antibody-protein-DNA complex for one hour at 4 °C. Beads were then washed once with 1 ml of 250 mM LiCl wash buffer (100 mM Tris pH 8, 250 mM LiCl, 2% TritonX-100), twice with 600 mM NaCl wash buffer (100 mM Tris pH 8, 600 mM NaCl, 2%SDS), twice with 300 mM NaCl wash buffer (100 mM Tris pH 8, 300 mM NaCl, 2%SDS), and twice with TE. Elution buffer (50 mM Tris pH 8, 10 mM EDTA, 1% SDS) was added after the final wash step, and beads were incubated at 65 °C for 30 minutes toremove the crosslinked protein-DNA complexes from the beads. After centrifugation to remove the beads, the samples were incubated overnight at 65 °C to reverse the protein-DNA formaldehyde crosslinks. DNA was purified using Qiagen’s PCR Purification kit and eluted to a final volume of 50ul with EB.
Cell pellets (from initial 50 ml of culture) were thawed and resuspended in 250ul of IP buffer (100 mM Tris pH 8, 300 mM NaCl, 2% TritonX-100) and sonicated using a microtip sonicator set at 10% output for 20 second intervals with periods of cooling in between. Cells were then treated for one hour at 4 °C with RNase A (2 ng/ml) micrococcal nuclease (50 units), 20 μM CaCl2,1.2 mM KCl, 0.3 mM NaCl, 6 mM sucrose, and 10 μM DTT. After treatment, a distribution of DNA fragments ranging from 200-600 bp was detected by agarose-gel electrophoretic separation of a small sample that was de-crosslinked by incubation at 65 °C for >4 hr. EDTA was added to 10 mM to stop the micrococcal nuclease and the samples were spun down to remove cell debris. The lysate was then incubated with a 50/50 slurry of Sepharose protein A beads and protein G beads in IP buffer for 2-3 hours at 4 °C. The beads were removed by centrifugation and no antibody was added to the pre-cleared lysate for an overnight incubation. The next day, 30 μl of a 50/50 slurry of Sepharose protein A and G beads in IP buffer was added to the lysate to capture antibody-protein-DNA complex for one hour at 4 °C. Beads were then washed once with 1 ml of 250 mM LiCl wash buffer (100 mM Tris pH 8, 250 mM LiCl, 2% TritonX-100), twice with 600 mM NaCl wash buffer (100 mM Tris pH 8, 600 mM NaCl, 2%SDS), twice with 300 mM NaCl wash buffer (100 mM Tris pH 8, 300 mM NaCl, 2%SDS), and twice with TE. Elution buffer (50 mM Tris pH 8, 10 mM EDTA, 1% SDS) was added after the final wash step, and beads were incubated at 65 °C for 30 minutes toremove the crosslinked protein-DNA complexes from the beads. After centrifugation to remove the beads, the samples were incubated overnight at 65 °C to reverse the protein-DNA formaldehyde crosslinks. DNA was purified using Qiagen’s PCR Purification kit and eluted to a final volume of 50ul with EB.
Cell pellets were lysed and RNA collected using Qiagen’s RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit.  RNA samples were then treated with DNase (New England Biolabs) for 30 min at 37 °C.
Cell pellets were lysed in Tissue and Cell lysis solution (EpiCentre) and proteinase K. RNA was isolated and DNase treated using the RNeasy Kit (Qiagen) using the manufacturer’s protocol. The amount of total RNA in each sample was quantified using the Qubit 2.0 Flurometer (Life Technologies) and quality was assessed using the RNA6000 Nano Chip on the Bioanalyzer 2100 (Agilent).
cells
Cells (10 ml) for transcriptomic analysis were collected into tubes containing 1.25 ml ice-cold 5% (vol/vol) unbuffered phenol in ethanol (EP) and pelleted by centrifugation (10,000 g, 4°C, 3 min). To remove residual traces of hydrolysate, cell pellets were twice resuspended in ice-cold GMM plus 0.125 volume of EP, repelleted, then flash frozen in dry ice-ethanol, and stored at -80°C.
cells 12 min after treatment by norfloxacin
cells 24 min after treatment by norfloxacin
cells 36 min after treatment by norfloxacin
cells 48 min after treatment by norfloxacin
cells 60 min after treatment by norfloxacin
Cells aerobically grown to mid-log phase in MOPS/0.5% glucose at 37C and ~250 RPM.
Cells at appropriate cell density were cross-linked by 1% formaldehyde at room temperature for 25 min. Following quenching the unused formaldehyde with a final concentration of 125 mM glycine at room temperature for 5 min. The cross-linked cells were harvested and washed three times with 50 mL of ice-cold TBS (Tris Buffered Saline). The washed cells were re-suspended in 0.5 mL lysis buffer composed of 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM EDTA, 1 ug/mL RNaseA, protease inhibitor cocktail (Sigma) and 1 kU Ready-LyseTM lysozyme (Epicentre). The cells were incubated at room temperature for 30 min and then treated with 0.5 mL of 2XIP buffer with the protease inhibitor cocktail. The lysate was then sonicated four times for 20 sec each in an ice bath to fragment the chromatin complexes using Misonix sonicator 3000 (output level = 2.5). The range of the DNA size resulting from the sonication procedure was 300 – 1000 bp. 6 uL of mouse antibody (NT63, Neoclone) was used to immunoprecipitate the chromatin complex of RNA polymerase subunit and DNA. For the control (mock-IP), 2 ug of normal mouse IgG (Upstate) was added into the cell extract. IP DNAs were purified with QIAquick PCR Purification Kit (Qiagen) then amplified PCR.
Cells at appropriate cell density were cross-linked by 1% formaldehyde at room temperature for 25 min. Following quenching the unused formaldehyde with a final concentration of 125 mM glycine at room temperature for 5 min. The cross-linked cells were harvested and washed three times with 50 mL of ice-cold TBS (Tris Buffered Saline). The washed cells were re-suspended in 0.5 mL lysis buffer composed of 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM EDTA, 1 ug/mL RNaseA, protease inhibitor cocktail (Sigma) and 1 kU Ready-LyseTM lysozyme (Epicentre). The cells were incubated at room temperature for 30 min and then treated with 0.5 mL of 2XIP buffer with the protease inhibitor cocktail. The lysate was then sonicated four times for 20 sec each in an ice bath to fragment the chromatin complexes using Misonix sonicator 3000 (output level = 2.5). The range of the DNA size resulting from the sonication procedure was 300 – 1000 bp. 6 uL of mouse antibody (NT63, Neoclone) was used to immunoprecipitate the chromatin complex of RNA polymerase subunit (rpoB) and DNA. For the control (mock-IP), 2 ug of normal mouse IgG (Upstate) was added into the cell extract. IP DNAs were purified with QIAquick PCR Purification Kit (Qiagen) then amplified PCR.
Cells at appropriate cell density were cross-linked by 1% formaldehyde at room temperature for 25 min. Following quenching the unused formaldehyde with a final concentration of 125 mM glycine at room temperature for 5 min. The cross-linked cells were harvested and washed three times with 50 mL of ice-cold TBS (Tris Buffered Saline). The washed cells were re-suspended in 0.5 mL lysis buffer composed of 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM EDTA, 1 ug/mL RNaseA, protease inhibitor cocktail (Sigma) and 1 kU Ready-LyseTM lysozyme (Epicentre). The cells were incubated at room temperature for 30 min and then treated with 0.5 mL of 2XIP buffer with the protease inhibitor cocktail. The lysate was then sonicated four times for 20 sec each in an ice bath to fragment the chromatin complexes using Misonix sonicator 3000 (output level = 2.5). The range of the DNA size resulting from the sonication procedure was 300 - 1000 bp. For the control (mock-IP), 2 ug of normal mouse IgG was added into the cell extract. IP DNAs were purified with QIAquick PCR Purification Kit (Qiagen) then amplified PCR.
Cells at mid-log phase (OD600nm 0.5) in M9 glucose (0.2%) media, with 42oC heatshock for 10 min.
Cells at mid-log phase (OD600nm 0.5) in W2 media supplemented with 0.2% glucose and 0.2% glutamine
Cells at stationary phase (OD600nm 1.5) in M9 glucose media
Cells corresponding to 10 ml culture volume were harvested at 0 hrs using centrifugation. The cell pellet was immediately resuspended in RNAlater (Ambion, Austin, TX, USA) and stored at -20°C until further processing. Prior to RNA extraction using MasterPure RNA purification kit (Epicentre, Madison, WI, USA) the pellet was washed in cold phosphate-buffered saline to remove RNAlater.
Cells corresponding to 10 ml culture volume were harvested at 1.5 hrs after induction with 0.1 mM IPTG using centrifugation. The cell pellet was immediately resuspended in RNAlater (Ambion, Austin, TX, USA) and stored at -20°C until further processing. Prior to RNA extraction using MasterPure RNA purification kit (Epicentre, Madison, WI, USA) the pellet was washed in cold phosphate-buffered saline to remove RNAlater.
Cells corresponding to 10 ml culture volume were harvested at 1.5 hrs after induction with 0 mM IPTG using centrifugation. The cell pellet was immediately resuspended in RNAlater (Ambion, Austin, TX, USA) and stored at -20°C until further processing. Prior to RNA extraction using MasterPure RNA purification kit (Epicentre, Madison, WI, USA) the pellet was washed in cold phosphate-buffered saline to remove RNAlater.
Cells corresponding to 10 ml culture volume were harvested at 1.5 hrs after induction with 1.0 mM IPTG using centrifugation. The cell pellet was immediately resuspended in RNAlater (Ambion, Austin, TX, USA) and stored at -20°C until further processing. Prior to RNA extraction using MasterPure RNA purification kit (Epicentre, Madison, WI, USA) the pellet was washed in cold phosphate-buffered saline to remove RNAlater.
Cells corresponding to 10 ml culture volume were harvested at 3.5 hrs after induction with 0.1 mM IPTG using centrifugation. The cell pellet was immediately resuspended in RNAlater (Ambion, Austin, TX, USA) and stored at -20°C until further processing. Prior to RNA extraction using MasterPure RNA purification kit (Epicentre, Madison, WI, USA) the pellet was washed in cold phosphate-buffered saline to remove RNAlater.
Cells corresponding to 10 ml culture volume were harvested at 3.5 hrs after induction with 0 mM IPTG using centrifugation. The cell pellet was immediately resuspended in RNAlater (Ambion, Austin, TX, USA) and stored at -20°C until further processing. Prior to RNA extraction using MasterPure RNA purification kit (Epicentre, Madison, WI, USA) the pellet was washed in cold phosphate-buffered saline to remove RNAlater.
Cells corresponding to 10 ml culture volume were harvested at 3.5 hrs after induction with 1.0 mM IPTG using centrifugation. The cell pellet was immediately resuspended in RNAlater (Ambion, Austin, TX, USA) and stored at -20°C until further processing. Prior to RNA extraction using MasterPure RNA purification kit (Epicentre, Madison, WI, USA) the pellet was washed in cold phosphate-buffered saline to remove RNAlater.
Cells for inoculation were from overnight planktonic culture in 10% Luria-Bertani broth at 30 degree Celsius. Cells were washed in equal volume of fresh 10% LB broth before inoculated into 30 ml 10% LB in a flask. 300 ul E. coli culture was inoculated for mono-species pure culture. 150 ul E. coli and 60 ul S. maltophilia were mixed and inoculated for mixed-species cultures. Flasks were set on a shaker (250 rpm) at room temperature (20 C) for 18 h.
Cells for inoculation were from overnight planktonic culture in 10% Luria-Bertani broth at 30 degree Celsius. Cells were washed in equal volume of fresh 10% LB broth before inoculation and were inoculated into 5 ml 10% LB in a disposable petri dish (60 mm x 15 mm). 50 ul E. coli culture was inoculated for mono-species pure culture. 50 ul E. coli and 10 ul S. maltophilia were mixed and inoculated for mixed-species culture. Petri dishes were set static at room temperature (20 C) for 18 h for biofilm growth.
Cells for inoculation were from overnight planktonic culture in 10% Luria-Bertani broth at 30 degree Celsius. Cells were washed in equal volume of fresh 10% LB broth before inoculation. Planktonic cultures were conducted in flasks with 30 ml 10% LB, inoculated with 300 ul E. coli overnight culture. Flasks were set on a shaker (250 rpm) at room temperature (20 C) for 18 h. Biofilms were cultivated in static disposable petri dishes (60 mm x 15 mm) with 5 ml 10% LB, inoculated with 50 ul E. coli overnight culture. The petri dishes were set static at room temperature (20 C) for 18 h.
Cells from each strain were rapidly harvested by filtration and lysate was produced by pulverization of liquid nitrogen cooled samples.
Cells from single colonies were grown on LB agar and then inoculated into liquid LB and grown to saturation. Then 50 µl was inoculated into 5 ml of K-medium and grown to saturation again. The cultures were then inoculated into the separate media as follows: 25 μl into K-medium, 50 µl into K-medium + 0.3M NaCl, 75 µl into K-medium + 0.6M urea; the final volume was 5ml in all cases. These cultures were grown overnight. The cultures were incubated in 250 ml Erlenmeyer flasks in the three media in a water bath at 30ºC.
Cells grew in MOPS minimal medium with 0.4% glucose and 0.2 mM K2HPO4 and harvested at the OD600 value of 1.0.
Cells grown aerobically to exponential phase (OD600 = 0.8) in LB media at 37C were harvested.
Cells harvested at mid-exponential phase, spun, washed twice with M9 medium and shifted to limiting or no thymine medium. Samples taken at listed intervals.
Cells harvested at OD450 = 0.3
Cells in log phase under ethanol stress
Cells in log phase under furfural stress
Cells in RNAlater were aliquoted into two. One served as non-sorted cells and kept at 4 degree C. The other aliquot was homogenized with OMNI TH homogenizer for 2 min on ice and further aliquoted into small vials. Cells in each vial were then re-suspended in nuclease-free phosphate buffered saline, incubated with anti-E. coli antibody and microbeads, followed by separation on a MACS separator (Miltenyi, Auburn, CA) at 4 degree C. Sorted cells were re-suspended into RNAlater.
Cells of each evolved colony type were collected by centrifugation at 13,000 × g for 1 min at 4°C and were immediately used for total RNA isolation with NucleoSpin RNA II isolation kit (Macherey – Nagel, Biokè, Leiden, the Netherlands).
cells prior to treatment by norfloxacin
Cells treated during mid-exponential growth phase
Cells treated with bacterial protect reagent and freeze at -70 C
Cells used for expression analysis were grown in minimal medium (Glansdorff, 1965) supplemented with 0.5% glucose (w/v), L-methionine (100mg ml-1) and with L-arginine (100ug ml-1). For expression analysis, cells were grown in a rotary shaker at 37°C and harvested by centrifugation at mid-log phase ( (OD) 660nm = 0.5) and the metabolism was quenched in liquid nitrogen.
Cells used for expression analysis were grown in minimal medium (Glansdorff, 1965) supplemented with 0.5% glucose (w/v), L-methionine (100ug ml-1) and with L-arginine (100ug ml-1). For expression analysis, cells were grown in a rotary shaker at 37°C and harvested by centrifugation at mid-log phase ( (OD) 660nm = 0.5) and the metabolism was quenched in liquid nitrogen.
Cells used for expression analysis were grown in minimal medium (Glansdorff, 1965) supplemented with 0.5% glucose (w/v), L-methionine (100ug ml-1). For expression analysis, cells were grown in a rotary shaker at 37°C and harvested by centrifugation at mid-log phase ( (OD) 660nm = 0.5) and the metabolism was quenched in liquid nitrogen.
Cell suspension was ammended with 1.25 M sucrose to an osmotic pressure of 2.7 Os kg-1 for 10 minutes. The biomass was centrifuged at 4000 rpm and the pellet treated with RNAProtect (Qiagen) following the manufacturer's protocol.
Cell suspension was ammended with 1.37 M NaCl to obtain an osmotic pressure of 2.7 Os kg-1 for 10 minutes. The biomass was centrifuged at 4000 rpm and the pellet treated with RNAProtect (Qiagen) following the manufacturer's protocol.
Cells were centrifuged and the cell pellets were stored in RNA Later solution at -80ºC. The RNeasy Mini Kit (Qiagen, Venlo, Netherlands) was used to isolate total RNA. The samples were then incubated at 37ºC with RNaseOut (New England Biolabs) and DNaseI (New England Biolabs) according to the manufacture’s protocol for 1 hour. The samples were mixed with saturated phenol/chloroform (pH=4.5) (Life Technologies) and precipitated with ethanol and 30 µL, 3 M sodium acetate (pH=5.5) (Fisher Scientific), overnight at -80ºC. After precipitation, the tubes were centrifuged and the RNA pellet was washed twice with 70 % ethanol and dried under vacuum.
Cells were collected as a function of time after rifampicin treatment at the specified times. RNA was extracted using the RNAsnap protocol.
Cells were collected by centrifugation and washed three times in ice-cold 1X PBS. The pellet was then re-suspended in 250 μl ChIP buffer (200 mM Tris-HCl (pH 8.0), 600 mM NaCl 4% Triton X, Complete protease inhibitor cocktail EDTA-free (Roche)). Sonication of crosslinked samples was performed using the Diagenode Bioruptor® at 30s intervals for 10 min at high amplitude. After sonication, 350 μl of ChIP buffer was added to each sample, the samples were mixed by gentle pipetting and 100 μl of each lysate was removed and stored as ‘input’. Immunoprecipitation was performed overnight at 4°C using 1/100 anti-RecA antibody (Abcam, ab63797). IP samples were then incubated with Protein G Dynabeads® (Life Technologies) for 2 h at room temperature. All samples were washed 3 times with 1 X PBS + 0.02% Tween-20 before re-suspending the Protein G dynabeads in 200 μl of TE buffer (10 mM Tris (pH 7.4), 1 mM EDTA) + 1% SDS. 100 μl of TE buffer was added to the input samples and all samples were then incubated at 65°C for 10 h to reverse formaldehyde crosslinks. DNA was isolated using the MinElute PCR purification kit (Qiagen). DNA was eluted in 50 μl of TE buffer using a 2-step elution. Samples were stored at -20°C.
Cells were cross-linked by the addition of formaldehyde at 1% final concentration with continued shaking at 37 °C for 5 min before quenching with glycine (100 mM final).
Cells were crosslinked in 1% formadehyde for 25 min at room temperature followed by 5 minutes of quenching with glycine. Cells were washed 3X with ice cold TBS. Cell pellets were stored at -80 C.
Cells were cultured in LB medium containing ampicillin at 28˚C. The overnight cell culture was inoculated into the fresh  medium at 1/70 (v/v) and was incubated for  2 hr at 28˚C (OD600 reached  0.35) and then for 2 hr at 42˚C (OD600 reached 2.3) to induce the PR promoter.
Cells were disrupted by sonication and NsrR bound DNA was isolated with anti-Flag antibody.
Cells were enyzmatically lysed in the presence of protease inhibitors prior to fragmentation using sonication. Protein/DNA complexes were recovered using an appropriate mouse monoclonal antibody followed by recovery using Pan Mouse IgG Dynabeads. While complexed on the magnetic bead, a series of enzymatic reactions were performed to 1) end repair, fragmented DNA, 2) ligate sequencing adpator 2, 3) nick repair, 4) lambda exonuclease treatment, 5) RecJ nuclease treatment. This was based on the method developed by Rhee et al. (doi:10.1016/j.cell.2011.11.013). IP DNA was then rleased from the complex and recovered.
Cells were fixed in 1% formaldehyde at room temperature for 20 min, quenched with glycine, and lysed. Chromatin was pelleted and solublized by sonication.
Cells were fixed in 1% formaldehyde at room temperature for 20 min, quenched with glycine, and lysed. Chromatin was pelleted and solublized by sonication. Crosslinked chromatin was then immunoprecipitated.
Cells were fixed in the required growth phase in formaldehyde, quenched, washed and lysed. Fragmented DNA - protein complex were pulled using the monoclonal flag tag antibody. The complex was then washed, reverse cross-linked and obtained DNA purified using Qiagen min elute PCR purification kit.
Cells were fixed with 1% formaldehyde for 5min before quenching with ice-cold glycine (100mM). Cells were harvested, washed with ice-cold PBS and flash-frozen in liquid nitrogen. Cell pellets were resuspended in 500 ml of IP buffer (100 mM Tris pH 8, 300mM NaCl, 2% TritonX-100) and sonicated using a Misonix sonicator (S-4000) with a cup horn (431C) set at 60% output, 10 sec ON and 10 sec OFF, for a total sonication time of 16 min. Cells were then treated for one hour at 4 °C with RNase A (2 ng/ml; USB, Inc.) and the samples were centrifuged at 20,000 x g for 10 min at 4 °C to remove cell debris. The lysate was then incubated with a 50/50 slurry of Sepharose protein A beads (Upstate; now Millipore) and protein G beads (GE Healthcare) in IP buffer for 3 hours at 4 °C. The beads were removed by centrifugation (1000 x g for 2 min at 4 °C) and antibodies were added to the pre-cleared lysate for an overnight incubation. For ChIP, we used anti-RNAP b subunit NT63 monoclonal antibodies (Neoclone W0002), anti-RNAP s70 subunit monoclonal antibodies (Neoclone W0004), or anti-DksA rabbit polyclonal antisera (a kind gift from Diana Downs). The next day, 30 μl of a 50/50 slurry of Sepharose protein A and G beads in 250 μl IP buffer was added to the lysate to capture antibody-protein-DNA complex for one hour at 4 °C. Beads were then washed once with 1 ml of 250 mM LiCl wash buffer (100 mM Tris pH 8, 250 mM LiCl, 2% Triton X-100), twice with 1 ml 600 mM NaCl wash buffer (100 mM Tris pH 8, 600 mM NaCl, 2% SDS), twice with 1 ml 300 mM NaCl wash buffer (100 mM Tris pH 8, 300 mM NaCl, 2% SDS), and twice with 1 ml TE (10 mM Tris pH 8, 1 mM EDTA). Elution buffer (50 mM Tris pH 8, 10 mM EDTA, 1% SDS) was added after the final wash step, and beads were incubated at 65 °C for 30 minutes to remove the crosslinked protein-DNA complexes from the beads. After centrifugation (1000 x g for 2 min at 25 °C) to remove the beads, the samples were incubated overnight at 65 °C to reverse the protein-DNA formaldehyde crosslinks. DNA was purified using Qiagen’s PCR Purification kit and eluted in a final volume of 65 μl with 10 mM Tris pH 8.
Cells were flash frozen in liquid nitrogen after the media was rapidly filtered. Frozen cells were pulverized by mixer milling and thawed in 20 mM EDC, pH 5.8. The crosslinking reaction was quenched with 250 mM glycine, 100 mM Tris Cl 8.0, and 4 mM NaHCO3.
Cells were flash frozen in liquid nitrogen after the media was rapidly filtered. Frozen cells were pulverized by mixer milling and thawed in 2.5 mM DSP. The crosslinking reaction was quenched with 100 mM Tris Cl 8.3.
Cells were grown aerobically (25% O2, 70% N2 and 5% CO2) until mid-log phase (OD600 of 0.35) and treated with 1% final volumen formaldehyde for ten minutes. Sodium phosphate (1/100 vol. of 1M, pH 7.6; 10 mM final) was added to the mid-log cultures followed by formaldehyde to 1% final, and anaerobic sparging was continued for 10 min. Cold 2.5 M glycine was added to 100mM and the mixture was incubated at 4 °C with anaerobic sparging for 30 minutes to stop the crosslinking. Cells were spun at 5000 x g, and washed repeatedly with phosphate buffered saline before being frozen at -80 °C.
Cells were grown aerobically (70% N2, 25% O2, and 5% CO2) or anaerobically (95% N2 and 5% CO2) until mid-log phase (OD600 of ~0.3-0.35).
Cells were grown aerobically (70% N2, 25% O2, and 5% CO2) or anaerobically (95% N2 and 5% CO2) until mid-log phase (OD600 of ~0.3-0.35) in MOPS minimal glucose media containing 10 µM FeSO4.
Cells were grown aerobically in 50 ml LB medium until OD600 reached ~1 (late log phase).
Cells were grown anaerobically (95% N2 and 5% CO2) until mid-log phase (OD600 of 0.3) and treated with 1% final volumen formaldehyde for ten minutes. Sodium phosphate (1/100 vol. of 1M, pH 7.6; 10 mM final) was added to the mid-log cultures followed by formaldehyde to 1% final, and anaerobic sparging was continued for 10 min. Cold 2.5 M glycine was added to 100mM and the mixture was incubated at 4 °C with anaerobic sparging for 30 minutes to stop the crosslinking. Cells were spun at 5000 x g, and washed repeatedly with phosphate buffered saline before being frozen at -80 °C.
Cells were grown at 30°C in LB medium to an OD600 of 0.55-0.6
Cells were grown at 30 °C to an OD450 of about 0.07 in AB glucose CAA medium, shifted to 39 °C for 70min and back to 30°C for 0min before crosslinking.
Cells were grown at 30 °C to an OD450 of about 0.07 in AB glucose CAA medium, shifted to 39 °C for 70min and back to 30°C for 15min before crosslinking.
Cells were grown at 30 °C to an OD450 of about 0.07 in AB glucose CAA medium, shifted to 39 °C for 70min and back to 30°C for 16min before crosslinking.
Cells were grown at 30 °C to an OD450 of about 0.07 in AB glucose CAA medium, shifted to 39 °C for 70min and back to 30°C for 17min before crosslinking.
Cells were grown at 30 °C to an OD450 of about 0.07 in AB glucose CAA medium, shifted to 39 °C for 70min and back to 30°C for 35min before crosslinking.
Cells were grown at 30 °C to an OD450 of about 0.07 in AB glucose CAA medium, shifted to 39 °C for 70min and back to 30°C for 50min before crosslinking.
Cells were grown at 30 °C to an OD450 of about 0.07 in AB glucose CAA medium, shifted to 39 °C for 70min and back to 30°C for 5min before crosslinking.
Cells were grown at 37°C, 200 rpm in M9 glucose, for 16 hours (stationary phase).
Cells were grown at 37°C in Luria-Bertani (LB) medium containing 50 μg/ml ampicillin overnight, then diluted at a ratio of 1:100 into LB medium containing 1.5% (v/v) ethanol and 50 μg/ml ampicillin, and grown at 37°C.
Cells were grown at 37°C in Luria-Bertani (LB) medium supplemented with 50 μg/ml ampicillin overnight, then inoculated into LB medium supplemented with 0.095% (v/v) furfural and 50 μg/ml ampicillin at an initial OD600 value of 0.02, and grown at 37°C.
Cells were grown at 37°C in M4 minimal medium under oxic and anoxic conditions. The minimal medium (1.27 mM K2HPO4, 0.73 mM KH2PO4, 5 mM sodium HEPES, 150 mM NaCl, 9 mM (NH4)2SO4) was supplemented with 0.1 g/l caseinhydrolysate 1 mM MgSO4, 0.1 mM CaCl2 and trace elements (5 μM CoCl2, 0.2 μM CuSO4, 57 μM H3BO3, 5.4 μM FeCl2, 1.3 μM MnSO4, 67.2 μM Na2EDTA, 3.9 μM Na2MoO4, 1.5 μM Na2SeO4, 5 μM NiCl2, and 1 μM ZnSO4). The pH of the media was adjusted to 7.2. Glycerol (50 mM) or glycerol (50mM) plus propionate (10 mM) served as the carbon and electron sources, respectively. Potassium nitrate (50 mM) was the electron acceptor under anoxic conditions.
Cells were grown at 37 °C to an OD450 of about 0.15 in 100 ml AB acetate medium before crosslinking.
Cells were grown at 37 °C to an OD600 of about 0.15 in 100 ml LB (+ 0.2% glucose).
Cells were grown at 37 °C to an OD600 of about 0.15 in 50 ml LB (+ 0.2% glucose) before crosslinking.
Cells were grown at 37oC without shaking in 18 mm test tubes containing 5 ml of the MOPS-based culture medium designed by Neidhardt. Mouse cecal mucus was prepared from streptomycin-treated CD-1 mice (not colonized with E. coli). Cultures were grown to A600 = 0.4 in MOPS medium containing glucose or mannose (0.2%) and also in 10 mg/ml of lyophilized mucus at A600=0.2 (P1) or 0.5 (P2).
Cells were grown in 65 ml LB medium at 30 °C to an OD600 of about 0.3. Subsequently 30 ml of culture were transformed to a pre warmed flask at 43 °C and the remainder kept at 30 °C (see control sample).
Cells were grown in 65 ml LB medium at 30 °C to an OD600 of about 0.3. Subsequently 30 ml of culture were transformed to a pre warmed flask at 43 °C (see heat sample) and the remainder kept at 30 °C.
Cells were grown in a 250 ml fermenter containing 100 ml LB medium supplemented  with 3 g/L glucose, 0.1 mM IPTG, and 50 μg/mL antibiotics. The fermentors were operated at 37 °C and 250 rpm with  aeration (200 mL/min). Flow rate was 1.162ml/min(dilution rate 0,7/h). The pellets were used for RNA.
Cells were grown in  anaerobic incubator for 1h at 37℃ and drugs were added according to the different concentrations. The cultures were incubated for 30min.
Cells were grown in LB at 22°C or 37°C, as indicated.
Cells were grown in LB at 37 degrees celsius with shaking for 150 minutes
Cells were grown in LB at 37 degrees celsius with shaking for 240 minutes
Cells were grown in LB at 37 degrees celsius with shaking for 360 minutes
Cells were grown in LB at 37 degrees celsius with shaking for 90 minutes
Cells were grown in LB media supplemented with 0.2% arabinose at 37°C to and OD600nm of 0.2-0.25
Cells were grown in LB media with 1mM IPTG at 37 °C with shaking for 2 hours
cells were grown in LB overnight at 37 degrees celcius.
Cells were grown in Luria Bertani (LB) media at 37C at 200 rpm. Overnight cultures were inoculated with single, independent colonies in triplicate, incubated aerobically overnight at 37oC, and sub-cultured to a starting OD600 of 0.0001. Cultures were harvested at OD600 = 0.3 in exponential phase and at OD600 = 1.5 in stationary phase.
Cells were grown in M63 glucose (0.2%) minimal media at 37oC at 200 rpm. Overnight cultures were inoculated with single, independent colonies in triplicate, incubated aerobically overnight at 37oC, and sub-cultured to a starting OD600 of 0.0001. Cultures were harvested at an OD600 = 0.3 after being maintained in exponential phase for at least eight generations.
Cells were grown in M63 glucose (0.2%) minimal media at 37oC at 200 rpm. Overnight cultures were inoculated with single, independent colonies in triplicate, incubated aerobically overnight at 37oC, and sub-cultured to a starting OD600 of 0.0001. Cultures were harvested at an OD600 = 1.5.
cells were grown in M9 glucose (0.4% w/v)
Cells were grown in M9 medium supplemented with 0.2% glucose and 0.4% casamino acid at 37℃
Cells were grown in M9 minimal media supplemented with 0.2% casamino acids, 0.5% glucose 5μM CaCl2 and 1mM MgSO4 at 37°C to and OD600nm of 0.2-0.25
Cells were grown in MOPS minimal medium with 0.2% glucose at 37 degrees C in gas-sparged Roux bottles to mid-log phase.
Cells were grown in MOPS minimal medium with 0.2% glucose at 37 oC  in gas-sparged Roux bottles or shaking flasks to mid-log phase (OD600 ~ 0.3-0.4).
Cells were grown in shake flasks to mid-exponential phase under either aerobic or anaerobic conditions depending on the sample. M9 minimal media supplement with either glucose, fructose, or glycerol as the sole carbon source was used depending on the sample.
Cells were grown in TB7 supplemented with 22 mM glucose until OD600 ~1.8.
Cells were grown in the absence and presence of 0.005 mg/mL 5-azacytidine to logarithmic phase (2 hours, A600=~0.45) or early stationary phase (8 hours, A600=~2.7)
Cells were grown in the minimal media, M63. The final cell concentrations were controlled ~ 10^8 cells/mL within the exponential growth phase.
Cells were grown in the minimal media, M63. The final cell concentrations were controlled ~ 108 cells/mL within the exponential growth phase.
Cells were grown in the minimal media, modified M63. The final cell concentrations were controlled ~ 10^8 cells/mL within the exponential growth phase.
Cells were grown to an OD_600 of 0.4 in Luria Broth Lennox
Cells were grown to an OD of 0.4 and then 0.5 mM IPTG was added to induce the protein expression
Cells were grown to approximately mid-log phase (OD560 = approximately 0.5) in LB.
Cells were grown to exponential phase in Lysogeny broth, 37oC with shaking
Cells were grown to the stationary phase at 37ºC in Luria-Bertani medium.
Cells were grown with 16 µM IPTG and 300 µL Cm20 anaerobically (95% N2 and 5% CO2) until mid-log phase (OD600 of 0.3) and treated with 1% final volumen formaldehyde for ten minutes. Sodium phosphate (1/100 vol. of 1M, pH 7.6; 10 mM final) was added to the mid-log cultures followed by formaldehyde to 1% final, and anaerobic sparging was continued for 10 min. Cold 2.5 M glycine was added to 100mM and the mixture was incubated at 4 °C with anaerobic sparging for 30 minutes to stop the crosslinking. Cells were spun at 5000 x g, and washed repeatedly with phosphate buffered saline before being frozen at -80 °C.
Cells were grown with 4 µM IPTG and 300 µL Cm20 anaerobically (95% N2 and 5% CO2) until mid-log phase (OD600 of 0.3) and treated with 1% final volumen formaldehyde for ten minutes. Sodium phosphate (1/100 vol. of 1M, pH 7.6; 10 mM final) was added to the mid-log cultures followed by formaldehyde to 1% final, and anaerobic sparging was continued for 10 min. Cold 2.5 M glycine was added to 100mM and the mixture was incubated at 4 °C with anaerobic sparging for 30 minutes to stop the crosslinking. Cells were spun at 5000 x g, and washed repeatedly with phosphate buffered saline before being frozen at -80 °C.
Cells were grown with 8 µM IPTG and 300 µL Cm20 anaerobically (95% N2 and 5% CO2) until mid-log phase (OD600 of 0.3) and treated with 1% final volumen formaldehyde for ten minutes. Sodium phosphate (1/100 vol. of 1M, pH 7.6; 10 mM final) was added to the mid-log cultures followed by formaldehyde to 1% final, and anaerobic sparging was continued for 10 min. Cold 2.5 M glycine was added to 100mM and the mixture was incubated at 4 °C with anaerobic sparging for 30 minutes to stop the crosslinking. Cells were spun at 5000 x g, and washed repeatedly with phosphate buffered saline before being frozen at -80 °C.
Cells were grown with vigorous shaking at 37 °C to mid-log (light scattering at 600 nm equivalent to 0.4 OD). Sodium phosphate (1/100 vol. of 1M, pH 7.6; 10 mM final) was added to the mid-log cultures followed by formaldehyde to 1% final, and shaking was continued for 5 min. Cold 2.5 M glycine was added to 100mM and the mixture was incubated at 4 °C with agitation for 30 minutes to stop the crosslinking. Cells were spun at 5000 x g, and washed repeatedly with phosphate buffered saline before being frozen at -80 °C.
Cells were harvested after the addition of rifampicin  (250 μg/ml) to stop nascent transcription and quenched with stop solution (10% phenol in ethanol). The first timepoint was taken 3.5 minutes after addition of the antibiotic to give time for the diffusion of rifampicin into the cells and binding of the antibiotic to RNA polymerase. This sample was called 0 minutes, and further samples were taken at 2.5, 5, 7.5, 10, and 20 minutes from wild-type E. coli and the RNase III mutant. A partial biological replicate of wild-type was taken (0, 2.5, and 7.5 minutes), to examine the reproducibility between samples.
Cells were harvested and resuspended in RNAlater and kept in 4C fridge overnight. Cells were aliquoted into vials containing around 2x10^8 cells. Cells in each vial were then re-suspended in nuclease-free phosphate buffered saline, incubated with anti-E. coli antibody (ViroStat) and microbeads (Miltenyi), followed by separation on a MACS separator (Miltenyi, Auburn, CA) at 4 degree C. Sorted cells were re-suspended into RNAlater until RNA extraction.
Cells were harvested by centrifugation at 5,000 g for 5 min.  Total RNA was purified using the RNeasy Mini kit (Qiagen) according to the supplier’s protocol (the composition of the RNeasy solutions are unknown).  The supernatant was decanted and 200 μl of TE buffer (10 mM Tris, 1 mM EDTA in DEPC-treated water, pH 8) plus lysosyme (Sigma) was used to resuspend the pellet.  This was mixed vigorously and incubated with intermittent shaking for 5 min at room temperature.  Buffer RLT (700 μl) with β-mercaptoethanol (10 μl of 14.3 M β-mercaptoethanol per 1 ml RTL) was then added to the solution.  The lysate was then mixed with 500 μl of absolute ethanol before applying the solution to an RNeasy Mini column.  This was then centrifuged for 15 s at 8,000 x g.  Buffer RW1 (700 μl) was applied to the column and centrifuged to wash the RNA.  At this point an RNase-free DNase on-column digest (Qiagen) was carried out, before the wash process was repeated twice with 500 μl of RPE buffer.  The RNA was eluted twice in one 30 μl volume of RNase-free water and stored at -70 oC.
Cells were harvested directly into phenol:ethanol to stabilize RNA and total RNA was purified using Qiagen’s RNeasy Mini Kit, according to the manufacturer's instructions.
Cells were harvested from aerobic and anaerobic cultures of seven E. coli strains grown to an OD600 of 0.6 (exponential phase). Cultures were divided into 10 ml aliquots and were immediately mixed with 0.2 volumes of ice-cold STOP solution (95% ethanol, 5% phenol (pH 4.7)). After 20 min incubation on ice, samples were spun down for 10 min at 4˚C and 7000 x g in a centrifuge. Pellets from one aliquot were gently resuspended in RNAProtect (QIAGEN, Germany) to further stabilize the RNA. Remaining samples were mixed with RNAlater (QIAGEN, Germany) and placed at -80˚C for archival storage. Total RNA was extracted using RNeasy Mini kit (QIAGEN, Germany) and on column DNase treatment following the manufacturers’ instructions. The 23S and 16S rRNAs were removed by subtractive hybridization using the MICROBExpress kit (Ambion, USA) with modifications. Compared with the standard protocol, 50% more capture oligonucleotides and magnetic beads were used. 5S rRNAs (120 nt in length) were removed during the total RNA extraction on column. Specifically, ribosomal depletion on total RNA isolated from the E. coli BL21 (DE3) was performed using RiboZero (Gram Negative Bacteria) kit (Epicenter, USA). RNA samples were stored at -80°C.
Cells were harvested on days 1 and 3 of glucose starvation, with samples taken from the
Cells were harvested using RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) for stabilization of RNA. Stabilized cultures were used for RNA isolation using the RNeasy MiniKit system (Qiagen, Hilden, Germany). In brief, 1 ml of each culture was used and processed according to the manufacturer's instructions including an on-column DNaseI treatment. RNA quality was assayed by denaturing urea-PAGE and by measuring the ratio of absorption at 260/280 nm in a GeneQuant II spectrophotometer (Amersham). RNA concentration was determined by measuring UV light absorption at 260 nm.
Cells were incubated at 37C prior to extraction
Cells were induced with arabinose or heat shocked, then harvested and flash frozen.
Cells were inoculated from frozen cultures into 5 mL of LB, and grown.  5 µL of this overnight culture was diluted into 5 mL of LB with the appropriate concentration of arabinose, and grown for 20h.
Cells were inoculated from overnight culture in rich Lysogeny broth at 37 degrees in aerobic conditions.
Cells were inoculated from overnight grown culture in Lysogeny Broth (LB) and then harvested in the early exponential growth phase and mid exponential growth phase.
Cells were lysed in liquid nitrogen, then samples were taken for ribosome footprint extraction.
Cells were lysed in liquid nitrogen, then samples were taken for total RNA.
Cells were lysed using a bead beater (Biospec) and mRNA was isolated using a Qiagen RNeasy mini kit (Cat# 74104).
Cells were pelleted and RNA was purified using a commercially available RNA extraction kit (Qiagen).  RNA preparations were then subjected to a DNase treatment to eliminate DNA contamination from the sample (Qiagen).  A treatment was also included to deplete ribosomal RNA using a commercially available kit (MicrobExpress, Ambion).  The two biological replicates for each growth condition were pooled for sequencing.
Cells were pelleted in the presence of RNALater (Applied Biosystems) and flash frozen in ethanol-dry ice.
Cells were resuspended in Lysis buffer (10mM tris, 20% sucrose, 50mM NaCl, 10mM EDTA, 10mg/ml lysosyme, 0.1mg/ml EDTA, 0.1mg/ml RNaseA) and subsequently incubated for 30min at 37C. Next, IP buffer was added (50mM Hepes, 150mM NaCl, 1mM EDTA, 1%triton, 0.1% sodium deoxycholate, 0.1% SDS). Cells have been sonicated, centrifugated, and the supernatent was used for the immunoprecipitation.
Cells were subcultured from overnight cultures into 20 ml of LB media
Cells were then lysed with 0.2 µM of lysozyme in TE (10 mM Tris-Cl, 1 mM EDTA, pH 8.0) for 5 min at room temperature, and total RNA was extracted using the RNeasy Mini Kit (Qiagen). DNA contamination was eliminated by treatment with TURBO DNase (Thermo Fisher). Depletion of ribosomal RNA was accomplished with the Ribominus Transcriptome Isolation Kit (Thermo Fisher) followed by ethanol precipitation.
Cells were then placed on ice and RNAprotect™ bacteria reagent (Qiagen) was added to stabilize the RNA. Total RNAs of cells were purified by RNeasy mini kit (Qiagen). Isolated RNA (10 ug) was used for random primer cDNA synthesis using SuperScript II reverse transcriptase, 18064–071 (Invitrogen). The reaction mixture was then subsequently treated with 1 N NaOH to degrade any remaining RNA and treated with 1 N HCl to neutralize the NaOH. Synthesized cDNA was then purified using MiniElute PCR purification columns, 28004 (Qiagen). Purified cDNA (3 ug) was fragmented to between 50 and 200 bps by 0.6 U/ g of DNase I, 27–0514-01 (Amersham Biosciences) for 10 min at 37 °C in 1  One-Phor-All buffer, 27–0901-02 (Amersham Biosciences). Heat inactivation of the DNase I enzyme was performed at 98 °C for 10 min.
Cells were transferred to the fresh minimal media, mM63, in the presence or absence of histidine. The initial cell concentrations were controlled as 104-105 cells/mL, and the final ones ~ 108 cells/mL within the exponential growth phase.
Cells were treated with a stop solution of phenol and ethanol (Khodursky et al, Methods in Molecular Biology 2003), spun down, and flash frozen and stored at -80°C.
Cells were treated with a stop solution of Phenol and Ethanol, spun down and flash frozen and stored at -80°C (ref). Total RNA was extracted using a hot phenol method (ref). RNA quality was determined by analysis with an Agilent 2100 bioanalyzer and quantity was determined using a NanoDrop. To enrich for mRNA, the 23S and 16S rRNA were removed using the Ambion MICROBExpress kit (Ambion) following manufacturer’s guidelines, except the total RNA was incubated with the rRNA oligonucleotides for one hour instead of 15 minutes.
Cells were treated with rifampicin before sample collection. In some cases, kasugamycin was added 15 minutes before the rifampicin addition.
cell type: Ancestral I- cells
cell type: Ancestral L- cells
cell type: bacterial cells
cell type: bacterial liquid culture
cell type: biofilm
cell type: Escherichia coli str. K-12 substr. MG1655
cell type: Evolved I- cells
cell type: Evolved L- cells
cell type: Original prototroph DH1 cells
cell type: Persister cells
cell type: Planktonic cells harvested at a turbidity of 0.5 at 600 nm, adjusted to the turbidity at 1, and then exposed to 20 μg/mL ampicillin for 1 h.
Cell were grown in 3-liter stirred tank bioreactor anaerobically. The growth medium contained Na2H2PO4 (1.1 g/l), K2HPO4 (2.5 g/l), (NH4)2SO4 (9.0 g/l), Glucose (15.0 g/l), CaCl2 (2.2 mg/l), MgSO4 (0.55 g/l), NaH2-Citrate (234 mg/l), FeCl3*6 H2O (25.0 mg/l), ZnSO4*7 H2O (0.18 mg/l), MnSO4*7 H2O (0.1 mg/l), CuSO4*5 H2O (0.16 mg/l), CoCl2*6 H2O (0.18 mg/l).
CF104.3.3_u1
CF104.3.3_u7
CF104.3.3_y2
CF104.3.3_y9
CF108.4B_u1
CF108.4B_u2
CF108.4B_y3
CF108.4B_y8
CFT073 in K-med
CFT073 in LB, after 5 hours of growth.
CFT073 in LB+PACs (100 µg/mL), after 5 hours of growth.
CFT073 in NaCl
CFT073 in urea
CFT073 K-med biological rep 1
CFT073 K-med biological rep 2
CFT073 K-med biological rep 3
CFT073_LB+PACs_rep1
CFT073_LB+PACs_rep2
CFT073_LB+PACs_rep3
CFT073_LB_rep1
CFT073_LB_rep2
CFT073_LB_rep3
CFT073 NaCl biological rep 1
CFT073 NaCl biological rep 2
CFT073 NaCl biological rep 3
CFT073 +pBAD rep 1
CFT073 +pBAD rep 2
CFT073 +pBAD rep 3
CFT073 +pBAD-tosR rep 1
CFT073 +pBAD-tosR rep 2
CFT073 +pBAD-tosR rep 3
CFT073 urea biological rep 1
CFT073 urea biological rep 2
CFT073 urea biological rep 3
Cfx_IN_10mkM_3
Cfx_IN_Mu_10mkM_1
Cfx_IN_Mu_10mkM_2
Cfx_IP_10mkM_3
Cfx_IP_Mu_10mkM_1
Cfx_IP_Mu_10mkM_2
CGATGT-D2
CH3COOH (pH 5.9 ± 0.05); HCl (pH 4.75 ± 0.05); NaOH (pH 9.6 ± 0.05); EtOH (5%); NaCl (4.5%); Glycerol (15%); BC (7 and 9 mg/ml); EtBr (150 mg/ml); 46°C; 15°C
CH3COOH replicate 1
CH3COOH replicate 2
CH3COOH replicate 3
channel 1
Channel 1
Chemostat 1 h irradiated
Chemostat 1h irradiated
Chemostat 50 h irradiated
chemostat, specific growth rate 0.51 1/h
chemostat STR culture
chemostat STR culture STR  reference 1, rep1
chemostat STR culture STR reference 1 , rep2
chemostat STR culture STR  reference 2, rep1
chemostat STR culture STR reference 2 , rep2
chemostat STR culture STR  reference 3, rep1
chemostat STR culture STR reference 3 , rep2
chemostat STR-PFR culture
chemostat STR-PFR culture PFR P1 120min, rep1
chemostat STR-PFR culture PFR P1 120min, rep2
chemostat STR-PFR culture PFR P1 25min, rep1
chemostat STR-PFR culture PFR P1 25min, rep2
chemostat STR-PFR culture PFR P1 28h, rep1
chemostat STR-PFR culture PFR P1 28h, rep2
chemostat STR-PFR culture PFR P3 120min, rep1
chemostat STR-PFR culture PFR P3 120min, rep2
chemostat STR-PFR culture PFR P3 25min, rep1
chemostat STR-PFR culture PFR P3 25min, rep2
chemostat STR-PFR culture PFR P3 28h, rep1
chemostat STR-PFR culture PFR P3 28h, rep2
chemostat STR-PFR culture PFR P5 10min, rep1
chemostat STR-PFR culture PFR P5 10min, rep2
chemostat STR-PFR culture PFR P5 120min, rep1
chemostat STR-PFR culture PFR P5 120min, rep2
chemostat STR-PFR culture PFR P5 210min, rep1
chemostat STR-PFR culture PFR P5 210min, rep2
chemostat STR-PFR culture PFR P5 25h, rep1
chemostat STR-PFR culture PFR P5 25h, rep2
chemostat STR-PFR culture PFR P5 25min, rep1
chemostat STR-PFR culture PFR P5 25min, rep2
chemostat STR-PFR culture PFR P5 26h, rep2
chemostat STR-PFR culture PFR P5 28h, rep1
chemostat STR-PFR culture PFR P5 28h, rep2
chemostat STR-PFR culture PFR P5 330min, rep2
chemostat STR-PFR culture PFR P5 45min, rep1
chemostat STR-PFR culture PFR P5 45min, rep2
chemostat STR-PFR culture PFR P5 5min, rep1
chemostat STR-PFR culture PFR P5 5min, rep2
chemostat STR-PFR culture PFR P5 75min, rep2
chemostat STR-PFR culture STR 10min, rep1
chemostat STR-PFR culture STR 10min, rep2
chemostat STR-PFR culture STR 120min, rep1
chemostat STR-PFR culture STR 120min, rep2
chemostat STR-PFR culture STR 210min, rep1
chemostat STR-PFR culture STR 210min, rep2
chemostat STR-PFR culture STR 25h, rep1
chemostat STR-PFR culture STR 25h, rep2
chemostat STR-PFR culture STR 25min, rep1
chemostat STR-PFR culture STR 25min, rep2
chemostat STR-PFR culture STR 26h, rep1
chemostat STR-PFR culture STR 26h, rep2
chemostat STR-PFR culture STR 28h, rep1
chemostat STR-PFR culture STR 28h, rep2
chemostat STR-PFR culture STR 330min, rep1
chemostat STR-PFR culture STR 330min, rep2
chemostat STR-PFR culture STR 45min, rep1
chemostat STR-PFR culture STR 45min, rep2
chemostat STR-PFR culture STR 5min, rep1
chemostat STR-PFR culture STR 5min, rep2
chemostat STR-PFR culture STR 75min, rep1
chemostat STR-PFR culture STR 75min, rep2
chilled in a dry ice/ethanol. bath.  After homogenization with glass beads,. RNA was
chip antibody: 9E10 Myc tag antibody
chip antibody: anti-b(RNAP) NT63
chip antibody: anti-c-myc antibody
chip antibody: anti-FecI antibody
chip antibody: anti-Flag
chip antibody: anti-FLAG antibody (Sigma Cat #: F3165-1MG)
chip antibody: antiFlag M2
chip antibody: anti-Flag (Sigma)
chip antibody: Anti-FLAG (sigma-aldrich cat no F3165)
chip antibody: anti-H-NS
chip antibody: anti-myc
chip antibody: Anti-myc (9E10) (Santa Cruz, Dallas, TX)
chip antibody: anti-myc (Santa Cruz Biotech, sc-28207)
chip antibody: anti-RecA antibody
chip antibody: anti-RpoB antibody
chip antibody: anti-RpoB (Neoclone, WP002)
chip antibody: anti-rpoB (Santa Cruz Biotech, sc-56766)
chip antibody: anti-RpoD antibody
chip antibody: anti-RpoF antibody
chip antibody: anti-RpoN antibody
chip antibody: anti-RpoS antibody
chip antibody: anti-RpoS (neoclone, WP009)
chip antibody: biotin conjugated anti-c-myc antibody
chip antibody cat.#: ab63797
chip antibody cat. #: sc-28207
chip antibody cat. #: W0002
chip antibody: c-Myc Antibody (9E10), Santa Cruz Biotech, sc-40
chip antibody: Custom anti-Fur polyclonal antibody
chip antibody: E. coli CRP Monoclonal Antibody, Neoclone, #N0004
chip antibody: E. coli RNA Sigma 70 Monoclonal Antibody, Neoclone, #WP004
chip antibody: FLAG antibody
chip antibody: HRP-conjugated sheep anti-mouse IgG
chip antibody manufacturer/lot#: Sigma-Aldrich, M8823-1ML, Lot #  SLBD7244V
chip antibody manufacturer: Upstate
chip antibody: Monoclonal anti-FLAG antibody, Murine  IgG
chip antibody: Monoclonal ANTI-FLAG  M5(Sigma-Aldrich, catalog number: F4042 )
chip antibody: none
chip antibody: None
chip antibody: none, input
chip antibody: normal mouse IgG (Upstate)
chip antibody: normal rabbit IgG (Upstate Biotechnology, Cat. no. 12-370)
chip antibody: RNAP beta subunit antibody
chip antibody: RNA polymerase subunit β
chip antibody: RpoS (Neoclone cat. no. WP009)
chip antibody: SeqA
chip antibody vendor: Abcam
chip antibody vendor: Amersham Biosciences
chip antibody vendor: Neoclone
chip antibody vendor: Santa Cruz Biotech
chip antibody vendor: Santa Cruz Biotechnology
chip antibody: σ32
chip-ArcA_ArcA8myc_glucose_NH4CL_anaerobic_1
chip-ArcA_ArcA8myc_glucose_NH4CL_anaerobic_2
chip-ArcA_ArcA8myc_glucose_NH4CL_anaerobic_3
chip-ArcA_ArcA8myc_glucose_NH4CL_NO3_1
chip-ArcA_ArcA8myc_glucose_NH4CL_NO3_2
chip-ArcA_ArcA8myc_glucose_NH4CL_NO3_3
Chipchip BW25113/pBAD-Myc-His C in LB for 24 h 37oC with 0.5% L-arabinose suspension cell
Chipchip BW25113/pBAD-Myc-His C-mqsA in LB for 24 h 37oC with 0.5% L-arabinose suspension cell
Chipchip BW25113/pCA24N in LB for 24 h 37oC with 2 mM IPTG biofilm cell
Chipchip BW25113/pCA24N-mqsR in LB for 24 h 37oC with 2 mM IPTG biofilm cell
ChIP DNA from MG1655_PhoB_FLAG
ChIP DNA from MG1655 wild type strain
ChIPExo-ArcA_ArcA8myc_glucose_NH4Cl_anaerobic_1_anti-myc
ChIPExo-ArcA_ArcA8myc_glucose_NH4Cl_anaerobic_2_anti-myc
ChIPExo-ArcA_ArcA8myc_glucose_NH4Cl_anaerobic_3_anti-myc
ChIPExo-Crp_delAr1delAr2_glycerol_NH4Cl_O2_1_anti-crp
ChIPExo-Crp_delAr1delAr2_glycerol_NH4Cl_O2_2_anti-crp
ChIPExo-Crp_delAr1delAr2_glycerol_NH4Cl_O2_3_anti-crp
ChIPExo-Crp_delAr1_glycerol_NH4Cl_O2_1_anti-crp
ChIPExo-Crp_delAr1_glycerol_NH4Cl_O2_2_anti-crp
ChIPExo-Crp_delAr1_glycerol_NH4Cl_O2_3_anti-crp
ChIPExo-Crp_delAr2_glycerol_NH4Cl_O2_1_anti-crp
ChIPExo-Crp_delAr2_glycerol_NH4Cl_O2_2_anti-crp
ChIPExo-Crp_delAr2_glycerol_NH4Cl_O2_3_anti-crp
ChIPExo-Crp_delta-crp_glycerol_NH4Cl_O2_1_anti-crp
ChIPExo-Crp_delta-crp_glycerol_NH4Cl_O2_2_anti-crp
ChIPExo-Crp_delta-crp_glycerol_NH4Cl_O2_3_anti-crp
ChIPExo-Crp_wt_fructose_NH4Cl_O2_1_anti-crp
ChIPExo-Crp_wt_fructose_NH4Cl_O2_2_anti-crp
ChIPExo-Crp_wt_fructose_NH4Cl_O2_3_anti-crp
ChIPExo-Crp_wt_fructose_NH4Cl_O2_4_anti-crp
ChIPExo-Crp_wt_fructose_NH4Cl_O2_5_anti-crp
ChIPExo-Crp_wt_glucose_NH4Cl_O2_1_anti-crp
ChIPExo-Crp_wt_glucose_NH4Cl_O2_2_anti-crp
ChIPExo-Crp_wt_glycerol_NH4Cl_O2_1_anti-crp
ChIPExo-Crp_wt_glycerol_NH4Cl_O2_1_anti-crp_rif
ChIPExo-Crp_wt_glycerol_NH4Cl_O2_2_anti-crp
ChIPExo-Crp_wt_glycerol_NH4Cl_O2_2_anti-crp_rif
ChIPExo-Crp_wt_glycerol_NH4Cl_O2_3_anti-crp
ChIPExo-Crp_wt_glycerol_NH4Cl_O2_3_anti-crp_rif
ChIPExo-Crp_wt_glycerol_NH4Cl_O2_4_anti-crp
ChIPExo-Crp_wt_glycerol_NH4Cl_O2_5_anti-crp
ChIPExo-Crp_wt_glycerol_NH4Cl_O2_6_anti-crp
ChIPExo-Fnr_Fnr8myc_glucose_NH4Cl_anaerobic_1_anti-myc
ChIPExo-Fnr_Fnr8myc_glucose_NH4Cl_anaerobic_2_anti-myc
ChIPExo-Fnr_Fnr8myc_glucose_NH4Cl_anaerobic_3_anti-myc
ChIP-exo GadE pH5.5 1
ChIP-exo GadE pH5.5 2
ChIP-exo GadW pH5.5 1
ChIP-exo GadW pH5.5 2
ChIP-exo GadX pH5.5 1
ChIP-exo GadX pH5.5 2
ChIP-exo reads were aligned to the ASM584v2 genome reference sequence using using bowtie v1.0.0 with parameters  -S
ChIP-exo reads were aligned to the NC_000913 genome reference sequence using using bowtie v1.0.0 with parameters  -S
ChIP-exo reads were aligned using BWA with  default parameters
ChIPExo-RpoD_wt_fructose_NH4Cl_O2_1_anti-rpod
ChIPExo-RpoD_wt_fructose_NH4Cl_O2_2_anti-rpod
ChIPExo-RpoD_wt_fructose_NH4Cl_O2_3_anti-rpod
ChIPExo-RpoD_wt_glucose_NH4Cl_O2_1_anti-rpod
ChIPExo-RpoD_wt_glucose_NH4Cl_O2_2_anti-rpod
ChIPExo-RpoD_wt_glucose_NH4Cl_O2_3_anti-rpod
ChIPExo-RpoD_wt_glycerol_NH4Cl_O2_1_anti-rpod
ChIPExo-RpoD_wt_glycerol_NH4Cl_O2_2_anti-rpod
ChIPExo-RpoD_wt_glycerol_NH4Cl_O2_3_anti-rpod
ChIP-exo RpoS pH5.5 1
ChIP-exo RpoS pH5.5 2
chip-Fnr_Fnr8myc_glucose_NH4CL_anaerobic_1
chip-Fnr_Fnr8myc_glucose_NH4CL_anaerobic_2
chip-Fnr_Fnr8myc_glucose_NH4CL_anaerobic_3
chip-Fnr_Fnr8myc_glucose_NH4CL_NO3_1
chip-Fnr_Fnr8myc_glucose_NH4CL_NO3_2
chip-Fnr_Fnr8myc_glucose_NH4CL_NO3_3
ChIP_hns-F_bcm-#1
ChIP_hns-F_bcm+#1
ChIP_hns-F_bcm-#2
ChIP_hns-F_bcm+#2
ChIP-Seq
ChIP-seq experiments were performed in duplicate using similar growth condition and protocols for chromatin immunoprecipitation. The first experiment was done in the Centre for Genomic Regulation (CRG, Barcelona, Spain), while the second one in the Immanuel Kant Baltic Federal University (Kaliningrad, Russia). In both cases, bacterial cells were grown aerobically at 37°C until OD600~0.6 were treated with formaldehyde (final concentration of 1%, 20 min incubation). Cross-linking was stopped with glycine (final concentration of 450 mM). After 5 minutes of incubation the cells were pelleted by centrifugation at 14,000 rpm for 15 minutes (+4°C), washed twice with 5 ml of PBS and resuspended in 1.3 ml of ice-cold immunoprecipitation buffer prepared from 50 ml of buffer containing 100 mM NaCl, 50 mM Tris-HCl (pH 8.1), 5 mM EDTA, 0.2% NaN3, 0.5% SDS, and 25 ml of buffer containing 100 mM Tris-HCl (pH 8.6); 100 mM NaCl; 5 mM EDTA; 0,2% NaN3, 5% Triton-X-100. Then phenylmethylsulfonyl fluoride (final concentration of 1 mM) or 20 μl of Protease Inhibitor Cocktail (PIC, Sigma) for the first and the second experiment, respectively, were added followed by incubation for 30 min at +4°C.
ChIP-seq libraries were prepared for sequencing using standard Illumina protocols
ChIP-seq libraries were prepared from 5-10 ng of the DNA samples with the NebNext® Ultra™ DNA Library Prep Kit for Illumina (New England Biolabs, MA, USA) following the manufacturer’s instructions. For the final amplification of the library 15 PCR cycles were used. Size distribution and concentration of the amplicons was checked on the Bioanalyzer 2100 (Agilent, USA). In the first experiment, the maximum was at about 300 bp, and ChIP libraries were sequenced using 50 nt single-end read protocol on the Illumina HiSeq system (Illumina, USA) of the Genomics Facility in the Centre for Genomic Regulation (Barcelona). In the second experiment, the maximum was at about 450 bp, and samples were sequenced using standard paired-end 2*150 nt protocol on the MiSeq system (Illumina, USA) in the Immanuel Kant Baltic Federal University (Kaliningrad).
ChIP-seq reads were aligned to the CFT073 genome using bowtie (version 0.12.8)
ChIP-seq reads were aligned to the E. coli NC_000913 genome using BWA 0.6.2
Cholic Acid Treatment
CHP files were generated using Affymetrix Expression Control.  Downstream data analysis was performed in GeneSpring GX 12,  CEL files were imported using RMA algorithm and median normalization was performed.
Chromatin was extracted and processed according to Oxford Gene Technology protocols (www.ogt.co.uk).
Chromosomal DNA
CIP2G_00000
CIP2G_00045
CIP2G_00090
CIP2G_00135
CIP2G_00180
CIP4G_00000
CIP4G_00045
CIP4G_00090
CIP4G_00135
CIP4G_00180
Ciprofloxacin Rep 1 +A-IP
Ciprofloxacin Rep 1 +A+IP
Ciprofloxacin Rep 2 +A-IP
Ciprofloxacin Rep 2 +A+IP
Ciprofloxacin Rep 3 +A-IP
Ciprofloxacin Rep 3 +A+IP
CIPSG_00000
CIPSG_00045
CIPSG_00090
CIPSG_00135
CIPSG_00180
Cirpofloxacin treated fur mutant sample at T1h, biological rep 1
Cirpofloxacin treated fur mutant sample at T1h, biological rep 2
Cirpofloxacin treated WT sample at T1h, biological rep 1
Cirpofloxacin treated WT sample at T1h, biological rep 2
Clarified extracts were treated with microccocal nuclease (45 enzyme units per absorbance unit of lysate at 260 nm), purified through a sucrose cushion, and affinity purified via TF. Ribosome-protected footprints were size selected and converted into a cDNA library for sequencing.
Clarified extracts were treated with microccocal nuclease (45 enzyme units per absorbance unit of lysate at 260 nm), purified through a sucrose gradient. Ribosome-protected footprints were size selected and converted into a cDNA library for sequencing.
Clindamycin_replicate_1
Clindamycin_replicate_2
Clindamycin_replicate_3
clinical-1 strain grown to exponential phase of growth
Clinical-1 vs Bovine-biased-1
Clinical-1 vs Bovine-biased-2
Clinical-1 vs Bovine-biased-3
Clinical-1 vs Bovine-biased-4
clinical-2 strain grown to exponential phase of growth
Clinical-2 vs Bovine-biased-1
Clinical-2 vs Bovine-biased-2
Clinical-2 vs Bovine-biased-3
Clinical-2 vs Bovine-biased-4
clinical-3 strain grown to exponential phase of growth
Clinical-3 vs Bovine-biased-1
Clinical-3 vs Bovine-biased-2
Clinical-3 vs Bovine-biased-3
Clinical-3 vs Bovine-biased-4
clinical-4 strain grown to exponential phase of growth
Clinical-4 vs Bovine-biased-1
Clinical-4 vs Bovine-biased-2
Clinical-4 vs Bovine-biased-3
Clinical-4 vs Bovine-biased-4
Clinical isolate, minus ciprofloxacin, 0min
Clinical isolate, minus ciprofloxacin, 30min
Clinical isolate, minus ciprofloxacin, 90min
Clinical isolate, plus ciprofloxacin, 0min
Clinical isolate, plus ciprofloxacin, 30min
Clinical isolate, plus ciprofloxacin, 90min
Clones were grown in M9 with 0.4% (w/v) glucose as carbon source minimal medium with 0.3M NaCl (osmotic stress medium) to mid-log phase (OD600 approx. 0.8).
[Clostridium] leptum
[Clostridium] symbiosum
Cluster detection and base calling were performed using RTA v1.13 (Illumina), and the quality of the reads was assessed with CASAVA v1.8.1 (Illumina).
Co-hybridization of E. coli G 1/2 isolate with E. coli K-12 MG1655
Co-hybridization of E. coli G 1/2 isolate with E. coli O157:H7 EDL933
Co-hybridization of E. coli G 3/10 isolate with E. coli O157:H7 EDL933
Co-hybridization of E. coli G 4/9 isolate with E. coli K-12 MG1655
Co-hybridization of E. coli G5 isolate with E. coli K-12 MG1655
Co-hybridization of E. coli G5 isolate with E. coli O157:H7 EDL933
Co-hybridization of E. coli isolate G 3/10 with control strain K-12 MG1655
Co-hybridization of E. coli isolate G 4/9 with E. coli O157:H7 EDL933
Co-hybridization of E. coli O157:H7 EDL933 with E. coli K-12 M1655 #1
Co-hybridization of E. coli O157:H7 EDL933 with E. coli K-12 M1655 #2
coli_coldstress_timepoint1_rep1
coli_coldstress_timepoint1_rep2
coli_coldstress_timepoint1_rep3
coli_coldstress_timepoint2_rep1
coli_coldstress_timepoint2_rep2
coli_coldstress_timepoint2_rep3
coli_coldstress_timepoint3_rep1
coli_coldstress_timepoint3_rep2
coli_coldstress_timepoint3_rep3
coli_coldstress_timepoint4_rep1
coli_coldstress_timepoint4_rep2
coli_coldstress_timepoint4_rep3
coli_coldstress_timepoint5_rep1
coli_coldstress_timepoint5_rep2
coli_coldstress_timepoint5_rep3
coli_coldstress_timepoint6_rep1
coli_coldstress_timepoint6_rep2
coli_coldstress_timepoint6_rep3
coli_coldstress_timepoint7_rep1
coli_coldstress_timepoint7_rep2
coli_coldstress_timepoint7_rep3
coli_coldstress_timepoint8_rep1
coli_coldstress_timepoint8_rep2
coli_coldstress_timepoint8_rep3
coli_control_timepoint1_rep1
coli_control_timepoint1_rep2
coli_control_timepoint1_rep3
coli_control_timepoint2_rep1
coli_control_timepoint2_rep2
coli_control_timepoint2_rep3
coli_control_timepoint3_rep1
coli_control_timepoint3_rep2
coli_control_timepoint3_rep3
coli_control_timepoint4_rep1
coli_control_timepoint4_rep2
coli_control_timepoint4_rep3
coli_control_timepoint5_rep1
coli_control_timepoint5_rep2
coli_control_timepoint5_rep3
coli_control_timepoint6_rep1
coli_control_timepoint6_rep2
coli_control_timepoint6_rep3
coli_control_timepoint7_rep1
coli_control_timepoint7_rep2
coli_control_timepoint7_rep3
coli_control_timepoint8_rep1
coli_control_timepoint8_rep2
coli_control_timepoint8_rep3
coli_heatstress_timepoint1_rep1
coli_heatstress_timepoint1_rep2
coli_heatstress_timepoint1_rep3
coli_heatstress_timepoint2_rep1
coli_heatstress_timepoint2_rep2
coli_heatstress_timepoint2_rep3
coli_heatstress_timepoint3_rep1
coli_heatstress_timepoint3_rep2
coli_heatstress_timepoint3_rep3
coli_heatstress_timepoint4_rep1
coli_heatstress_timepoint4_rep2
coli_heatstress_timepoint4_rep3
coli_heatstress_timepoint5_rep1
coli_heatstress_timepoint5_rep2
coli_heatstress_timepoint5_rep3
coli_heatstress_timepoint6_rep1
coli_heatstress_timepoint6_rep2
coli_heatstress_timepoint6_rep3
coli_heatstress_timepoint7_rep1
coli_heatstress_timepoint7_rep2
coli_heatstress_timepoint7_rep3
coli_heatstress_timepoint8_rep1
coli_heatstress_timepoint8_rep2
coli_heatstress_timepoint8_rep3
coli_lactose_timepoint2_rep1
coli_lactose_timepoint2_rep2
coli_lactose_timepoint2_rep3
coli_lactose_timepoint3_rep1
coli_lactose_timepoint3_rep3
coli_lactose_timepoint4_rep1
coli_lactose_timepoint4_rep2
coli_lactose_timepoint4_rep3
coli_lactose_timepoint5_rep1
coli_lactose_timepoint5_rep2
coli_lactose_timepoint5_rep3
coli_lactose_timepoint6_rep1
coli_lactose_timepoint6_rep2
coli_lactose_timepoint6_rep3
coli_lactose_timepoint7_rep1
coli_lactose_timepoint7_rep2
Coli-MDS42_bcm-100mcg/ml_rep1
Coli-MDS42_bcm-100mcg/ml_rep2
Coli-MDS42_del-nusA_rep1
Coli-MDS42_del-nusA_rep2
Coli-MDS42_del-nusG_rep1
Coli-MDS42_del-nusG_rep2
Coli-MDS42_no-drug_rep1
Coli-MDS42_no-drug_rep2
Coli-MG1655_bcm-100mcg/ml_rep1
Coli-MG1655_bcm-100mcg/ml_rep2
Coli-MG1655_bcm-10mcg/ml_rep1
Coli-MG1655_bcm-10mcg/ml_rep2
Coli-MG1655_bcm-25mcg/ml_rep1
Coli-MG1655_bcm-25mcg/ml_rep2
Coli-MG1655_no-drug_rep1
Coli-MG1655_no-drug_rep2
Coli-O157H7_bcm-100mcg/ml_rep1
Coli-O157H7_bcm-100mcg/ml_rep2
Coli-O157H7_no-drug_rep1
Coli-O157H7_no-drug_rep2
coli_oxidativestress_timepoint10_rep1
coli_oxidativestress_timepoint10_rep2
coli_oxidativestress_timepoint10_rep4
coli_oxidativestress_timepoint11_rep1
coli_oxidativestress_timepoint11_rep2
coli_oxidativestress_timepoint11_rep4
coli_oxidativestress_timepoint12_rep2
coli_oxidativestress_timepoint1_rep1
coli_oxidativestress_timepoint1_rep2
coli_oxidativestress_timepoint1_rep4
coli_oxidativestress_timepoint2_rep1
coli_oxidativestress_timepoint2_rep2
coli_oxidativestress_timepoint2_rep4
coli_oxidativestress_timepoint3_rep1
coli_oxidativestress_timepoint3_rep2
coli_oxidativestress_timepoint3_rep4
coli_oxidativestress_timepoint4_rep1
coli_oxidativestress_timepoint4_rep2
coli_oxidativestress_timepoint4_rep4
coli_oxidativestress_timepoint5_rep1
coli_oxidativestress_timepoint5_rep2
coli_oxidativestress_timepoint5_rep4
coli_oxidativestress_timepoint6_rep1
coli_oxidativestress_timepoint6_rep2
coli_oxidativestress_timepoint6_rep4
coli_oxidativestress_timepoint7_rep1
coli_oxidativestress_timepoint7_rep2
coli_oxidativestress_timepoint7_rep4
coli_oxidativestress_timepoint8_rep1
coli_oxidativestress_timepoint8_rep2
coli_oxidativestress_timepoint8_rep4
coli_oxidativestress_timepoint9_rep1
coli_oxidativestress_timepoint9_rep2
coli_oxidativestress_timepoint9_rep4
Collected cells were lysed using Trizol (Invitrogen), and total RNA was isolated using phenol-chloroform and precipitated with ice cold isopropanol. Then the precipitations were further washed with 70% ethanol and dissolved in RNase-free water. Genomic DNA was removed using RNase-free DNase I. RNA samples were further purified using RNeasy Mini Kits (Qiagen). RNA concentration and quality were determined using A Nanodrop ND 1000 spectrophotometer (Thermo Fisher Scientific, Pittsburgh, PA, USA) and agarose gel electrophoresis. The isolated RNA was stored at −80°C before use.
Collinsella aerofaciens ATCC 25986
Colony Biofilm Replicate 1
Colony Biofilm Replicate 2
Colony Biofilm Replicate 3
Colony Biofilm Replicate 4
Column purification
Combined input
common reference (OD600=0.5)
CompA
Comparison cya mutant with wt under glucose-limited conditions (replicate 1)
Comparison cya mutant with wt under glucose-limited conditions (replicate 2)
Comparison cya mutant with wt under glucose-limited conditions (replicate 3)
Comparison rpoS mutant with wt under glucose-limited conditions (replicate 1)
Comparison rpoS mutant with wt under glucose-limited conditions (replicate 2)
Comparison rpoS mutant with wt under glucose-limited conditions (replicate 3)
CompB
Compile annotated counts using custom Python script (ExtractMapCounts from http://uwgenomics.org/downloads/RNA-Seq-1.1.tar.gz)
completely aerobic conditions
Computation of genomic intervals based on computed signal and p-values
Computation of summary statistics
CON206.3A_u1
CON206.3A_u2
CON206.3A_y1
CON206.3A_y2
CON208.3A_u1
CON208.3A_u8
CON208.3A_y2
CON208.3A_y6
concentration: 0.2 ppm
concentration: 2 ppm
condition: 37ºC
condition: 45ºC
condition: acetonitrile (control)
condition: exponential growth, 36.9ºC
condition: exponential growth, 41.2ºC
condition: exponential growth, 43.2ºC
condition: exponential growth, 44.8ºC
condition: glucose limited
condition: heat-shocked condition without rifampicin treatment
condition: heat shock response, 44.8ºC
condition: histidine depleted
condition: histidine supplied, 1 mM
condition: in vitro
condition: in vivo
condition: LB+3g/L Glc +0.1mM IPTG
condition: LB+3g/L Glc +0.1mM IPTG + 50μg/ml Amp
condition: mid-exponential condition without rifampicin treatment
condition: mid-exponential condition with rifampicin treatment
condition: myxotoxin
condition: nitrogen-limiting condition without rifampicin treatment
condition: osmotic pressure
condition: regular
condition: starvation
condition: stationary condition without rifampicin treatment
condition: temperature change
conducted by CeGaT (Tübingen, Germany) according to SOLiD standard protocols for RNA-seq
con_RNAA
consensus binding regions were obtained as the portion which was covered by replicate samples
contamination status: hydrocarbon contaminated
Continuous aerobically grown cultures in Evans medium, CORM-401 samples or samples prior to addition of CORM-401
Continuous aerobically grown cultures in Evans medium, exposed to 0.1L/min CO gas for 10min
Continuous aerobically grown cultures in Evans medium, exposed to 0.1L/min CO gas for 10 min
Continuous aerobically grown cultures in Evans medium, exposed to 0.1L/min CO gas for 20min
Continuous aerobically grown cultures in Evans medium, exposed to 0.1L/min CO gas for 2.5min
Continuous aerobically grown cultures in Evans medium, exposed to 0.1L/min CO gas for 40min
Continuous aerobically grown cultures in Evans medium, exposed to 0.1L/min CO gas for 5min
Continuous aerobically grown cultures in Evans medium, exposed to 0.1L/min CO gas for 80min
Continuous aerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 10min
Continuous aerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 20min
Continuous aerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 2.5min
Continuous aerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 40min
Continuous aerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 5min
Continuous aerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 80min
Continuous aerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 10min
Continuous aerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 20min
Continuous aerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 2.5min
Continuous aerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 40min
Continuous aerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 5min
Continuous aerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 80min
Continuous aerobically grown cultures in Evans medium, prior to CORM-3 addition
Continuous anaerobically grown cultures in Evans medium, CORM-401 samples or samples prior to addition of CORM-401
Continuous anaerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 10min
Continuous anaerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 20min
Continuous anaerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 2.5min
Continuous anaerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 40min
Continuous anaerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 5min
Continuous anaerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 80min
Continuous anaerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 10min
Continuous anaerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 20min
Continuous anaerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 2.5min
Continuous anaerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 40min
Continuous anaerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 5min
Continuous anaerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 80min
Continuous anaerobically grown cultures in Evans medium, exposed to CO gas at 0.1L/min for 10min
Continuous anaerobically grown cultures in Evans medium, exposed to CO gas at 0.1L/min for 20min
Continuous anaerobically grown cultures in Evans medium, exposed to CO gas at 0.1L/min for 2.5min
Continuous anaerobically grown cultures in Evans medium, exposed to CO gas at 0.1L/min for 40min
Continuous anaerobically grown cultures in Evans medium, exposed to CO gas at 0.1L/min for 5min
Continuous anaerobically grown cultures in Evans medium, exposed to CO gas at 0.1L/min for 80min
Continuous anaerobically grown cultures in Evans medium, prior to CORM-3 addition
control
Control
Control, 0.8%butanol,1.5h,replicate 1
Control, 0.8%butanol,1.5h,replicate 2
Control, 0.8%butanol,1.5h,replicate 3
Control_1
Control109_0.8%Bu_1.5h_rep1
Control109_0.8%Bu_1.5h_rep2
Control109_0.8%Bu_1.5h_rep3
control 12h
Control-1, biological rep1
Control_2
control 24h
Control-2, biological rep2
Control-3, biological rep3
control 6h
control (additional)
Control bacteria at 37°C (common reference).  Total RNA isolated from 5 indepedent cultures (pooled after cDNA labeling).
control, biological rep1 C1
control, biological rep1 C2
control, biological rep1 C3
control, biological rep2 C4
control, biological rep2 C5
control, biological rep2 C6
Control chemostat 1 h not irradiated
Control chemostat 1h not irradiated
Control chemostat 50 h not irradiated
Control pAN1201 replicate 1 (IPTG-/aTc-/Ara-)
Control pAN1201 replicate 2 (IPTG-/aTc-/Ara-)
Control replicate 1
Control replicate 2
Control replicate 3
control sample at 30 min, biological rep1
control sample at 30 min, biological rep2
control sample at 60 min, biological rep1
control sample at 60 min, biological rep2
Control samples (285c/empty vector) were harvested via filtration and resuspended in RNALater once they had reached OD = 0.5. Experimental samples were harvested after 1 hour of heat shock at 42 C in an analogous procedure.
Control_Step_1-1
Control_Step_1-2
Control_Step_2-1
Control_Step_2-2
Control_Step_3-1
Control_Step_3-2
Control_Step_4-1
Control_Step_4-2
control strain
Control Strain at specific growth rate 0.5h-1 0h
Control Strain at specific growth rate 0.5h-1 10h
Control Strain at specific growth rate 0.5h-1 16h
Control Strain at specific growth rate 0.5h-1 20h
Control Strain at specific growth rate 0.5h-1 6h
Control Strain at specific growth rate 0.5h-1 8h
Control strain exponentially grown in the absence of histidine
Control strain exponentially grown in the presence of histidine (1 mM)
control strain K-12 MG1655
control strain O157:H7 EDL933
control strain with hypoxanthine
control strain w/o hypoxanthine 120 min at low dilution protocol
control strain w/o hypoxanthine 15 min at low dilution protocol
control strain w/o hypoxanthine 30 min at low dilution protocol
control strain w/o hypoxanthine 45 min at low dilution protocol
control strain w/o hypoxanthine 60 min at low dilution protocol
Control treatment. Bacteria were grown in DMEM pH 7.4, 90 minutes, 37C, 5% CO2, static (unstressed)
Control treatment. Bacteria were grown in DMEM pH 7.4 (unstressed)
Control Wild type E.coli SE15 vs. LuxS mutant E.coli SE15
conversion: Convert SOLiD output to fastq (Galaxy Version 1.0.0); default parameters.
convert back to sorted.sam with samtools
convert bowtie output .sam to .bam with samtools
corresponding to the same tip. Finally, all the log ratios of the same gene from each slide
counting: countOverlaps of Iranges; default parameters
Count reads aligned to each base IGVtools (version 2.3.71), window size = 1
Counts per million unique reads were calculated for each gene.
Counts were depth normalized to a pseudo-reference sample calculated from all samples (ribozero treated samples) or using counts per million counts (total RNA samples).
Coverage calculation and normalisation (TRAPL)
Coverage calculation and normalisation (via READemption)
cpxA-ala-1
cpxA-ala-2
cpxA mutant in Ala media
cpxA mutant in Gln media
cpxR__U_N0075_r1
cpxR__U_N0075_r2
cpxR__U_N0075_r3
cpxR upregulation, 0.075 ug/ml norfloxacin
cra-8myc tagged strain_acetate
cra-8myc tagged strain_fructose
cra-8myc tagged strain_glucose
Cra acetate 1
Cra acetate 2
Cra fructose 1
Cra fructose 2
Cra glucose 1
Cra glucose 2
cra KO
cra KO + L-trp
crcB__U_N0075_r1
crcB__U_N0075_r2
crcB__U_N0075_r3
crcB upregulation, 0.075 ug/ml norfloxacin
CRE Multi 0uM Rep1 Plasmid
CRE Multi 0uM Rep2 Plasmid
CRE Multi 100uM Rep1 Plasmid
CRE Multi 100uM Rep2 Plasmid
CRE Single 100uM Rep1 Plasmid
CRE Single 100uM Rep2 Plasmid
Crooks_aero
Crooks_anaero
Crosslink
Cross-linked and sonicated chromatin complex of ArcA-8myc and DNA was immunoprecipitated by rabbit serum containing myc antibody.
Cross-linked and sonicated chromatin complex of ArgR-8myc and DNA was immunoprecipitated by 9E10 myc antibody.
Cross-linked and sonicated chromatin complex of ArgR-8myc and DNA was immunoprecipitated by rabbit serum containing myc antibody.
Cross-linked and sonicated chromatin complex of ArgR-8myc and DNA was immunoprecipitated by using normal mouse IgG for the control.
Cross-linked and sonicated chromatin complex of Fnr-8myc and DNA was immunoprecipitated by rabbit serum containing myc antibody.
Cross-linked and sonicated chromatin complex of Lrp-8myc and DNA was immunoprecipitated by 9E10 myc antibody.
Cross-linked and sonicated chromatin complex of Lrp-8myc and DNA was immunoprecipitated by using normal mouse IgG for the control.
Cross-linked and sonicated chromatin complex of PurR-8myc and DNA was immunoprecipitated by 9E10 myc antibody.
Cross-linked and sonicated chromatin complex of PurR-8myc and DNA was immunoprecipitated by using normal mouse IgG for the control.
Cross-linked and sonicated chromatin complex of RNAP and DNA was immunoprecipitated by anti-RpoB antibody.
Cross-linked and sonicated chromatin complex of RNAP and DNA was immunoprecipitated by using normal mouse IgG for the control.
Cross-linked and sonicated chromatin complex of RNAP beta-subunit and DNA was immunoprecipitated by normal mouse IgG (Upstate) for the control (mock-IP).
Cross-linked and sonicated chromatin complex of RNAP beta-subunit and DNA was immunoprecipitated by NT63 mouse antibody.
Cross-linked and sonicated chromatin complex of TrpR-8myc and DNA was immunoprecipitated by 9E10 myc antibody.
Cross-linked and sonicated chromatin complex of TrpR-8myc and DNA was immunoprecipitated by using normal mouse IgG for the control.
Cross-linked cells were harvested and washed two times with ice-cold PBS. Cells were resuspended in 450μl of TES buffer (50mM Tris-HCl pH 7.5, 150mM NaCl) and 20μl of lysis solution (13.6mg/ml lysozyme, 50% glycerol, 50mM Tris-HCl pH7.5, 100mM NaCl, 1mM DTT, 0.1% Triton X-100) followed of a 5min incubation at room temperature. 10μl of cOmplete EDTA free protease inhibitor (Roche) were added and incubated 10min at room temperature. 550μl of ChIP buffer (1.1% Triton X-100, 1.2mM EDTA, 16.7mM Tris-HCl, 167mM NaCl, 20μl/ml of cOmplete EDTA free protease inhibitor (Roche) were added followed of 10min incubation at 37ºC. The lysate was then sonicated (UP200S-Hielscher) to an average size between 300bp and 700bp with 5 cycles of and amplitude of 55%, 0.45sec pulse during 10sec and 50sec in ice. Insoluble cell debris were removed by centrifugation at 20000g for 3min at 4ºC and the supernatant collected. The supernatant was added to α-Flag-agarose beads (Sigma) and incubated at 4ºC under rotation. The samples were then washed once with low salt wash buffer (0.1% SDS, 1% Triton X-100, 2mM EDTA, 20mM Tris-HCl pH 8.1, 150mM NaCl), once with high salt wash buffer (0.1% SDS, 1% Triton X-100, 2mM EDTA, 20mM Tris-HCl pH 8.1, 500mM NaCl), once with LiCl wash buffer (250mM LiCl, 1% NP-40, 1% deoxycholate, 1mM EDTA, 10mM Tris-HCl pH 8.1), and twice with TE buffer (10mM Tris-HCl pH 8.1, 1mM EDTA). Two washes with 250μl of freshly prepared elution buffer (1% SDS, 100mM NaHCO3) were done followed by vortexing and incubation under rotation at room temperature for 15min. To reverse the cross-link 30μl of 5M NaCl were added to the elute and incubated over night at 65ºC. Finally, 4μl of 0.5M EDTA, 20μl of 1M Tris-HCl pH 6.5 and 2μl of 10mg/ml Proteinase-K (Sigma) were added and the suspension incubated at 45ºC for 2h. DNA was purified and recovered by standard phenol-chloroform extraction and ethanol precipitation with 20μg of glycogen.
Cross-linked cells were harvested by centrifugation, washed thrice with ice-cold TBS (pH 7.5), resuspended in 1 ml lysis buffer [10 mM Tris (pH 8.0), 20% sucrose, 50 mM NaCl, 10 mM EDTA, 20 mg/ml lysozyme and 0.1 mg/ml RNase A] and incubated at 37°C for 30 min. After lysis, 3 ml immunoprecipitation (IP) buffer [50 mM HEPES–KOH (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, 0.1% sodium dodecyl sulphate (SDS) and PMSF (final 1 mM)] was added and the DNA sheared to an average size of ~250 bp using a Bioruptor (Diagenode). Insoluble cellular matter was removed by centrifugation for 10 min at 4°C. An 800 μl aliquot was incubated with 20 μl Protein A/G UltraLink Resin (Pierce) on a rotary shaker for 45 minutes at room temperature. The supernatant was removed and incubated with mouse monoclonal antibody (Neoclone cat. no. WP009) and 30 μl Protein A/G UltraLink Resin (pre-incubated with 1mg/ml BSA in TBS), on a rotary shaker at room temperature for 90 min. Samples were washed once with IP buffer, twice with IP buffer + 500 mM NaCl, once with wash buffer [10 mM Tris (pH 8.0), 250 mM LiCl, 1 mM EDTA, 0.5% Nonidet P-40 and 0.5% sodium deoxycholate] and once with TE (pH 7.5). Immunoprecipitated complexes were eluted in 100 μl elution buffer [10 mM Tris (pH 7.5), 10 mM EDTA and 1% SDS] at 65°C for 20 min. Immunoprecipitated samples and the sheared DNA from the Bioruptor were uncrosslinked in elution buffer containing 0.8 mg/ml Pronase at 42°C for 2 h followed by 65°C for 6 h. DNA was purified using the phenol-chloroform method.
Crosslinked cells were then resuspended in 500 ul of lysis buffer (10 mM Tris-HCl (pH 7.5), 100 mM NaCl and 1 mM EDTA) with 40 ul of protease inhibitor cocktail (50 mg in 0.25 ml of DMSO and 0.75 ml of TDW). Cells were lyzed with 1 ul of lysozyme for 30 min at 37C on a rocker. 0.55 ml of 2X IP buffer (100 mM Tris-HCl (pH 7.5), 200 mM NaCl, 2% Triton X-100 and 1 mM EDTA) were added to the sample, and then was sonicated to fragmentize genomic DNA. 0.3 ml of Wash buffer I (50 mM Tris-HCl (pH 7.5), 140 mM NaCl, 1% Triton X-100 and 1mM EDTA) was added to make the volume up to 1.4 ml. Only 0.7 ml was taken and transfered to a new tube, and 15 ul of Anti-c-myc mouse antibody was added, and the sample was incubated overnight at 4C to make Antibody-TF complex. 50 ul of Dynabeads Pan mouse IgG were washed 3 times with bead washing solution (250 mg BSA in 50 ml of PBS), and were added to the sample. Cell lysate with beads were incubated for 6 hours or overnight at 4C to make Dynabead-antibody-TF complex. The beads were pulled down on a magnet stand, and washed 2 times with wash buffer I and with wash buffer II (50 mM Tris-HCl (pH 7.5), 500 mM NaCl, 1% Triton X-100 and 1mM EDTA), wash buffer III (10 mM Tris-HCl (pH 8.0), 250 mM LiCl, 1% Triton X-100 and 1mM EDTA), and wash buffer IV (10 mM Tris-HCl (pH 8.0), 1mM EDTA). The bead-bound TF-DNA complex was then end-repaired, dA-tailed, and ligated to the first adapter. Adapter-ligated sample was then treated with nick-repair reagent, and was treated with lambda exonuclease and RecJ exonuclease. Then DNA was eluted away from Dynabeads by incubating in 200 ul of elution buffer (50 mM Tris-HCl (pH 8.0), 1% SDS and 1 mM EDTA) at 65C overnight. Protein was removed by treating 4 ul of protease K and being incubated at 55C for 2 hours, and by Phenol-Chloroform-IAA extraction. Purified DNA was used to bulid the second strand synthesis, followed by another dA-tailing, second strand ligation, and 3' overhang removal stpes. Then the sequencing library was amplified with PCR enrichment.
Crosslinked cells were then resuspended in 500 ul of lysis buffer (10 mM Tris-HCl (pH 7.5), 100 mM NaCl and 1 mM EDTA) with 40 ul of protease inhibitor cocktail (50 mg in 0.25 ml of DMSO and 0.75 ml of TDW). Cells were lyzed with 1 ul of lysozyme for 30 min at 37oC on a rocker. 0.55 ml of 2X IP buffer (100 mM Tris-HCl (pH 7.5), 200 mM NaCl, 2% Triton X-100 and 1 mM EDTA) were added to the sample, and then was sonicated to fragmentize genomic DNA. 0.3 ml of Wash buffer I (50 mM Tris-HCl (pH 7.5), 140 mM NaCl, 1% Triton X-100 and 1mM EDTA) was added to make the volume up to 1.4 ml. Only 0.7 ml was taken and transfered to a new tube, and 10 ul of Anti-rpoB mouse antibody was added, and the sample was incubated overnight at 4 oC to make Antibody-TF complex. 50 ul of Dynabeads Pan mouse IgG were washed 3 times with bead washing solution (250 mg BSA in 50 ml of PBS), and were added to the sample. Cell lysate with beads were incubated for 6 hours or overnight at 4oC to make Dynabead-antibody-TF complex. The beads were pulled down on a magnet stand, and washed 2 times with wash buffer I and with wash buffer II (50 mM Tris-HCl (pH 7.5), 500 mM NaCl, 1% Triton X-100 and 1mM EDTA), wash buffer III (10 mM Tris-HCl (pH 8.0), 250 mM LiCl, 1% Triton X-100 and 1mM EDTA), and wash buffer IV (10 mM Tris-HCl (pH 8.0), 1mM EDTA). The bead-bound TF-DNA complex was then end-repaired, dA-tailed, and ligated to the first adapter. Adapter-ligated sample was then treated with nick-repair reagent, and was treated with lambda exonuclease and RecJ exonuclease. Then DNA was eluted away from Dynabeads by incubating in 200 ul of elution buffer (50 mM Tris-HCl (pH 8.0), 1% SDS and 1 mM EDTA) at 65oC overnight. Protein was removed by treating 4 ul of protease K and being incubated at 55 oC for 2 hours, and by Phenol-Chloroform-IAA extraction. Purified DNA was used to bulid the second strand synthesis, followed by another dA-tailing, second strand ligation, and 3' overhang removal stpes. Then the sequencing library was amplified with PCR enrichment.
Crosslinked cells were then resuspended in 500 ul of lysis buffer (10 mM Tris-HCl (pH 7.5), 100 mM NaCl and 1 mM EDTA) with 40 ul of protease inhibitor cocktail (50 mg in 0.25 ml of DMSO and 0.75 ml of TDW). Cells were lyzed with 1 ul of lysozyme for 30 min at 37oC on a rocker. 0.55 ml of 2X IP buffer (100 mM Tris-HCl (pH 7.5), 200 mM NaCl, 2% Triton X-100 and 1 mM EDTA) were added to the sample, and then was sonicated to fragmentize genomic DNA. 0.3 ml of Wash buffer I (50 mM Tris-HCl (pH 7.5), 140 mM NaCl, 1% Triton X-100 and 1mM EDTA) was added to make the volume up to 1.4 ml. Only 0.7 ml was taken and transfered to a new tube, and 15 ul of Anti-c-myc mouse antibody was added, and the sample was incubated overnight at 4 oC to make Antibody-TF complex. 50 ul of Dynabeads Pan mouse IgG were washed 3 times with bead washing solution (250 mg BSA in 50 ml of PBS), and were added to the sample. Cell lysate with beads were incubated for 6 hours or overnight at 4oC to make Dynabead-antibody-TF complex. The beads were pulled down on a magnet stand, and washed 2 times with wash buffer I and with wash buffer II (50 mM Tris-HCl (pH 7.5), 500 mM NaCl, 1% Triton X-100 and 1mM EDTA), wash buffer III (10 mM Tris-HCl (pH 8.0), 250 mM LiCl, 1% Triton X-100 and 1mM EDTA), and wash buffer IV (10 mM Tris-HCl (pH 8.0), 1mM EDTA). The bead-bound TF-DNA complex was then end-repaired, dA-tailed, and ligated to the first adapter. Adapter-ligated sample was then treated with nick-repair reagent, and was treated with lambda exonuclease and RecJ exonuclease. Then DNA was eluted away from Dynabeads by incubating in 200 ul of elution buffer (50 mM Tris-HCl (pH 8.0), 1% SDS and 1 mM EDTA) at 65oC overnight. Protein was removed by treating 4 ul of protease K and being incubated at 55 oC for 2 hours, and by Phenol-Chloroform-IAA extraction. Purified DNA was used to bulid the second strand synthesis, followed by another dA-tailing, second strand ligation, and 3' overhang removal stpes. Then the sequencing library was amplified with PCR enrichment.
Crosslinked/reversed DNA
Crosslinking was performed using 1% of forlmaldehyde
crp.ee.chipseq
crp.ee.input
crpfis.rep1.ee
crpfis.rep1.me
crpfis.rep2.ee
crpfis.rep2.me
crp.me.chipseq
crp.me,input
crp.me.input
crpmutant.fis.ee.chipseq
crpmutant.fis.ee.input
crpmutant.fis.me.chipseq
crpmutant.fis.me.input
crp.rep1.ee
crp.rep1.me
crp.rep2.ee
crp.rep2.me
crp___U_N0075_r1
crp___U_N0075_r2
crp___U_N0075_r3
crp upregulation, 0.075 ug/ml norfloxacin
CSH50 control E-minimal medium 90 min
CSH50 control (mock igG) E-minimal medium replicate 1
CSH50 control (mock igG) E-minimal medium replicate 2
CSH50 E-minimal medium pH 4.5 90 min
CSH50 E-minimal medium pH 4.5 90 min replicate 1
CSH50 E-minimal medium pH 4.5 90 min replicate 2
CSH50 E-minimal medium pH 4.5 90 min replicate 3
CSH50 E-minimal medium pH 7 90 min
CSH50 E-minimal medium pH 7 90 min replicate 1
CSH50 E-minimal medium pH 7 90 min replicate 2
CSH50 E-minimal medium pH 7 90 min replicate 3
CsiR_ChIPSeq
CsiR_RNASeq
cspF__U_N0075_r1
cspF__U_N0075_r2
cspF__U_N0075_r3
cspF upregulation, 0.075 ug/ml norfloxacin
csv files contain 16 columns of the data, each pair corresponds to the counts from the top (odd numbers) and bottom (even numbers) strand. The first pair corresponds to counts collected at 0 minutes after rifampicin addition. Similarly, the second, third, fourth, fifth, sixth, seventh, and eigth pairs correspond to counts collected at 2, 4, 6, 8, 10, 15, and 20 minutes after rifampicin addition. The ith row in each column corresponds to the number of alignments at the ith base in NC_000913.2.
ctrl1
ctrl2
ctrl3
cultivation: continuous cultivation, A-stat
cultivation: continuous cultivation, chemostat
culture: 18 h at 37°C
Culture cells
culture condition: Aerobic cultures
culture condition: Anaerobic cultures
culture condition: Anaerobic Cultures
culture condition: anaerobic fermentive condition
culture condition: nitrate respiratory condition
Culture conditions: 37 C with shaking at 220 RPM
culture conditions: aerobic
culture conditions: anaerobic
Cultured cells
Cultured cells (50 mL) were cross-linked with 1% formaldehyde at room temperature for 30 min and added 2 mL of 2.5M glycine to quench the unused formaldehyde. After washing  three times with 50 mL of ice-cold Tris-buffered saline (TBS), the washed cells were resuspended in 0.5 mL of lysis buffer composed of 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM EDTA, 1 μg/mL RNaseA, protease inhibitor cocktail and 1 kU Ready-Lyse lysozyme (Epicentre, Madison, WI) and incubated at 37oC for 30 min. The cells were then treated with 0.5 mL of 2×IP buffer (100 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM EDTA, 2%(v/v) Triton X-100, and protease inhibitor cocktail), followed by incubation on ice for 30 min. The lysate was then sonicated in an ice bath using Sonic Dismembrator Model 500 (four times for 20 s each, output level, 2.5). Size distribution of the fragmented DNAs was confirmed using agarose gel electrophoresis (200-400 bp) after removing cell debris by centrifugation.
culture denity: OD600=0.55-0.6 culture
cultured in: M9 minimal media with 0.2% acetate
cultured in: M9 minimal media with 0.2% fructose
cultured in: M9 minimal media with 0.2% glucose
Culture grown in 14 ml tube
Culture grown in 250 ml Erlenmeyer flask
culture/growth condition: Heatshock 15min
culture/growth condition: Heatshock 30min
culture/growth condition: Heatshock 60min
culture/growth condition: LB (OD=0.87)
culture/growth condition: MOPS-P 0h
culture/growth condition: MOPS-P 2h
culture/growth condition: MOPS-P 4h
culture media: 10% Luria broth
culture media: LB
culture media: LB with 2.5 mM Fumaric acid
Culture of bacterial strains (10 mL) were centrifuged 20 min at 10,000 g and bacterial pellets were washed 3 times with 2 mL of phosphate buffered saline (PBS). DNA extraction was performed using the EasyDNA kit (Invitrogen) following the manufacturer instructions slightly modified. Briefly, the bacterial pellet was incubated 5 min in 200 μL of PBS and 1 μL of protéinase K (20 mg/mL, Invitrogen). Then, bacteria were grinded 3 min with ~100 mg of 0.1 mm zirconia beads (BioSpec Products) using the model MM2000 BeadBeater instrument (Retsch). Concentration and quality of isolated gDNA were checked with the spectrophotometer Nanodrop 1000 (Thermo Fisher Scientific). Their integrity was verified by 1% agarose gel electrophoresis. gDNA were kept at -20°C.
Cultures (+A and -A) were incubated at 32°C with shaking for additional 15 min, then cells were pelleted by centrifugation at 10°C (4500xg) and resuspended in 10 ml of TES buffer (10 mM Tris-Cl pH7.5, 1 mM EDTA, 250 mM NaCl). Washing procedure was repeated twice to remove culture liquid and excess of gyrase poison.
Culture samples for microarray analysis were added to ice-cold 5% water-saturated phenol in ethanol solution, centrifuged at 6,600 g and the cell pellets flash frozen in liquid N2 before storing at -80 degrees C until required. Total RNA was isolated from the stored cell pellets using the hot phenol method, and labeled Cy3 and Cy5 cDNA was prepared from 16 ug total RNA with 10 ug random hexamer (Integrated DNA Technologies, Inc., Coralville, IA, USA).
Culture samples frozen in liquid methanol
Culture samples were transferred directly into an ice-cold ethanol/phenol stop solution, then collected by centrifugation and stored at -80°C until RNA extraction.
Cultures for samples 1 and 2 were incubated at 44°C for 45 min after growth.
Cultures grown in MOPS minimal glucose media containing 10 µM FeSO4
Cultures of both strains were started with a 2% overnight inoculum in LB media containing 35ug/ml chloramphenicol.
Cultures of Caulobacter (TLS1631-TLS1633) were grown at 30oC in PYE and supplemented with antibiotics, as necessary, at appropriate concentrations. To deplete wild-type non-tagged ParB, exponential-phase cells were washed off xylose and re-introduced to PYE+0.2% glucose for an additional 5 hours. After 4 hours, vanillate was added to induce the expression of flag-parB (WT) or flag-parB (G101S/R104A) for an hour. Cultures of Escherichia coli (TLS1637-TLS1650) were grown at 30oC in LB and supplemented with antibiotics, as necessary, at appropriate concentrations. IPTG (0.5mM) was added to induce the production of T18-ParB (WT) or T18-ParB (G101S). After an hour, formadehyde (1% final concentration) were added to fix cells for ChIP-seq.
Cultures of E. coli CFT073 were maintained at –80ºC in Luria-Bertani broth with 15% glycerol. Cultures were streaked onto LB agar plates and incubated (37°C, 24 h).  A single colony was inoculated into 150 mL of LB broth (in a 500 mL baffled flask).  Three inoculated flasks contained LB broth alone (controls), and three inoculated flasks were supplemented with cranberry derived PAC extract (100 µg/mL).Bacteria were incubated at 37°C, 5 h, 200 rpm to mid-log growth phase.
Cultures of E. coli MG1655 and its derivates were cross linked by addition of 27 µl of formaldehyde (37%) per ml medium (final concentration 1%). Crosslinking was performed at slow shaking (100 rpm) for 20 min followed by quenching with 0.2 ml of 2.5 M glycine per ml medium (final concentration 0.5 M). Cells were collected by centrifugation and washed twice with cold TBS (pH7.5). After resuspension in 1 ml lysis buffer (10mM Tris (pH 8.0), 20% sucrose, 50mM NaCl, 10mM EDTA, 10 mg/ml lysozyme) and incubation at 37 °C for 30 min C followed by addition of 4 ml IP buffer cells were sonicated on ice with 12 times 30 sec and 30 sec breaks at an UP 400s Ultrasonic processor (Dr. Hielscher GmbH) with 100% power. After centrifugation for 10 min at 9000 g, 800 µl aliquotes of the supernatant were stored at -20 °C. 800 µl of sonicated cell extract (see above) were incubated with 20 µl protein A/G agarose beads (Ultralink) and antibody rotating at 4 °C. Washing was done with 500 µl buffer (2 x 500 µl IP buffer [50 mM HEPES-KOH pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% Triton X 100, 0.1 % Sodium deoxycholate, 0.1 % SDS], 1 x IP buffer with 500mM NaCl, 1 x wash buffer [10mM Tris pH 8.0, 250 mM LiCl, 1 mM EDTA, 0.5% Nonidet-P40, 0.5% Sodium deoxycholate] and 1 x TE) followed by rotation at room temperature for three minutes with subsequent collection of the beads by centrifugation. For elution, 100 µl elution buffer (50 mM Tris (pH 7.5), 10 mM EDTA, 1% SDS) was added to the beads, incubated in a 65 °C water bath for 10 min and centrifuged as above. After reversion of crosslink the DNA was purified with phenol/chloroform.
Cultures of E. coli MG1655 and its derivates were cross linked by addition of 27 µl of formaldehyde (37%) per ml medium (final concentration 1%). Crosslinking was performed at slow shaking (100 rpm) for 20 min followed by quenching with 0.2 ml of 2.5 M glycine per ml medium (final concentration 0.5 M). Cells were collected by centrifugation and washed twice with cold TBS (pH7.5). After resuspension in 1 ml lysis buffer (10mM Tris (pH 8.0), 20% sucrose, 50mM NaCl, 10mM EDTA, 10 mg/ml lysozyme) and incubation at 37 °C for 30 min C followed by addition of 4 ml IP buffer cells were sonicated on ice with 12 times 30 sec and 30 sec breaks at an UP 400s Ultrasonic processor (Dr. Hielscher GmbH) with 100% power. After centrifugation for 10 min at 9000 g, 800 µl aliquotes of the supernatant were stored at -20 °C. 800 µl of sonicated cell extract (see above) were incubated with 20 µl protein A/G agarose beads (Ultralink) and antibody rotating at 4 °C. Washing was done with 500 µl buffer (2 x 500 µl IP buffer [50 mM HEPES-KOH pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% Triton X 100, 0.1 % Sodium deoxycholate, 0.1 % SDS], 1 x IP buffer with 500mM NaCl, 1 x wash buffer [10mM Tris pH 8.0, 250 mM LiCl, 1 mM EDTA, 0.5% Nonidet-P40, 0.5% Sodium deoxycholate] and 1 x TE) followed by rotation at room temperature for three minutes with subsequent collection of the beads by centrifugation. For elution, 100 µl elution buffer (50 mM Tris (pH 7.5), 10 mM EDTA, 1% SDS) was added to the beads, incubated in a 65 °C water bath for 10 min and centrifuged as above. After reversion of crosslink the DNA was purified with phenol/chloroform. METHOD DETAILS are given and are important for the different arrays.  METHOD DETAILS:  For RNAP old, SeqA old and SeqA old deltaSeqA:  Cell extracts were incubated with agarose beads and antibody over night. Samples were transferred to a Spin-X centrifuge column (Costar), centrifuged for 2 min at 4.000 rpm to collect the beads on the column. The flow through was removed. Washing was by adding the described buffers to the beads on the spin column and rotation at room temperature for three minutes with subsequent collection of the beads by centrifugation as above. For elution, 100 µl elution buffer was added to the column with the beads, incubated in a 65 °C water bath for 10 min and centrifuged as above. To prepare the control DNA, 800 µl of sonicated cell extract was incubated at 65 °C over night followed by 30 min after addition of 1 µl RNase A (20 mg/ml) and extraction with phenol/chloroform.  For SeqA new, SeqA new deltaSeqA, sigma32 30°C and sigma 32 43°C:  The ChIP protocol as described above resulted in the high background signal. The following modifications were applied. First, agarose beads were not collected on a spin column but instead at the bottom of a usual 1.5 ml reaction tube. The supernatant was than removed by pipetting. Second, the control DNA was taken from the supernatant resulting from centrifugation of the precipitated chromatin beads processed further as the immuno precipitated DNA after elution. Third, before addition of proteinase K sample and control DNA were incubated with RNase A (50 µg/ml) for at least 90 min at 42 °C. Incubation of 800 µl cell extract with σ32- or SeqA antiserum was for 1 h at 4 °C.  For sigma32 30°C short RNase and  sigma32 30°C short RNase:  The ChIP protocol was as described for sigma 32 30°C and sigma 32 43°C but with a shorter RNase A incubation for only 30 instead of 90 min.
Cultures were diluted into DNA-RNA Protect (Sierra Diagnostics) to inhibit RNA degradation and the RNA was purified using RNeasy minkits with the optional DNase treatment (Qiagen).
Cultures were grown aerobically at 37 °C in 1 L volumes of M9 minimal medium, supplemented with MgSO4 (1 mM), CaCl2 (0.1 mM), and glucose (10 g/L) in vigorously shaken (225 rpm) Fernbach flasks.
Cultures were grown to mid-log phase in Luria-Bertani (Miller) broth medium at 37C.
Cultures were grown to mid-log phase in Luria-Bertani (Miller) broth medium at 37C.  Cells were cultured with 25 ug/ml chloramphenicol to maintain selection. However, this genomic mutation is stable and RNA was prepared from non-selectively grown cultures inoculated with overnight stocks (grown with selection) to eliminate any unrelated effects of exogenous drugs on gene expression.
Cultures were grown to mid-log phase in Luria-Bertani (Miller) broth medium at 37C.  Cells were cultured with 25 ug/ml kanamycin to maintain selection.  However, this genomic mutation is stable and RNA was prepared from non-selectively grown cultures inoculated with overnight stocks (grown with selection) to eliminate any unrelated effects of exogenous drugs on gene expression.
Cultures were grown to the OD600 value of 1.0 and treated with 1% formaldehyde for 10 min. To quench the reaction, glycine was added at the final concentration of 0.125 M for 5 min. Cells were washed twice with lysis buffer (10 mM Tris-HCl (pH 7.4), 0.1 M NaCl, 1 mM EDTA and 0.5% Tween-20). The washed cells were then lysed with the lysis buffer containing 8 KU/ml lysozyme, 1 mM PMSF and protease inhibitor cocktail (Sigma) for 30 min at 4 ℃. The lysates were sonicated by a sonicator (Bioruptor) and this sonication resulted in the size of DNA ranged from 100 bps to 1000 bps with the average size of 500 bps. After sonication, the lysates were centrifuged at 12,000 g for 20 min at 4 ℃ and the resulting supernatant was used for immunoprecipitation. Before immunoprecipitation, the magnetic beads coated with Dynabeads Protein G (Invitrogen) were pre-incubated with 0.05 mg/ml anti-FLAG antibody (Sigma) and the lysates were also pre-cleared by incubating with the beads only. To immunoprecipitate the PhoB-FLAG-DNA complex, beads pre-incubated with antibody were added in both lysates of MG1655_PhoB_FLAG and MG1655 strains at 4 ℃ overnight. The beads were washed once with IP buffer (10 mM Tris-HCl (pH 7.4), 0.1 M NaCl, 1 mM EDTA, and 0.05% [v/v] Tween-20 and 1 mM fresh PMSF), twice with ChIP wash buffer I (10 mM Tris HCl (pH 7.4), 300 mM NaCl, 1 mM EDTA, 0.1% Tween-20 and 1 mM fresh PMSF), three times with ChIP wash buffer II (10 mM Tris-HCl (pH 7.4), 500 mM NaCl, 1 mM EDTA, 0.1% [v/v] Tween-20 and 1 mM fresh PMSF), once with ChIP wash buffer III (10 mM Tris-HCl (pH 7.4), 250 mM LiCl, 1 mM EDTA, 0.1% [v/v] Tween-20 and 1 mM fresh PMSF) and once with TE buffer (10 mM Tris-HCl (pH 7.4) and 1 mM EDTA). After removing the TE buffer, beads were incubated with elution buffer (50 mM Tris-HCl (pH 7.4), 10 mM EDTA and 1% SDS) at 65 ℃ for 15 min twice and then the resulting eluted solutions combined. After incubating with the final concentration of 10.5 U/ml proteinase K (Sigma) at 42 ℃ for 2 hours, the reverse cross-link procedure was performed by incubating at 65 ℃ overnight. Samples were then treated with the final concentration of 26 μg/ml RNase A (Sigma). The PCR purification kit (Qiagen) was used to purify DNA from the RNase A-treated samples.
Cultures were inoculated from a single colony, incubated overnight, sub-cultured with a 1% inoculum, and grown to the late exponential growth phase, corresponding to an OD600 nm of 0.6 – 0.7.
Cultures were maintained on tryptic soy agar (TSA) (Becton Dickinson, Le Pont Claix, France). Overnight cultures were grown in Difco Luria-Bertani (LB) broth (Lennox; Franklin Lakes, NJ, USA) at 37 °C aerobically on a shaker at 200 rpm. Bacteria (picked from 5-10 colonies) were suspended in 1 ml of PBS, yielding a suspension corresponding to the turbidity of McFarland 0.5, and diluted 1:100 in minimal salt (MS)-medium (~106 CFU/ml). The suspension was exposed to CORM-2 (250 µM) or vehicle (2.5% DMSO) for 4 hours at 37 °C. A volume (10 µl) was spread onto TSA-agar plates and incubated at 37 °C overnight. This procedure was repeated 10 times (10x, ~45 generations) or 20 times (20x, ~90 generations).
cultures were split into two 10 ml cultures. One half was treated with 2 mM NaN3 for 10 minutes and the other half was left untreated
Cultures were spun down at 4 °C, 15,000 × g for 3 minutes. Supernatants were discarded after centrifugation and cell pellets were flash frozen in liquid nitrogen for storage at -80 °C. Cells were lysed with 1 mg of lysozme (Sigma Aldrich L6871) in 10 mM Tris-HCl (pH 8.0) (USB 75825) supplemented with 0.1 mM EDTA (USB 15694). RNA was extracted with PureLink RNA Mini Kit (Life Technologies) and further purified and concentrated with RNA Clean & Concentrator-5 (Zymo Research) to assure sample quality. The purified RNA samples were analyzed using a Bioanalyzer (Agilent) and Ribo-Zero rRNA Removal Kit for bacteria (Illumina) was used to deplete rRNA from the samples.
Cultures were transferred directly into an ice-cold ethanol/phenol stop solution, which immediately inactivated cellular RNases. Cells were collected by centrifugation and stored at -80 oC until RNA extraction.
culture system: BACTEC
culture system: flask with continous shaking (250 rpm)
culture system: flask with continuous shaking (250 rpm)
culture system: static petri dish (disposable)
culture temperature: 30 °C for 60 min
culture temperature: 37°C
culture temperature: 42°C
culture temperature: 42 °C for 60 min
culture temperature: room temperature (20 C)
culture time: 18 h
culture type: Ancestor
culture type: coculture
culture type: evolved
culture type: monoculture
Custom anti-Fur antibodies were purified over a His6-Fur bound HiTrap NHS-activated HP column (GE Healthcare) as previously described (PMID: 21478858). Western blot analyses showed that the purified antibody was specific for Fur.
CV108_minus_aMG_1
CV108_minus_aMG_2
CV108_minus_aMG_3
CV108_plus_aMG_1
CV108_plus_aMG_2
CV108_plus_aMG_3
Cy3 and Cy5 intensities were normalized by scaling so that the 75th percentile in the Cy3 and Cy5 channels were equal.
Cy3 labeled EHEC grown in DMEM pH 7.4
Cy3 labeled EHEC grown in DMEM pH 7.4, 15 minutes
Cy3 labeled EHEC grown in DMEM pH 7.4, 90 minutes
Cy5 labeled EHEC acid-adapted in DMEM pH 5, followed by 30 minutes pH 3
Cy5 labeled EHEC acid-stressed in DMEM pH 3, 15 minutes
Cy5 labeled EHEC acid-stressed in DMEM pH 3, 30minutes
Cy5 labeled EHEC bile salt-stressed in DMEM, 90 minutes
cy_a4
cya mutant
cya.rep1.ee
cya.rep1.me
cya.rep2.ee
cya.rep2.me
cy_b4
cyc1
cyc2
cyc3
cyc4
cyd1
cyd2
cyd3
cyd4
cysA KO rep1
cysA KO rep2
cysA KO rep3
cysG KO LB rep1
cysG KO LB rep2
cysH KO LB rep1
cysH KO LB rep2
cysQ-gln-1
cysQ-gln-2
cysQ mutantin Ala media
cysQ mutantin Gln media
Cysteine addition
Cytidine addition
D1-ae10
D1-ae11
D1-ae12
D1+ae7
D1+ae8
D1+ae9
D1+AN
D1+AN2
D1+AN3
D1-AN4
D1-AN5
D1-AN6
D2_14_m10 [COPRO-Seq]
D2_14_m11 [COPRO-Seq]
D2_14_m12 [COPRO-Seq]
D2_14_m13 [COPRO-Seq]
D2_14_m1 [COPRO-Seq]
D2_14_m2 [COPRO-Seq]
D2_14_m3 [COPRO-Seq]
D2_14_m4 [COPRO-Seq]
D2_14_m5 [COPRO-Seq]
D2_14_m7 [COPRO-Seq]
D2_14_m8 [COPRO-Seq]
D2_14_m9 [COPRO-Seq]
D2_1_m12 [COPRO-Seq]
D2_1_m13 [COPRO-Seq]
D2_1_m1 [COPRO-Seq]
D2_1_m2 [COPRO-Seq]
D2_1_m3 [COPRO-Seq]
D2_1_m4 [COPRO-Seq]
D2_1_m5 [COPRO-Seq]
D2_1_m6 [COPRO-Seq]
D2_1_m7 [COPRO-Seq]
D2_1_m8 [COPRO-Seq]
D2_1_m9 [COPRO-Seq]
D2_2_m10 [COPRO-Seq]
D2_2_m12 [COPRO-Seq]
D2_2_m13 [COPRO-Seq]
D2_2_m1 [COPRO-Seq]
D2_2_m2 [COPRO-Seq]
D2_2_m3 [COPRO-Seq]
D2_2_m4 [COPRO-Seq]
D2_2_m5 [COPRO-Seq]
D2_2_m6 [COPRO-Seq]
D2_2_m7 [COPRO-Seq]
D2_2_m8 [COPRO-Seq]
D2_2_m9 [COPRO-Seq]
D2_4_m10 [COPRO-Seq]
D2_4_m11 [COPRO-Seq]
D2_4_m12 [COPRO-Seq]
D2_4_m13 [COPRO-Seq]
D2_4_m1 [COPRO-Seq]
D2_4_m3 [COPRO-Seq]
D2_4_m4 [COPRO-Seq]
D2_4_m5 [COPRO-Seq]
D2_4_m6 [COPRO-Seq]
D2_4_m7 [COPRO-Seq]
D2_4_m8 [COPRO-Seq]
D2_4_m9 [COPRO-Seq]
D2_7_m10 [COPRO-Seq]
D2_7_m11 [COPRO-Seq]
D2_7_m12 [COPRO-Seq]
D2_7_m13 [COPRO-Seq]
D2_7_m1 [COPRO-Seq]
D2_7_m3 [COPRO-Seq]
D2_7_m4 [COPRO-Seq]
D2_7_m5 [COPRO-Seq]
D2_7_m6 [COPRO-Seq]
D2_7_m8 [COPRO-Seq]
D2_7_m9 [COPRO-Seq]
D3_10_m1
D3_10_m10
D3_10_m11
D3_10_m12
D3_10_m13
D3_10_m2
D3_10_m3
D3_10_m4
D3_10_m5
D3_10_m6
D3_10_m7
D3_10_m8
D3_10_m9
D3_14_m10 [COPRO-Seq]
D3_14_m11 [COPRO-Seq]
D3_14_m12 [COPRO-Seq]
D3_14_m13 [COPRO-Seq]
D3_14_m2 [COPRO-Seq]
D3_14_m3 [COPRO-Seq]
D3_14_m4 [COPRO-Seq]
D3_14_m5 [COPRO-Seq]
D3_14_m6 [COPRO-Seq]
D3_14_m7 [COPRO-Seq]
D3_14_m8 [COPRO-Seq]
D3_14_m9 [COPRO-Seq]
D3_1_m10 [COPRO-Seq]
D3_1_m11 [COPRO-Seq]
D3_1_m13 [COPRO-Seq]
D3_1_m1 [COPRO-Seq]
D3_1_m2 [COPRO-Seq]
D3_1_m3 [COPRO-Seq]
D3_1_m4 [COPRO-Seq]
D3_1_m5 [COPRO-Seq]
D3_1_m6 [COPRO-Seq]
D3_1_m7 [COPRO-Seq]
D3_1_m8 [COPRO-Seq]
D3_2_m10 [COPRO-Seq]
D3_2_m11 [COPRO-Seq]
D3_2_m12 [COPRO-Seq]
D3_2_m13 [COPRO-Seq]
D3_2_m2 [COPRO-Seq]
D3_2_m4 [COPRO-Seq]
D3_2_m5 [COPRO-Seq]
D3_2_m6 [COPRO-Seq]
D3_2_m7 [COPRO-Seq]
D3_4_m10 [COPRO-Seq]
D3_4_m11 [COPRO-Seq]
D3_4_m12 [COPRO-Seq]
D3_4_m13 [COPRO-Seq]
D3_4_m1 [COPRO-Seq]
D3_4_m2 [COPRO-Seq]
D3_4_m3 [COPRO-Seq]
D3_4_m4 [COPRO-Seq]
D3_4_m5 [COPRO-Seq]
D3_4_m6 [COPRO-Seq]
D3_4_m7 [COPRO-Seq]
D3_4_m8 [COPRO-Seq]
D3_4_m9 [COPRO-Seq]
D3_7_m10 [COPRO-Seq]
D3_7_m11 [COPRO-Seq]
D3_7_m12 [COPRO-Seq]
D3_7_m13 [COPRO-Seq]
D3_7_m1 [COPRO-Seq]
D3_7_m2 [COPRO-Seq]
D3_7_m3 [COPRO-Seq]
D3_7_m4 [COPRO-Seq]
D3_7_m5 [COPRO-Seq]
D3_7_m6 [COPRO-Seq]
D3_7_m9 [COPRO-Seq]
D3+ae19
D3+ae20
D3+ae21
D3-ae22
D3-ae23
D3-ae24
D3+AN13
D3+AN14
D3+AN15
D3-AN16
D3-AN17
D3-AN18
D4_10_m1
D4_10_m10
D4_10_m11
D4_10_m12
D4_10_m13
D4_10_m2
D4_10_m3
D4_10_m4
D4_10_m5
D4_10_m6
D4_10_m7
D4_10_m8
D4_10_m9
D4_14_m10 [COPRO-Seq]
D4_14_m11 [COPRO-Seq]
D4_14_m12 [COPRO-Seq]
D4_14_m13 [COPRO-Seq]
D4_14_m1 [COPRO-Seq]
D4_14_m2 [COPRO-Seq]
D4_14_m3 [COPRO-Seq]
D4_14_m5 [COPRO-Seq]
D4_14_m6 [COPRO-Seq]
D4_14_m7 [COPRO-Seq]
D4_14_m8 [COPRO-Seq]
D4_14_m9 [COPRO-Seq]
D4_1_m10 [COPRO-Seq]
D4_1_m11 [COPRO-Seq]
D4_1_m12 [COPRO-Seq]
D4_1_m13 [COPRO-Seq]
D4_1_m7 [COPRO-Seq]
D4_1_m8 [COPRO-Seq]
D4_1_m9 [COPRO-Seq]
D4_2_m10 [COPRO-Seq]
D4_2_m11 [COPRO-Seq]
D4_2_m12 [COPRO-Seq]
D4_2_m13 [COPRO-Seq]
D4_2_m2 [COPRO-Seq]
D4_2_m3 [COPRO-Seq]
D4_2_m4 [COPRO-Seq]
D4_2_m5 [COPRO-Seq]
D4_2_m6 [COPRO-Seq]
D4_2_m7 [COPRO-Seq]
D4_2_m8 [COPRO-Seq]
D4_2_m9 [COPRO-Seq]
D4_4_m10 [COPRO-Seq]
D4_4_m12 [COPRO-Seq]
D4_4_m13 [COPRO-Seq]
D4_4_m2 [COPRO-Seq]
D4_4_m4 [COPRO-Seq]
D4_4_m5 [COPRO-Seq]
D4_4_m6 [COPRO-Seq]
D4_4_m7 [COPRO-Seq]
D4_4_m8 [COPRO-Seq]
D4_4_m9 [COPRO-Seq]
D4_7_m1 [COPRO-Seq]
D4_7_m2 [COPRO-Seq]
D4_7_m3 [COPRO-Seq]
D4_7_m4 [COPRO-Seq]
D4_7_m5 [COPRO-Seq]
D4_7_m6 [COPRO-Seq]
dam___U_N0075_r1
dam___U_N0075_r2
dam___U_N0075_r3
dam upregulation, 0.075 ug/ml norfloxacin
∆dapF parent Sample 28
∆dapF parent Sample 47
∆dapF parent Sample 9
dapF suppressor 1-1 Sample 10
dapF suppressor 1-1 Sample 29
dapF suppressor 1-1 Sample 48
dapF suppressor 3-1 Sample 11
dapF suppressor 3-1 Sample 30
dapF suppressor 3-1 Sample 49
Data analysis was carried out using the Agilent GeneSpring GX. Robust Multi-array Average (RMA) normalization performed using of signal intensity spot data which obtained by scanning process and it is indicated as a scatter plot data. Distribution of all genes which obtained result of the experiment is indicated as a histogram. Accuracy of the results of the experiment was determined through comparison of the histogram with the scatter plot data.
Data analysis was done using R language and environment for a statistical computing and Bioconductor.  Array data were normalized with gcRMA method.
Data collapsed using fastx collapser to remove identical sequencing reads (http://hannonlab.cshl.edu/fastx_toolkit/index.html) - Example: fastx_collapser -i DL4900_clipped.fasta -o DL4900_clip_clp.fasta
Data extraction from Images was done using Feature Extraction software v 9.5.1 of Agilent. Feature extracted raw data was analyzed using GeneSpring GX V 7.3.1 software from Agilent. Normalization of the data was done in GeneSpring GX using the recommended one color Per Chip and Per Gene Data Transformation: Set measurements less than 0.01 to 0.01, Per Chip: Normalize to 50th percentile, Per Gene: Normalize to Specific Samples. Significant genes up and down regulated showing one fold and above among the samples was identified.
Data filtered for PCR success, >3x local background and spot quality (GenePix Flag). Normalized using Lowess smoothing from MA plot
Data filtering was done with in-house script with the set value as follows: Removal if % of N nucleotide is more than 10%, if more than 40% of the nucleotide is Q20 or less, if average quality of the reads is less than Q20.
Data from two independent experiments were normalized and then analyzed using the GenePix Pro 3.0 software (Axon Instruments).
Data has not been processed other than those protocols within GCOSv1.4
Data included in file has not been processed other than those protocols within GCOSv1.4
Data obtained from E. coli O157:H7 microarrays were normalized using the Ratio-based and Lowess methods in Acuity 3.1 (Axon instruments) before analysis. The normalized data for all strains were converted into log2 (Fluor 647/Fluor 546) in Acuity 3.1 and subsequently analyzed in Microsoft Excel. Control, blank, and test spots with a mean intensity below that of the mean of all negative controls were removed from the analysis. The arithmetic mean of the remaining spots across the duplicates was taken to construct the dataset. GACK (Genomotyping Analysis by Charles Kim), was used to generate a cut off value determining the presence or absence of genes, and a dendrogram using the Euclidean distance metric with average linkage was created with tMEV v4.1.
Data processed with FeatureExtraction v9.5.1 and quantile normalized using R2.6.1 statistical software
Data quantification was performed using Agilent Feature Extraction software 9.3.2.1 (Agilent Technology, USA). The average fluorescence intensity for each spot was calculated and local background was subtracted. All data normalization and selection of fold-changed genes were performed using GeneSpringGX 7.3.1 (Agilent Technology, USA). Normalization for Agilent one-color method was performed, which is Data transformation. Set measurements less than 5.0 to 5.0 and Per Chip : Normalize to 50th percentage. Reliable genes were filtered by flag as following the Agilent manual.
Data = read.madata(\
Data selection
Datasets were normalized using locally weighted linear regression (LOWESS) normalization on raw Cy3 and Cy5 signals to correct for intensity-dependent dye effects within each array using the “normalizeWithinArrays” function in the limma package for the statistical program R (v.2.14.2).
Data was analysed using GeneSpring
Data was analyzed in the Affymetrix GenomeChipOperating Software (GCOS).
Data was analyzed in the software Acuity 4.0 (Molecular Devices, Sunnyvale, CA). Hybridized spots for E. coli K12 having a high QC (quality control) value >0.1, good flag tags (A, B and C) in both Cy3/Cy5 channels were chosen for analysis. LOWESS normalization was performed with three iterations using a smoothing factor of 0.4.  One sample t-tests were performed across replicates. P-value of 0.05 was chosen as the significant level.
Data was analyzed in the software Acuity 4.0 (Molecular Devices, Sunnyvale, CA). LOWESS normalization was performed with three iterations using a smoothing factor of 0.4. Hybridized spots having a high QC (quality control) value >0.1, good flag tags (A, B and C) in both Cy3/Cy5 channels were chosen for further analysis. One sample t-tests were performed across replicates. Step-down Bonferroni-Holm was used for the correction of multiple hypotheses testing. Only oligonucleotides for E. coli K12 were choosen to draw conclusion.
Data was analyzed with RMA using the program Partek 6.6
Data was extracted with Agilent Feature Extraction software 10.7 (Agilent) using default parameters (protocol GE1-v1_91) to obtain background subtracted and spatially detrended Processed Signal intensities. Features flagged in Feature Extraction as Feature Non-uniform outliers were excluded.
Data was obtained using the GeneChip® Command Console and Expression Console Software (AGCC; Version 3.2 and Expression Console; Version 1.2) using the MAS5 algorithm to generate .CHP files.
Data was processed by MATLAB to median normalize each channel and lowess normalize the sample set.
Data were analyzed by Feature Extraction V.11.5.1.1. RNA
Data were analyzed using custom software based on the R programming environment and BioConductor packages. Each probe was randomly spotted in three to five replicates to control for positional effects on the array. Data from replicate probes were summarized by the median of the log2-transformed intensities. No normalization or background correction was performed.
Data were analyzed using GeneChip Operating Software Version 1.4 (Affymetrix)
Data were analyzed with RMA (Robust Multiarray Analysis) using Affymetrix default analysis settings and global scaling as normalization method.
Data were extracted in GenePix 4100A scanning software and normalized using the lowess method implemented in TM4 MIDAS
Data were extracted with Feature Extraction software 10.7 (Agilent technologies, Santa Clara, CA, US). Raw data were normalized by Quantile algorithm, GeneSpring Software 11.0 (Agilent technologies, Santa Clara, CA, US).
Data were normalized using LOWESS (MIDAS) and analyzed for statistical significance using the Rank Product method in the MultiExperimentViewer
Data were normalized using RMA algorithm from R/Bioconductor/XPS package.
Data were normalized using the LOWESS algorithm and analyzed for statistical significance using the MeV package
Data were processed using Affymetrix apt-probeset-summarize software version 1.10 and RMA algorithm. Samples were normalized using the standard normalization probes present on the Affymetrix GeneChip.
Data were processed using the robust multiarray average algorithm (RMA) for normalization, background correction and expression value calculation. The EB (Wright and Simon) test was used for the fold change and the p­value calculation,
Data were visualized in the Rockhopper IGV genome browser (McClure et al., 2013) and TreeView 3.0 (Saldana et al., 2004).
day: . strain: . oxygen: .
dcd KO LB rep1
dcd KO LB rep2
dcd KO M9 rep1
dcd KO M9 rep2
DdksA cells were grown in MOPS medium with 0.2% glucose, leucine, isoleucine, valine, glycine, phenylalanine, threonine (40 mg/ml) and uracil (50 mg/ml) until mid-log phase and treated with 0.5mg/ml serine hydroxamate (SHX) for 20min at 37°C with vigorous shaking.
DdksA cells were grown in MOPS medium with 0.2% glucose, leucine, isoleucine, valine, glycine, phenylalanine, threonine (40 mg/ml) and uracil (50 mg/ml) until mid-log phase at 37°C with vigorous shaking.
DdksA cells were grown in MOPS medium with 0.2% glucose, leucine, isoleucine, valine, glycine, phenylalanine, threonine (40 mg/ml) and uracil (50 mg/ml) until mid-log phase (OD600~0.4) at 37°C with vigorous shaking.
Deconvolute peaks in close proximity, dPeak
Deer feces isolate D1
Deer feces isolate D3
Deer feces isolate W6A
Deer III versus MG1655 technical replicate 1
Deer III versus MG1655 technical replicate 2
Deer II versus MG1655 technical replicate 1
Deer II versus MG1655 technical replicate 2
Deer I versus MG1655 technical replicate 1
Deer I versus MG1655 technical replicate 2
Delta dksA Cells
Delta dksA Cells Replicate 1
Delta dksA Cells Replicate 2
Delta dksA Cells Replicate 3
delta hfq
Delta hfq
deltamatP 22°C
delta-rnr mutant_anoxic (NO3)_glycerol
delta-rnr mutant_anoxic (NO3)_glycerol + propionate
delta-rnr mutant_oxic_glycerol
delta-rnr mutant_oxic_glycerol + propionate
Delta rseA
Demultiplexing
Depletion of ribosomal RNA was accomplished with the Ribominus Transcriptome Isolation Kit (Thermo Fisher) followed by ethanol precipitation. A stranded library was prepared using a ScriptSeq kit (Illumina) using manufacturer’s recommended protocols.  Each sample was tagged with a six nucleotide barcode unique to each sample to allow multiplexing. The products are purified and enriched by PCR to create the final cDNA library. Final libraries were checked for quality and quantity by TapeStation (Agilent) and qPCR using Kapa’s library quantification kit for Illumina Sequencing platforms (Kapa Biosystems) following the manufacturer's recommended protocols.  Six samples were sequenced per lane on a 50 cycle single end run on a HiSeq 2500 (Illumina) in high output mode using version 4 reagents.
Desulfovibrio piger GOR1
Detailed parameters for reads mapping: bowtie2 -x ATCC8739 -1 X_1.fq -2 X_2.fq --no-mixed -p 2 -S X.sam
developmental stage: mixed population, exponential phase
DGE analysis used a false-discovery rate (FDR) of 0.10.
∆dgk parent Sample 16
∆dgk parent Sample 35
∆dgk parent Sample 54
dgk suppressor 1-1 Sample 17
dgk suppressor 1-1 Sample 36
dgk suppressor 1-1 Sample 55
dgk suppressor 2-1 Sample 18
dgk suppressor 2-1 Sample 37
dgk suppressor 2-1 Sample 56
dgk suppressor 3-1 Sample 19
dgk suppressor 3-1 Sample 38
dgk suppressor 3-1 Sample 57
DH1-log
DH1-log-tr
DicF rep1
DicF rep2
DicF rep3
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => APPLE:250,OAT:250,RICE:250,BEEF:250
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => APPLE:250,RICE:250,OAT:250,BEEF:250
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => APPLE:250,RICE:250,PEACH:250,CHICK:250
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => APPLE:666.7,BEEF:222.2,CHICK:55.6,PEACH:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => APPLE:666.7,OAT:222.2,CHICK:55.6,BEEF:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => APPLE:666.7,PEACH:222.2,CHICK:55.6,RICE:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => APPLE:666.7,PEACH:222.2,CHICK:55.6,SWEET_POTATO:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => BEEF:250,PEA:250,CHICK:250,OAT:250
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => BEEF:666.7,PEACH:222.2,SWEET_POTATO:55.6,RICE:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => BEEF:666.7,RICE:222.2,PEA:55.6,CHICK:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => CHICK:421.1,BEEF:421.1,PEA:105.3,APPLE:52.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => CHICK:666.7,PEACH:222.2,BEEF:55.6,RICE:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => CHICK:666.7,PEACH:222.2,RICE:55.6,OAT:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => CHICK:666.7,SWEET_POTATO:222.2,RICE:55.6,OAT:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => OAT:421.1,APPLE:421.1,BEEF:105.3,RICE:52.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => OAT:421.1,RICE:421.1,CHICK:105.3:APPLE:52.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => OAT:666.7,RICE:222.2,BEEF:55.6,SWEET_POTATO:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => PEA:250,OAT:250,BEEF:250,CHICK:250
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => PEA:421.1,CHICK:421.1,RICE:105.3,PEACH:52.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => PEA:666.7,APPLE:222.2,SWEET_POTATO:55.6,PEACH:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => PEA:666.7,CHICK:222.2,OAT:55.6,SWEET_POTATO:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => PEA:666.7,PEACH:222.2,CHICK:55.6,OAT:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => PEA:666.7,RICE:222.2,APPLE:55.6,BEEF:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => PEA:666.7,RICE:222.2,SWEET_POTATO:55.6,PEACH:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => PEACH:250,OAT:250,RICE:250,SWEET_POTATO:250
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => PEACH:421.1,BEEF:421.1,OAT:105.3,RICE:52.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => PEACH:421.1,OAT:421.1,SWEET_POTATO:105.3,BEEF:52.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => PEACH:666.7,OAT:222.2,SWEET_POTATO:55.6,CHICK:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => PEACH:666.7,PEA:222.2,APPLE:55.6,CHICK:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => PEACH:666.7,PEA:222.2,OAT:55.6,RICE:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => PEACH:666.7,PEA:222.2,RICE:55.6,BEEF:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => RICE:666.7,APPLE:222.2,SWEET_POTATO:55.6,BEEF:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => SWEET_POTATO:250,APPLE:250,PEACH:250,BEEF:250
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => SWEET_POTATO:250,BEEF:250,PEACH:250,RICE:250
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => SWEET_POTATO:421.1,OAT:421.1,CHICK:105.3,RICE:52.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => SWEET_POTATO:421.1,RICE:421.1,CHICK:105.3,PEA:52.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => SWEET_POTATO:666.7,APPLE:222.2,BEEF:55.6,PEACH:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => SWEET_POTATO:666.7,CHICK:222.2,BEEF:55.6,PEA:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => SWEET_POTATO:666.7,OAT:222.2,PEACH:55.6,PEA:55.6
diet: Mouse was fed a meal of human pureed food in the following concentrations (g/kg) => SWEET_POTATO:666.7,RICE:222.2,PEACH:55.6,BEEF:55.6
diet: Mouse was fed Harlan Teklad Diet TD.09049
diet: Mouse was fed Harlan Teklad Diet TD.09050
diet: Mouse was fed Harlan Teklad Diet TD.09051
diet: Mouse was fed Harlan Teklad Diet TD.09052
diet: Mouse was fed Harlan Teklad Diet TD.09053
diet: Mouse was fed Harlan Teklad Diet TD.09054
diet: Mouse was fed Harlan Teklad Diet TD.09055
diet: Mouse was fed Harlan Teklad Diet TD.09055.
diet: Mouse was fed Harlan Teklad Diet TD.09056
diet: Mouse was fed Harlan Teklad Diet TD.09057
diet: Mouse was fed Harlan Teklad Diet TD.09057.
diet: Mouse was fed Harlan Teklad Diet TD.09058
diet: Mouse was fed Harlan Teklad Diet TD.09059
diet: Mouse was fed Harlan Teklad Diet TD.09620
diet: Mouse was fed Harlan Teklad Diet TD.09621
diet: Mouse was fed Harlan Teklad Diet TD.09622
diet: Mouse was fed Harlan Teklad Diet TD.09623
diet: Mouse was fed Harlan Teklad Diet TD.09624
diet: Mouse was fed Harlan Teklad Diet TD.09625
Differential expression analysis was carried out using cuffdiff v.2.0.2 with upper-quartile normalization and fr-firststrand for library type
Differential expression analysis was performed with R (version 3.1.1) and edgeR (version 3.8.5) (Bioconductor).
Differential expression analysis with DESeq (Anders and Huber 2010)  with the default setting
Differential expression between aerobic and anaerobic environments was identified by using DESeq2 (Love M, Huber W and  Anders S, 2014)
differential expression: Bioconductor package edgeR (version 3.2.3); default parameters
Differential expression testing between sample groups was performed in Rstudio (v. 1.0.36) using DESeq2 (v.1.14.1)
Differential gene expression (DGE) was then performed on fragments per kilobase mapped (FPKM) values in Cufflinks’ Cuffdiff package (version 0.0.7).
Differentially expressed (DE) genes in all stress evolved strains were found relative to the expression levels in the reference G500 strain using the edgeR R package.
Differentially expressed genes were identified by processing raw counts of mapped reads with edgeR R library version 2.6.9. Normalized counts for each biological replicate were averaged between two technical replicates.
Dilution rate = 0.14/h
dinI___U_N0025_r1
dinI___U_N0025_r2
dinI___U_N0025_r3
dinI upregulation, amp 50ug/ml, 0.0125% arabinose, 0.025ug/ml norfloxacin OD ~0.3
dinP___U_N0025_r1
dinP___U_N0025_r2
dinP___U_N0025_r3
dinP upregulation, amp 50ug/ml, 0.0125% arabinose, 0.025ug/ml norfloxacin OD ~0.3
Direct testing of culture broth (Standard) or after centrifugation of culture broth (Supernatant)
disease state: control
disease state: cystic fibrosis
Dividing t=2 hours
DksA ChIP DNA from DdksA cells
DksA ChIP DNA from wt cells
DksA_DdksA_untreated
DksA_wt_untreated_rep1
DksA_wt_untreated_rep2
DL4184 biological repeat 1 RecA ChIP
DL4184 biological repeat 2 RecA ChIP_reanalyzed
DL4184C_ChIP-seq
DL4201 biological repeat 1 RecA ChIP
DL4201 biological repeat 2 RecA ChIP_reanalyzed
DL4201C_ChIP-seq
DL4311C_ChIP-seq
DL4312C_ChIP-seq
DL4899
DL4900
DL4900_input
DL5215
DL5322
DL5324
DL5326
DL5328
DL5330
DL5699 biological repeat 1 RecA ChIP
DL5699 biological repeat 2 RecA ChIP
DL6204 biological repeat 1 RecA ChIP
DL6204 biological repeat 2 RecA ChIP
DMS-MaPSeq of purified cspA mRNA at 10°C
DMS-MaPSeq of purified cspA mRNA at 10°C, rep1
DMS-MaPSeq of purified cspA mRNA at 10°C, rep2
DMS-MaPSeq of purified cspA mRNA at 10°C, rep 3
DMS-MaPSeq of purified cspA mRNA at 10°C, rep 4
DMS-MaPSeq of purified cspA mRNA at 10°C with 0.025mM CspA protein
DMS-MaPSeq of purified cspA mRNA at 10°C with 0.05mM CspA protein
DMS-MaPSeq of purified cspA mRNA at 10°C with 0.1mM CspA protein
DMS-MaPSeq of purified cspA mRNA at 10°C with 0.1mM CspA protein, rep1
DMS-MaPSeq of purified cspA mRNA at 10°C with 0.1mM CspA protein, rep 2
DMS-MaPSeq of purified cspA mRNA at 10°C with 0.1mM CspA protein, rep 3
DMS-MaPSeq of purified cspA mRNA at 10°C with 0.1mM CspA protein, rep 4
DMS-MaPSeq of purified cspA mRNA at 37°C
DMS-MaPSeq of purified cspA mRNA at 37°C, rep1
DMS-MaPSeq of purified cspA mRNA at 37°C, rep 2
DMSO_0min_rep1
DMSO_0min_rep2
DMSO_0min_rep3
DMSO_60min_rep1
DMSO_60min_rep2
DMSO_60min_rep3
DMSO_60min_rep4
DMSO-Only Treatment
DMSO treatment, 0 min, replicate 1
DMSO treatment, 0 min, replicate 2
DMSO treatment, 0 min, replicate 3
DMSO treatment, 60 min, replicate 1
DMSO treatment, 60 min, replicate 2
DMSO treatment, 60 min, replicate 3
DMSO treatment, 60 min, replicate 4
DMS-seq 30 min after shift to 10°C in WT cells
DMS-seq 6 hr after shift to 10°C in WT cells
DMS-seq 8 hr after shift to 10°C in ∆cspABEG cells
DMS-seq 8 hr after shift to 10°C in ∆cspBG cells
DMS-seq 8 hr after shift to 10°C in WT cells
DMS-seq of purified mRNA in vitro at 10°C, rep1
DMS-seq of purified mRNA in vitro at 10°C, rep2
DMS-seq of WT cells after kasugamycin treatment at 10°C
DMS-seq (Ribo- RNA)
DMS-seq (Total RNA)
dnaA__U_N0075_r1
dnaA__U_N0075_r2
dnaA__U_N0075_r3
dnaA upregulation, 0.075 ug/ml norfloxacin
dnaB-Ts_30°C
dnaB-Ts_42°C
dnaB-Ts ΔahpC_30°C
dnaB-Ts ΔahpC_42°C
dnaC2 30' at 30 deg, 2 ug gen DNA, pdN6 RT
dnaC2 90' at 42 deg, 2 ug gen DNA, pdN6 RT
dnaC2 synchrony 30' after shift, print 7 array
dnaC fully replicated, 2 ug Sau3AI, pdN6 RT
dnaC fully replicated, 2 ug Say3AI, pdN6 RT
dnaC genomic DNA, Sau3A, 2 ug
DNA detected with GyrA immunoglobulin
DNA extraction: Genomic DNA was isolated and purified according to standard procedures (Ausubel et al. 1994).  Genomic DNA was fragmented by nebulization as described by Girgis et al. PLoS Genetics 3(9): e154 (2007) and purified by phenol/chloroform extraction and ethanol precipitated.
DNA fragments were treated with Epicentre End-It DNA End Repair Kit and 3’ A overhangs were added with DNA polymerase I (Klenow fragment).  Adapters from the IlluminaTruSeq DNA sample preparation kit were ligated using LigFast (Promega) and DNAs were amplified by PCR using primers provided in the IlluminaTruSeq DNA sample preparation kit and Phusion DNA polymerase (NEB).  Products of the ligation reaction and PCR amplification in the range 300-400 bp were purified by 2% agarose gel electrophoresis.  DNA concentrations were measured using Qubit™ dsDNA HS Assay Kits (Invitrogen).
dnaJ-ala-1
dnaJ-ala-2
dnaJ-gln-1
dnaJ-gln-2
dnaJ mutant in Ala media
dnaJ mutant in Gln media
DnaK deletant_37C
DNA libraries were prepared for sequencing using standard Illumina protocols by FASTERIS SA, Switzerland
dnaN__U_N0075_r1
dnaN__U_N0075_r2
dnaN__U_N0075_r3
dnaN upregulation, 0.075 ug/ml norfloxacin
DNA samples were submitted to the University of Wisconsin-Madison DNA Sequencing Facility for ChIP-seq library preparation. All libraries were generated using reagents from the Illumina Paired End Sample Preparation Kit (Illumina) and the Illumina protocol “Preparing Samples for ChIP Sequencing of DNA” (Illumina part # 11257047 RevA) as per the manufacturer’s instructions, except products of the ligation reaction were purified by gel electrophoresis using 2% SizeSelect agarose gels (Invitrogen) targeting 50 bp fragments.  After library construction and amplification, quality and quantity were assessed using an Agilent DNA 1000 series chip assay (Agilent) and QuantIT PicoGreen dsDNA Kit (Invitrogen), respectively, and libraries were standardized to 10μM.  Cluster generation was performed using a cBot Single Read Cluster Generation Kit (v4) and placed on the Illumina cBot.  For aerobic and anaerobic replicates A, a single read, 50 bp run was performed, using standard SBS kits (v4) and SCS 2.6 on an Illumina Genome Analyzer IIx. For aerobic and anaerobic replicates B and C, the input, and the anaerobic, iron deficient samples, a single read, 50 bp run was performed, using standard SBS kits (v3) and SCS 1.8.2 on an Illumina HiSeq2000.
dnaT__U_N0075_r1
dnaT__U_N0075_r2
dnaT__U_N0075_r3
dnaT upregulation, 0.075 ug/ml norfloxacin
DNA was extracted from resulting supernatant with phenol/chlorophorm method followed by ethanol precipitation. Mock controls (-IP) were made both for +A and for -A: 100 μl aliquots of lysates obtained after sonication were deproteinized and DNA was purified as described earlier. The procedure described gives a quartet of samples (+A+IP, +A-IP, -A+IP, -A-IP), where +A-IP, -A+IP, and -A-IP serves as controls for gyrase poison action and immunoprecipitation.
DNA was extracted in the same manner as described by McNulty et al. (PMID: 22030749).
DNA was isolated using the Qiagen Cell Lysis and Protein Precipitation solutions. Detailed protocols are listed in the Supplementary Materials
DNA was removed with Dnase I. rRNA was removed with the gram-negative RiboZero kit. Libraries were prepared with the RNAUltra directional kit from New England Biolabs for total RNA sequencing. For signal peptide fusions, cDNA was constructed using primers that target the signal-peptide-coding/barcode region of the fusion RNAs.
DNA were extracted and purified as described by Muniesa et al. (2003). Shiga toxin 2-converting bacteriophages associated with clonal variability in Escherichia coli O157:H7 strains of human origin isolated from a single outbreak. Infect Immun 71, 4554-4562.
DNA were submitted to the Joint Genome Institute for ChIP-seq library preparation.  Samples were sheared to 200-500 nt during the IP process to facilitate library preparation.  All libraries were generated using reagents from the Illumina Paired End Sample Preparation Kit (Illumina) and the Illumina protocol “Preparing Samples for ChIP Sequencing of DNA” (Illumina part # 11257047 RevA) as per the manufacturer’s instructions, except products of the ligation reaction were purified by gel electrophoresis using 2% SizeSelect agarose gels (Invitrogen) targeting either 275 bp fragments (s70 libraries).  After library construction and amplification, quality and quantity were assessed using an Agilent DNA 1000 series chip assay (Agilent) and QuantIT PicoGreen dsDNA Kit (Invitrogen), respectively, and libraries were standardized to 10μM.  Cluster generation was performed using a cBot Single Read Cluster Generation Kit (v4) and placed on the Illumina cBot.  A single read, 36 bp run was performed, using standard SBS kits (v4) and SCS 2.6 on an Illumina Genome Analyzer IIx. Basecalling was performed using the standard Illumina Pipeline version 1.6.
DNeasy (Qiagen)
Donor was transformed with a random genomic library made from E. coli and stored as glycerol stocks. The library was revived and transferred to four recipient strains using conjugation; the donor was miniprepped at this time, and the recipients were miniprepped after outgrowth under dual selection. Two recipient libraries in BWG and BWY were propagated under n-butanol stress for three days, and then miniprepped as well.
double mutant (PPK1 and PPX)
Double stranded cDNA was generated using Superscript II (Invitrogen) to generate the first strand followed by E. coli DNA polymerase, RNaseH, and E.coli DNA ligase (NEB) to generate the second strand.
Double stranded cDNA was generated using Superscript II (Invitrogen) to generate the first strand followed by E. coli DNA polymerase, RNaseH, and E.coli DNA ligase (NEB) to generate the second strand.isoamyl alcohol (25:24:1, pH 8.0; Ambion) and lysed by using a bead beater (BioSpec Products). Cellular debris was removed by centrifugation (8,000g; 3 min). The nucleic acids were precipitated with isopropanol and sodium acetate and resuspended in 100 ul TE. The resuspension was further purified with a Qiagen PCR column and eluted into 30 ul of EB buffer.
dpiA 2x Overexpression pHI1429 in LB at 37 Mid Log Phase
dpiAoverexpressor
d_rnr NO3 1
d_rnr NO3 2
d_rnr NO3 w/propionate 1
d_rnr NO3 w/propionate 2
d_rnr O2 1
d_rnr O2 2
d_rnr O2 w/propionate 1
d_rnr O2 w/propionate 2
Drug: bicyclomycin
Drug: none
DSP1_AP
DSP1_Total
DSP2_AP
DSP2_Total
DSP3_AP
DSP3_Total
Duplicate O/N cultures in LB with 15 mg/L chloramphenicol each of strains pCA24N,-gfp/DA4201, Svi3-3 comp. (recoded Svi3-3)/DA4201 and pORF1/DA4201 were diluted 1:100 into two, four and four cultures of 20 mL M9 + 0.2% glucose with 5 μg/mL chloramphenicol.  The pCA24N,-gfp/DA4201 cultures and two cultures each of Svi3-3 comp. (recoded Svi3-3)/DA4201 and pORF1/DA4201 were supplemented by 50 μM IPTG. The cells were grown to OD 0.15-0.2 and cells were withdrawn for RNA extraction and whole cell proteomics.
E058 in vitro, biological rep1
E058 in vitro, biological rep2
E058 in vivo, biological rep1
E058 in vivo, biological rep2
E058 in vivo, biological rep3
E058ΔrstAB in vivo, biological rep1
E058ΔrstAB in vivo, biological rep2
E058ΔrstAB in vivo, biological rep3
E0-E1_rep1_a
E0-E1_rep1_b
E0-E1_rep2_a
E0-E1_rep2_b
E0-E1_rep3_a
E0-E1_rep3_b
E11_1_m1 [COPRO-Seq]
E11_1_m3 [COPRO-Seq]
E11_1_m4 [COPRO-Seq]
E11_1_m5 [COPRO-Seq]
E11_1_m6 [COPRO-Seq]
E11_1_m7 [COPRO-Seq]
E11_1_m8 [COPRO-Seq]
E1_14_m1
E1_14_m1 [COPRO-Seq]
E11_4_m1 [COPRO-Seq]
E1_14_m2
E1_14_m2 [COPRO-Seq]
E1_14_m3
E1_14_m3 [COPRO-Seq]
E1_14_m4
E1_14_m4 [COPRO-Seq]
E11_4_m4 [COPRO-Seq]
E1_14_m5 [COPRO-Seq]
E11_4_m5 [COPRO-Seq]
E1_14_m6 [COPRO-Seq]
E1_14_m7 [COPRO-Seq]
E11_4_m7 [COPRO-Seq]
E1_14_m8
E1_14_m8 [COPRO-Seq]
E11_4_m8 [COPRO-Seq]
E11_6_m2 [COPRO-Seq]
E11_6_m3 [COPRO-Seq]
E11_6_m4 [COPRO-Seq]
E11_6_m5 [COPRO-Seq]
E11_7_m1 [COPRO-Seq]
E11_7_m2 [COPRO-Seq]
E11_7_m3 [COPRO-Seq]
E11_7_m4 [COPRO-Seq]
E11_7_m6 [COPRO-Seq]
E11_7_m7 [COPRO-Seq]
E11_7_m8 [COPRO-Seq]
E1_1_m1 [COPRO-Seq]
E1_1_m2 [COPRO-Seq]
E1_1_m4 [COPRO-Seq]
E1_1_m5 [COPRO-Seq]
E1_1_m7 [COPRO-Seq]
E1_1_m8 [COPRO-Seq]
E1_2_m1 [COPRO-Seq]
E1_2_m2 [COPRO-Seq]
E1_2_m3 [COPRO-Seq]
E1_2_m4 [COPRO-Seq]
E1_2_m5 [COPRO-Seq]
E1_2_m6 [COPRO-Seq]
E1_2_m7 [COPRO-Seq]
E1_2_m8 [COPRO-Seq]
E13_1_m1 [COPRO-Seq]
E13_1_m2 [COPRO-Seq]
E13_1_m3 [COPRO-Seq]
E13_1_m4 [COPRO-Seq]
E13_1_m5 [COPRO-Seq]
E13_1_m6 [COPRO-Seq]
E13_1_m7 [COPRO-Seq]
E13_1_m8 [COPRO-Seq]
E13_4_m1 [COPRO-Seq]
E13_4_m3 [COPRO-Seq]
E13_4_m4 [COPRO-Seq]
E13_4_m5 [COPRO-Seq]
E13_4_m6 [COPRO-Seq]
E13_4_m7 [COPRO-Seq]
E13_4_m8 [COPRO-Seq]
E13_6_m1 [COPRO-Seq]
E13_6_m4 [COPRO-Seq]
E13_6_m5 [COPRO-Seq]
E13_7_m1 [COPRO-Seq]
E13_7_m2 [COPRO-Seq]
E13_7_m4 [COPRO-Seq]
E13_7_m5 [COPRO-Seq]
E13_7_m6 [COPRO-Seq]
E13_7_m7 [COPRO-Seq]
E13_7_m8 [COPRO-Seq]
E1_4_m1 [COPRO-Seq]
E1_4_m2 [COPRO-Seq]
E1_4_m3 [COPRO-Seq]
E1_4_m4 [COPRO-Seq]
E1_4_m5 [COPRO-Seq]
E1_4_m6 [COPRO-Seq]
E1_4_m7 [COPRO-Seq]
E1_4_m8 [COPRO-Seq]
E15_1_m1 [COPRO-Seq]
E15_1_m2 [COPRO-Seq]
E15_1_m3 [COPRO-Seq]
E15_1_m4 [COPRO-Seq]
E15_1_m5 [COPRO-Seq]
E15_1_m7 [COPRO-Seq]
E15_1_m8 [COPRO-Seq]
E15_4_m1 [COPRO-Seq]
E15_4_m2 [COPRO-Seq]
E15_4_m3 [COPRO-Seq]
E15_4_m4 [COPRO-Seq]
E15_4_m6 [COPRO-Seq]
E15_4_m7 [COPRO-Seq]
E15_4_m8 [COPRO-Seq]
E15_6_m1 [COPRO-Seq]
E15_6_m3 [COPRO-Seq]
E15_6_m5 [COPRO-Seq]
E15_6_m6 [COPRO-Seq]
E15_6_m7 [COPRO-Seq]
E15_6_m8 [COPRO-Seq]
E15_7_m1 [COPRO-Seq]
E15_7_m3 [COPRO-Seq]
E15_7_m4 [COPRO-Seq]
E15_7_m5 [COPRO-Seq]
E15_7_m7 [COPRO-Seq]
E15_7_m8 [COPRO-Seq]
E17_1_m1 [COPRO-Seq]
E17_1_m2 [COPRO-Seq]
E17_1_m3 [COPRO-Seq]
E17_1_m4 [COPRO-Seq]
E17_1_m5 [COPRO-Seq]
E17_1_m6 [COPRO-Seq]
E17_1_m7 [COPRO-Seq]
E17_1_m8 [COPRO-Seq]
E17_4_m1 [COPRO-Seq]
E17_4_m2 [COPRO-Seq]
E17_4_m3 [COPRO-Seq]
E17_4_m4 [COPRO-Seq]
E17_4_m5 [COPRO-Seq]
E17_4_m6 [COPRO-Seq]
E17_4_m7 [COPRO-Seq]
E17_4_m8 [COPRO-Seq]
E17_6_m1 [COPRO-Seq]
E17_6_m3 [COPRO-Seq]
E17_6_m4 [COPRO-Seq]
E17_6_m5 [COPRO-Seq]
E17_6_m6 [COPRO-Seq]
E17_6_m7 [COPRO-Seq]
E17_6_m8 [COPRO-Seq]
E17_7_m1 [COPRO-Seq]
E17_7_m2 [COPRO-Seq]
E17_7_m3 [COPRO-Seq]
E17_7_m4 [COPRO-Seq]
E17_7_m6 [COPRO-Seq]
E17_7_m7 [COPRO-Seq]
E1_7_m1 [COPRO-Seq]
E1_7_m2 [COPRO-Seq]
E1_7_m3 [COPRO-Seq]
E1_7_m4 [COPRO-Seq]
E1_7_m5 [COPRO-Seq]
E1_7_m6 [COPRO-Seq]
E1_7_m7 [COPRO-Seq]
E1_7_m8 [COPRO-Seq]
E19_1_m1 [COPRO-Seq]
E19_1_m2 [COPRO-Seq]
E19_1_m3 [COPRO-Seq]
E19_1_m4 [COPRO-Seq]
E19_1_m5 [COPRO-Seq]
E19_1_m6 [COPRO-Seq]
E19_1_m7 [COPRO-Seq]
E19_1_m8 [COPRO-Seq]
E19_4_m2 [COPRO-Seq]
E19_4_m3 [COPRO-Seq]
E19_4_m4 [COPRO-Seq]
E19_4_m5 [COPRO-Seq]
E19_4_m6 [COPRO-Seq]
E19_4_m7 [COPRO-Seq]
E19_4_m8 [COPRO-Seq]
E19_6_m1 [COPRO-Seq]
E19_6_m2 [COPRO-Seq]
E19_6_m3 [COPRO-Seq]
E19_6_m4 [COPRO-Seq]
E19_6_m5 [COPRO-Seq]
E19_6_m6 [COPRO-Seq]
E19_6_m7 [COPRO-Seq]
E19_6_m8 [COPRO-Seq]
E19_7_m1 [COPRO-Seq]
E19_7_m2 [COPRO-Seq]
E19_7_m3 [COPRO-Seq]
E19_7_m4 [COPRO-Seq]
E19_7_m5 [COPRO-Seq]
E19_7_m6 [COPRO-Seq]
E19_7_m7 [COPRO-Seq]
E19_7_m8 [COPRO-Seq]
E2_14_m1
E2_14_m1 [COPRO-Seq]
E2_14_m2 [COPRO-Seq]
E2_14_m3
E2_14_m3 [COPRO-Seq]
E2_14_m4
E2_14_m4 [COPRO-Seq]
E2_14_m5 [COPRO-Seq]
E2_14_m6
E2_14_m6 [COPRO-Seq]
E2_14_m7 [COPRO-Seq]
E2_14_m8
E2_1_m1 [COPRO-Seq]
E2_1_m2 [COPRO-Seq]
E2_1_m3 [COPRO-Seq]
E2_1_m4 [COPRO-Seq]
E2_1_m5 [COPRO-Seq]
E2_1_m6 [COPRO-Seq]
E2_1_m7 [COPRO-Seq]
E2_1_m8 [COPRO-Seq]
E22
E2_2_m1 [COPRO-Seq]
E2_2_m2 [COPRO-Seq]
E2_2_m3 [COPRO-Seq]
E2_2_m4 [COPRO-Seq]
E2_2_m5 [COPRO-Seq]
E2_2_m6 [COPRO-Seq]
E2_2_m7 [COPRO-Seq]
E2_2_m8 [COPRO-Seq]
E2_4_m1 [COPRO-Seq]
E2_4_m2 [COPRO-Seq]
E2_4_m3 [COPRO-Seq]
E2_4_m4 [COPRO-Seq]
E2_4_m5 [COPRO-Seq]
E2_4_m6 [COPRO-Seq]
E2_4_m7 [COPRO-Seq]
E2_4_m8 [COPRO-Seq]
E2_7_m1 [COPRO-Seq]
E2_7_m2 [COPRO-Seq]
E2_7_m3 [COPRO-Seq]
E2_7_m4 [COPRO-Seq]
E2_7_m5 [COPRO-Seq]
E2_7_m6 [COPRO-Seq]
E2_7_m7 [COPRO-Seq]
E2_7_m8 [COPRO-Seq]
E3_14_m1 [COPRO-Seq]
E3_14_m2 [COPRO-Seq]
E3_14_m3 [COPRO-Seq]
E3_14_m4 [COPRO-Seq]
E3_14_m6 [COPRO-Seq]
E3_14_m7 [COPRO-Seq]
E3_14_m8 [COPRO-Seq]
E3_1_m1 [COPRO-Seq]
E3_1_m2 [COPRO-Seq]
E3_1_m3 [COPRO-Seq]
E3_1_m4 [COPRO-Seq]
E3_1_m5 [COPRO-Seq]
E3_1_m6 [COPRO-Seq]
E3_1_m7 [COPRO-Seq]
E3_1_m8 [COPRO-Seq]
E3_2_m1 [COPRO-Seq]
E3_2_m2 [COPRO-Seq]
E3_2_m3 [COPRO-Seq]
E3_2_m4 [COPRO-Seq]
E3_2_m5 [COPRO-Seq]
E3_2_m6 [COPRO-Seq]
E3_2_m7 [COPRO-Seq]
E3_2_m8 [COPRO-Seq]
E3_4_m2 [COPRO-Seq]
E3_4_m3 [COPRO-Seq]
E3_4_m4 [COPRO-Seq]
E3_4_m5 [COPRO-Seq]
E3_4_m6 [COPRO-Seq]
E3_4_m7 [COPRO-Seq]
E3_4_m8 [COPRO-Seq]
E3_7_m1 [COPRO-Seq]
E3_7_m2 [COPRO-Seq]
E3_7_m3 [COPRO-Seq]
E3_7_m4 [COPRO-Seq]
E3_7_m5 [COPRO-Seq]
E3_7_m6 [COPRO-Seq]
E3_7_m7 [COPRO-Seq]
E3_7_m8 [COPRO-Seq]
E4 -O2 1
E4 +O2 1
E4 -O2 2
E4 +O2 2
E4 -O2 3
E4 +O2 3
E9_1_m1 [COPRO-Seq]
E9_1_m2 [COPRO-Seq]
E9_1_m3 [COPRO-Seq]
E9_1_m4 [COPRO-Seq]
E9_1_m5 [COPRO-Seq]
E9_1_m6 [COPRO-Seq]
E9_1_m7 [COPRO-Seq]
E9_1_m8 [COPRO-Seq]
E9_4_m1 [COPRO-Seq]
E9_4_m2 [COPRO-Seq]
E9_4_m3 [COPRO-Seq]
E9_4_m4 [COPRO-Seq]
E9_4_m5 [COPRO-Seq]
E9_4_m6 [COPRO-Seq]
E9_4_m7 [COPRO-Seq]
E9_4_m8 [COPRO-Seq]
E9_6_m2 [COPRO-Seq]
E9_6_m3 [COPRO-Seq]
E9_6_m4 [COPRO-Seq]
E9_6_m5 [COPRO-Seq]
E9_6_m7 [COPRO-Seq]
E9_7_m2 [COPRO-Seq]
E9_7_m3 [COPRO-Seq]
E9_7_m4 [COPRO-Seq]
E9_7_m5 [COPRO-Seq]
E9_7_m6 [COPRO-Seq]
E9_7_m7 [COPRO-Seq]
E9_7_m8 [COPRO-Seq]
Each bacteria pellet from a 25 ml culture (OD600 ~0.3) was homogeneously resuspended in 200 µl of Buffer A [10 mM Tris pH 8.0; 20% Sucrose; 100 mM NaCl] supplemented with 200 U SUPERase• In™ RNase Inhibitor, by pipetting. 50 µl of Buffer B [50 mM EDTA; 120 mM Tris pH 8.0] supplemented with 1 µl Ready-Lyse™ Lysozyme Solution (Epicentre, cat. R1810M) were added dropwise, and the vial was gently tilted 5 times to ensure homogenous mixing. The sample was then incubated 1 minute at room temperature. 250 µl of Buffer C [0.5% Tween-20: 0.4% NaDOC; 2 M NaCl; 10 mM EDTA] were immediately added dropwise. The sample was then incubated 5 minutes at room temperature. At this stage the solution clears considerably without increasing its viscosity, and nucleoid becomes visible. Using a cut P1000 pipette tip, the whole sample was gently layered on the top of a 5-30% w/v sucrose gradient [10 mM Tris pH 8.0; 1 M NaCl; 1 mM EDTA; 1 mM DTT], and centrifuged at 17,000 RPM in a SW55Ti rotor (Beckman Coulter, cat. 342194) for 9 minutes (4°C). After centrifugation, the nucleoid fraction was collected using a syringe with a 18G blunt fill needle, and transferred to a new centrifuge tube. The remaining gradient was assumed to represent the cytosolic fraction. The nucleoid was then resuspended in 2.5 ml Wash & Resuspension buffer [40 mM Tris pH 7.5; 150 mM KCl; 10 mM MgCl2; 1 mM DTT; 0.01% Triton X-100] supplemented with 200 U SUPERase• In™ RNase Inhibitor, pulse vortexed for 5 seconds, and then centrifuged at 28,000 RPM in a SW55Ti rotor for 30 minutes (0°C). After centrifugation the supernatant was decanted, and the nucleoid pellet was washed twice with 2 ml of Wash & Resuspension buffer, taking care not to disturb it. The nucleoid was then resuspended in 500 µl Wash & Resuspension buffer, and solubilized by addition of 0.1 gr acid-washed glass beads (Sigma, cat. G1145), and shaking for 5 minutes in a TissueLyser (QIAGEN). For each 100 µl of purified nucleoids (or cytosolic fraction), 1 ml of TRIzol® Reagent (Invitrogen, cat. 15596-018) was added, and RNA was extracted following manufacturer’s instructions. RNA was analyzed on a 2100 Bioanalyzer (Agilent). In all experiments, RNA from cytosolic fraction (corresponding to mature RNA species) had RIN > 9.5. Total RNA yield from nucleoid fraction was ~6% of the total RNA content.
Each dataset was normalized to reads per million per position prior to further analysis.
Each strain was inoculated from the frozen stock into 10 mL of M9 medium for preculture. Five-microliter aliquots of preculture medium cells were inoculated into the fresh minimal media, M9 with 5%(v/v) ethanol in 10 mL test tube with screw cap and cultured for 10 generations. When OD600nm reached 0.05 within the exponential growth phase, cell were collected.
Each tube of the cell pellet stored at -80˚C was resuspended in 650 ml TES buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 100 mM NaCl, 0.1% TritonX 100, 0.3 mM PMSF) at room temperature (RT). The cell suspension was mixed with 100 kU Ready-Lyse Lysozyme (Epicentre) and 50 µg RNaseA (Sigma) and incubated for 5 min, allowing rapid cell lysis. To digest the nucleoide, 62.5 U DNaseI (Roche) and 250 µg/ml heparin at the final concentrations as well as 74 ml DNaseI buffer (10 mM MnCl2 10 mM Tris-HCl, pH 7.5) were added to the mixture and incubated for 10 min at RT. To remove cell debris, the mixture was centrifuged at 20,000 x g for 3 min at 4˚C and the supernatant was collected into a new 1.5 ml tube. The supernatant including RNAPs that form ternary complexes with RNA/DNA were immobilized on ~155 µl Ni-NTA agarose (Qiagen) pre-equilibrated with the binding buffer (0.5 M NaCl, 5 mM imidazole, 5% glycerol, 20 mM Tris-HCl, pH7.9, 1 mM 2-mercaptoethanol) with shaking for 10 min at 4˚C. The immobilized ternary complexes were washed five times with the wash buffer (1M NaCl, 15 mM imidazole, 5% glycerol, pH7.9, 1 mM 2-mercaptoethanol) at 4˚C, washed twice with the nuclease buffer (40 mM KCl, 15 mM imidazole, 20 mM Tris-HCl, pH 7.9, 0.3 mM MgCl2 5% glycerol, 1 mM 2-mercaptoethanol) at 4˚C. The RNA transcript and DNA unprotected by RNAP were cleaved by the additions of 0.4 U RNase V1 (Invitrogen), 0.7 U RNase T1 (Sigma), and 5 U DNase I (Takara Bio) to the immobilized complexes and incubation for 7 min at RT. The nuclease-treated complexes were washed twice with the wash buffer, twice with the MnCl2-free nuclease buffer at 4˚C, and eluted by increasing the concentration of imidazole to 100 mM followed by shaking for 10 min at 4˚C in the presence of 30 U SUPERase RNase inhibitor (Ambion).
Each type of error rates per position was determined as  the number of sequence reads with a particular type of base-substitution  divided by the number of the reads with the reference base in each DNA  position.
early stationary phase 1
early stationary phase 2
early stationary phase 3
early stationary phase 4
early stationary phase 5
EC12n090 RpoE 2.5 min Time course 4
EC12n091 RpoE 5 min Time course 4
EC12n092a RpoE 10 min Time course 4
EC12n093 RpoE 20 min Time course 4
EC12n094 RpoE 30 min Time course 4
EC12n095 RpoE 60 min Time course 4
EC12n096 RpoE 0 min Time course 4
EC12n097 delta rseA
EC12n098 delta rseA
EC12n099 delta rseA
EC12n101 RpoE 0 min Time course 3
EC18n018 hfq+ rpoE overexpression 20 min
EC18n019 hfq- rpoE overexpression 20 min
EC18n035 delta rseA
EC18n036 delta rseA
EC18n037 delta hfq
EC18n038 delta hfq
EC18n039 delta hfq
EC18n040 delta hfq
EC18n122 RpoH 10 min Time course 4
EC18n136 hfq+ rpoE overexpression 20 min
Ec18n137 hfq- rpoE overexpression 20 min
EC18n139 hfq+ rpoE overexpression 20 min
EC18n140 hfq- rpoE overexpression 20 min
EC18n167 RpoH 0 min Time course 2
EC18n168 RpoH 2.5 min Time course 2
EC18n169 RpoH 5 min Time course 2
EC18n170 RpoH 10 min Time course 2
EC18n171 RpoH 20 min Time course 2
EC18n177 RpoH 0 min Time course 1
EC18n178 RpoH 2.5 min Time course 1
EC18n179 RpoH 5 min Time course 1
EC18n180 RpoH 10 min Time course 1
EC18n181 RpoH 20 min Time course 1
EC18n182 RpoH 0 min Time course 3
EC18n183 RpoH 2.5 min Time course 3
EC18n184 RpoH 5 min Time course 3
EC18n185 RpoH 10 min Time course 3
EC18n186 RpoH 20 min Time course 3
EC19n075 delta hfq
EC19n076 delta hfq
EC19n098 delta hfq
EC19n099 delta hfq
EC19n100 delta rseA
EC19n101 delta rseA
EC7n018 RpoE 5 min Time course 1
EC7n019 RpoE 15 min Time course 1
EC7n065 RpoE 5 min Time course 2
EC7n066 RpoE 15 min Time course 2
EC7n067 RpoE 30 min Time course 2
EC7n068 RpoE 60 min Time course 2
EC7n071 RpoE 60 min Time course 1
EC8n021 RpoE 2.5 min Time course 3
EC8n022 RpoE 5 min Time course 3
EC8n050 RpoE 10min Time course 3
EC8n051 RpoE 20 min Time course 3
EC8n052 RpoE 30 min Time course 3
EC8n053 RpoE 60 min Time course 3
EC_Cont1_DNA
EC_Cont1_RNA
EC_Cont2_DNA
EC_Cont2_RNA
ecd3-c-0081429 wt vs dpiAoverexpressor
ecd3-c-0101429 wt vs dpiAoverexpressor
ECDH5_GD_RP1
EcJR-8 grown to OD600 = 0.5 in DMEM-MOPS 0.4% glucose at a 10:1 flask-to-media volume in a rotary shaker (180 RPM).
EcJR-8 grown to OD600 = 1.8 in DMEM-MOPS 0.4% glucose at a 10:1 flask-to-media volume in a rotary shaker (180 RPM).
eco_0.21_0.11
eco_0.26_0.11
eco_0.31_0.11
eco_0.36_0.11
eco_0.40_0.11
eco_0.48_0.11
Eco 50ng - 0%
Eco 50ng - 10%
Eco 50ng - 15%
Eco 50ng - 20%
Eco 50ng - 25%
Eco 50ng - 32.5%
Eco 50ng - 45%
Eco 50ng - 5%
Eco 5ng - 0%
Eco 5ng - 10%
Eco 5ng - 15%
Eco 5ng - 20%
Eco 5ng - 25%
Eco 5ng - 32.5%
Eco 5ng - 45%
Eco 5ng - 5%
E. coli
E. coli 042 WT
E coli, 0 min
E. coli - 0 min before nutrient shift
E. coli 0 mins
E.coli 0 minutes after BRP induction
E.coli_0%tannin_#2
E.coli_0%tannin_#8
E. coli 10 mins
E.coli -10 minutes after BRP induction
E.coli 10 minutes after BRP induction
E coli, 15 min
E.coli_15min_AE_1
E.coli_15min_AE_2
E.coli_15min_aerobic
E. coli - 15 min after shift to limiting medium
E. coli - 15 min after shift to thymineless medium
E.coli_15min_ANA_1
E. coli_15min_ANA_2
E. coli_15min_anaerobic
E.coli_15min_anaerobic
E.coli_15min_CORM-2 treated_aerobic
E.coli_15min_CORM-2 treated_anaerobic
E.coli_15min_CORM_AE_1
E.coli_15min_CORM_AE_2
E.coli_15min_CORM_ANA_1
E.coli_15min_CORM_ANA_2
E. coli 15 minute 5 µM cadmium dye swap treatment
E. coli 15 minute 5 µM cadmium treatment
E. coli 15 minute pH only dye swap treatment
E. coli 15 minute pH only treatment
E. coli, 15 minutes, 5 µM cadmium, pH 5
E. coli, 15 minutes, 5 µM cadmium, pH 7
E. coli, 15 minutes, no cadmium, pH 5
E. coli, 15 minutes, no cadmium, pH 7
E. coli, 1-h, serine hydroxamate
E.coli_1%tannin_#3
e.coli_1%tannin_#5
E.coli-1x CORM2-rep1
E.coli-1x CORM2-rep2
E.coli-1x CORM2-rep3
E.coli-1x CORM2-rep4
E.coli-1x vehicle-rep1
E.coli-1x vehicle-rep2
E.coli-1x vehicle-rep3
E.coli-1x vehicle-rep4
E.coli 20 minutes after BRP induction
E.coli-20x CORM2-rep1
E.coli-20x CORM2-rep2
E.coli-20x CORM2-rep3
E.coli-20x CORM2-rep4
E.coli-20x vehicle-rep1
E.coli-20x vehicle-rep2
E.coli-20x vehicle-rep3
E.coli-20x vehicle-rep4
E coli, 25 min
E coli, 25 min after turning off oxygen
E. coli 2.5 mins
Ecoli, 2 min
E coli, 2 min after turning off oxygen
E.coli 2 minutes after BRP induction
E. coli 2% NaCl
E. coli - 30 min after shift to limiting medium
E. coli - 30 min after shift to thymineless medium
E. coli 30 mins
E.coli 30 minutes after BRP induction
E. coli 3538 #1
E. coli 3538 #2
ecoli_3538_2x_v2
E. coli 3538 #3
ecoli_3538_3x_v2
ecoli_3538_4x_v2
E coli, 35 min
E coli, 35 min after turning off oxygen
E. coli 3.5% NaCl, replicate 1
E. coli 3.5% NaCl, replicate 2
e.coli , 37°C, 60min
E.coli, 37°C, 60min
E.coli,37°C, 60min
E.coli，37°C，60min 
E. coli 37L evolved strain, under 37ºC, rep 1
E. coli 37L evolved strain, under 37ºC, rep 2
E. coli 37L evolved strain, under 37ºC, rep 3
E. coli 3' RACE Rep1
E. coli 3' RACE Rep2
E. coli 41B evolved strain, evolutionary temperature, rep 1
E. coli 41B evolved strain, evolutionary temperature, rep 2
E. coli 41B evolved strain, evolutionary temperature, rep 3
E. coli 41B evolved strain, regular temperature, rep 1
E. coli 41B evolved strain, regular temperature, rep 2
E. coli 41B evolved strain, regular temperature, rep 3
E. coli 41B evolved strain, under 37ºC, rep 1
E. coli 41B evolved strain, under 37ºC, rep 2
E. coli 41B evolved strain, under 37ºC, rep 3
E. coli 41B evolved strain, under 41ºC, rep 1
E. coli 41B evolved strain, under 41ºC, rep 2
E. coli 41B evolved strain, under 41ºC, rep 3
E. coli 41B strain, 30 min heat shock at 45ºC, rep 1
E. coli 41B strain, 30 min heat shock at 45ºC, rep 2
E. coli 41B strain, 5 min heat shock at 45ºC, rep 1
E. coli 41B strain, 5 min heat shock at 45ºC, rep 2
E. coli 41B strain, heat shock, long, rep 1
E. coli 41B strain, heat shock, long, rep 2
E. coli 41B strain, heat shock, rep 1
E. coli 41B strain, heat shock, rep 2
E. coli 43B evolved strain, evolutionary temperature, rep 1
E. coli 43B evolved strain, evolutionary temperature, rep 2
E. coli 43B evolved strain, evolutionary temperature, rep 3
E. coli 43B evolved strain, regular temperature, rep 1
E. coli 43B evolved strain, regular temperature, rep 2
E. coli 43B evolved strain, regular temperature, rep 3
E. coli 43B evolved strain, under 37ºC, rep 1
E. coli 43B evolved strain, under 37ºC, rep 2
E. coli 43B evolved strain, under 37ºC, rep 3
E. coli 43B evolved strain, under 43ºC, rep 1
E. coli 43B evolved strain, under 43ºC, rep 2
E. coli 43B evolved strain, under 43ºC, rep 3
E. coli 43B strain, 30 min heat shock at 45ºC, rep 1
E. coli 43B strain, 30 min heat shock at 45ºC, rep 2
E. coli 43B strain, 5 min heat shock at 45ºC, rep 1
E. coli 43B strain, 5 min heat shock at 45ºC, rep 2
E. coli 43B strain, heat shock, long, rep 1
E. coli 43B strain, heat shock, long, rep 2
E. coli 43B strain, heat shock, rep 1
E. coli 43B strain, heat shock, rep 2
e.coli , 43°C, 60min
E.coli, 43°C, 60min
E.coli,43°C, 60min
E.coli，43°C，60min 
E. coli 45L evolved strain, evolutionary temperature, rep 1
E. coli 45L evolved strain, evolutionary temperature, rep 2
E. coli 45L evolved strain, evolutionary temperature, rep 3
E. coli 45L evolved strain, regular temperature, rep 1
E. coli 45L evolved strain, regular temperature, rep 2
E. coli 45L evolved strain, regular temperature, rep 3
E. coli 45L evolved strain, under 37ºC, rep 1
E. coli 45L evolved strain, under 37ºC, rep 2
E. coli 45L evolved strain, under 37ºC, rep 3
E. coli 45L evolved strain, under 45ºC, rep 1
E. coli 45L evolved strain, under 45ºC, rep 2
E. coli 45L evolved strain, under 45ºC, rep 3
E. coli 45L strain, 30 min heat shock at 45ºC, rep 1
E. coli 45L strain, 30 min heat shock at 45ºC, rep 2
E. coli 45L strain, 5 min heat shock at 45ºC, rep 1
E. coli 45L strain, 5 min heat shock at 45ºC, rep 2
E. coli 45L strain, heat shock, long, rep 1
E. coli 45L strain, heat shock, long, rep 2
E. coli 45L strain, heat shock, rep 1
E. coli 45L strain, heat shock, rep 2
E coli, 45 min
E. coli - 45 min after shift to limiting medium
E. coli - 45 min after shift to thymineless medium
E coli, 45 min after turning off oxygen
E.coli 45 minutes after BRP induction
E. coli 4.5% NaCl
E coli, 55 min
E. coli 5.5% NaCl
E coli, 5 min
Ecoli, 5 min after turning off oxygen
E coli, 5 min after turning off oxygen first replicate
E. coli 5 minute 5 µM cadmium dye swap treatment
E. coli 5 minute 5 µM cadmium treatment
E. coli 5 minute pH only dye swap treatment
E. coli 5 minute pH only treatment
E. coli, 5 minutes, 5 µM cadmium, pH 5
E. coli, 5 minutes, 5 µM cadmium, pH 7
E.coli 5 minutes after BRP induction
E. coli, 5 minutes, no cadmium, pH 5
E. coli, 5 minutes, no cadmium, pH 7
E. coli 5% NaCl
E. coli - 60 min after shift to limiting medium
E. coli - 60 min after shift to thymineless medium
E.coli 60 minutes after BRP induction
E. coli 7 mins
E. coli 8624
E. coli 8624 qseF deletion mutant
E. coli 8624 WT
E. coli - 90 min after shift to limiting medium
E. coli - 90 min after shift to thymineless medium
E. coli AcrA Multidrug Efflux Mutant
E. coli AcrB and EmrAB Multidrug Efflux Double Mutant
E. coli AcrB Multidrug Efflux Mutant
ecoli_aerobicanaerobic_0min
ecoli_aerobicanaerobic_15min
ecoli_aerobicanaerobic_25min_rep1
ecoli_aerobicanaerobic_25min_rep2
ecoli_aerobicanaerobic_2min
ecoli_aerobicanaerobic_35min
ecoli_aerobicanaerobic_45min
ecoli_aerobicanaerobic_55min_rep1
ecoli_aerobicanaerobic_55min_rep2
ecoli_aerobicanaerobic_5min_Rep1
ecoli_aerobicanaerobic_5min_rep2
Ecoli_Ag0.0_rep1
Ecoli_Ag0.0_rep2
Ecoli_Ag0.0_rep3
Ecoli_Ag5.0_rep1
Ecoli_Ag5.0_rep2
Ecoli_Ag5.0_rep3
Ecoli_Ag6.5_rep1
Ecoli_Ag6.5_rep2
Ecoli_Ag6.5_rep3
Ecoli_Ag8.5_rep1
Ecoli_Ag8.5_rep2
Ecoli_Ag8.5_rep3
Ecoli_Ampicillin treatment T1
Ecoli_Ampicillin treatment T2
Ecoli_Ampicillin treatment T3
Ecoli_Ampicillin treatment T4
Ecoli_Ampicillin treatment T5
Ecoli_Ampicillin treatment T6
Ecoli_Anaerobic growth in M9 + glucose + fumarate,reference Genomic DNA T1
Ecoli_Anaerobic growth in M9 + glucose + fumarate,reference Genomic DNA T2
Ecoli_Anaerobic growth in M9 + glucose + fumarate,reference Genomic DNA T3
Ecoli_Anaerobic growth in M9 + glucose + fumarate,reference Genomic DNA T4
Ecoli_Anaerobic growth in M9 + glucose + fumarate,reference Genomic DNA T5
Ecoli_Anaerobic growth in M9 + glucose + fumarate,reference Genomic DNA T6
Ecoli_Anaerobic growth in M9 + glucose + fumarate vs Aerobic OD 0.4 T1
Ecoli_Anaerobic growth in M9 + glucose + fumarate vs Aerobic OD 0.4 T2
Ecoli_Anaerobic growth in M9 + glucose + fumarate vs Aerobic OD 0.4 T3
Ecoli_Anaerobic growth in M9 + glucose + fumarate vs Aerobic OD 0.4 T4
Ecoli_Anaerobic growth in M9 + glucose + fumarate vs Aerobic OD 0.4 T5
Ecoli_Anaerobic growth in M9 + glucose + fumarate vs Aerobic OD 0.4 T6
Ecoli_Anaerobic growth in M9 + glucose, reference Genomic DNA T1
Ecoli_Anaerobic growth in M9 + glucose, reference Genomic DNA T2
Ecoli_Anaerobic growth in M9 + glucose, reference Genomic DNA T3
Ecoli_Anaerobic growth in M9 + glucose, reference Genomic DNA T4
Ecoli_Anaerobic growth in M9 + glucose, reference Genomic DNA T5
Ecoli_Anaerobic growth in M9 + glucose, reference Genomic DNA T6
Ecoli_Anaerobic growth in M9 + glucose vs Aerobic OD 0.4 T1
Ecoli_Anaerobic growth in M9 + glucose vs Aerobic OD 0.4 T2
Ecoli_Anaerobic growth in M9 + glucose vs Aerobic OD 0.4 T3
Ecoli_Anaerobic growth in M9 + glucose vs Aerobic OD 0.4 T4
Ecoli_Anaerobic growth in M9 + glucose vs Aerobic OD 0.4 T5
Ecoli_Anaerobic growth in M9 + glucose vs Aerobic OD 0.4 T6
E. coli ancestor strain, 30 min heat shock at 45ºC, rep 1
E. coli ancestor strain, 30 min heat shock at 45ºC, rep 2
E. coli ancestor strain, 5 min heat shock at 45ºC, rep 1
E. coli ancestor strain, 5 min heat shock at 45ºC, rep 2
E. coli ancestor strain, under 37ºC, rep 1
E. coli ancestor strain, under 37ºC, rep 2
E. coli ancestor strain, under 37ºC, rep 3
E. coli Anc strain, heat shock, long, rep 1
E. coli Anc strain, heat shock, long, rep 2
E. coli Anc strain, heat shock, rep 1
E. coli Anc strain, heat shock, rep 2
E. coli Anc strain, regular temperature, rep 1
E. coli Anc strain, regular temperature, rep 2
E. coli Anc strain, regular temperature, rep 3
E. coli and S. Typhimurium cells (at mid-exponential growth phase) were fixed with formaldehyde (1% final concentration) for  20 min at 30°C with shaking. The crosslinking reaction was then quenched by the addition of glycine (0.33M final concentrationg) for 5 minutes at room temperature with gentle mixing.  Cells where then lysed on ice with lysozyme and sonication.
E. Coli ArcA-8myc ChIP DNA Mock antibody anaerobic
E. Coli ArcA-8myc ChIP DNA Mock antibody NO3
E. Coli ArcA ChIP DNA anaerobic
E. Coli ArcA ChIP DNA NO3
E. Coli ArgR ChIP DNA Arginine 1
E. Coli ArgR ChIP DNA Arginine 2
E. Coli ArgR ChIP DNA NH4Cl 1
E. Coli ArgR ChIP DNA NH4Cl 2
E. coli ATCC 25922 marR deletion+QnrS replicate 1
E. coli ATCC 25922 marR deletion+QnrS replicate 2
E. coli ATCC 25922 QnrS replicate 1
E. coli ATCC 25922 QnrS replicate 2
E. coli ATCC 25922 Ser83Leu+QnrS replicate 1
E. coli ATCC 25922 Ser83Leu+QnrS replicate 2
E. coli ATCC 25922 (wild-type) and EC14, EC19, EC24 (LLQR) isogenic strains were tested to evaluate the global response to relevant fix concentration of ciprofloxacin (1 mg/L, breakpoint for reduced susceptibility according to CLSI). All of them were susceptible to quinolones according to CLSI breakpoints. (CLSI, n.d.) Cultures were started from single colonies and grown overnight in 25 ml of LB. These cell were diluted 1:100 and growth to cell concentration of 4x108 cells/ml (OD600 nm=0.4, exponential phase) for treatment. Three biological replicates per genotype were incubated at 1 mg/L of ciprofloxacin during 60 minutes (that means 250xMIC for E. coli ATCC 25922, 8xMIC for EC14, 2xMIC for EC19 and 1xMIC for EC24). Approximately 109 cells (2 ml) were taken for RNA isolation.
E. coli B178 groESL(-) expressing human Hsp60 and Hsp10
E. coli B178 groESL(-) expressing human wt and Val98Ile Hsp60 and Hsp10
E. coli batch culture without TAP
E. coli batch culture with TAP
E. coli BL21(DE3) cells expressing catalytically inactive mutant of  M.HpyAVIB
E. coli BL21(DE3) cells expressing wild-type M.HpyAVIB
E. coli BW25113 were maintained in Luria-Bertani medium at 37ºC for about 14 h until they reached the stationary phase of cell growth before treatment.
Ecoli_CaCl2 wash T1
Ecoli_CaCl2 wash T2
Ecoli_CaCl2 wash T3
Ecoli_CaCl2 wash T4
Ecoli_CaCl2 wash T5
Ecoli_CaCl2 wash T6
E. coli CC72 was grown in water bath to early-exponential phase (OD600 0.2) at 37°C in LB medium.
E. coli_CCCP_15 min
E. coli cell
E. coli cell cultures
E coli cells
E.coli cells
E. coli cells 0 min before perturbation
E. coli cells 10 min after specific perturbation
E.coli cells at 1.5 hrs after addition of high IPTG (1.0 mM), biological rep1, technical rep 1
E.coli cells at 1.5 hrs after addition of high IPTG (1.0 mM), biological rep1, technical rep2
E.coli cells at 1.5 hrs after addition of high IPTG (1.0 mM), biological rep2, technical rep 1
E.coli cells at 1.5 hrs after addition of high IPTG (1.0 mM), biological rep2, technical rep2
E.coli cells at 1.5 hrs after addition of low IPTG (0.1 mM), biological rep1, technical rep 1
E.coli cells at 1.5 hrs after addition of low IPTG (0.1 mM), biological rep1, technical rep2
E.coli cells at 1.5 hrs after addition of low IPTG (0.1 mM), biological rep2, technical rep 1
E.coli cells at 1.5 hrs after addition of low IPTG (0.1 mM), biological rep2, technical rep2
E.coli cells at 1.5 hrs after addition of no IPTG (0 mM), biological rep1, technical rep 1
E.coli cells at 1.5 hrs after addition of no IPTG (0 mM), biological rep1, technical rep2
E.coli cells at 1.5 hrs after addition of no IPTG (0 mM), biological rep2, technical rep 1
E.coli cells at 1.5 hrs after addition of no IPTG (0 mM), biological rep2, technical rep2
E.coli cells at 1.5 hrs after induction with 0.1 mM IPTG
E.coli cells at 1.5 hrs after induction with 0 mM IPTG
E.coli cells at 1.5 hrs after induction with 1.0 mM IPTG
E.coli cells at 3.5 hrs after addition of high IPTG (1.0 mM), biological rep1, technical rep 1
E.coli cells at 3.5 hrs after addition of high IPTG (1.0 mM), biological rep1, technical rep2
E.coli cells at 3.5 hrs after addition of high IPTG (1.0 mM), biological rep2, technical rep 1
E.coli cells at 3.5 hrs after addition of high IPTG (1.0 mM), biological rep2, technical rep2
E.coli cells at 3.5 hrs after addition of low IPTG (0.1 mM), biological rep1, technical rep 1
E.coli cells at 3.5 hrs after addition of low IPTG (0.1 mM), biological rep1, technical rep2
E.coli cells at 3.5 hrs after addition of low IPTG (0.1 mM), biological rep2, technical rep 1
E.coli cells at 3.5 hrs after addition of low IPTG (0.1 mM), biological rep2, technical rep2
E.coli cells at 3.5 hrs after addition of no IPTG (0 mM), biological rep1, technical rep 1
E.coli cells at 3.5 hrs after addition of no IPTG (0 mM), biological rep1, technical rep2
E.coli cells at 3.5 hrs after addition of no IPTG (0 mM), biological rep2, technical rep 1
E.coli cells at 3.5 hrs after addition of no IPTG (0 mM), biological rep2, technical rep2
E.coli cells at 3.5 hrs after induction with 0.1 mM IPTG
E.coli cells at 3.5 hrs after induction with 0 mM IPTG
E.coli cells at 3.5 hrs after induction with 1.0 mM IPTG
E.coli cells at the time of IPTG induction
E.coli cells at the time of IPTG induction (T=0 hrs), biological rep1, technical rep 1
E.coli cells at the time of IPTG induction (T=0 hrs), biological rep1, technical rep2
E.coli cells at the time of IPTG induction (T=0 hrs), biological rep2, technical rep 1
E.coli cells at the time of IPTG induction (T=0 hrs), biological rep2, technical rep2
E. coli cells containing a pBAD18 vector encoding synthetic protein DX exposed to arabinose inducer for 0.5h.  RNA extracted with Invitrogen PureLink kit.
E. coli cells from biofilm 1
E. coli cells from biofilm 2
E. coli cells from planktonic culture 1
E. coli cells from planktonic culture 2
E. coli cells grown to mid-exponential phase after 6-8 generations after stationary phase in M9 minimal medium + 0.4 % glucose.
E.coli cells  grown with aeration in LB media at 37º C until early log phase (0.4) and were treated with/without 200 mM glyphosate for 1 h, after that the cells were harvested to extract RNA. LB medium recipe is as follow: 10g tryptone, 5g yeast extract, 10g NaCl per 1 liter.
E. coli cells_HS15min
E. coli cells_HS30min
E. coli cells_HS60min
E. coli cells_LB(OD=0.87)
E. coli cells_M-P0h
E. coli cells_M-P2h
E. coli cells_M-P4h
E. coli cells were crosslinked in 1% formaldehyde for 25 minutes at RT on a rocker, then washed 3 times with 50 ml of ice-cold TBS (Tris buffered saline) each time.
E. coli cells were grown at 22°C, 30°C and 37°C in either Lennox Broth (LB) or liquid minimal medium A supplemented with 0.12% casamino acids and 0.4% glucose. The cultures were grown to OD600 = 0.2 (early exponential) or 2 (stationary phase).
E. coli cells were grown in annular reactor (BioSurface Technologies, Bozeman, MT) inoculated with 1 ml overnight cultures and supplied with fresh 10-fold diluted Luria broth at 100 ml/h at room temperature for 7-days. Cells were harvested onto membrane filters (pore size 0.45 micrometer) after pre-filtering out aggregates larger than 5 micrometer from planktonic cultures in the reactor. Cells were re-suspended in RNAlater after harvest and stored at 4 degree C overnight.
E. coli cells were grown in Kornberg medium (1.1% [wt/vol] K2HPO4, 0.85% [wt/vol] KH2PO4, 0.6% [wt/vol] yeast extract containing 0.5% [wt/vol] glucose) to mid-exponential phase (OD600 = ~0.6) at 37C and shaking 250rpm
E. coli cells were grown in Luria Broth supplemented with 100ug/ml ampicillin to retain the plasmids.
E. coli cells were grown until mid-exponential phase and treated with 0.5mM isopropyl-β-d-thiogalactopyranoside (IPTG) to induce expression of the empty vector or the small RNA.
E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes.
E. coli cells with or without BnTR1 were transferred and incubated at 37°C and 42°C for 1 hour, respectively
E. coli CFT073 carrying either pBAD or pBAD-tosR-his6 were cultured overnight in biological triplicates in LB medium containing ampicillin (100 µg/ml). Cultures were diluted 1:100 into fresh LB medium containing 10 mM L-arabinose and ampicillin and cultured at 37°C with aeration. A 400 µL sample was collected between OD600 0.46-0.96, and stabilized by the immediate addition of 800 µl of RNAprotect (Qiagen).
E.coli CFT073 genomic DNA
E.coli CFT073 genomic DNA hybridization to LLNL virulence mechanism array v2A
E. coli Cholic Acid Treatment
E. coli CMA540(MG1693 ∆hfq::cat)
Ecoli, completely aerobic conditions
E. coli_control_30 min
Ecoli_control_5h_rep1
Ecoli_control_5h_rep2
Ecoli_control_5h_rep3
Ecoli_control_5h_rep4
E. coli control, biological replicate 1
E. coli control (biological replicate 2)
E.coli, control culture, 20 minutes (t2) after treatment, replicate A
E.coli, control culture, 20 minutes (t2) after treatment, replicate B
E.coli, control culture, 20 minutes (t2) after treatment, replicate C
E.coli, control culture, 40 minutes (t3) after treatment, replicate A
E.coli, control culture, 40 minutes (t3) after treatment, replicate B
E.coli, control culture, 40 minutes (t3) after treatment, replicate C
E.coli, control culture, 5h in 10 mM NaCl, replicate 1
E.coli, control culture, 5h in 10 mM NaCl, replicate 2
E.coli, control culture, 5h in 10 mM NaCl, replicate 3
E.coli, control culture, 5h in 10 mM NaCl, replicate 4
E.coli, control culture, at the time of treatment (t1), replicate A
E.coli, control culture, at the time of treatment (t1), replicate B
E.coli, control culture, at the time of treatment (t1), replicate C
E.coli_control_repA_t1
E.coli_control_repA_t2
E.coli_control_repA_t3
E.coli_control_repB_t1
E.coli_control_repB_t2
E.coli_control_repB_t3
E.coli_control_repC_t1
E.coli_control_repC_t2
E.coli_control_repC_t3
E. coli CRP N strain_acetate_exponential phase_repl1
E. coli CRP N strain_acetate_exponential phase_repl2
E. coli CRP N strain_acetate_stationary phase_repl1
E. coli CRP N strain_acetate_stationary phase_repl2
E. coli CRP N strain_glucose_exponential phase_repl1
E. coli CRP N strain_glucose_exponential phase_repl2
E. coli CRP N strain_glucose_stationary phase_repl1
E. coli CRP N strain_glucose_stationary phase_repl2
E. coli CRP N strain grown in acetate batch minimal media, cells were harvested at exponential phase, biological rep1
E. coli CRP N strain grown in acetate batch minimal media, cells were harvested at exponential phase, biological rep2
E. coli CRP N strain grown in acetate batch minimal media, cells were harvested at stationary phase, biological rep1
E. coli CRP N strain grown in acetate batch minimal media, cells were harvested at stationary phase, biological rep2
E. coli CRP N strain grown in glucose batch minimal media, cells were harvested at exponential phase, biological rep1
E. coli CRP N strain grown in glucose batch minimal media, cells were harvested at exponential phase, biological rep2
E. coli CRP N strain grown in glucose batch minimal media, cells were harvested at stationary phase, biological rep1
E. coli CRP N strain grown in glucose batch minimal media, cells were harvested at stationary phase, biological rep2
E. coli CRP Q strain_acetate_exponential phase_repl1
E. coli CRP Q strain_acetate_exponential phase_repl2
E. coli CRP Q strain_acetate_stationary phase_repl1
E. coli CRP Q strain_acetate_stationary phase_repl2
E. coli CRP Q strain_glucose_exponential phase_repl1
E. coli CRP Q strain_glucose_exponential phase_repl2
E. coli CRP Q strain_glucose_stationary phase_repl1
E. coli CRP Q strain_glucose_stationary phase_repl2
E. coli CRP Q strain grown in acetate batch minimal media, cells were harvested at exponential phase, biological rep1
E. coli CRP Q strain grown in acetate batch minimal media, cells were harvested at exponential phase, biological rep2
E. coli CRP Q strain grown in acetate batch minimal media, cells were harvested at stationary phase, biological rep1
E. coli CRP Q strain grown in acetate batch minimal media, cells were harvested at stationary phase, biological rep2
E. coli CRP Q strain grown in glucose batch minimal media, cells were harvested at exponential phase, biological rep1
E. coli CRP Q strain grown in glucose batch minimal media, cells were harvested at exponential phase, biological rep2
E. coli CRP Q strain grown in glucose batch minimal media, cells were harvested at stationary phase, biological rep1
E. coli CRP Q strain grown in glucose batch minimal media, cells were harvested at stationary phase, biological rep2
E. coli CRP R strain_acetate_exponential phase_repl1
E. coli CRP R strain_acetate_exponential phase_repl2
E. coli CRP R strain_acetate_stationary phase_repl1
E. coli CRP R strain_acetate_stationary phase_repl2
E. coli CRP R strain_glucose_exponential phase_repl1
E. coli CRP R strain_glucose_exponential phase_repl2
E. coli CRP R strain_glucose_stationary phase_repl1
E. coli CRP R strain_glucose_stationary phase_repl2
E. coli CRP R strain grown in acetate batch minimal media, cells were harvested at exponential phase, biological rep1
E. coli CRP R strain grown in acetate batch minimal media, cells were harvested at exponential phase, biological rep2
E. coli CRP R strain grown in acetate batch minimal media, cells were harvested at stationary phase, biological rep1
E. coli CRP R strain grown in acetate batch minimal media, cells were harvested at stationary phase, biological rep2
E. coli CRP R strain grown in glucose batch minimal media, cells were harvested at exponential phase, biological rep1
E. coli CRP R strain grown in glucose batch minimal media, cells were harvested at exponential phase, biological rep2
E. coli CRP R strain grown in glucose batch minimal media, cells were harvested at stationary phase, biological rep1
E. coli CRP R strain grown in glucose batch minimal media, cells were harvested at stationary phase, biological rep2
E. coli culture
e.coli culture protocol: conditioned Caco-2 cell medium
e.coli culture protocol: fresh medium
E. coli cultures
E. coli cultures were grown at  37 °C in M9 minimal media with glucose as the primary carbon source and harvested at mid exponetial phase. Aerobic E. coli conditions were grown in shake flasks and anaerobic conditions were grown in anoxic serum bottles.  Condition specific media supplementation was added as described else where.
E.coli, culture with ethanol 20%, 20 minutes (t2) after treatment, replicate A
E.coli, culture with ethanol 20%, 20 minutes (t2) after treatment, replicate B
E.coli, culture with ethanol 20%, 20 minutes (t2) after treatment, replicate C
E.coli, culture with ethanol 20%, 40 minutes (t3) after treatment, replicate A
E.coli, culture with ethanol 20%, 40 minutes (t3) after treatment, replicate B
E.coli, culture with ethanol 20%, 40 minutes (t3) after treatment, replicate C
E.coli, culture with ethanol 20%, at the time of treatment (t1), replicate A
E.coli, culture with ethanol 20%, at the time of treatment (t1), replicate B
E.coli, culture with ethanol 20%, at the time of treatment (t1), replicate C
E.coli, culture with VWPE extract diluted in ethanol 20%, 20 minutes (t2) after treatment, replicate A
E.coli, culture with VWPE extract diluted in ethanol 20%, 20 minutes (t2) after treatment, replicate B
E.coli, culture with VWPE extract diluted in ethanol 20%, 20 minutes (t2) after treatment, replicate C
E.coli, culture with VWPE extract diluted in ethanol 20%, 40 minutes (t3) after treatment, replicate A
E.coli, culture with VWPE extract diluted in ethanol 20%, 40 minutes (t3) after treatment, replicate B
E.coli, culture with VWPE extract diluted in ethanol 20%, 40 minutes (t3) after treatment, replicate C
E.coli, culture with VWPE extract diluted in ethanol 20%, at the time of treatment (t1), replicate A
E.coli, culture with VWPE extract diluted in ethanol 20%, at the time of treatment (t1), replicate B
E.coli, culture with VWPE extract diluted in ethanol 20%, at the time of treatment (t1), replicate C
E. coli cultutures were grown in M9 media using standard protocol, to log phase (OD600 of 0.7-0.8)
E. coli D1 #1
E. coli D1 #2
ecoli_D1_2x_v2
E. coli D1 #3
ecoli_D1_3x_v2
ecoli_D1_4x_v2
Ecoli_dFNR_rep1_anaerobic
Ecoli_dFNR_rep2_anaerobic
Ecoli_Early Recovery in LB T1
Ecoli_Early Recovery in LB T2
Ecoli_Early Recovery in LB T3
Ecoli_Early Recovery in LB T4
Ecoli_Early Recovery in LB T5
Ecoli_Early Recovery in LB T6
Ecoli_Early Recovery in LB T7
E. coli EDL933 #1 
E. coli EDL933 #2
ecoli_EDL933_2x_v2
E. coli EDL933 #3
ecoli_EDL933_3x_v2
ecoli_EDL933_4x_v2
E. coli Estradiol Treatment
E.coli ethanologen strain GLBRCE1 or GLBRCE1 lacking the plasmid-borne PET cassette (GLBRCE1_pBBR) was grown in AFEX corn stover hydrolysate (ACSH). Fermentations were carried out in 3 L bioreactors (Applikon Biotechnology) containing 2.45 L of ACSH and cultures were diluted into ACSH with initial OD at 0.2, grown anaerobically overnight, and then inoculated into bioreactors to a starting OD600 of 0.2.  One biological replicate was grown in each medium.  RNA samples were obtained at 3 time points, corresponding to mid-exponential (Exp), transitional (Trans), and stationary (Stat) growth phases.
E.coli_ethanol_repA_t1
E.coli_ethanol_repA_t2
E.coli_ethanol_repA_t3
E.coli_ethanol_repB_t1
E.coli_ethanol_repB_t2
E.coli_ethanol_repB_t3
E.coli_ethanol_repC_t1
E.coli_ethanol_repC_t2
E.coli_ethanol_repC_t3
E. Coli Exponential FecI ChIP DNA 1
E. Coli Exponential FecI ChIP DNA 2
E. Coli Exponential FecI ChIP DNA 3
E. Coli Exponential FecI ChIP DNA Mock 1
E. Coli Exponential FecI ChIP DNA Mock 2
E. Coli Exponential FecI ChIP DNA Mock 3
E. Coli Exponential RpoB ChIP DNA 1
E. Coli Exponential RpoB ChIP DNA 2
E. Coli Exponential RpoB ChIP DNA 3
E. Coli Exponential RpoB ChIP DNA Mock 1
E. Coli Exponential RpoB ChIP DNA Mock 2
E. Coli Exponential RpoB ChIP DNA Mock 3
E. Coli Exponential RpoD ChIP DNA 1
E. Coli Exponential RpoD ChIP DNA 2
E. Coli Exponential RpoD ChIP DNA 3
E. Coli Exponential RpoD ChIP DNA Mock 1
E. Coli Exponential RpoD ChIP DNA Mock 2
E. Coli Exponential RpoD ChIP DNA Mock 3
E. Coli Exponential RpoD DelN ChIP DNA 1
E. Coli Exponential RpoD DelN ChIP DNA 2
E. Coli Exponential RpoD DelN ChIP DNA Mock 1
E. Coli Exponential RpoD DelN ChIP DNA Mock 2
E. Coli Exponential RpoF ChIP DNA 1
E. Coli Exponential RpoF ChIP DNA 2
E. Coli Exponential RpoF ChIP DNA 3
E. Coli Exponential RpoF ChIP DNA Mock 1
E. Coli Exponential RpoF ChIP DNA Mock 2
E. Coli Exponential RpoF ChIP DNA Mock 3
E. Coli Exponential RpoH ChIP DNA 1
E. Coli Exponential RpoH ChIP DNA 2
E. Coli Exponential RpoH ChIP DNA Mock 1
E. Coli Exponential RpoH ChIP DNA Mock 2
E. Coli Exponential RpoN ChIP DNA 1
E. Coli Exponential RpoN ChIP DNA 2
E. Coli Exponential RpoN ChIP DNA 3
E. Coli Exponential RpoN ChIP DNA Mock 1
E. Coli Exponential RpoN ChIP DNA Mock 2
E. Coli Exponential RpoN ChIP DNA Mock 3
E. Coli Exponential RpoS ChIP DNA 1
E. Coli Exponential RpoS ChIP DNA 2
E. Coli Exponential RpoS ChIP DNA Mock 1
E. Coli Exponential RpoS ChIP DNA Mock 2
E. coli expressing dr1558 replicate 1
E. coli expressing dr1558 replicate 2
E. coli expressing dr1558 replicate 3
E. coli flhD, A600=0.2 on mucus
E. coli flhD, A600=0.4 on glucose
E. coli flhD, A600=0.4 on mannose
E. coli flhD, A600=0.5 on mucus
E. Coli Fnr-8myc ChIP DNA Mock antibody anaerobic
E. Coli Fnr-8myc ChIP DNA Mock antibody NO3
E. Coli Fnr ChIP DNA anaerobic
E. Coli Fnr ChIP DNA NO3
E. coli Frag1 (biological replicate 2)
E. coli Frag1 (control sample 1)
E. coli Frag1, hyperosmotic NaCl treatment (biological replicate 1)
E. coli Frag1, NaCl hyperosmotic treatment (biological replicate 2)
E.coli Frag1, sucrose hyperosmotic treatment (biological replicate 1)
E. coli Frag1, sucrose hyperosmotic treatment (biological replicate 2)
E. coli G 1/2
E. coli G4/9
E. coli G5
E. coli galT mutant cells were cultivated in 125-mL corning flasks containing 30 mL of M63 minimal medium plus glycerol (final 0.3%) at 37 °C.
E. coli galT mutant with galactose
E. coli galT mutant without galactose
Ecoli_Gamma treatment T1
Ecoli_Gamma treatment T2
Ecoli_Gamma treatment T3
Ecoli_Gamma treatment T4
Ecoli_Gamma treatment T5
E.coli gene expression data in deletion of chaperone DnaK
E. coli_gentamicin_30 min
E. coli, glucose limitation, 110 min after depletion of extracellular acetate
E. coli, glucose limitation, 170 min after depletion of extracellular acetate
E. coli, glucose limitation, 230 min after depletion of extracellular acetate
E. coli, glucose limitation, 30 min after depletion of extracellular acetate
E. coli, glucose limitation, 350 min after depletion of extracellular acetate
E. coli, glucose limitation, 50 min after depletion of extracellular acetate
E. coli, glucose limitation, acetate concentration ≤ 0.35 gL-1
E. coli, glucose limitation (glucose concentration < 0.05 gL-1)
E. coli, glucose limitation (glucose concentration < 0.05 gL-1), fed-batch
E. coli glutamine 1
E. coli glutamine 2
E. Coli Glutamine RpoB ChIP DNA 1
E. Coli Glutamine RpoB ChIP DNA 2
E. Coli Glutamine RpoB ChIP DNA Mock 1
E. Coli Glutamine RpoB ChIP DNA Mock 2
E. Coli Glutamine RpoD ChIP DNA 1
E. Coli Glutamine RpoD ChIP DNA 2
E. Coli Glutamine RpoD ChIP DNA Mock 1
E. Coli Glutamine RpoD ChIP DNA Mock 2
E. Coli Glutamine RpoN ChIP DNA 1
E. Coli Glutamine RpoN ChIP DNA 2
E. Coli Glutamine RpoN ChIP DNA Mock 1
E. Coli Glutamine RpoN ChIP DNA Mock 2
E. coli grow in LB rich medium to OD600=2.4
E.coli, grown in LB+ glycerol to0.8OD
E.coli, grown in LB+glycerol to 0.8OD
E.coli, grown in LB to 0.8OD
E.coli, grown in LB to0.8OD
Ecoli_gyrArparCr_Norfloxacin (15 ug/ml) treatment T1
Ecoli_gyrArparCr_Norfloxacin (15 ug/ml) treatment T2
Ecoli_gyrArparCr_Norfloxacin (15 ug/ml) treatment T3
Ecoli_gyrArparCr_Norfloxacin (15 ug/ml) treatment T4
Ecoli_gyrArparCr_Norfloxacin (15 ug/ml) treatment T5
Ecoli_gyrArparCr_Norfloxacin (50 ug/ml) treatment T1
Ecoli_gyrArparCr_Norfloxacin (50 ug/ml) treatment T2
Ecoli_gyrArparCr_Norfloxacin (50 ug/ml) treatment T3
Ecoli_gyrArparCr_Norfloxacin (50 ug/ml) treatment T4
Ecoli_gyrArparCr_Norfloxacin (50 ug/ml) treatment T5
E. coli harboring pRadGro replicate 1
E. coli harboring pRadGro replicate 2
E. coli harboring pRadGro replicate 3
E. coli HB101 grown in Terrific broth media for 12 hours were washed three times in sdH2O and re-suspended in S-Basal complete medium.
E.coli_heat_dynamic_1
E.coli_heat_dynamic_2
E. coli heatshock 1
E. coli heatshock 2
E. coli heat shock gene expression data using direct labeling method (replicate-1)
E. coli heat shock gene expression data using direct labeling method (replicate-2)
E. coli heat shock gene expression data using PAOD method (replicate-1)
E. coli heat shock gene expression data using PAOD method (replicate-2)
E. coli heat shock gene expression data using random priming method (replicate-1)
E. coli heat shock gene expression data using random priming method (replicate-2)
E. Coli Heatshock RpoB ChIP DNA 1
E. Coli Heatshock RpoB ChIP DNA 2
E. Coli Heatshock RpoB ChIP DNA Mock 1
E. Coli Heatshock RpoB ChIP DNA Mock 2
E. Coli Heatshock RpoD ChIP DNA 1
E. Coli Heatshock RpoD ChIP DNA 2
E. Coli Heatshock RpoD ChIP DNA Mock 1
E. Coli Heatshock RpoD ChIP DNA Mock 2
E. Coli Heatshock RpoH ChIP DNA 1
E. Coli Heatshock RpoH ChIP DNA 2
E. Coli Heatshock RpoH ChIP DNA 3
E. Coli Heatshock RpoH ChIP DNA Mock 1
E. Coli Heatshock RpoH ChIP DNA Mock 2
E. Coli Heatshock RpoH ChIP DNA Mock 3
E. coli hhahha2
E. coli hns
E. coli hns2
E. coli hnshns2
E.coli/Hsp60-wt/VAL98Ile(-/+)
E.coli/Hsp60-wt/wt(-/+)
E. coli Hydrocortisone Treatment
E coli, immediately after turning off oxygen
E. coli imp fabI(G93V) [control]
E. coli imp fabI(G94V) [control]
E. coli incubated with GST-fused Drosophila immune proteins for 10 min
E. coli incubated with GST-fused Drosophila immune proteins for 10 min, biological rep1
E. coli incubated with GST-fused Drosophila immune proteins for 10 min, biological rep2
E. coli incubated with GST-fused Drosophila immune proteins for 10 min, biological rep3
E. coli incubated with GST protein alone for 10 min
E. coli incubated with GST protein for 10 min, biological rep1
E. coli incubated with GST protein for 10 min, biological rep2
E. coli incubated with GST protein for 10 min, biological rep3
Ecoli_Indol-acrylate (10 ug/ml) treatment T1
Ecoli_Indol-acrylate (10 ug/ml) treatment T2
Ecoli_Indol-acrylate (10 ug/ml) treatment T3
Ecoli_Indol-acrylate (10 ug/ml) treatment T4
Ecoli_Indol-acrylate (15 ug/ml) treatment T1
Ecoli_Indol-acrylate (15 ug/ml) treatment T2
Ecoli_Indol-acrylate (15 ug/ml) treatment T3
Ecoli_Indol-acrylate (15 ug/ml) treatment T4
E. Coli Iron RpoD ChIP DNA 1
E. Coli Iron RpoD ChIP DNA 2
E. Coli Iron RpoD ChIP DNA Mock 1
E. Coli Iron RpoD ChIP DNA Mock 2
E. coli isolate G 1/2
E. coli isolate G 3/10
E. coli isolate G3/10
E. coli isolate G4/9
E. coli isolate G5
E.coli_IVT-RNA_sigma70-1
E.coli_IVT-RNA_sigma70-2
E.coli_IVT-RNA_sigmaS
E.coli_IVT-RNA_sigmaS-2
ecoli_k12_30C_f_1
ecoli_k12_30C_f_2
ecoli_k12_30C_f_3
ecoli_k12_30C_m_1
ecoli_k12_30C_m_2
ecoli_k12_30C_m_3
ecoli_k12_42C_10min_f_1
ecoli_k12_42C_10min_f_2
ecoli_k12_42C_10min_f_3
ecoli_k12_42C_10min_m_1
ecoli_k12_42C_10min_m_2
ecoli_k12_42C_10min_m_3
ecoli_k12_42C_20min_f_1
ecoli_k12_42C_20min_f_2
ecoli_k12_42C_20min_f_3
ecoli_k12_42C_20min_m_1
ecoli_k12_42C_20min_m_2
ecoli_k12_42C_20min_m_3
E. coli K-12 BW25113 mqsR mutant at OD600=0.5 LB 37C suspension cell
E. coli K-12 BW25113/pBAD-Myc-His C in LB for 24 h 37oC with 0.5% L-arabinose suspension cell
E. coli K-12 BW25113/pBAD-Myc-His C-mqsA in LB for 24 h 37oC with 0.5% L-arabinose suspension cell
E. coli K-12 BW25113/pCA24N at OD600=0.5 LB 37C 2 mM IPTG suspension cell
E. coli K-12 BW25113/pCA24N at OD600=0.5 LB 37C then 2 mM IPTG for 15 min short time suspension cell
E. coli K-12 BW25113/pCA24N in LB for 24 h 37oC with 2 mM IPTG biofilm cell
E. coli K-12 BW25113/pCA24N-mqsR at OD600=0.5 LB 37C 2 mM IPTG suspension cell
E. coli K-12 BW25113/pCA24N-mqsR at OD600=0.5 LB 37C then 2 mM IPTG for 15 min short time suspension cell
E. coli K-12 BW25113/pCA24N-mqsR in LB for 24 h 37oC with 2 mM IPTG biofilm cell
E. coli K-12 BW25113 wt at OD600=0.5 LB 37C suspension cell
E. coli K12 cells, M9, 8 h
E. coli K12 grown in M63 glucose (0.2%) minimal media, sampled in exponential phase OD600=0.3
E. coli K12 grown in M63 glucose (0.2%) minimal media, sampled in stationary phase OD600=1.5
E. coli K12 grown in minimal medium with added 5 μM TPEN
E. coli K12 grown in minimal medium without added TPEN
E. coli K12 interacted with lettuce rhizosphere rep1
E. coli K12 interacted with lettuce rhizosphere rep2
E. coli K12 interacted with lettuce rhizosphere rep3
E. coli K12 interacted with lettuce rhizosphere rep4
E. coli K12 interacted with lettuce rhizosphere rep5
E. coli K12 interacted with lettuce rhizosphere rep6
E. coli K-12 MG1655
E. coli K12 MG1655
E. coli K-12 MG1655 cra-8myc tagged strains was grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose, fructose and acetate.
E. coli [K-12 MG1655 strain (U00096.2)] was grown overnight at 30 °C in LB medium.  The resulting culture was diluted 500-fold in fresh LB medium and grown at 30 °C for 3.5 hours such that O.D. at 600 nm became 0.30-0.35.
E. coli K-12 MG 1655 was grown  in LB-Miller broth at 37°C ,160rpm to  an O.D.600 nm of 0. 7
E. coli K12 MG1655 was grown to mid-log phase (O.D.600nm 0.5) or to stationary phase (O.D.600nm 1.5) aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose or W2 minimal media supplemented with 0.2% glucose and 0.2% glutamine. For heatshock conditions, cells were grown to mid-log phase and incubated at 42oC for 10 min.
E. coli K-12 MG1655 WT and Fur-8-myc tagged strains were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. For iron treated cells, 0.1mM of FeCl2 were treated from the beginning of culture, and for DPD treated cells, 0.2mM of DPD were added at early-log phase and continued to culture for additional 2h. For the rifampicin-treated cultures, the rifampicin dissolved in methanol was added to a final concentration of 150 mg/mL at mid-log phase and stirred for 20 min.
E. coli K-12 MG1655 WT, and Δcra were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose, fructose and acetate.
E. coli K-12 MG1655 WT and Δfur were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. For iron treated cells, 0.1mM of FeCl2 were treated from the beginning of culture, and for DPD treated cells, 0.2mM of DPD were added at early-log phase and continued to culture for additional 2h.
E. coli K-12 MG1655 WT and ΔompR were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. Then cells were treated with 0.3 M of NaCl at mid-log pahse for 30 min with agitation.
E. coli K-12 MG1655 WT, GadE-8-myc, GadW-8-myc, and GadX-8-myc tagged strains were grown to mid-log phase (OD600 = 0.3) aerobically (250 rpm) at 37°C in M9 minimal media supplemented with 0.2% glucose at pH 5.5.
E. coli K-12 MG1655 WT, gadE, gadW and gadX mutant cells were grown to mid-log phase (OD600 = 0.3) aerobically (250 rpm) at 37°C in M9 minimal media supplemented with 0.2% glucose at pH 5.5.
E. coli K-12 MG1655 WT, ΔoxyR, ΔsoxR, and ΔsoxS were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. Then cells were treated with 250 uM of paraquat at mid-log pahse for 20 min with agitation.
ecoli_k12_pBAD_30C_f_1
ecoli_k12_pBad_30C_f_2
ecoli_k12_pBAD_30C_f_3
ecoli_k12_pBAD_30C_f_4
ecoli_k12_pBAD_30C_m_1
ecoli_k12_pBAD_30C_m_2
ecoli_k12_pBAD_30C_m_3
ecoli_k12_pBAD_30C_m_4
ecoli_k12_pBADsigma32I54N_30C_f_1
ecoli_k12_pBADsigma32I54N_30C_f_2
ecoli_k12_pBADsigma32I54N_30C_m_1
ecoli_k12_pBADsigma32I54N_30C_m_2
ecoli_k12_pBADsigma32wt_30C_f_1
ecoli_k12_pBADsigma32wt_30C_f_2
ecoli_k12_pBADsigma32wt_30C_f_3
ecoli_k12_pBADsigma32wt_30C_m_1
ecoli_k12_pBADsigma32wt_30C_m_2
ecoli_k12_pBADsigma32wt_30C_m_3
E. coli K-12 strain BW25113 was evolved in chemostats. The cells were grown in M9 minimal media (5 g/L glucose) with increasing concentrations of n-butanol.
E. coli K12 strain JM109
E. coli K12 substrain W3110 was used in this study. Bioreactor cultivations were performed using a two-compartment bioreactor system consisting of an STR (3L) with a recycle loop (PFR)  in defined medium at pH7 and 37°C. Bioreactor cultivations were carried out with a minimal medium containing (per liter) 19.0 g glucose, 1.0 g NaH2PO4.· 2 H2O, 2.6 g K2HPO4, 3.8 g (NH4)2SO4, and a trace element solution (0.11 g Na3C6H5O7, 0.00835 g FeCl3· 6 H2O, 0.00009 g ZnSO4· 7 H2O, 0.00005 g MnSO4· H2O, 0.0008 g CuSO4· 5 H2O, 0.00009 g CoCl2· 6 H2O, 0.0044 g CaCl2· 2 H2O, 0.1 g MgSO4· 7 H2O). The STR-PFR was operated as a chemostat with ammonia as the growth-limiting substrate. First, a reference steady state (µ=0.2 h−1) was established in the STR and sampled three times during a 16 h period following establishment of the steady state. Then, the PFR was added and samples for RNA-sequencing were aquired.
E. coli K-12 untreated (reference sample)_rep #1
E. coli K-12 untreated (reference sample)_rep #2
E. coli K-12 untreated (reference sample)_rep #3
E. coli K-12 W3110 #1
E. coli K-12 W3110 #2
E. coli K-12 W3110 #3
E. coli K12 (W3110), fed-batch/linear feed, glucose limitation, 110 min after depletion of extracellular acetate
E. coli K12 (W3110), fed-batch/linear feed, glucose limitation, 170 min after depletion of extracellular acetate
E. coli K12 (W3110), fed-batch/linear feed, glucose limitation, 230 min after depletion of extracellular acetate
E. coli K12 (W3110), fed-batch/linear feed, glucose limitation, 30 min after depletion of extracellular acetate
E. coli K12 (W3110), fed-batch/linear feed, glucose limitation, 350 min after depletion of extracellular acetate
E. coli K12 (W3110), fed-batch/linear feed, glucose limitation, 50 min after depletion of extracellular acetate
E. coli K12 (W3110), fed-batch/linear feed, glucose limitation, acetate concentration ≤ 0.35 gL-1
E. coli K12 (W3110), fed-batch/linear feed, glucose limitation (glucose concentration < 0.05 gL-1)
E. coli K12 (W3110), fed-batch/linear feed, unlimited growth (batch)
E. coli K12 (W3110), fed-batch/linear feed, unlimited growth (batch) 
E.coli K12 was cultured in LB and grown at 37°C
E. coli K-12 was incubated in 5 ml LB liquid for 16 h at 37°C with constant shaking, and then 100 µl of each myxotoxin dissolved in acetonitrile was added to each culture to a final concentration of 0.2, and 2 ppm. Additional incubation was performed for 2 h.
E.coli K12 with ccdB upregulation 0 minutes after induction
E.coli K12 with ccdB upregulation 120 minutes after induction
E.coli K12 with ccdB upregulation 30 minutes after induction
E.coli K12 with ccdB upregulation 60 minutes after induction
E.coli K12 with ccdB upregulation 90 minutes after induction
E.coli K12 with lacZ upregulation 0 minutes after induction
E.coli K12 with lacZ upregulation 120 minutes after induction
E.coli K12 with lacZ upregulation 30 minutes after induction
E.coli K12 with lacZ upregulation 60 minutes after induction
E.coli K12 with lacZ upregulation 90 minutes after induction
E. coli K12_WT_M9_rep1
E. coli K12_WT_M9_rep2
E. coli K12 ybjN mutant cells, M9, 8 h
E. coli K12_ybjN_MUTANT_M9_rep1
E. coli K12_ybjN_MUTANT_M9_rep2
E. coli K12_ybjN_MUTANT_M9_rep3
E. coli K12 ybjN over-expression cells, M9, 8 h
E. coli K12_ybjN_OVER-EXPRESSION_M9_rep1
E. coli K12_ybjN_OVER-EXPRESSION_M9_rep2
E. coli K12_ybjN_OVER-EXPRESSION_M9_rep3
Ecoli_Kanamycin treatment T1
Ecoli_Kanamycin treatment T2
Ecoli_Kanamycin treatment T3
Ecoli_Kanamycin treatment T4
Ecoli_Kanamycin treatment T5
Ecoli_Kanamycin treatment T6
Ecoli_ko_arcA_1%_isobutanol_Sample1_TechRep1
Ecoli_ko_arcA_1%_isobutanol_Sample1_TechRep2
Ecoli_ko_arcA_1%_isobutanol_Sample2_TechRep1
Ecoli_ko_arcA_1%_isobutanol_Sample2_TechRep2
Ecoli_ko_arcA_1%_isobutanol_Sample3_TechRep1
Ecoli_ko_arcA_1%_isobutanol_Sample3_TechRep2
Ecoli_ko_arcA_1%_isobutanol_Sample4_TechRep1
Ecoli_ko_arcA_1%_isobutanol_Sample4_TechRep2
Ecoli ko-arcA grown in MOPS
Ecoli ko-arcA grown in MOPS, 10 minutes after 1% isobutanol treatment
Ecoli_ko_fur_1%_isobutanol_Sample1_TechRep1
Ecoli_ko_fur_1%_isobutanol_Sample1_TechRep2
Ecoli_ko_fur_1%_isobutanol_Sample2_TechRep1
Ecoli_ko_fur_1%_isobutanol_Sample2_TechRep2
Ecoli_ko_fur_1%_isobutanol_Sample3_TechRep1
Ecoli_ko_fur_1%_isobutanol_Sample3_TechRep2
Ecoli_ko_fur_1%_isobutanol_Sample4_TechRep1
Ecoli_ko_fur_1%_isobutanol_Sample4_TechRep2
Ecoli ko-fur grown in MOPS
Ecoli ko-fur grown in MOPS, 10 minutes after 1% isobutanol treatment
Ecoli ko-furgrown in MOPS, 10 minutes after 1% isobutanol treatment
Ecoli_ko_ihfA_1%_isobutanol_Sample1_TechRep1
Ecoli_ko_ihfA_1%_isobutanol_Sample1_TechRep2
Ecoli_ko_ihfA_1%_isobutanol_Sample2_TechRep1
Ecoli_ko_ihfA_1%_isobutanol_Sample2_TechRep2
Ecoli_ko_ihfA_1%_isobutanol_Sample3_TechRep1
Ecoli_ko_ihfA_1%_isobutanol_Sample3_TechRep2
Ecoli_ko_ihfA_1%_isobutanol_Sample4_TechRep1
Ecoli_ko_ihfA_1%_isobutanol_Sample4_TechRep2
Ecoli ko-ihfA grown in MOPS
Ecoli ko-ihfA grown in MOPS, 10 minutes after 1% isobutanol treatment
Ecoli_ko_phoB_1%_isobutanol_Sample1_TechRep1
Ecoli_ko_phoB_1%_isobutanol_Sample1_TechRep2
Ecoli_ko_phoB_1%_isobutanol_Sample2_TechRep1
Ecoli_ko_phoB_1%_isobutanol_Sample2_TechRep2
Ecoli_ko_phoB_1%_isobutanol_Sample3_TechRep1
Ecoli_ko_phoB_1%_isobutanol_Sample3_TechRep2
Ecoli_ko_phoB_1%_isobutanol_Sample4_TechRep1
Ecoli_ko_phoB_1%_isobutanol_Sample4_TechRep2
Ecoli ko-phoB grown in MOPS
Ecoli ko-phoB grown in MOPS, 10 minutes after 1% isobutanol treatment
Ecoli_ko_ubiE_1%_isobutanol_Sample1_TechRep1
Ecoli_ko_ubiE_1%_isobutanol_Sample1_TechRep2
Ecoli_ko_ubiE_1%_isobutanol_Sample2_TechRep1
Ecoli_ko_ubiE_1%_isobutanol_Sample2_TechRep2
Ecoli ko-ubiE grown in MOPS
Ecoli ko-ubiE grown in MOPS, 10 minutes after 1% isobutanol treatment
Ecoli_Late Recovery in LB T1
Ecoli_Late Recovery in LB T2
Ecoli_Late Recovery in LB T3
Ecoli_Late Recovery in LB T4
Ecoli_Late Recovery in LB T5
Ecoli_Late Recovery in LB T6
Ecoli_Late Recovery in LB T7
Ecoli_LB growth T1
Ecoli_LB growth T10
Ecoli_LB growth T11
Ecoli_LB growth T2
Ecoli_LB growth T3
Ecoli_LB growth T4
Ecoli_LB growth T5
Ecoli_LB growth T6
Ecoli_LB growth T7
Ecoli_LB growth T8
Ecoli_LB growth T9
E.coli_LB_rep2
E.coli_LB_rep3
E.coli_log_dynamic_1
E.coli_log_dynamic_2
E.coli_log_dynamic_3
E.coli_log_rif_1
E.coli_log_rif_2
E.coli_log_rif_3
E. Coli Lrp ChIP DNA Leucine 1
E. Coli Lrp ChIP DNA Leucine 2
E. Coli Lrp ChIP DNA Leucine 3
E. Coli Lrp ChIP DNA NH4Cl 1
E. Coli Lrp ChIP DNA NH4Cl 2
E. Coli Lrp ChIP DNA NH4Cl 3
E. coli MC4100 strain was cultured at 37°C to mid-log phase (OD600 ~ 0.4) in LB media
E. coli MDS42, osmotic pressure NaCl 0.20 M
E. coli MDS42, osmotic pressure, NaCl 0.20 M
E. coli MDS42, osmotic pressure NaCl 0.20 M, rep 1
E. coli MDS42, osmotic pressure, NaCl 0.20 M, rep 2
E. coli MDS42, osmotic pressure, NaCl 0.20 M, rep 3
E. coli MDS42, osmotic pressure, NaCl 0.45 M
E. coli MDS42, osmotic pressure, NaCl 0.45 M, rep 1
E. coli MDS42, osmotic pressure, NaCl 0.45 M, rep 2
E. coli MDS42, osmotic pressure, NaCl 0.45 M, rep 3
E. coli MDS42, osmotic pressure, NaCl 0.55 M
E. coli MDS42, osmotic pressure, NaCl 0.55 M, rep 1
E. coli MDS42, osmotic pressure, NaCl 0.55 M, rep 2
E. coli MDS42, osmotic pressure, NaCl 0.55 M, rep 3
E. coli MDS42, regular
E. coli MDS42, regular, rep 1
E. coli MDS42, regular, rep 2
E. coli MDS42, regular, rep 3
E. coli MDS42, starvation, SHX 100 ng/ml
E. coli MDS42, starvation, SHX 100 ng/ml, rep 1
E. coli MDS42, starvation, SHX 100 ng/ml, rep 2
E. coli MDS42, starvation, SHX 100 ng/ml, rep 3
E. coli MDS42, starvation, SHX 150 ng/ml
E. coli MDS42, starvation, SHX 150 ng/ml, rep 1
E. coli MDS42, starvation, SHX 150 ng/ml, rep 2
E. coli MDS42, starvation, SHX 150 ng/ml, rep 3
E. coli MDS42, starvation, SHX 50 ng/ml
E. coli MDS42, starvation, SHX 50 ng/ml, rep 1
E. coli MDS42, starvation, SHX 50 ng/ml, rep 2
E. coli MDS42, starvation, SHX 50 ng/ml, rep 3
E. coli MDS42, temperature change, 40.0 deg C
E. coli MDS42, temperature change, 40.0 deg C, rep 1
E. coli MDS42, temperature change, 40.0 deg C, rep 2
E. coli MDS42, temperature change, 40.0 deg C, rep 3
E. coli MDS42, temperature change, 41.5 deg C
E. coli MDS42, temperature change, 41.5 deg C, rep 1
E. coli MDS42, temperature change, 41.5 deg C, rep 2
E. coli MDS42, temperature change, 41.5 deg C, rep 3
E. coli MDS42, temperature change, 41.8 deg C
E. coli MDS42, temperature change, 41.8 deg C, rep 1
E. coli MDS42, temperature change, 41.8 deg C, rep 2
E. coli MDS42, temperature change, 41.8 deg C, rep 3
E.coli MG1063 (recA56 = recA-) with ccdB upregulation 0 minutes after induction
E.coli MG1063 (recA56 = recA-) with ccdB upregulation 120 minutes after induction
E.coli MG1063 (recA56 = recA-) with ccdB upregulation 30 minutes after induction
E.coli MG1063 (recA56 = recA-) with ccdB upregulation 60 minutes after induction
E.coli MG1063 (recA56 = recA-) with ccdB upregulation 90 minutes after induction
E.coli MG1063 (recA56 = recA-) with lacZ upregulation 0 minutes after induction
E.coli MG1063 (recA56 = recA-) with lacZ upregulation 120 minutes after induction
E.coli MG1063 (recA56 = recA-) with lacZ upregulation 30 minutes after induction
E.coli MG1063 (recA56 = recA-) with lacZ upregulation 60 minutes after induction
E.coli MG1063 (recA56 = recA-) with lacZ upregulation 90 minutes after induction
E. coli MG1655
E. coli MG1655 10 min after TMP+adenine+glycine+methionine treatment in M9 media
E. coli MG1655 10 min after TMP+adenine treatment in M9 media
E. coli MG1655 10 min after TMP+glycine+methionine treatment in M9 media
E. coli MG1655 10 min after TMP+thymine+adenine+glycine+methionine treatment in M9 media
E. coli MG1655 10 min after TMP treatment in LB media
E. coli MG1655 10 min after TMP treatment in M9 media
E. coli MG1655 120 min after TMP+adenine+glycine+methionine treatment in M9 media
E. coli MG1655 120 min after TMP+adenine treatment in M9 media
E. coli MG1655 120 min after TMP+glycine+methionine treatment in M9 media
E. coli MG1655 120 min after TMP+thymine+adenine+glycine+methionine treatment in M9 media
E. coli MG1655 120 min after TMP treatment in LB media
E. coli MG1655 120 min after TMP treatment in M9 media
E. coli MG1655 30 min after TMP+adenine+glycine+methionine treatment in M9 media
E. coli MG1655 30 min after TMP+adenine treatment in M9 media
E. coli MG1655 30 min after TMP+glycine+methionine treatment in M9 media
E. coli MG1655 30 min after TMP+thymine+adenine+glycine+methionine treatment in M9 media
E. coli MG1655 30 min after TMP treatment in LB media
E. coli MG1655 30 min after TMP treatment in M9 media
E. coli MG1655 60 min after TMP+adenine+glycine+methionine treatment in M9 media
E. coli MG1655 60 min after TMP+adenine treatment in M9 media
E. coli MG1655 60 min after TMP+glycine+methionine treatment in M9 media
E. coli MG1655 60 min after TMP+thymine+adenine+glycine+methionine treatment in M9 media
E. coli MG1655 60 min after TMP treatment in LB media
E. coli MG1655 60 min after TMP treatment in M9 media
E. coli MG1655 90 min after TMP+adenine+glycine+methionine treatment in M9 media
E. coli MG1655 90 min after TMP treatment in M9 media
E. coli MG1655, BCM treated-Replicate1
E. coli MG1655, BCM treated-Replicate2
E. coli MG1655-C8-1
E. coli MG1655-C8-3
E. coli MG1655 Cold Shock
E. coli MG1655 Cold Shock was grown at 15°C for 4 hour then grown untill reach to half of O.D.600nm of Standard sample at 37°C in LB media.
E. coli MG1655-control-1
E. coli MG1655-control-2
E. coli MG1655-control-3
E. coli MG1655 genomic DNA
E. coli MG1655 Heat Shock
E. coli MG1655 Heat Shock was grown at 50°C for 4 hour then grown untill reach to half of O.D.600nm of Standard sample at 37°C in LB media.
E. coli MG1655 Low pH
E. coli MG1655 Low pH was grown at 37°C for 1 hour in LB media with pH4.5 then grown untill reach to half of O.D.600nm of Standard sample at 37°C in LB media.
E. coli MG1655, M9 media with 4 g/L glucose, aerobic, log phase
E. coli MG1655, M9 media with 4 g/L glucose, anaerobic, log phase
E. coli MG1655 mid-log phase in LB media
E. coli MG1655 mid-log phase in M9 media
E. coli MG1655 minimal C
E. coli MG1655 minimal C&N
E. coli MG1655 minimal C&N Source was grown untill reach to quater of O.D.600nm of Standard sample at 37°C in minimal C and N source MOPS media(C-N- MOPS).
E. coli MG1655 minimal C Source was grown untill reach to half of O.D.600nm of Standard sample at 37°C in minimal C source MOPS media(C- MOPS).
E. coli MG1655 minimal N
E. coli MG1655 minimal N Source was grown untill reach to half of O.D.600nm of Standard sample at 37°C in minimal N source MOPS media(N- MOPS).
E. coli MG1655-MOPS+2%Dextrose
E. coli MG1655-MOPS+2%Dextrose+10mM C8
E. coli MG1655 Osmotic stress
E. coli MG1655 Osmotic Stress was grown untill reach to half of O.D.600nm of Standard sample at 37°C in 45ml MOPS media with 6ml 4M Sodium Chloride.
E. coli MG1655 Oxidative stress
E. coli MG1655 Oxidative Stress was grown untill reach to half of O.D.600nm of Standard sample at 37°C in 49ml MOPS media with 400μl 7% Hydrogen peroxide.
E. coli MG1655 parC::flag
E. coli MG1655 parE::flag
E. coli MG1655 / pCA24N, -gfp
E. coli MG1655 PhoB knock-out strain grows under phosphate starvation condition
E. coli MG1655 / pORF1
E. coli MG1655 ∆Rac G324D, treated-Replicate1-mutant
E. coli MG1655 ∆Rac G324D, treated-Replicate2-mutant
E. coli MG1655 ∆Rac N340S, treated-Replicate1-mutant
E. coli MG1655 ∆Rac N340S, treated-Replicate2-mutant
E. coli MG1655 ∆Rac WT, control-Replicate1-Wildtype
E. coli MG1655 ∆Rac WT, control-Replicate2-Wildtype
E. coli MG1655 RNA
E. coli MG1655 Standard
E. coli MG1655 Standard was grown to mid-log phase (O.D.600nm 0.6~0.8) at 37°C in LB media.
E. coli MG1655star, A600=0.2 on mucus
E. coli MG1655star, A600=0.4 on glucose
E. coli MG1655star, A600=0.4 on mannose
E. coli MG1655star, A600=0.5 on mucus
E. coli MG1655 strain was cultured in M9 complete medium at 37 °C with constant agitation and harvested at mid-exponential phase. (OD600nm ~ 0.6)
E. coli MG1655 strain was cultured in M9 complete medium at 37 °C with constant agitation and harvested at stationary phase. (OD600nm ~ 1.5)
E. coli MG1655 strain was cultured in M9 complete medium at 37 °C with constant agitation. For heat-shock, culture was mix with pre-warmed medium (50 °C) and incubated at 45 °C for 10 min.
E. coli MG1655 strain was cultured in W2 minimal medium (for nitrogen-limiting condition) at 37 °C with constant agitation and harvested at mid-exponential phase. (OD600nm ~ 0.6) (Powell, B. S. et al. J of Biol. Chem.270(9):4822)
E. coli MG1655 / Svi3-3 comp.
E. coli MG1655 thyA- cells grown in M9 minimal medium + 0.2% glucose and 20 ug/ml thymine
E. coli MG1655 UV
E. coli MG1655 UV was exposed to UV light for 15 minutes then grown untill reach to half of O.D.600nm of Standard sample at 37°C in LB media.
E. coli MG1655, Vector control-Replicate1
E. coli MG1655, Vector control-Replicate2
E. coli MG1655 was grown in MOPS + 2 % Dextrose minimal media +- 10 mM octanoic acid (pH=7.0) from OD550 0.05 to ~0.8 and harvested at Midlog.
E. coli MG1655 wildtype strain grows under phosphate starvation condition
E. coli MG1655, WT Rho treated-Replicate1
E. coli MG1655, WT Rho treated-Replicate2
E. coli MG1693
E.coli_Na10_rep1
E.coli_Na10_rep2
E.coli_Na10_rep3
E.coli_Na20_rep1
E.coli_Na20_rep2
E.coli_Na20_rep3
E.coli_Na45_rep1
E.coli_Na45_rep2
E.coli_Na45_rep3
E. coli NaCl hyperosmotic treatment (biological replicate 1)
E. coli NaCl hyperosmotic treatment (biological replicate 2)
ecoli NC_000913.2
E_coli_negativ_control_left_chamber_rep1
E_coli_negativ_control_left_chamber_rep2
E_coli_negativ_control_left_chamber_rep3
E_coli_negativ_control_right_chamber_rep1
E_coli_negativ_control_right_chamber_rep2
E_coli_negativ_control_right_chamber_rep3
E.coli_nitrogen_dynamic_1
E.coli_nitrogen_dynamic_2
Ecoli_Norfloxacin (50 ug/ml) treatment T1
Ecoli_Norfloxacin (50 ug/ml) treatment T2
Ecoli_Norfloxacin (50 ug/ml) treatment T3
Ecoli_Norfloxacin (50 ug/ml) treatment T4
Ecoli_Norfloxacin (50 ug/ml) treatment T5
Ecoli_Novobiocin treatment (200 ug/ml)
Ecoli_Novobiocin treatment (20 ug/ml)
Ecoli_Novobiocin treatment (50 ug/ml)
Ecoli_Novobiocin treatment (5 ug/ml)
Ecoli_NOX-_balanced groNOX-h at OD 0.19
Ecoli_NOX-_balanced groNOX-h at OD 0.3
Ecoli_NOX-_balanced groNOX-h at OD 0.41
Ecoli_NOX-_balanced groNOX-h at OD 0.49
Ecoli_NOX-_balanced groNOX-h at OD 0.6
Ecoli_NOX+_balanced growth at OD 0.13
Ecoli_NOX+_balanced growth at OD 0.21
Ecoli_NOX+_balanced growth at OD 0.28
Ecoli_NOX+_balanced growth at OD 0.34
Ecoli_NOX+_balanced growth at OD 0.4
Ecoli_NP-TiO2_5h_rep1
Ecoli_NP-TiO2_5h_rep2
Ecoli_NP-TiO2_5h_rep3
Ecoli_NP-TiO2_5h_rep4
E.coli,  NP-TiO2 exposed culture, 5h in 10 mM NaCl 100mg/L NP-TiO2, replicate 1
E.coli,  NP-TiO2 exposed culture, 5h in 10 mM NaCl 100mg/L NP-TiO2, replicate 2
E.coli,  NP-TiO2 exposed culture, 5h in 10 mM NaCl 100mg/L NP-TiO2, replicate 3
E.coli,  NP-TiO2 exposed culture, 5h in 10 mM NaCl 100mg/L NP-TiO2, replicate 4
E.coliO157_0.5% (w/v)sodiumbenzoate_0min_rep1
E.coliO157_0.5% (w/v)sodiumbenzoate_0min_rep2
E.coliO157_0.5% (w/v)sodiumbenzoate_15min_rep1
E.coliO157_0.5% (w/v)sodiumbenzoate_15min_rep2
E.coliO157_0.5% (w/v)sodiumbenzoate_30min_rep1
E.coliO157_0.5% (w/v)sodiumbenzoate_30min_rep2
E.coliO157_0.5% (w/v)sodiumbenzoate_5min_rep1
E.coliO157_0.5% (w/v) sodiumbenzoate_5min_rep2
E.coliO157_0.5% (w/v)sodiumbenzoate_60min_rep1
E.coliO157_0.5% (w/v)sodiumbenzoate_60min_rep2
E.coliO157_0%sodiumbenzoate_0min_rep1
E.coliO157_0%sodiumbenzoate_0min_rep2
E.coliO157_0%sodiumbenzoate_15min_rep1
E.coliO157_0%sodiumbenzoate_15min_rep2
E.coliO157_0%sodiumbenzoate_30min_rep1
E.coliO157_0%sodiumbenzoate_30min_rep2
E.coliO157_0%sodiumbenzoate_5min_rep1
E.coliO157_0%sodiumbenzoate_5min_rep2
E.coliO157_0%sodiumbenzoate_60min_rep1
E.coliO157_0%sodiumbenzoate_60min_rep2
E. coli O157:H7 86-24 in LB at 37oC at OD 4.0
E. coli O157:H7 86-24 was inoculated in 25 ml of LB in 250 ml shake flasks with overnight cultures that were diluted 1:100. Cells were shaken at 250 rpm and 37°C for an absorbance of 4.0 at 600 nm.  Cells were immediately chilled with dry ice and 95% ethanol (to prevent RNA degradation) for 30 sec before centrifugation at 13,000 g for 2 min; cell pellets were frozen immediately with dry ice and stored -80°C.  RNA was isolated using Qiagen RNeasy mini Kit (Cat# 74104).
E. coli O157:H7 EDL933
E.coli O157:H7 EDL 933 genomic DNA
E.coli O157:H7 EDL 933 genomic DNA hybridization to LLNL virulence mechanism array v2A
E. coli O157:H7 EDL933 in LB at 37oC at 7 hrs incubation
E. coli O157:H7 EDL933 in LB at 37oC at 7 hrs incubation with phloretin
E. coli O157:H7 EDL933 in LB at 37oC at OD 4.0
E. coli O157:H7 EDL933 in LB at 37oC for 7 hrs incubation
E. coli O157:H7 EDL933 in LB at 37oC for 7 hrs incubation with DMSO
E. coli O157:H7 EDL933 in LB at 37oC for 7 hrs incubation with honey
E. coli O157:H7 EDL933 in LB at 37oC for 7 hrs incubation with indole-3-acetaldehyde
E. coli O157:H7 EDL933 was inoculated in 100 ml of LB in 250 ml shake flasks with overnight cultures that were diluted 1:100. Cells were shaken with 4 g of glass wool at 250 rpm and 37°C for 7 hrs.  Cells were immediately chilled with dry ice and 95% ethanol (to prevent RNA degradation) for 30 sec before centrifugation in 50 ml centrifuge tubes at 13,000 g for 2 min; cell pellets were frozen immediately with dry ice and stored -80°C.  RNA was isolated using Qiagen RNeasy mini Kit (Cat# 74104) with Qiagen RNase-free DNase I (Cat# 79254).
E. coli O157:H7 EDL933 was inoculated in 250 ml of LB in 1000 ml shake flasks with overnight cultures that were diluted 1:100. Cells were shaken with 10 g of glass wool at 100 rpm and 37°C for 7 hrs.  Cells were immediately chilled with dry ice and 95% ethanol (to prevent RNA degradation) for 30 sec before centrifugation in 50 ml centrifuge tubes at 13,000 g for 2 min; cell pellets were frozen immediately with dry ice and stored -80°C.  RNA was isolated using Qiagen RNeasy mini Kit (Cat# 74104) with Qiagen RNase-free DNase I (Cat# 79254).
E. coli O157:H7 EDL933 was inoculated in 25 ml of LB in 250 ml shake flasks with overnight cultures that were diluted 1:100. Cells were shaken at 100 rpm and 37°C for 7 hrs.  Cells were immediately chilled with dry ice and 95% ethanol (to prevent RNA degradation) for 30 sec before centrifugation in 50 ml centrifuge tubes at 13,000 g for 2 min; cell pellets were frozen immediately with dry ice and stored -80°C.  RNA was isolated using Qiagen RNeasy mini Kit (Cat# 74104) with Qiagen RNase-free DNase I (Cat# 79254).
E. coli O157:H7 EDL933 was inoculated in 25 ml of LB in 250 ml shake flasks with overnight cultures that were diluted 1:100. Cells were shaken at 250 rpm and 37°C for an absorbance of 4.0 at 600 nm.  Cells were immediately chilled with dry ice and 95% ethanol (to prevent RNA degradation) for 30 sec before centrifugation at 13,000 g for 2 min; cell pellets were frozen immediately with dry ice and stored -80°C.  RNA was isolated using Qiagen RNeasy mini Kit (Cat# 74104).
E.coli O157:H7 in LB at mid-log phase
E. coli O157:H7 interacted with lettuce rhizosphere biological rep 1 slide 1
E. coli O157:H7 interacted with lettuce rhizosphere biological rep 1 slide 2
E. coli O157:H7 interacted with lettuce rhizosphere biological rep 2 slide 3
E. coli O157:H7 interacted with lettuce rhizosphere biological rep 2 slide 4
E. coli O157:H7 interacted with lettuce rhizosphere biological rep 3 slide 5
E. coli O157:H7 interacted with lettuce rhizosphere biological rep 3 slide 6
E. coli O157:H7 was grown in 15mL falcon tubes containing 8mL of filtered rat's caecal content. Growth were performed in static condition at 37 °C for 6 hours.
E. coli O157 (Sakai) untreated (reference sample)_rep #1
E. coli O157 (Sakai) untreated (reference sample)_rep #2
E. coli O157 (Sakai) untreated (reference sample)_rep #3
E. coli (OD660 nm = 0.3) was incubated with control protein or antibacterial preparations in 5 mM TRIS (pH 7.6) with 150 mM NaCl, 10 µM ZnSO4, and 2% LB, at 37oC aerobically with shaking.
E.coli_∆ompR pH 5.6 A
E.coli_∆ompR pH 5.6 B
E.coli_∆ompR pH 5.6 C
E.coli_∆ompR pH 7.2+15% sucrose A
E.coli_∆ompR pH 7.2+15% sucrose B
E. coli_PGRP_30 min
E. coli phage 3538 #1
E. coli phage 3538 #2
E.coli_polyphenols_repA_t1
E.coli_polyphenols_repA_t2
E.coli_polyphenols_repA_t3
E.coli_polyphenols_repB_t1
E.coli_polyphenols_repB_t2
E.coli_polyphenols_repB_t3
E.coli_polyphenols_repC_t1
E.coli_polyphenols_repC_t2
E.coli_polyphenols_repC_t3
E. coli Progesterone Treatment
Ecoli_pUC expression OD 0.2
Ecoli_pUC expression OD 0.5
Ecoli_pUC expression OD 0.9
E. Coli PurR ChIP DNA Adenine 1
E. Coli PurR ChIP DNA Adenine 2
E. Coli PurR ChIP DNA glucose 1
E. Coli PurR ChIP DNA glucose 2
E. Coli PurR Input DNA Adenine 1
E. Coli PurR Input DNA Adenine 2
E. Coli PurR Input DNA glucose 1
E. Coli PurR Input DNA glucose 2
E. coli recoded ompF
E. coli recoded ompF (recoded ompF gene)
Ecoli_Recovery in 10mM Na-P + 0.2 % glucose T1
Ecoli_Recovery in 10mM Na-P + 0.2 % glucose T2
Ecoli_Recovery in 10mM Na-P + 0.2 % glucose T3
Ecoli_Recovery in 10mM Na-P + 0.2 % glucose T4
Ecoli_Recovery in 10mM Na-P + 0.2 % glucose T5
Ecoli_Recovery in 10mM Na-P + 0.2 % glucose T6
Ecoli_Recovery in 10mM Na-P + 0.2 % glucose T7
Ecoli_Recovery in 10mM Na-P T1
Ecoli_Recovery in 10mM Na-P T2
Ecoli_Recovery in 10mM Na-P T3
Ecoli_Recovery in 10mM Na-P T4
Ecoli_Recovery in 10mM Na-P T5
Ecoli_Recovery in 10mM Na-P T6
Ecoli_Recovery in 10mM Na-P T7
E_coli_response_control_1mM_H2O2_added_rep1
E_coli_response_control_1mM_H2O2_added_rep2
E_coli_response_control_1mM_H2O2_added_rep3
E_coli_response_control_water_added_rep1
E_coli_response_control_water_added_rep2
E_coli_response_control_water_added_rep3
E.coli RNAP beta subunit ChIP DNA from heat-shocked condition without rifampicin treatment
E.coli RNAP beta subunit ChIP DNA from mid-exponential condition without rifampicin treatment
E.coli RNAP beta subunit ChIP DNA from mid-exponential condition with rifampicin treatment
E.coli RNAP beta subunit ChIP DNA from nitrogen-limiting condition without rifampicin treatment
E.coli RNAP beta subunit ChIP DNA from stationary condition without rifampicin treatment
E. coli RNA polymerase core enzyme was purchased from Epicentre (Madison, WI, USA). Histidine-tagged σ factors were produced and purified as described (Lacour et al., 2003; Checroun et al., 2004); proteins appeared pure from contaminants as determined by denaturing protein gel electrophoresis (data not shown). For reconstitution of RNA polymerase holoenzymes, the core enzyme was incubated for 10 minutes at 37 °C with either σS or σ70 at a 1:10 ratio. For calculation of RNA polymerase concentrations in transcription assays, it was assumed that, after reconstitution, core enzyme would be 100% active and fully saturated by either σ factor. 2 ug of genomic DNA from E. coli MG1655 digested with EcoRI were used in transcription assays for ROMA experiments. RNA polymerase holoenzyme concentrations were 100 nM in 50 ul reaction mixture. Ten independent run-off transcription assays were performed, and transcripts were pooled together (ca. 1 ug total RNA).
E. coli Rosetta cells transformed with pET-28a or pET-28a-BnTR1 (OD600nm = 0.6) were induced with 0.1 mM IPTG at 37°C for 1 hour.
E.coli_RviaT1_SR1
E.coli_RviaT1_SR2
E.coli_RviaT1_SR3
E.coli_RviaT2_SR1
E.coli_RviaT2_SR2
E.coli_RviaT2_SR3
E.coli_RviaT3_SR1
E.coli_RviaT3_SR2
E.coli_RviaT3_SR3
E.coli_RviaT4_SR1
E.coli_RviaT4_SR2
E.coli_RviaT4_SR3
E.coli_RviaT5_SR2
E.coli_RviaT5_SR3
E.coli_RviaT6_SR2
E.coli_RviaT6_SR3
E.coli_RviaT7_SR2
E.coli_RviaT7_SR3
E.coli_RviaT8_SR2
E.coli_RviaT8_SR3
E. coli samples for RNA extraction were taken during fermentation. Cells were harvested by centrifugation at the cultivation temperature (37°C, 10,000 g, 1 min), separated from the supernatant, and rapidly frozen in dry ice. The samples were stored at -70°C until analysis
E.coli SE15 is cultured in LB broth and LuxS E.coli SE15 is cultured in LB broth with kanamycine at 37℃and in 150rpm shaking incubator
E.coli SE15 is isolated from indwelling catheter of patient and deleted LuxS gene (related to quorum sensing)
E.coli SE15 isolated from indwelling catheter of patient
E_coli_sham_powerline_interm_15h_rep1
E_coli_sham_powerline_interm_15h_rep2
E_coli_sham_powerline_interm_15h_rep3
E_coli_sham_powerline_interm_2.5h_rep1
E_coli_sham_powerline_interm_2.5h_rep2
E_coli_sham_powerline_interm_2.5h_rep3
E_coli_sham_powerline_interm_8min_rep1
E_coli_sham_powerline_interm_8min_rep2
E_coli_sham_powerline_interm_8min_rep3
E_coli_sham_sinusoidal_cont_15h_rep1
E_coli_sham_sinusoidal_cont_15h_rep2
E_coli_sham_sinusoidal_cont_15h_rep3
E_coli_sham_sinusoidal_cont_2.5h_rep1
E_coli_sham_sinusoidal_cont_2.5h_rep2
E_coli_sham_sinusoidal_cont_2.5h_rep3
E_coli_sham_sinusoidal_cont_8min_rep1
E_coli_sham_sinusoidal_cont_8min_rep2
E_coli_sham_sinusoidal_cont_8min_rep3
E_coli_sham_sinusoidal_interm_15h_rep1
E_coli_sham_sinusoidal_interm_15h_rep2
E_coli_sham_sinusoidal_interm_15h_rep3
E_coli_sham_sinusoidal_interm_2.5h_rep1
E_coli_sham_sinusoidal_interm_2.5h_rep2
E_coli_sham_sinusoidal_interm_2.5h_rep3
Ecoli_Sodium Azide treatment T1
Ecoli_Sodium Azide treatment T2
Ecoli_Sodium Azide treatment T3
Ecoli_Sodium Azide treatment T4
E. coli ST131 UR40 was treated with ciprofloxacin (2µg/mL) and samples were taken at time points 0 min, 30 min and 90min.
E.coli_stat_dynamic_1
E.coli_stat_dynamic_2
E. coli stationary 1
E. coli stationary 2
Ecoli_Stationary phase in LB T1
Ecoli_Stationary phase in LB T2
Ecoli_Stationary phase in LB T3
Ecoli_Stationary phase in LB T4
Ecoli_Stationary phase in LB T5
Ecoli_Stationary phase in LB T6
E. Coli Stationary RpoB ChIP DNA 1
E. Coli Stationary RpoB ChIP DNA 2
E. Coli Stationary RpoB ChIP DNA Mock 1
E. Coli Stationary RpoB ChIP DNA Mock 2
E. Coli Stationary RpoD ChIP DNA 1
E. Coli Stationary RpoD ChIP DNA 2
E. Coli Stationary RpoD ChIP DNA Mock 1
E. Coli Stationary RpoD ChIP DNA Mock 2
E. Coli Stationary RpoD DelS ChIP DNA 1
E. Coli Stationary RpoD DelS ChIP DNA 2
E. Coli Stationary RpoD DelS ChIP DNA Mock 1
E. Coli Stationary RpoD DelS ChIP DNA Mock 2
E. Coli Stationary RpoS ChIP DNA 1
E. Coli Stationary RpoS ChIP DNA 2
E. Coli Stationary RpoS ChIP DNA 3
E. Coli Stationary RpoS ChIP DNA Mock 1
E. Coli Stationary RpoS ChIP DNA Mock 2
E. Coli Stationary RpoS ChIP DNA Mock 3
E. coli strain B178 (Georgopoulos et al. (1973) J Mol Biol 76: 45-60) in which the endogenous groES and groEL genes have been deleted and that is maintained alive by the pOFX-tac1-derived plasmid carrying an IPTG-inducible operon with cDNA encoding human Hsp10 and the mature part of human wild type Hsp60 (Hansen et al., 2002). These cells were subsequently transformed by electroporation with a second plasmid, derivative of pBAD/hisA (Invitrogen), that contained an operon with Hsp10 and the Val98Ile mutant variant of Hsp60 under control of the arabinose-inducible BAD promoter. The pBAD/hisA-derived plasmid carries a pBR322 origin of replication and an ampicillin resistance gene and can be stably maintained in the same cell with the p15A-origin/kanamycin resistance gene containing pOFX-tac derivative.
E. coli strain B178 (Georgopoulos et al. (1973) J Mol Biol 76: 45-60) in which the endogenous groES and groEL genes have been deleted and that is maintained alive by the pOFX-tac1-derived plasmid carrying an IPTG-inducible operon with cDNA encoding human Hsp10 and the mature part of human wild type Hsp60 (Hansen et al., 2002). These cells were subsequently transformed by electroporation with a second plasmid, derivative of pBAD/hisA (Invitrogen), that contained an operon with Hsp10 and wild type Hsp60 under control of the arabinose-inducible BAD promoter. The pBAD/hisA-derived plasmids carry a pBR322 origin of replication and an ampicillin resistance gene and can be stably maintained in the same cell with the p15A-origin/kanamycin resistance gene containing pOFX-tac derivative.
E. coli strain B-a
E. coli strain B-b
E. coli strain B DNA
E. coli strain DH5α harboring pAR060302 was grown in 10 mL DifcoTM Luria-Bertani (LB) broth aliquots at 37º C with shaking until an OD600 of 0.5.
E.coli strain, DY330, was grown at 30C in M9 media supplemented with 0.4% glucose, vitamins and amino acids.
E. coli strain FHI12
E. coli strain FHI24
E. coli strain FHI25
E. coli strain FHI27
E. coli strain FHI36
E. coli strain FHI4
E. coli strain FHI43
E. coli strain FHI48
E. coli strain FHI6
E. coli strain FHI63
E. coli strain FHI66
E. coli strain FHI7
E. coli strain FHI79
E. coli strain FHI8
E. coli strain FHI83
E. coli strain FHI9
E. coli strain FHI95
E. coli, strain Frag1
E. coli strain isolated from CF patient stool
E. coli strain isolated from healthy child stool
E. coli strain K12
E. coli strain K12-a
E. coli strain K12-b
E. coli strain K12-c
E. coli strain K12-d
E. coli strain K12 DNA
E. coli strain MC4100relA+ in mid log phase incubated at 37ºC for 4 hours with 100 μg/ml NA
E. coli strain MC4100relA+ in mid log phase incubated at 37ºC for 4 hours with 10 μg/ml NA
E. coli strain MC4100relA+ in mid log phase incubated at 37ºC for 4 hours without treatment.
E. coli strain MC4100relA+ ∆mazEF in mid log phase incubated at 37ºC for 4 hours with 100 μg/ml NA
E. coli strain MC4100relA+ ∆mazEF in mid log phase incubated at 37ºC for 4 hours with 10 μg/ml NA
E. coli strain MC4100relA+ ∆mazEF in mid log phase incubated at 37ºC for 4 hours without treatment
E. coli strain MC4100relA+ ∆mazEFlexA3 in mid log phase incubated at 37ºC for 4 hours with 100 μg/ml NA
E. coli strain MC4100relA+ ∆mazEFlexA3 in mid log phase incubated at 37ºC for 4 hours with 10 μg/ml NA
E. coli strain MC4100relA+ ∆mazEFlexA3 in mid log phase incubated at 37ºC for 4 hours without treatment
E.coli strain MG1655
E. coli strain NM580 (genotype MG1655 ermBL-ermB’::LacZ) cells were grown in LB broth (37°C) until OD600 of ~0.3.
E.Coli, strain P4XB2 mutant, grown in presence of arginine(100 ug/ml)
E.Coli, strain P4X, grown in presence of arginine(100 ug/ml)
E.Coli, strain P4X, grown on minimal medium, reference sample
E. coli strains harboring ArgR-8myc were grown in glucose (2 g/L) minimal W2 medium supplemented with 1g/L arginine.
E. coli strains harboring ArgR-8myc were grown in glucose (2 g/L) minimal W2 medium supplemented with 2g/L glutamine.
E. coli strains harboring Lrp-8myc were grown in glucose (2 g/L) minimal M9 medium supplemented with 10 mM leucine.
E. coli strains harboring Lrp-8myc were grown in glucose (2 g/L) minimal M9 medium supplemented without 10 mM leucine.
E. coli strains harboring PurR-8myc were grown in minimal M9 medium supplemented with glucose (2 g/L) then inoculated into 100mL of fresh M9 minimal medium.
E. coli strains harboring PurR-8myc were grown in minimal M9 medium supplemented with glucose (2 g/L) then inoculated into 100mL of fresh M9 minimal medium supplemented with 100ug/L adenine.
E. coli strains harboring TrpR-8myc were grown in glucose (2 g/L) minimal M9 medium supplemented with 20 mg/L tryptophan.
E. coli strains harboring TrpR-8myc were grown in glucose (2 g/L) minimal M9 medium supplemented without 20 mg/L tryptophan.
E. coli strains harboring σ70 mutant B8 and WT were cultured overnight and inoculated (1%) into fresh medium.
E. coli strains HT874, HT873, HT875, HT873 treated with or no polyamines by Trizol protocol.
E. coli strain St. Olav104
E. coli strain St. Olav157
E. coli strain St. Olav164 
E. coli strain St. Olav17
E. coli strain St. Olav172
E. coli strain St. Olav173
E. coli strain St. Olav174
E. coli strain St. Olav176
E. coli strain St. Olav178
E. coli strain St. Olav179
E. coli strain St. Olav39
E. coli strain St. Olav40
E. coli strain St. Olav63
E. coli strains was grown in MgM media at pH 5.6, 7.2 and 7.2 with 15% (w/v) sucrose to O.D ~0.6.
E. coli strains  were grown in minimal M9 medium supplemented with glucose (2 g/L) and additional iron to mid-exponential phase
E. coli strains  were grown in minimal M9 medium supplemented with glucose (2 g/L) to mid-exponential phase
E. coli strains  were grown in minimal M9 medium supplemented with glucose (2 g/L) to mid-exponential phase and treated with heatshock for 10 min
E. coli strains  were grown in minimal M9 medium supplemented with glucose (2 g/L) to mid-exponential phase with heatshock for 10 min
E. coli strains  were grown in minimal M9 medium supplemented with glucose (2 g/L) to stationary phase
E. coli strains  were grown in minimal W2 medium supplemented with glucose (2 g/L) and glutamine (2 g/L) to mid-exponential phase
E. coli, stressed by NaCl, in presence of glycine betaine
e. coli subset: enterohemorrhagic E.coli
E. coli sucrose hyperosmotic treatment (biological replicate 1)
E. coli sucrose hyperosmotic treatment (biological replicate 2)
E.coli_T1viaR_SR1
E.coli_T1viaR_SR2
E.coli_T1viaR_SR3
E.coli_T2viaR_SR1
E.coli_T2viaR_SR2
E.coli_T2viaR_SR3
E.coli_T3viaR_SR1
E.coli_T3viaR_SR2
E.coli_T3viaR_SR3
E.coli_T4viaR_SR1
E.coli_T4viaR_SR2
E.coli_T4viaR_SR3
E.coli_T5viaR_SR2
E.coli_T5viaR_SR3
E.coli_T6viaR_SR2
E.coli_T6viaR_SR3
E.coli_T7viaR_SR2
E.coli_T7viaR_SR3
E.coli_T8viaR_SR2
E.coli_T8viaR_SR3
E. coli - TAP
E. coli + TAP
Ecoli_Temperature upshift in gyrBT mutant T1
Ecoli_Temperature upshift in gyrBT mutant T2
Ecoli_Temperature upshift in gyrBT mutant T3
Ecoli_Temperature upshift in gyrBT mutant T4
E. coli TolC cells were grown o/n in LB medium at 37°C and 200 rpm.
E_coli_transcriptome_1
E_coli_transcriptome_2
E_coli_treated_powerline_interm_15h_rep1
E_coli_treated_powerline_interm_15h_rep2
E_coli_treated_powerline_interm_15h_rep3
E_coli_treated_powerline_interm_2.5h_rep1
E_coli_treated_powerline_interm_2.5h_rep2
E_coli_treated_powerline_interm_2.5h_rep3
E_coli_treated_powerline_interm_8min_rep1
E_coli_treated_powerline_interm_8min_rep2
E_coli_treated_powerline_interm_8min_rep3
E_coli_treated_sinusoidal_cont_15h_rep1
E_coli_treated_sinusoidal_cont_15h_rep2
E_coli_treated_sinusoidal_cont_15h_rep3
E_coli_treated_sinusoidal_cont_2.5h_rep1
E_coli_treated_sinusoidal_cont_2.5h_rep2
E_coli_treated_sinusoidal_cont_2.5h_rep3
E_coli_treated_sinusoidal_cont_8min_rep1
E_coli_treated_sinusoidal_cont_8min_rep2
E_coli_treated_sinusoidal_cont_8min_rep3
E_coli_treated_sinusoidal_interm_15h_rep1
E_coli_treated_sinusoidal_interm_15h_rep2
E_coli_treated_sinusoidal_interm_15h_rep3
E_coli_treated_sinusoidal_interm_2.5h_rep1
E_coli_treated_sinusoidal_interm_2.5h_rep2
E_coli_treated_sinusoidal_interm_2.5h_rep3
E. coli treated with bicontinious microemulsion
E. coli treated with o/w microemulsion
E. coli treated with w/o microemulsion
E. Coli TrpR ChIP DNA glucose
E. Coli TrpR ChIP DNA Tryptophan
E. coli Type_II genotype strain, under 37ºC, rep 1
E. coli Type_II genotype strain, under 37ºC, rep 2
E. coli Type_II genotype strain, under 37ºC, rep 3
E. coli Type_II genotype strain, under 45ºC, rep 1
E. coli Type_II genotype strain, under 45ºC, rep 2
E. coli Type_II genotype strain, under 45ºC, rep 3
E. coli Type_III genotype strain, under 37ºC, rep 1
E. coli Type_III genotype strain, under 37ºC, rep 2
E. coli Type_III genotype strain, under 37ºC, rep 3
E. coli Type_III genotype strain, under 45ºC, rep 1
E. coli Type_III genotype strain, under 45ºC, rep 2
E. coli Type_III genotype strain, under 45ºC, rep 3
E. coli, unlimited growth (batch)
E. coli, unlimited growth (batch) 
E.coli W1863 wt lambda- with ccdB upregulation 0 minutes after induction
E.coli W1863 wt lambda- with ccdB upregulation 30 minutes after induction
E.coli W1863 wt lambda- with ccdB upregulation 60 minutes after induction
E.coli W1863 wt lambda- with ccdB upregulation 90 minutes after induction
E.coli W1863 wt lambda- with lacZ upregulation 0 minutes after induction
E.coli W1863 wt lambda- with lacZ upregulation 30 minutes after induction
E.coli W1863 wt lambda- with lacZ upregulation 60 minutes after induction
E.coli W1863 wt lambda- with lacZ upregulation 90 minutes after induction
E.coli W3110, 15 minutes after oxygen downshift, sample S2
E.coli W3110, 15 minutes before oxygen downshift, sample S1
ecoli_W3110_2x_v2
ecoli_W3110_3x_v2
E.coli W3110, 45 minutes after oxygen downshift, sample S3
ecoli_W3110_4x_v2
E.coli W3110, 75 minutes after oxygen downshift, sample S4
E. coli W3110 (control)
E. coli W3110 expressing PCK
E. coli W3110 expressing ppc
E. coli W3110 expressing ppc at LB-GlC medium, D=0.1 h-1
E.coli W3110, fermentation sample taken 15 minutes after oxygen downshift
E.coli W3110, fermentation sample taken 15 minutes before oxygen downshift
E.coli W3110, fermentation sample taken 45 minutes after oxygen downshift
E.coli W3110, fermentation sample taken 75 minutes after oxygen downshift
E. coli W3110 grown at glucose-minimal medium (IPTG induction) in early log phase (u=0.25 h-1)
E. coli W3110 grown at LB-glucose medium (IPTG induction) in chemostat (D=0.1 h-1)
E. coli W3110 (KCTC 2223)
E. coli W3110 (KCTC 2223) 
E. coli W3110 (KCTC 2223) at LB-GlC medium, D=0.1 h-1
E. coli W3110/pck grown at LB-glucose medium (IPTG induction) in chemostat (D=0.1 h-1)
E. coli W3110/PCK with glucose-minimal medium (IPTG induced) at early log phase (u=0.25) 
E. coli W3110/ppc grown at glucose-minimal medium (IPTG induction) in early log phase (u=0.25 h-1)
E. coli W3110/ppc grown at LB-glucose medium (IPTG induction) in chemostat (D=0.1 h-1)
E. coli W3110 with glucose-minimal medium (IPTG induced) at early log phase (u=0.25)
E. coli was grown in M9 medium supplemented with 0.4% glucose. The cultures were grown on a rotary shaker (200 rpm) at 37 °C until the contents of the flask reached an OD600 of 0.3 (mid-log phase of growth). Each culture was divided into 25 mL aliquots, transferred to 50 mL conical tubes, and centrifuged at 2540 x g for 12 minutes. The supernatant was decanted, and the cells were resuspended in 25 mL of M9 medium at pH 7 in the presence of 5.4 µM (1 µg/mL) total cadmium, added as CdCl2. The cultures were incubated at 25 °C for 15 minutes with manual rotations of the flasks once per minute to resuspend the cells.
E. coli was grown in M9 medium supplemented with 0.4% glucose. The cultures were grown on a rotary shaker (200 rpm) at 37 °C until the contents of the flask reached an OD600 of 0.3 (mid-log phase of growth). Each culture was divided into 25 mL aliquots, transferred to 50 mL conical tubes, and centrifuged at 2540 x g for 12 minutes. The supernatant was decanted, and the cells were resuspended in 25 mL of M9 medium at pH 7. The cultures were incubated at 25 °C for 15 minutes with manual rotations of the flasks once per minute to resuspend the cells.
E. coli was grown in M9 medium supplemented with 0.4% glucose. The cultures were grown on a rotary shaker (200 rpm) at 37 °C until the contents of the flask reached an OD600 of 0.3 (mid-log phase of growth). Each culture was divided into 25 mL aliquots, transferred to 50 mL conical tubes, and centrifuged at 2540 x g for 12 minutes. The supernatant was decanted, and the cells were resuspended in 25 mL of M9 medium at pH 7. The cultures were incubated at 25 °C for 5 minutes with manual rotations of the flasks once per minute to resuspend the cells.
E. coli was grown in M9 medium supplemented with 0.4% glucose. The cultures were grown on a rotary shaker (200 rpm) at 37 °C until the contents of the flask reached an OD600 of 0.3 (mid-log phase of growth). Each culture was divided into 25 mL aliquots, transferred to four 50 mL conical tubes, and centrifuged at 2540 x g for 12 minutes. The supernatant was decanted, and the cells were resuspended in 25 mL of M9 medium at pH 5 in the presence of 5.4 µM (1 µg/mL) total cadmium, added as CdCl2. The cultures were incubated at 25 °C for 15 minutes with manual rotations of the flasks once per minute to resuspend the cells.
E. coli was grown in M9 medium supplemented with 0.4% glucose.  The cultures were grown on a rotary shaker (200 rpm) at 37 °C  until the contents of the flask reached an OD600 of 0.3 (mid-log phase of growth).  Each culture was divided into 25 mL aliquots, transferred to four 50 mL conical tubes, and centrifuged at 2540 x g for 12 minutes.  The supernatant was decanted, and the cells were resuspended in 25 mL of M9 medium at pH 5 in the presence of 5.4 µM (1 µg/mL) total cadmium, added as CdCl2.  The cultures were incubated at 25 °C for 5 minutes with manual rotations of the flasks once per minute to resuspend the cells.
E. coli was grown in M9 medium supplemented with 0.4% glucose. The cultures were grown on a rotary shaker (200 rpm) at 37 °C until the contents of the flask reached an OD600 of 0.3 (mid-log phase of growth). Each culture was divided into 25 mL aliquots, transferred to four 50 mL conical tubes, and centrifuged at 2540 x g for 12 minutes. The supernatant was decanted, and the cells were resuspended in 25 mL of M9 medium at pH 5 in the presence of 5.4 µM (1 µg/mL) total cadmium, added as CdCl2. The cultures were incubated at 25 °C for 5 minutes with manual rotations of the flasks once per minute to resuspend the cells.
E. coli was grown in M9 medium supplemented with 0.4% glucose. The cultures were grown on a rotary shaker (200 rpm) at 37 °C until the contents of the flask reached an OD600 of 0.3 (mid-log phase of growth). Each culture was divided into 25 mL aliquots, transferred to four 50 mL conical tubes, and centrifuged at 2540 x g for 12 minutes. The supernatant was decanted, and the cells were resuspended in 25 mL of M9 medium at pH 5. The cultures were incubated at 25 °C for 15 minutes with manual rotations of the flasks once per minute to resuspend the cells.
E. coli was grown in M9 medium supplemented with 0.4% glucose. The cultures were grown on a rotary shaker (200 rpm) at 37 °C until the contents of the flask reached an OD600 of 0.3 (mid-log phase of growth). Each culture was divided into 25 mL aliquots, transferred to four 50 mL conical tubes, and centrifuged at 2540 x g for 12 minutes. The supernatant was decanted, and the cells were resuspended in 25 mL of M9 medium at pH 5. The cultures were incubated at 25 °C for 5 minutes with manual rotations of the flasks once per minute to resuspend the cells.
E. coli was grown in M9 medium supplemented with 0.4% glucose.  The cultures were grown on a rotary shaker (200 rpm) at 37 °C  until the contents of the flask reached an OD600 of 0.3 (mid-log phase of growth).  Each culture was divided into 25 mL aliquots, transferred to four 50 mL conical tubes, and centrifuged at 2540 x g for 12 minutes.  The supernatant was decanted, and the cells were resuspended in 25 mL of M9 medium at pH 7 in the presence of 5.4 µM (1 µg/mL) total cadmium, added as CdCl2.  The cultures were incubated at 25 °C for 5 minutes with manual rotations of the flasks once per minute to resuspend the cells.
E. coli was grown in M9 medium supplemented with 0.4% glucose. The cultures were grown on a rotary shaker (200 rpm) at 37 °C until the contents of the flask reached an OD600 of 0.3 (mid-log phase of growth). Each culture was divided into 25 mL aliquots, transferred to four 50 mL conical tubes, and centrifuged at 2540 x g for 12 minutes. The supernatant was decanted, and the cells were resuspended in 25 mL of M9 medium at pH 7 in the presence of 5.4 µM (1 µg/mL) total cadmium, added as CdCl2. The cultures were incubated at 25 °C for 5 minutes with manual rotations of the flasks once per minute to resuspend the cells.
E. coli was grown to exponential phase in glucose minimal medium in the presence of the osmoprotectant glycine beatine with a range of salt concentrations at 2, 3.5 (2 repeats), 4.5, 5 and 5.5% NaCl.  E. coli were inoculated at 104 cfu/ml and cultures incubated to reach 107 cfu/ml, an ODs of about 0.03 (cultures entered stationary phase at 108 cfu/ml)  before harvesting.
E. coli was grown to mid-log phase in Luria-Bertani (Miller) broth medium at 37C in the presence of dimethyl sulfoxide (DMSO)-dissolved cholic acid at 1 mM final culture concentration.
E. coli was grown to mid-log phase in Luria-Bertani (Miller) broth medium at 37C in the presence of dimethyl sulfoxide (DMSO)-dissolved estradiol at 1 mM final culture concentration.
E. coli was grown to mid-log phase in Luria-Bertani (Miller) broth medium at 37C in the presence of dimethyl sulfoxide (DMSO)-dissolved hydrocortisone at 1 mM final culture concentration.
E. coli was grown to mid-log phase in Luria-Bertani (Miller) broth medium at 37C in the presence of dimethyl sulfoxide (DMSO)-dissolved progesterone at 1 mM final culture concentration.
E. coli was grown to mid-log phase in Luria-Bertani (Miller) broth medium at 37C in the presence of dimethyl sulfoxide (DMSO)-only steroid carrier.
E. coli was grown to mid-log phase (O.D.600nm 0.3-0.4) in Lennox LB broth (Becton Dickinson, Franklin Lakes, NJ) at 37°C.
E. coli was treated at 37C aerobically with shaking with BSA (control, 100 µg/ml), PGRP (human recombinant PGLYRP4, 100 µg/ml), or gentamicin (5 µg/ml) for 30 min, or with CCCP (carbonyl cyanide 3-chlorophenylhydrazone, 800 µM) for 15 min. Each experiment was repeated 3 times.
E. coli were grown in defined rich media at 30C.
E. coli were grown in LB or minimal medium supplemented with casaminoacids (0,1%) and succinate (0,1%) until OD 0,2-0,4
E. coli were incubated in S-Basal complete medium alone or in the presence of C. elegans, Giardia conditioned meida, and both C. elegans and Giardia conditioned media.
E. coli were sampled at times = 0, 1 hour, and 2 hours following release from stationary phase.
Ecoli_wildtype_1%_butanol_Sample1_TechRep1
Ecoli_wildtype_1%_butanol_Sample1_TechRep2
Ecoli_wildtype_1%_butanol_Sample2_TechRep1
Ecoli_wildtype_1%_butanol_Sample2_TechRep2
Ecoli_wildtype_1%_butanol_Sample3_TechRep1
Ecoli_wildtype_1%_butanol_Sample3_TechRep2
Ecoli_wildtype_1%_butanol_Sample4_TechRep1
Ecoli_wildtype_1%_butanol_Sample4_TechRep2
Ecoli_wildtype_1%_isobutanol_Sample1_TechRep1
Ecoli_wildtype_1%_isobutanol_Sample1_TechRep2
Ecoli_wildtype_1%_isobutanol_Sample2_TechRep1
Ecoli_wildtype_1%_isobutanol_Sample2_TechRep2
Ecoli_wildtype_1%_isobutanol_Sample3_TechRep1
Ecoli_wildtype_1%_isobutanol_Sample3_TechRep2
Ecoli_wildtype_1%_isobutanol_Sample4_TechRep1
Ecoli_wildtype_1%_isobutanol_Sample4_TechRep2
Ecoli_wildtype_1%_isobutanol_Sample5_TechRep1
Ecoli_wildtype_1%_isobutanol_Sample5_TechRep2
Ecoli_wildtype_3%_ethanol_Sample1_TechRep1
Ecoli_wildtype_3%_ethanol_Sample1_TechRep2
Ecoli_wildtype_3%_ethanol_Sample2_TechRep1
Ecoli_wildtype_3%_ethanol_Sample2_TechRep2
Ecoli_wildtype_3%_ethanol_Sample3_TechRep1
Ecoli_wildtype_3%_ethanol_Sample3_TechRep2
Ecoli_wildtype_3%_ethanol_Sample4_TechRep1
Ecoli_wildtype_3%_ethanol_Sample4_TechRep2
E. coli wild-type, A600=0.2 on mucus
E. coli wild-type, A600=0.4 on glucose
E. coli wild-type, A600=0.4 on mannose
E. coli wild-type, A600=0.5 on mucus
E. coli Wild type_acetate_exponential phase_repl1
E. coli Wild type_acetate_exponential phase_repl2
E. coli Wild type_acetate_stationary phase_repl1
E. coli Wild type_acetate_stationary phase_repl2
E. coli Wild type and its mutants were grown in M9 minimal medium with 10mM glucose or 30mM acetate as sole carbon source. Samples for RNA extraction were taken in middle exponential phase (OD600≈0.5) and in stationary phase (OD600≈1.5)
Ecoli_wildtype_calibration_Sample1_TechRep1
Ecoli_wildtype_calibration_Sample1_TechRep2
Ecoli_wildtype_calibration_Sample2_TechRep1
Ecoli_wildtype_calibration_Sample2_TechRep2
E. coli Wild type_glucose_exponential phase_repl1
E. coli Wild type_glucose_exponential phase_repl2
E. coli Wild type_glucose_stationary phase_repl1
E. coli Wild type_glucose_stationary phase_repl2
Ecoli wildtype grown in MOPS
Ecoli wildtype grown in MOPS, 10 minutes after 1% butanol treatment
Ecoli wildtype grown in MOPS, 10 minutes after 1% isobutanol treatment
Ecoli wildtype grown in MOPS, 10 minutes after 3% ethanol treatment
Ecoli_wild-type_rep1_anaerobic
Ecoli_wild-type_rep2_anaerobic
E. coli without microemulsion treatment
Ecoli_WT_100uM_KCN_Sample1_TechRep1
Ecoli_WT_100uM_KCN_Sample1_TechRep2
Ecoli_WT_100uM_KCN_Sample2_TechRep1
Ecoli_WT_100uM_KCN_Sample2_TechRep2
Ecoli_WT_100uM_KCN_Sample3_TechRep1
Ecoli_WT_100uM_KCN_Sample3_TechRep2
Ecoli_WT_100uM_KCN_Sample4_TechRep1
Ecoli_WT_100uM_KCN_Sample4_TechRep2
E. coli wt grown in acetate batch minimal media, cells were harvested at exponential phase, biological rep1
E. coli wt grown in acetate batch minimal media, cells were harvested at exponential phase, biological rep2
E. coli wt grown in acetate batch minimal media, cells were harvested at stationary phase, biological rep1
E. coli wt grown in acetate batch minimal media, cells were harvested at stationary phase, biological rep2
E. coli wt grown in glucose batch minimal media, cells were harvested at exponential phase, biological rep1
E. coli wt grown in glucose batch minimal media, cells were harvested at exponential phase, biological rep2
E. coli wt grown in glucose batch minimal media, cells were harvested at stationary phase, biological rep1
E. coli wt grown in glucose batch minimal media, cells were harvested at stationary phase, biological rep2
E.coli_WT pH 5.6 A
E.coli_WT pH 5.6 B
E.coli_WT pH 5.6 C
E.coli_WT pH 7.2+15% sucrose A
E.coli_WT pH 7.2+15% sucrose B
E.coli_WT pH 7.2+15% sucrose C
Ecoli_WT_RNAseq
Eco_TolC_0min_A
Eco_TolC_0min_B
Eco_TolC_15min_Carolacton_A
Eco_TolC_15min_Carolacton_B
Eco_TolC_15min_control_A
Eco_TolC_15min_control_B
Eco_TolC_30min_Carolacton_A
Eco_TolC_30min_Carolacton_B
Eco_TolC_30min_control_A
Eco_TolC_30min_control_B
Eco_TolC_5min_Carolacton_A
Eco_TolC_5min_Carolacton_B
Eco_TolC_5min_control_A
Eco_TolC_5min_control_B
Ec-pR VS Ec-1558 rep1
Ec-pR VS Ec-1558 rep2
Ec-pR VS Ec-1558 rep3
EC_Trim1_DNA
EC_Trim1_RNA
EC_Trim2_DNA
EC_Trim2_RNA
EDC1_AP
EDC1_Total
EDL932 exposure to CL MC fraction
EDL932 unexposed
EDL933 24 h post infection in THP-1 humans cells
EDL933 8h post-infection in THP-1 human cells
EDL933 8h post THP-1 infection
EDL 933 at 37oC at OD 1.0
EDL933 cDNA 24 h post-infcetion of THP-1 human cells
EDL933 cDNA obtained 24 h post- infection of THP-1 human cells
EDL933 cDNA obtained 24h post-infection of THP-1 human cells
EDL933 from overnight culture in LB broth
EDL933 genomic DNA
EDL933 genomic DNA 
EDL933 genommic DNA
EDL933 infection of THP-1 cells, recovered 2 h post-infection
EDL933 infection of THP-1 cells, recovered 2h post-infection
EDL933 in humans macrophages 8h post-infection
EDL933 in RPMI medium
EDL933 in THP-1 cells 8h post-infection
EDL933_LB_I
EDL933_LB_II
EDL 933 with 0.1 mg/ml IAN at 37oC at OD 1.0
EDL 933 with 0.1 mg/ml IAN at 37oC at OD 1.0 
EDL (O157:H7)
Efflux Mutant Parent Strain
EGS084
EGS084_control_rep_1
EGS084_control_rep_2
EGS084_control_rep_3
EGS084_control_rep_4
EGS084_control_rep_5
EGS084_control_rep_6
EGS212
EGS212_MlfabH_rep_1
EGS212_MlfabH_rep_2
EGS212_MlfabH_rep_3
EGS212_MlfabH_rep_4
EGS212_MlfabH_rep_5
EHEC
EHEC either grown on plain LB plates or LB plates containing Symbioflor within the agar
EHEC in LB Experiment 1 [RIBO-Seq]
EHEC in LB Experiment 1 [RNA-Seq]
EHEC in LB Experiment 2 [RIBO-Seq]
EHEC in LB Experiment 2 [RNA-Seq]
EHEC LB 7 h 7HI biofilm cells
EHEC LB 7 h biofilm cells
EHEC LB 7 h isatin biofilm cells
EHEC LB 7 h suspension cells
EHEC plus Symbioflor
ehec strain: 86-24
EHEC strain 86-24
EJW3, BW25113 rpoC K370_A396dup
EJW3 in M9 Replicate 1
EJW3 in M9 Replicate 2
EJW3 in M9 supplemented with 0.6 M NaCl Replicate 1
EJW3 in M9 supplemented with 0.6 M NaCl Replicate 2
Elements with poor spot morphology or exhibiting uneven hybridization caused by dust particles or scratches, were flagged manually and excluded from further analyses. After local background  subtraction and global normalization relative to the genomic DNA reference, duplicate measurements on the same array were averaged, yielding a single vector for each time-point across a perturbation. The data from all hybridizations were combined into a matrix and scaled relative to each other using quantile-normalization as implemented in the Matlab Bioinformatics  toolbox. Biological duplicates from all experiments were averaged, leading to a single set of time-series data for each perturbation. Seven time-points were assayed for each perturbation, corresponding to 0, 4, 8, 12, 20, 28, and 44 minutes post transition.
EM1456 wild-type pNM12#1 +arabinose
Emplty Vector, 37°C, replicate 1
Emplty Vector, 37°C, replicate 2
Emplty Vector, 37°C, replicate 3
Emplty Vector, 42°C, replicate 1
Emplty Vector, 42°C, replicate 2
Emplty Vector, 42°C, replicate 3
emptyvec_mRNA_5m_rep1
emptyvec_mRNA_5m_rep2
EmptyVector_37_rep1
EmptyVector_37_rep2
EmptyVector_37_rep3
EmptyVector_42_rep1
EmptyVector_42_rep2
EmptyVector_42_rep3
emptyvec_totalRNA_30m_rep1
emptyvec_totalRNA_30m_rep2
emptyvec_totalRNA_5m_rep1
emptyvec_totalRNA_5m_rep2
emrR__U_N0075_r1
emrR__U_N0075_r3
emrR upregulation, 0.075 ug/ml norfloxacin
[E-MTAB-332] fis early-exponential
[E-MTAB-332] fis mid-exponential
[E-MTAB-332] H-NS early-exponential
[E-MTAB-332] H-NS mid-exponential
[E-MTAB-332] H-NS stationary
[E-MTAB-332] H-NS transition-to-stationary
[E-MTAB-332] rpo delfis mid-exponential
[E-MTAB-332] rpo delhns mid-exponential
[E-MTAB-332] rpo wt mid-exponential
Eno- (DF261)  in  M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log
Eno- (DF261) in  M9  0.2% Glycerol  0.2% Tryptone 40 mM Suc. at 30 C Mid Log
Eno- (DF261) in  M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log
Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone 40mM Suc. at 30 C Mid Log
Eno- (DF261) in M9 + 0.2% Glycerol, 0.2% Tryptone, 40mM Suc. at 30 C Mid Log
Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone 40mM Suc. at 30 C Mid Log 1.5' post rif
Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone 40mM Suc. at 30 C Mid Log 3.0' post rif
Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone 40mM Suc. at 30 C Mid Log 4.5' post rif
Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone 40mM Suc. at 30 C Mid Log 6.0' post rif
∆entC parent Sample 12
∆entC parent Sample 31
∆entC parent Sample 50
entC suppressor 1-1 Sample 13
entC suppressor 1-1 Sample 32
entC suppressor 1-1 Sample 51
entC suppressor 2-1 Sample 14
entC suppressor 2-1 Sample 33
entC suppressor 2-1 Sample 52
entC suppressor 3-1 Sample 15
entC suppressor 3-1 Sample 34
entC suppressor 3-1 Sample 53
Enteroheamorragic E. coli
enterohemorrhagic E. coli_172mM short chain fatty acid mix
enterohemorrhagic E. coli_30mM short chain fatty acid mix
Enterohemorrhagic Escherichia coli O157:H7 strain EDL933
Enteropathogenic E. coli
entF KO rep1
entF KO rep2
entF KO rep3
envz3600
envz600
envz900
envzM1200
envzM2400
envzM3600
envzM600
envzM900
Epicentre MasterPure RNA isolation Kit, Madison, WI
era___U_N0075_r1
era___U_N0075_r2
era___U_N0075_r3
era upregulation, 0.075 ug/ml norfloxacin
ercc spike-in: No
ercc spike-in: Prior to extraction
error-prone in vitro (Mn2+)
error-prone in vitro MnCl2
error-proof in vitro 1 (GreAB/Mg2+)
error-proof in vitro 2 (GreAB/Mn2+)
error-proof in vitro MgCl2 +GreAB
error-proof in vitro MnCl2 +GreAB
Erythromycin_replicate_1
Erythromycin_replicate_2
Erythromycin_replicate_3
ESBL019 Coliform
ESBL019 Filamented
ESBL019  Reverted
ESBL019 Transition
Escherchia coli HB101
Escherchia coli HB101 exposed to C. elegans and Giardia for 24 hours
Escherchia coli HB101 exposed to C. elegans for 24 hours
Escherchia coli HB101 exposed to Giardia for 24 hours
Escherichia coli
Escherichia coli 042
Escherichia coli,  0 µM AgNO3
Escherichia coli, 0 µM AgNO3
Escherichia coli 0 min vs 10 min Rep1
Escherichia coli 10 min vs 0 min Rep2
Escherichia coli 30 min vs 60 min Rep1
Escherichia coli, 5 µM AgNO3
Escherichia coli 60 min vs 30 min Rep2
Escherichia coli, 6.5 µM AgNO3
Escherichia coli, 8.5 µM AgNO3
Escherichia coli 8624
Escherichia coli 8624 grown in DMEM
Escherichia coli 8624 grown in DMEM with AI3
Escherichia coli 8624 grown in DMEM with Epinephrine
Escherichia coli 8624 grown in LB
Escherichia coli 8624 in LB
Escherichia coli 8624 kdpE deletion mutant
Escherichia coli 8624 kdpE deletion mutant grown in DMEM
Escherichia coli 8624 qseB deletion mutant
Escherichia coli 8624 qseB deletion mutant grown in DMEM
Escherichia coli 8624 qseC deletion mutant grown in DMEM
Escherichia coli 8624 qseC deletion mutant grown in DMEM with AI3
Escherichia coli 8624 qseC deletion mutant grown in DMEM with Epinephrine
Escherichia coli 8624 qseC mutant grown in  LB
Escherichia coli 8624 qseC mutant in DMEM
Escherichia coli 8624 qseC mutant in DMEM with AI3
Escherichia coli 8624 qseC mutant in DMEM with epinephrine
Escherichia coli 8624 qseC mutant in LB
Escherichia coli 8624 qseF deletion mutant
Escherichia coli 8624 qseF deletion mutant grown in DMEM media
Escherichia coli AB1157
Escherichia coli after addition of CO-RMs to aerobically growing cells- Sample 1a
Escherichia coli after addition of CO-RMs to aerobically growing cells- Sample 1b
Escherichia coli after addition of CO-RMs to aerobically growing cells- Sample 2a
Escherichia coli after addition of CO-RMs to aerobically growing cells- Sample 2b
Escherichia coli after addition of CO-RMs to aerobically growing cells- Sample 3a
Escherichia coli after addition of CO-RMs to aerobically growing cells- Sample 3b
Escherichia coli after addition of CO-RMs to aerobically growing cells- Sample 4a
Escherichia coli after addition of CO-RMs to aerobically growing cells- Sample 4b
Escherichia coli after addition of CO-RMs to anaerobically growing cells- Sample 1a
Escherichia coli after addition of CO-RMs to anaerobically growing cells- Sample 1b
Escherichia coli after addition of CO-RMs to anaerobically growing cells- Sample 2a
Escherichia coli after addition of CO-RMs to anaerobically growing cells- Sample 2b
Escherichia coli after addition of CO-RMs to anaerobically growing cells- Sample 3a
Escherichia coli after addition of CO-RMs to anaerobically growing cells- Sample 3b
Escherichia coli after addition of CO-RMs to anaerobically growing cells- Sample 4a
Escherichia coli after addition of CO-RMs to anaerobically growing cells- Sample 4b
Escherichia coli APEC O2
Escherichia coli ATCC 25922
Escherichia coli ATCC 8739
Escherichia coli B
Escherichia coli_Biofilm_bioreplicate1_techreplicate_1
Escherichia coli_Biofilm_bioreplicate1_techreplicate_2
Escherichia coli_Biofilm_bioreplicate2_techreplicate_1
Escherichia coli_Biofilm_bioreplicate2_techreplicate_2
Escherichia coli BL21
Escherichia coli BL21(DE3)
Escherichia coli BL21 (mu=0.20)
Escherichia coli BL21 (mu=0.46)
Escherichia coli BL21/pOri1 (mu=0.20)
Escherichia coli BL21/pOri1 (mu=0.39)
Escherichia coli BL21/pOri2 (mu=0.20)
Escherichia coli BL21/pOri2 (mu=0.29)
Escherichia coli B strain REL606 was revived from a freezer stock via overnight growth in 10 ml Davis Minimal medium supplemented with limiting glucose at 0.5 g/l (DM500) in a 50 ml Erlenmeyer flask. This culture was diluted 100-fold into 50 ml fresh DM500 in a 250 ml Erlenmeyer flask and incubated for 24 hours. To initiate the experiment, these preconditioned cultures were diluted 100-fold into 50 ml fresh DM500 in multiple 250 ml Erlenmeyer flasks and grown for the specified times until harvesting cells for total RNA isolation. All growth steps were conducted with incubation at 37°C and orbital shaking at 120 r.p.m. over a one-inch diameter.
Escherichia coli B str. REL606
Escherichia coli BW13711 grown anaerobically in continuous culture in MOPS medium plus 0.4% glucose with 1% Acacia mearnsii condensed tannins. 
Escherichia coli BW13711 grown anaerobically in continuous culture in MOPS medium plus 0.4% glucose without Acacia mearnsii condensed tannins. 
Escherichia coli BW13711 grown anaerobically in continuous culture in MOPS medium plus 0.4% glucose without Acacia mearnsii condensed tannins.  
Escherichia coli BW25113
Escherichia coli BW25113 and fur mutant strains were cultivated at 37Co in 25 ml of LB medium using Erlenmeyer flasks. 1 ml of OVN culture was transferred to 20 ml of fresh LB medium and cells were incubated in the presence or absence of ciprofloxacin (100 ng/ml).
Escherichia coli BW38028
Escherichia coli C600 , 10 min after Norfloxacin (50 ug/ml) addition in LB
Escherichia coli C600 , 20min after Norfloxacin (50 ug/ml) addition in LB
Escherichia coli C600 , 2 min after Norfloxacin (50 ug/ml) addition in LB
Escherichia coli C600 , 30 min after Norfloxacin (50 ug/ml) addition in LB
Escherichia coli C600 , 5 min after Norfloxacin (50 ug/ml) addition in LB
Escherichia coli C600 (gyrArparCr), 10 min after Norfloxacin (15 ug/ml) addition in LB
Escherichia coli C600 (gyrArparCr), 10 min after Norfloxacin (50 ug/ml) addition in LB
Escherichia coli C600 (gyrArparCr), 20min after Norfloxacin (15 ug/ml) addition in LB
Escherichia coli C600 (gyrArparCr), 20min after Norfloxacin (50 ug/ml) addition in LB
Escherichia coli C600 (gyrArparCr), 2 min after Norfloxacin (15 ug/ml) addition in LB
Escherichia coli C600 (gyrArparCr), 2 min after Norfloxacin (50 ug/ml) addition in LB
Escherichia coli C600 (gyrArparCr), 30 min after Norfloxacin (15 ug/ml) addition in LB
Escherichia coli C600 (gyrArparCr), 30 min after Norfloxacin (50 ug/ml) addition in LB
Escherichia coli C600 (gyrArparCr), 5 min after Norfloxacin (15 ug/ml) addition in LB
Escherichia coli C600 (gyrArparCr), 5 min after Norfloxacin (50 ug/ml) addition in LB
Escherichia coli C600 (gyrArparCr), LB
Escherichia coli C600 (gyrArparCr), LB, 0 min before treatment
Escherichia coli C600 , LB
Escherichia coli C600 , LB, 0 min before treatment
Escherichia coli cell lysate
Escherichia coli cells were grown in LB at 37oC with shaking at 250 RPM
Escherichia coli CFT073
Escherichia coli Colony Biofilm Interior
Escherichia coli Colony Biofilm Perimeter
Escherichia coli continous culture without tannins
Escherichia coli continuous culture with 1% tannins
Escherichia coli_control condition
Escherichia coli control vs H2O2 Rep1
Escherichia coli control vs H2O2 Rep2
Escherichia coli CSH50
Escherichia coli CSH50 Δfis
Escherichia coli CSH50 Δhns
Escherichia coli DH1 ∆fadE control and test strains were seeded with OD600nm 0.03 overnight cultures into 15ml tryptic soy broth media and grown at 37°C with 200rpm agitation.
Escherichia coli DH5[alpha]
Escherichia coli DH5alpha (NEB), OD 0.2 in LB + Amp,  pUC expression
Escherichia coli DH5alpha (NEB), OD 0.2 in LB, no pUC
Escherichia coli DH5alpha (NEB), OD 0.5 in LB + Amp,  pUC expression
Escherichia coli DH5alpha (NEB), OD 0.5 in LB, no pUC
Escherichia coli DH5alpha (NEB), OD 0.9 in LB + Amp,  pUC expression
Escherichia coli DH5alpha (NEB), OD 0.9 in LB, no pUC
Escherichia coli EDL 933 cells grown in the hydroponic system without interacting with the lettuce rhizosphere for 3 days
Escherichia coli EDL 933 cells interacted with the lettuce rhizosphere for 3 days
Escherichia coli EDL 933 were grown in 10 ml of LB medium until stationary phase, collected by centrifugation at 8,000 ×g for 10 min, and washed twice with sterilized, plant growth medium (Caspersen et al. 1999). The resultant cells were re-suspended in 10 ml of the same plant growth medium to a final concentration of approximately 10E9 cells/ml. Germinated lettuce seedlings  were each aseptically transferred into holes in the growth boxes filled with 300 ml of plant growth medium, and 3 ml washed bacterial suspension was added to provide approximately 10E7 cells/ml of growth medium. Seedling boxes were germinated for a week and  transferred to a plant growth chamber, and the aeration pump (Luft Pump; Oceanic systems Inc. Dallas, TX) was immediately started. Each pump supplied aeration of three growth boxes, at a rate of 1.3 L /min. The seedling boxes were incubated under 80% RH at 25°C with a photoperiod of 16 h for 3 days
Escherichia coli, expressing NsrR with a C-terminal Flag-tag, was grown anaerobically in L broth supplemented with glucose.
Escherichia coli, expressing NsrR with a C-terminal Flag-tag, was grown anaerobically in L broth supplemented with glucose. 
Escherichia coli, expressing NsrR with a C-terminal Flag-tag, was grown anaerobically in L broth supplemented with glucose.  
Escherichia coli, expressing NsrR with a C-terminal Flag-tag, was grown anaerobically in L broth supplemented with glucose and nitrate. 
Escherichia coli, expressing NsrR with a C-terminal Flag-tag, was grown anaerobically in L broth supplemented with glucose and nitrate.  
Escherichia coli GLBRCE1
Escherichia coli GLBRCE1_pBBR
Escherichia coli K-12
Escherichia coli K12 MG1655 was cultivated using M9 minimal medium containing 4.5 g/L α-(D)-glucose, pH = 7, temperature 37 ºC, aerobic conditions
Escherichia coli K12 MG1655 were grown in M9 minimal medium with 10 g/L glucose. The bacteria were cultivated in a chemostat at specific growth rate 0.3 h-1. After reaching steady state, dilution rate was increased with constant rate (0.01 h-2) and the samples were acquired when specific growth rate reached 0.47 h-1.
Escherichia coli K12 MG1655 were grown in M9 minimal medium with 10 g/L glucose. The bacteria were cultivated in a chemostat at specific growth rate 0.3 h-1 and the samples were acquired after culture reached steady state.
Escherichia coli K12 strain BW25113 (Datsenko & Wanner 2000. PNAS 97: 6640) was cultivated in 100 mL of LB broth ( Miller 1972. In: Experiments in molecular genetics. Cold Spring Harbor Laboratory, NY) in a 250 mL Erlenmeyer flask at 37°C with shaking (250 rpm) to an O.D.600nm of 0.6. S. coelicolor A3(2) strain M145 (Kieser et al. 2000. Practical Streptomyces Genetics. The John Innes Foundation, Norwich.) was incubated in YEME broth (Kieser et al. 2000) at 30°C with shaking until the mycelia became pigmented.
Escherichia coli K-12 strain MG1655 was cultivated aerobically (~0.5 l/min air supply) in a defined mineral medium containing 1 g/l glucose in continous cultures growing in a chemostat (dilution rate = 0.4 h-1, working volume = 100 ml).
Escherichia coli K-12 treated with menadione_rep#1
Escherichia coli K-12 treated with menadione_rep #2
Escherichia coli K-12 treated with menadione_rep #3
Escherichia coli K-12 tynA- 1h after induction of tynA expression
Escherichia coli K-12 tynA- 4h after the induction of tynA expression
Escherichia coli K-12 tynA- at time of induction of tynA expression
Escherichia coli K12 wild-type
Escherichia coli K-12 wt 1h after the induction of tynA expression
Escherichia coli K-12 wt 4h after the induction of tynA expression
Escherichia coli K-12 wt at time of induction of tynA expression
Escherichia coli LE234 acrD-, 0 min before treatment in LB
Escherichia coli LE234 acrD-, 5 min after Novobiocin (200 ug/ml) addition in LB
Escherichia coli LE234 acrD-, 5 min after Novobiocin (20 ug/ml) addition in LB
Escherichia coli LE234 acrD-, 5 min after Novobiocin (50 ug/ml) addition in LB
Escherichia coli LE234 acrD-, 5 min after Novobiocin (5 ug/ml) addition in LB
Escherichia coli LE234 acrD-, LB, 0 min before treatment
Escherichia coli MG1655
Escherichia coli MG1655, 0 min after Ampicillin (100 ug/ml) addition in M9 + glucose
Escherichia coli MG1655, 0 min after Kanamycin (100 ug/ml) addition in M9 + glucose
Escherichia coli MG1655, 0 min before treatment, Davis
Escherichia coli MG1655, 0 min recovery in 10mM Na-P
Escherichia coli MG1655, 0 min recovery in 10mM Na-P + 0.2 % glucose
Escherichia coli MG1655, 0 min recovery in 10 mM Na-P + 0.2 % glucose (pH 7.5) at OD 0.4
Escherichia coli MG1655, 0 min recovery in 10 mM Na-P (pH 7.5)
Escherichia coli MG1655, 0 min recovery in LB+0.2% glc
Escherichia coli MG1655, 0 min recovery in LB + glucose at OD 0.4
Escherichia coli MG1655, 0 min recovery in LB + glucose at OD 1.0
Escherichia coli MG1655, 105 min recovery in LB+0.2% glc
Escherichia coli MG1655, 10 min after Ampicillin (100 ug/ml) addition in M9 + glucose
Escherichia coli MG1655, 10 min after Gamma treatment in Davis
Escherichia coli MG1655, 10 min after Kanamycin (100 ug/ml) addition in M9 + glucose
Escherichia coli MG1655 10 minutes paraquat treatment
Escherichia coli MG1655, 133 min recovery in LB+0.2% glc
Escherichia coli MG1655, 1440 min recovery in LB+0.2% glc
Escherichia coli MG1655, 15 min after Ampicillin (100 ug/ml) addition in M9 + glucose
Escherichia coli MG1655, 15 min after Indol-acrylate (10 ug/ml)  addition in Bonner-Vogel
Escherichia coli MG1655, 15 min after Indol-acrylate (15 ug/ml)  addition in Bonner-Vogel
Escherichia coli MG1655, 15 min after Kanamycin (100 ug/ml) addition in M9 + glucose
Escherichia coli MG1655, 15 min recovery in 10mM Na-P
Escherichia coli MG1655, 15 min recovery in 10mM Na-P + 0.2 % glucose
Escherichia coli MG1655, 15 min recovery in 10 mM Na-P + 0.2 % glucose (pH 7.5) at OD 0.4
Escherichia coli MG1655, 15 min recovery in 10 mM Na-P (pH 7.5)
Escherichia coli MG1655, 15 min recovery in LB + glucose at OD 0.4
Escherichia coli MG1655, 15 min recovery in LB + glucose at OD 1.0
Escherichia coli MG1655, 163 min recovery in LB+0.2% glc
Escherichia coli MG1655, 191 min recovery in LB+0.2% glc
Escherichia coli MG1655, 20 min after Ampicillin (100 ug/ml) addition in M9 + glucose
Escherichia coli MG1655, 20 min after Gamma treatment in Davis
Escherichia coli MG1655, 20 min after Kanamycin (100 ug/ml) addition in M9 + glucose
Escherichia coli MG1655, 218 min recovery in LB+0.2% glc
Escherichia coli MG1655, 261 min recovery in LB+0.2% glc
Escherichia coli MG1655 2 minutes paraquat treatment
Escherichia coli MG1655, 30 min after Ampicillin (100 ug/ml) addition in M9 + glucose
Escherichia coli MG1655, 30 min after Indol-acrylate (10 ug/ml)  addition in Bonner-Vogel
Escherichia coli MG1655, 30 min after Indol-acrylate (15 ug/ml)  addition in Bonner-Vogel
Escherichia coli MG1655, 30 min after Kanamycin (100 ug/ml) addition in M9 + glucose
Escherichia coli MG1655, 30 min recovery in 10mM Na-P
Escherichia coli MG1655, 30 min recovery in 10mM Na-P + 0.2 % glucose
Escherichia coli MG1655, 30 min recovery in 10 mM Na-P + 0.2 % glucose (pH 7.5) at OD 0.4
Escherichia coli MG1655, 30 min recovery in 10 mM Na-P (pH 7.5)
Escherichia coli MG1655, 30 min recovery in LB + glucose at OD 0.4
Escherichia coli MG1655, 30 min recovery in LB + glucose at OD 1.0
Escherichia coli MG1655, 313 min recovery in LB+0.2% glc
Escherichia coli MG1655, 40 min after Ampicillin (100 ug/ml) addition in M9 + glucose
Escherichia coli MG1655, 40min after Gamma treatment in Davis
Escherichia coli MG1655, 40 min after Kanamycin (100 ug/ml) addition in M9 + glucose
Escherichia coli MG1655, 443 min recovery in LB+0.2% glc
Escherichia coli MG1655, 45min after Ampicillin (100 ug/ml) addition in M9 + glucose
Escherichia coli MG1655, 45min after Kanamycin (100 ug/ml) addition in M9 + glucose
Escherichia coli MG1655, 45min recovery in 10mM Na-P
Escherichia coli MG1655, 45min recovery in 10mM Na-P + 0.2 % glucose
Escherichia coli MG1655, 45min recovery in 10 mM Na-P + 0.2 % glucose (pH 7.5) at OD 0.4
Escherichia coli MG1655, 45min recovery in 10 mM Na-P (pH 7.5)
Escherichia coli MG1655, 45min recovery in LB + glucose at OD 0.4
Escherichia coli MG1655, 45min recovery in LB + glucose at OD 1.0
Escherichia coli MG1655 4 minutes paraquat treatment
Escherichia coli MG1655, 50 min after Ampicillin (100 ug/ml) addition in M9 + glucose
Escherichia coli MG1655, 50 min after Kanamycin (100 ug/ml) addition in M9 + glucose
Escherichia coli MG1655, 5 min after Ampicillin (100 ug/ml) addition in M9 + glucose
Escherichia coli MG1655, 5 min after Gamma treatment in Davis
Escherichia coli MG1655, 5 min after Indol-acrylate (10 ug/ml)  addition in Bonner-Vogel
Escherichia coli MG1655, 5 min after Indol-acrylate (15 ug/ml)  addition in Bonner-Vogel
Escherichia coli MG1655, 5 min after Kanamycin (100 ug/ml) addition in M9 + glucose
Escherichia coli MG1655, 60 min after Ampicillin (100 ug/ml) addition in M9 + glucose
Escherichia coli MG1655, 60 min after Gamma treatment in Davis
Escherichia coli MG1655, 60 min after Indol-acrylate (10 ug/ml)  addition in Bonner-Vogel
Escherichia coli MG1655, 60 min after Indol-acrylate (15 ug/ml)  addition in Bonner-Vogel
Escherichia coli MG1655, 60 min after Kanamycin (100 ug/ml) addition in M9 + glucose
Escherichia coli MG1655, 60 min recovery in 10mM Na-P
Escherichia coli MG1655, 60 min recovery in 10mM Na-P + 0.2 % glucose
Escherichia coli MG1655, 60 min recovery in 10 mM Na-P + 0.2 % glucose (pH 7.5) at OD 0.4
Escherichia coli MG1655, 60 min recovery in 10 mM Na-P (pH 7.5)
Escherichia coli MG1655, 60 min recovery in LB + glucose at OD 0.4
Escherichia coli MG1655, 60 min recovery in LB + glucose at OD 1.0
Escherichia coli MG1655 6 minutes paraquat treatment
Escherichia coli MG1655, 75 min after Ampicillin (100 ug/ml) addition in M9 + glucose
Escherichia coli MG1655, 75 min after Kanamycin (100 ug/ml) addition in M9 + glucose
Escherichia coli MG1655, 75 min recovery in 10mM Na-P
Escherichia coli MG1655, 75 min recovery in 10mM Na-P + 0.2 % glucose
Escherichia coli MG1655, 75 min recovery in 10 mM Na-P + 0.2 % glucose (pH 7.5) at OD 0.4
Escherichia coli MG1655, 75 min recovery in 10 mM Na-P (pH 7.5)
Escherichia coli MG1655, 75 min recovery in LB + glucose at OD 0.4
Escherichia coli MG1655, 75 min recovery in LB + glucose at OD 1.0
Escherichia coli MG1655, 78 min recovery in LB+0.2% glc
Escherichia coli MG1655 8 minutes paraquat treatment
Escherichia coli MG1655, 90 min recovery in 10mM Na-P
Escherichia coli MG1655, 90 min recovery in 10mM Na-P + 0.2 % glucose
Escherichia coli MG1655, 90 min recovery in 10 mM Na-P + 0.2 % glucose (pH 7.5) at OD 0.4
Escherichia coli MG1655, 90 min recovery in 10 mM Na-P (pH 7.5)
Escherichia coli MG1655, 90 min recovery in LB + glucose at OD 0.4
Escherichia coli MG1655, 90 min recovery in LB + glucose at OD 1.0
Escherichia coli MG1655 Aerobic growth OD 0.4
Escherichia coli MG1655 Aerobic growth on M9 + glucose + fumarate,OD 0.4
Escherichia coli MG1655 Aerobic growth on M9 +glucose, OD 0.4
Escherichia coli MG1655 after 30 min incubation
Escherichia coli MG1655 after 30 min incubation following colicin M treatment
Escherichia coli MG1655 after 60 min incubation
Escherichia coli MG1655 after 60 min incubation following colicin M treatment
Escherichia coli MG1655 before paraquat treatment
Escherichia coli MG1655, Bonner-Vogel
Escherichia coli MG1655, Bonner-Vogel, 0 min before treatment
Escherichia coli MG1655, Bonner-Vogel OD~0.5
Escherichia coli MG1655 cells
Escherichia coli MG1655 cells grown in the hydroponic system without interacting with the lettuce rhizosphere for 3 days
Escherichia coli MG1655 cells interacted with the lettuce rhizosphere for 3 days
Escherichia coli MG1655, Davis, 0 min before treatment
Escherichia coli MG1655 fis::kan grown 150 minutes
Escherichia coli MG1655 fis::kan grown 240 minutes
Escherichia coli MG1655 fis::kan grown 360 minutes
Escherichia coli MG1655 fis::kan grown 90 minutes
Escherichia coli MG1655 genomic DNA
Escherichia coli MG1655 K-12 dFNR (PK4854)
Escherichia coli MG1655 K-12 WT
Escherichia coli MG1655 K-12 WT and ∆fnr were grown to mid-log phase (O.D.600nm 0.3) anerobically (95% N2, 5% CO2) at 37°C in MOPS +0.2% glucose media (Ref).
Escherichia coli MG1655, M9 + glucose
Escherichia coli MG1655, M9 + glucose, 0 min before treatment
Escherichia coli MG1655, OD 0.03, anaerobic growth in M9 + glucose
Escherichia coli MG1655, OD 0.05, anaerobic growth in M9 + glucose + fumarate,
Escherichia coli MG1655, OD 0.08, anaerobic growth in M9 + glucose ,
Escherichia coli MG1655, OD 0.15, anaerobic growth in M9 + glucose ,
Escherichia coli MG1655, OD 0.15, anaerobic growth in M9 + glucose + fumarate ,
Escherichia coli MG1655, OD 0.21, anaerobic growth in M9 + glucose + fumarate,
Escherichia coli MG1655, OD 0.2, anaerobic growth in M9 + glucose
Escherichia coli MG1655, OD 0.30, anaerobic growth in M9 + glucose + fumarate ,
Escherichia coli MG1655,  OD 0.34, anaerobic growth in M9 + glucose ,
Escherichia coli MG1655,  OD 0.35, anaerobic growth in M9 + glucose
Escherichia coli MG1655,  OD 0.43, anaerobic growth in M9 + glucose + fumarate,
Escherichia coli MG1655, OD 0.43 LB
Escherichia coli MG1655,  OD 0.63, anaerobic growth in M9 + glucose + fumarate ,
Escherichia coli MG1655, OD 0.6, anaerobic growth in M9 + glucose
Escherichia coli MG1655, OD 0.73, anaerobic growth in M9 + glucose ,
Escherichia coli MG1655, OD 0.7, anaerobic growth in M9 + glucose + fumarate,
Escherichia coli MG1655, OD 0.85, anaerobic growth in M9 + glucose + fumarate ,
Escherichia coli MG1655,  OD 0.9, anaerobic growth in M9 + glucose
Escherichia coli MG1655,  OD 1.02, anaerobic growth in M9 + glucose ,
Escherichia coli MG1655,  OD 1.07, anaerobic growth in M9 + glucose + fumarate ,
Escherichia coli MG1655,  OD 1.27 anaerobic growth in M9 + glucose ,
Escherichia coli MG1655,  OD 1.29 anaerobic growth in M9 + glucose + fumarate ,
Escherichia coli MG1655,  OD 1.2, anaerobic growth in M9 + glucose + fumarate,
Escherichia coli MG1655/pTrc99a (NOX+), Balanced growth OD 0.06 in M9 + salts
Escherichia coli MG1655/pTrc99a (NOX+), Balanced growth OD 0.13 in M9 + salts
Escherichia coli MG1655/pTrc99a (NOX-), Balanced growth OD 0.19 in M9 + salts
Escherichia coli MG1655/pTrc99a (NOX-), Balanced growth OD 0.1 in M9 + salts
Escherichia coli MG1655/pTrc99a (NOX+), Balanced growth OD 0.21in M9 + salts
Escherichia coli MG1655/pTrc99a (NOX+), Balanced growth OD 0.28 in M9 + salts
Escherichia coli MG1655/pTrc99a (NOX+), Balanced growth OD 0.34 in M9 + salts
Escherichia coli MG1655/pTrc99a (NOX+), Balanced growth OD 0.4 in M9 + salts
Escherichia coli MG1655,Sample washed in 0.1 M CaCl2 + 15 % glycerol vs before washing OD 0.43 in LB, 10 min timepoint
Escherichia coli MG1655,Sample washed in 0.1 M CaCl2 + 15 % glycerol vs before washing OD 0.43 in LB, 20 min timepoint
Escherichia coli MG1655,Sample washed in 0.1 M CaCl2 + 15 % glycerol vs before washing OD 0.43 in LB, 2 min timepoint
Escherichia coli MG1655,Sample washed in 0.1 M CaCl2 + 15 % glycerol vs before washing OD 0.43 in LB, 40 min timepoint
Escherichia coli MG1655,Sample washed in 0.1 M CaCl2 + 15 % glycerol vs before washing OD 0.43 in LB, 5 min timepoint
Escherichia coli MG1655,Sample washed in 0.1 M CaCl2 + 15 % glycerol vs before washing OD 0.43 in LB, 60 min timepoint
Escherichia coli MG1655,  stationary phase anaerobic growth in M9 + glucose
Escherichia coli MG1655,  stationary phase anaerobic growth in M9 + glucose + fumarate,
Escherichia coli MG1655, Stationary phase in LB OD 2.4
Escherichia coli MG1655, Stationary phase in LB OD 2.8
Escherichia coli MG1655,  Stationary phase in LB OD 3.1
Escherichia coli MG1655, Stationary phase in LB OD 3.1 for 20 min
Escherichia coli MG1655,  Stationary phase in LB OD 3.1 for 40 min
Escherichia coli MG1655,  stationary phase in LB, OD 3.1 for 60 min
Escherichia coli MG1655 were grown in 10 ml of LB medium until stationary phase, collected by centrifugation at 8,000 ×g for 10 min, and washed twice with sterilized, plant growth medium (Caspersen et al. 1999). The resultant cells were re-suspended in 10 ml of the same plant growth medium to a final concentration of approximately 10E9 cells/ml. Germinated lettuce seedlings  were each aseptically transferred into holes in the growth boxes filled with 300 ml of plant growth medium, and 3 ml washed bacterial suspension was added to provide approximately 10E7 cells/ml of growth medium. Seedling boxes were germinated for a week and  transferred to a plant growth chamber, and the aeration pump (Luft Pump; Oceanic systems Inc. Dallas, TX) was immediately started. Each pump supplied aeration of three growth boxes, at a rate of 1.3 L /min. The seedling boxes were incubated under 80% RH at 25°C with a photoperiod of 16 h for 3 days
Escherichia coli MG1655 with a precise deletion in soxR and 10 minutes paraquat treatment
Escherichia coli MG1655 with a precise deletion in soxR and 2 minutes paraquat treatment
Escherichia coli MG1655 with a precise deletion in soxR and 4 minutes paraquat treatment
Escherichia coli MG1655 with a precise deletion in soxR and 6 minutes paraquat treatment
Escherichia coli MG1655 with a precise deletion in soxR and 8 minutes paraquat treatment
Escherichia coli MG1655 with a precise deletion in soxR before paraquat treatment
Escherichia coli MG1655 wt grown 150 minutes
Escherichia coli MG1655 wt grown 240 minutes
Escherichia coli MG1655 wt grown 360 minutes
Escherichia coli MG1655 wt grown 90 minutes
Escherichia coli_MixedSpeciesBiofilm_bioreplicate1_techreplicate_1
Escherichia coli_MixedSpeciesBiofilm_bioreplicate1_techreplicate_2
Escherichia coli_MixedSpeciesBiofilm_bioreplicate1_techreplicate_3
Escherichia coli_MixedSpeciesBiofilm_bioreplicate2_techreplicate_1
Escherichia coli_MixedSpeciesBiofilm_bioreplicate2_techreplicate_2
Escherichia coli_MixedSpeciesPlanktonic_bioreplicate1_techreplicate_1
Escherichia coli_MixedSpeciesPlanktonic_bioreplicate1_techreplicate_2
Escherichia coli_MixedSpeciesPlanktonic_bioreplicate2_techreplicate_1
Escherichia coli_MixedSpeciesPlanktonic_bioreplicate2_techreplicate_2
Escherichia coli_nickel condition
Escherichia coli O08
Escherichia coli O104:H4
Escherichia coli O157
Escherichia coli O157:H7
Escherichia coli O157:H7 cultivated for 6 hours in the caecal content of rats
Escherichia coli O157:H7 EDL933 Inside Acanthamoeba
Escherichia coli O157:H7 EDL933 Inside Acanthamoeba vs. Control Slide 1
Escherichia coli O157:H7 EDL933 Inside Acanthamoeba vs. Control Slide 2
Escherichia coli O157:H7 EDL933 Inside Acanthamoeba vs. Control Slide 3
Escherichia coli O157:H7 EDL933 Inside Acanthamoeba vs. Control Slide 4
Escherichia coli O157:H7 EDL933 Inside Acanthamoeba vs. Control Slide 5
Escherichia coli O157:H7 EDL933 Inside Acanthamoeba vs. Control Slide 6
Escherichia coli O157:H7 EDL933 Inside Acanthamoeba vs. Control Slide 7
Escherichia coli O157:H7 EDL933 Inside Acanthamoeba vs. Control Slide 8
Escherichia coli O157:H7 EDL933 Inside Acanthamoeba vs. Control Slide 9
Escherichia coli O157:H7 EDL933 Outside Control
Escherichia coli O157:H7 str. EDL933
Escherichia coli O157:H7 str. Sakai
Escherichia coli O157 (Sakai) treated with menadione_rep#1
Escherichia coli O157 (Sakai) treated with menadione_rep#2
Escherichia coli O157 (Sakai) treated with menadione_rep#3
Escherichia coli O157 TUV93-0 MEM-HEPES + 20uM ME0052 (in DMSO)
Escherichia coli O157 TUV93-0 MEM-HEPES + 20uM ME0053 (in DMSO)
Escherichia coli O157 TUV93-0 MEM-HEPES + 20uM ME0054 (in DMSO)
Escherichia coli O157 TUV93-0 MEM-HEPES + 20uM ME0055 (in DMSO)
Escherichia coli O157 TUV93-0 MEM-HEPES + DMSO
Escherichia coli O157 TUV93-0 was grown at 37 degrees C to OD 0.7 in MEM-HEPES supplemented with 0.1% Glucose and 250nM Fe(NO3)2.
Escherichia coli O157 TUV93-0 was grown at 37 degrees C to OD 0.7 in MEM-HEPES supplemented with 0.1% Glucose and 250nM Fe(NO3)2 and and equivalent volume of DMSO.
Escherichia coli O157 TUV93-0 was grown in the presence of 20uM ME0052
Escherichia coli O157 TUV93-0 was grown in the presence of 20uM ME0053
Escherichia coli O157 TUV93-0 was grown in the presence of 20uM ME0054
Escherichia coli O157 TUV93-0 was grown in the presence of 20uM ME0055
Escherichia coli O157 TUV93-0 was grown in the presence of DMSO
Escherichia coli O25b:H4-ST131
Escherichia coli ptsN mutant strain
Escherichia coli SCI-07
Escherichia coli SE15
Escherichia coli strains E.coli C (DSMZ 4860), E. coli Crooks (DSMZ 1576), E. coli DH5α (DSMZ 6897) E. coli W (DSMZ 1116), E. coli W3110 (DSMZ 5911) were obtained from DSMZ-German Collection of Microorganism and Cell Cultures; E. coli BL21 (DE3) was purchased as competent cells from Agilent (Agilent Technologies Inc., USA), E. coli K-12 MG1655 (ATCC 700926). All strains were cultured in M9 minimal medium (1) containing Na2HPO4 x 7H2O (6.8 g), KH2PO4 (3 g), NaCl (0.5 g), NH4Cl (1 g), MgSO4 (2 mmol), CaCl2 (0.1 mmol), trace elements, Wolf’s vitamin solution (2) and glucose (2 g L-1). Anoxic M9 minimal media with glucose was obtained by flushing solution with oxygen free nitrogen (95%). Overnight cultures from single colonies of each of seven E. coli strains were diluted to a starting optical density (OD600) of 0.01. Cultures were grown in 250 ml flasks or 300 ml oxygen-free sealed bottles containing 50 ml glucose-M9 minimal media in a shaking incubator at 37°C and 250 rpm.
Escherichia coli_stress experiment
Escherichia coli str. K-12 substr. MG1655
Escherichia coli str. K-12 substr. MG1655star
Escherichia coli str. K-12 substr. W3110
Escherichia coli treated with 0.5MIC of cyadox
Escherichia coli treated with 1%DMSO
Escherichia coli treated with MBC of cyadox
Escherichia coli treated with MBC of olaquindox
Escherichia coli treated with MIC of olaquindox
Escherichia coli W3110, 0  min before treatment, Bonner-Vogel + 50 ug/ml Tryptophan
Escherichia coli W3110, 0 min before treatment in Bonner-Vogel + 50 ug/ml Tryptophan
Escherichia coli W3110,5 min 0.01 M Sodium Azide treatment vs 0 min before treatment in Bonner-Vogel + 50 ug/ml Tryptophan
Escherichia coli W3110gyrb234, LB
Escherichia coli W3110gyrb234, LB, 10 min after upshift to 42 C
Escherichia coli W3110gyrb234, LB, 20 min after upshift to 42 C
Escherichia coli W3110gyrb234, LB, 2 min after upshift to 42 C
Escherichia coli W3110gyrb234, LB, 5 min after upshift to 42 C
Escherichia coli was grown aerobically in Luria-Bertani (LB) broth and LB + glycerol at 30°C in an incubator shaker at 150 r.p.m.
Escherichia coli was grown aerobically in Luria-Bertani (LB) broth at 30°C in an incubator shaker at 150 r.p.m.
Escherichia coli wild type strain
Escherichia coli wild type vs luxS mutants with 10% H2O2 Rep1
Escherichia coli wild type vs luxS mutants with 10% H2O2 Rep2
Escherichia coli wild type vs luxS mutants with 30% H2O2 Rep1
Escherichia coli wild type vs luxS mutants with 30% H2O2 Rep2
Escherichia coli wild type vs luxS mutants without H2O2 Rep1
Escherichia coli wild type vs luxS mutants without H2O2 Rep2
Escherichia coli with 1% tannins
Escherichia ProQ coIP
Escherichia ProQ Lysate
Escherichia WT coIP
Escherichia WT Lysate
Estradiol Treatment
EtBr replicate 1
EtBr replicate 2
EtBr replicate 3
ethanol treatment: 40 g EtOH/L, 10 min
ethanol treatment: 40 g EtOH/L, 70 min
ethanol treatment: no ethanol exposure
Ethanol was added to 40 g/L once A600 of cultures reached 0.3.  Samples were taken prior to ethanol addition (T0), 10 min after addition (T1), and 70 min after addition (T2). Cells were harvested rapidly onto 0.2 µm filters by vacuum then flash-frozen in liquid nitrogen to arrest ribosomes.  Ribosome footprinting samples were subjected to micrococcal nuclease digestion followed by monosome isolation by sucrose gradient centrifugation.
EtOH replicate 1
EtOH replicate 2
EtOH replicate 3
[Eubacterium] rectale ATCC 33656
Eureka
EvgSc_1
EvgSc_2
EvgSc mutant rep 1
EvgSc mutant rep 2
EvgSc_ompR_1
EvgSc_ompR_2
EvgSc ompR double mutant rep 1
EvgSc ompR double mutant rep 2
evolved 1min rep6
evolved 1min rep8
evolved 5min rep6
evolved 5min rep8
evolved 9min rep6
evolved 9min rep7
Evolved I- cells at amino acid starvation in monoculture
Evolved I- cells at log phase in monoculture
Evolved I- cells in coculture
Evolved I- cells in coculture, a biological replicate
Evolved L- cells at amino acid starvation in monoculture
Evolved L- cells at log phase in monoculture
Evolved L- cells at log phase in monoculture, a technical replicate
Evolved L- cells in coculture
Evolved L- cells in coculture, a biological replicate
Evolved strain A, time point 1
Evolved strain A, time point 2
Evolved strain A, time point 3
Evolved strain A, time point 4
Evolved strain A, time point 5
Evolved strain B, time point 1
Evolved strain B, time point 2
Evolved strain B, time point 3
Evolved strain B, time point 4
Evolved strain B, time point 5
Evolved strain C, time point 1
Evolved strain C, time point 2
Evolved strain C, time point 3
Evolved strain C, time point 4
Evolved strain C, time point 5
Evolved strain D, time point 1
Evolved strain D, time point 2
Evolved strain D, time point 3
Evolved strain D, time point 4
Evolved strain D, time point 5
Evolved strain E, time point 1
Evolved strain E, time point 2
Evolved strain E, time point 3
Evolved strain E, time point 4
Evolved strain E, time point 5
Evolved strain F, time point 1
Evolved strain F, time point 2
Evolved strain F, time point 3
Evolved strain F, time point 4
Evolved strain F, time point 5
evolved_temperature_Up_0min
evolved_temperature_Up_16min
evolved_temperature_Up_44min
evolved temperature up shift 0min
evolved temperature up shift 16min
evolved temperature up shift 44min
Exact details for the full computational pipeline are available at https://github.com/wilkelab/AG3C_starvation_tc_RNAseq.
exopolyphosphatase (PPX) mutant
Exp 1_control
Exp 1_IP sample
Exp 2_control
Exp 2_IP sample
experiment #115
experiment #116
experiment #203
experiment #204
experiment #205
experiment #206
experiment #303
experiment #305
experiment #306
Experimental,biological rep1 G1
Experimental,biological rep1 G2
Experimental,biological rep1 G3
Experimental,biological rep2 G4
Experimental,biological rep2 G5
Experimental,biological rep2 G6
Experiments were performed at 37°C and followed three steps: seed culture, pre-culture and experimental culture. In the seed culture the cells were grown overnight in Luria Broth, then diluted 1:100 in either M9 minimal media with glycerol or glucose for the pre-cultures. Finally, the experimental cultures were started from the overnight grown pre-cultures containing the same carbon source at a normalized optical density at 600 nm (OD600) of 0.05. Cultures were harvested at mid-exponential phase, cells were immediately spun down and cell pellets stored at -80°C until processed.
Exponential cells (DO600=0,4)
exponential culture
Exponential cultures of transformants were inoculated from fresh overnight cultures in LB medium supplemented with 25 µg/ml of kanamycin to an optical density at 600 nm (OD) of 0.1 and grown for 30 min at 37°C to an OD of 0.15. Then, IPTG was added to a final concentration of 1 mM for induction of expression. After 60 min of additional growth cells were harvested for RNA isolation.
exponentially growing cells
exponential phase
Exponential phase culture of EDL933 rpoS mutants in LB at OD600 of 0.3
Exponential phase culture of EDL933 wild type in LB at OD600 of 0.3
expose Bacillus VOC 12h
Expose Bacillus VOC-12h rep1
Expose Bacillus VOC-12h rep2
Expose Bacillus VOC-12h rep3
Expose Bacillus VOC-12h rep4
expose Bacillus VOC24h
Expose Bacillus VOC-24h rep1
Expose Bacillus VOC-24h rep2
Expose Bacillus VOC-24h rep3
Expose Bacillus VOC-24h rep4
expose Bacillus VOC 6h
Expose Bacillus VOC-6h rep1
Expose Bacillus VOC-6h rep2
Expose Bacillus VOC-6h rep3
Expose Bacillus VOC-6h rep4
Expression data were analyzed with the Microarray Analysis Suite, version 5.0  (Affymetrix). Global scaling was performed to compare genes between chips. Each chip was normalized to a target intensity value of 2,500. Expression analysis files created by Microarray Suite, version 5.0, were exported to Microsoft Excel for data formatting.
Expression data were normalized using the Affymetrix microarray suite 5(MAS5) algorithm implemented in Affymetrix expression console software .  To reduce noise for the significance analysis, probe sets that did not show detection call rate at least 50% of the samples in the comparison were filtered out. Highly expressed genes that showed a 2-fold change in expression were selected. 
Expression of introduced enzymes for 3-HP productionm was induced by 0.05mM IPTG and 50 µM vitamin B12 when the cell reached at the early-exponential growth phase. T
Expression values were calculated by the software package Feature Extraction 10.5.1.1 using protocol GE1_105_Dec08 (Agilent Technologies; Waldbronn, Germany)
Exp-rpoS-rep1
Exp-rpoS-Rep1
Exp-rpoS-rep2
Exp-rpoS-Rep2
Exp-rpoS-rep3
Exp-rpoS-Rep3
Exp-WT-rep1
Exp-WT-Rep1
Exp-WT-rep2
Exp-WT-Rep2
Exp-WT-rep3
Exp-WT-Rep3
extracted molecule: plasmid DNA
Extraction followed by DNase treatment with TURBO DNA-free kit from Ambion. rRNA depleted using an Illumina Ribo-zero rRNA removal kit. Followed by RNA-seq library prep using an Illumina TruSeq Stranded mRNA Library Prep Kit.
Extraction: Rneasy
Extraction: TRI Reagent
Extraction was performed as described in detail previously (Li et al., 2012; Oh et al., 2011). 200 ml of cell culture was rapidly filtered at 37C by passing through a nitrocellulose filter. Cell pellets was were rapidly collected using a pre-warmed metal table crumber, flash frozen in liquid nitrogen, and combined with frozen droplets of lysis buffer. Cells and lysis buffer were pulverized in 10 ml canisters (Retsch) pre-chilled in liquid nitrogen using Qiagen TissueLyser II. Pulverized lysate was thawed on ice and clarified by centrifugation at 4C.
Extraction was performed as described in detail previously (Li et al., 2012; Oh et al., 2011; Rouskin et al., 2014). For ribosome profiling, 200 ml of cell culture was rapidly filtered by passing through a nitrocellulose filter. Cell pellets was were rapidly collected using a pre-warmed metal table crumber, flash frozen in liquid nitrogen, and combined with frozen droplets of lysis buffer. Cells and lysis buffer were pulverized in 10 ml canisters (Retsch) pre-chilled in liquid nitrogen using Qiagen TissueLyser II. Pulverized lysate was thawed on ice and clarified by centrifugation at 4°C. Lysate containing 0.5 mg of RNA was digested for 1 h with 750 U of micrococcal nuclease (Roche) at 25°C. The ribosome-protected RNA fragments were isolated using a sucrose gradient followed by hot acid phenol extraction.
Extraction was performed as described previously (Li et al., 2012; Oh et al., 2011). For ribosome profiling, 200 mL of cell culture were filtered rapidly and the resulting cell pellet was flash-frozen in liquid nitrogen and combined with 650 µL of frozen lysis buffer (10 mM MgCl2, 100mM NH4Cl, 20mM Tris-HCl pH 8.0, 0.1% Nonidet P40, 0.4% Triton X-100, 100 U/mL DNase I (Roche), 1mM chloramphenicol). Cells were pulverized in 10mL canisters pre-chilled in liquid nitrogen. Lysate containing 0.5 mg of RNA was digested for 1 h with 750 U of micrococcal nuclease (Roche) at 25°C. The ribosome-protected RNA fragments were isolated using a sucrose gradient followed by hot acid phenol extraction. For mRNA-seq and DMS-seq, cells were pelleted by centrifuging for 2 min at 8000rpm. Total RNA was then hot acid phenol extracted. Ribosomal RNA and small RNA were removed with MICROBExpress (Ambion) or Ribozero (Epicenter) and MEGAclear (Ambion), respectively.
EYG1 in M9 Replicate 1
EYG1 in M9 Replicate 2
EYG1, MG1655 rpoC K370_A396dup
EYG in M9 supplemented with 0.6 M NaCl Replicate 1
EYG in M9 supplemented with 0.6 M NaCl Replicate 2
F1
F2
fadr KO LB rep1
fadr KO LB rep2
fadr KO M9 rep1
fadr KO M9 rep2
Faecal samples were collected by the Department of Microbiology and Alimentary Pharmabiotic Centre (Cork, Ireland) from three elderly patients (176, 204 and 205). The mock community was performed after culture of each individual bacterial strain in their reference medium at their optimal temperature for several days.
FastQ files were examined using the FastQC tool. All the relevant SPET-seq data (nascent RNA) analysis and normalization steps were performed using a custom wrapper built on top of the RNA Framework13. Briefly, reads were clipped from 3’ adapter sequences using Cutadapt v1.10, discarding reads shorter than 15 nucleotides. Escherichia coli str. K-12 substr. MG1655 (GenBank: U00096.2) was used as the reference genome to extract transcripts’ sequences. Forward and reverse reads were independently mapped to the reference transcriptome using Bowtie v1.1.2, by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes (parameters: -n 2 -m 7 -a --best --strata -5 5 [--norc for forward reads, --nofw for reverse reads]). Forward and reverse mapped reads were then re-paired. Using reverse read mapping positions (corresponding to RNA Polymerase positions along gene), forward reads were split into separate SAM files for each transcription intermediate. When analysis was performed in deciles of transcription, genes were split into 10 equally sized deciles, and reads belonging to transcription intermediates falling in the same decile were pooled. SAM files were then passed to the rf-count tool of the RNA Framework to generate RT-stop counts (RC) files. Resulting RC files were normalized using the rf-norm tool of the RNA Framework in 50 nt sliding windows, with a 25 nt offset (parameters: -sm 2 -nm 2 -ec 0 -mc 0 -n 50 -nw 50 -wo 25). Mapping of DMS-seq data (mature RNA) was performed by using the rf-count tool (parameters: -cl 15 -bm 7 -ba -b5 5). Resulting RC files were normalized using the rf-norm tool (parameters: -sm 2 -nm 2 -ec 50 -mc 50 -n 50 -nw 50 -wo 25). The rf-norm tool generates a XML file for each transcript (or for each transcription intermediate/decile in the case of SPET-seq data). XML files for mature RNA were passed to the rf-fold tool of the RNA Framework (using ViennaRNA Package 2.2 with soft constraints14) to infer mature RNA structures (parameters: -md 600 -nlp).
FastQ files were examined using the FastQC tool. All the relevant SPET-seq data (nascent RNA) analysis and normalization steps were performed using a custom wrapper built on top of the RNA Framework13. Briefly, reads were clipped from 3’ adapter sequences using Cutadapt v1.10, discarding reads shorter than 15 nucleotides. Forward and reverse reads were independently mapped to the RNase P (rnpB) gene using Bowtie v1.1.2, by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes (parameters: -n 2 -m 7 -a --best --strata -5 5 [--norc for forward reads, --nofw for reverse reads]). Forward and reverse mapped reads were then re-paired. Using reverse read mapping positions (corresponding to RNA Polymerase positions along gene), forward reads were split into separate SAM files for each transcription intermediate. SAM files were then passed to the rf-count tool of the RNA Framework to generate RT-stop counts (RC) files, that were then normalized using the rf-norm tool.
FastQ files were examined using the FastQC tool. Reads were clipped from 3’ adapter sequences using Cutadapt v1.10, discarding reads shorter than 15 nucleotides. Escherichia coli str. K-12 substr. MG1655 (GenBank: U00096.2) was used as the reference genome. Reads were mapped to the reference genome using Bowtie v1.1.2, by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes (parameters: -n 2 -m 7 -a --best --strata -5 5).
FASTQ formatted sequence files from strand-specific Illumina RNA-Seq reads were aligned to the GLBRCE1 reference genome NC_000913 using Bowtie version 0.12.7(Langmead et al., 2009) with '--nofw' strand-specific parameter and maximal distance between the paired reads of 1000 bp. NOTE: Genome NC_000913 (ASM584v2) represents the parental strain.  The strain used in our study was modified from the parental strain by replacing gene pflB with an insertion that contained 3 different genes.
Fastq quality trimming using FastX and a cut-off value of 20
FastQ quality trimming using FastX (version 0.0.13)  and a cut-off value of 20
Fastq to fasta conversion using FastX
Fastq to fasta conversion using FastX  FastX (version 0.0.13)
Feature fluorescence intensities [F532 media-B532 and F635media-B635] were extracted using GenePix Pro 6.0.  Local hybridization and intensity-dependent artifacts were removed with Lowess normalization using Standardization and Normalization of Microarray Data (SNOMAD, http://pevsnerlab.kennedykrieger.org/snomadinput.html).  The three replicate spots for each gene were averaged and variance was calculated.
Feature intensity was extracted by GeneChip Operating System as CEL files. The probe-level analysis of the CEL files was done by the PLIER algorithm in the Affymetrix Expression Console. No further adjustments were made to the data in the table.
Feature pixel median minus background pixel mean;
Fecal samples obtained from mice were immediately frozen in liquid nitrogen and stored at -80 °C until processing. All of the samples were suspended in a solution containing 500 ul of acid-washed glass beads (Sigma-Aldrich), 500 ul of extraction buffer A (200 mM Tris [pH 8], 200 mM NaCl, 20 mM EDTA), 200 ul of 20% SDS, and 500 ul of a mixture of phenol:chloroform:isoamyl alcohol (25:24:1, pH 8.0; Ambion) and lysed by using a bead beater (BioSpec Products). Cellular debris was removed by centrifugation (8,000g; 3 min). The nucleic acids were precipitated with isopropanol and sodium acetate and resuspended in 100 ul TE. The resuspension was further purified with a Qiagen PCR column and eluted into 30 ul of EB buffer.
Fecal samples obtained from mice were immediately frozen in liquid nitrogen and stored at -80 °C until processing. All of the samples were treated with RNAProtect (Qiagen) and suspended in a solution containing 500 μl of acid-washed glass beads (Sigma-Aldrich), 500 μl of extraction buffer A (200 mM NaCl, 20 mM EDTA), 210 μl of 20% SDS, and 500 μl of a mixture of phenol:chloroform:isoamyl alcohol (125:24:1, pH 4.5; Ambion) and lysed by using a bead beater (BioSpec Products). Cellular debris was removed by centrifugation (8,000 × g; 3 min). The nucleic acids were precipitated with isopropanol and sodium acetate (pH 5.5).
Fecal samples obtained from mice were span frozen in liquid nitrogen and stored at -80°C and maintained at this temperature prior to processing.
Fed batch high cell density cultivation
fepA KO LB rep1
fepA KO LB rep2
fepA KO M9 rep1
fepA KO M9 rep2
Fermentations were carried out in 3 L bioreactors (Applikon Biotechnology) containing 2.45 L of ACSH or SynH media, and cultures were diluted into ACSH or SynH with initial OD at 0.2, grown anaerobically overnight, and then inoculated into bioreactors to a starting OD600 of 0.2
Fermentations were carried out in 3L bioreactors (Applikon Biotechnology) containing 2.45L of ACSH, SynH, SynH+LT, or SynH + Acid/Amide LTs, and cultures were diluted into ACSH or SynH with initial OD at 0.2, grown anaerobically overnight, and then inoculated into bioreactors to a starting OD600 of 0.2
fermentation time: 20h
fermentation time: 30h
fermentation time: 40h
Fifteen mL fermentation broth was used for each RNA extraction. Harvested cells were rapidly cooled in a -80°C ethanol bath, then centrifuged at 5000 g for seven minutes at 4°C. The supernatant was discarded. The cell pellet was frozen at -80°C. Thawed (on ice) cell pellets were suspended in 150 mL of TE buffer (10 mM Tris-HCl, pH 7.6, 0.1 mM EDTA) containing 0.75 mg/mL lysozyme, and incubated for 15 minutes at room temperature. Total RNA was isolated using RNAqueousTM-Midi Kit (Ambion). The concentration of purified total RNA was determined spectrophotometrically by measuring absorbance at 260 nm. The quality and integrity of the isolated RNA was confirmed by agarose gels (clear 23S and 16S rRNA bands).
Files were coverted to .bam format using samtools
Filter for map quality >= 20 using Samtools 0.1.18
Filtering, Mapping quality=30, no ambiguous reads
Filter out rRNA reads, multi-mapped reads, > 3 mismatches, and gapped mappings using custom Python script (FilterBAM2BAM from http://uwgenomics.org/downloads/RNA-Seq-1.1.tar.gz)
First and second strand cDNA synthesis was carried out using the Ovation® Prokaryotic RNA-Seq System (NuGEN Technologies Inc., San Carlos, CA, USA), and NuGEN’s Encore NGS Library System was applied to construct the cDNA library for the IlluminaHiSeq platform.
First biological repeat 37°C
First biological repeat 50°C
First, ribosomal RNA was depleted from 1 μg of total RNA using the Ribo-ZeroTM Magnetic Kit (Bacteria) (Epicentre, Madison, WI, USA). Next, mRNA libraries were prepared using the TruSeq mRNA Library Prep Kit (Illumina, San Diego, CA, USA). mRNA libraries were prepared for sequencing using standard Illumina protocols.
first strand cDNA was performed by the use of SuperScriptII and the second strand cDNA synthesis was done before end-pair and dA-tailing
Fis – 120 min
fis 150 minutes growth rep1
fis 150 minutes growth rep2
fis 150 minutes growth rep3
Fis – 180 min
fis 240 minutes growth rep1
fis 240 minutes growth rep2
fis 240 minutes growth rep3
fis 360 minutes growth rep1
fis 360 minutes growth rep2
fis 360 minutes growth rep3
Fis – 420 min
Fis – 60 min
fis 90 minutes growth rep1
fis 90 minutes growth rep2
fis 90 minutes growth rep3
Fis, EE
fis.ee.chipseq
fis.ee.input
fis  Escherichia coli
Fis, ME
fis.me.chipseq
fis.me.input
fismutant.crp.ee.chipseq
fismutant.crp.ee.input
fismutant.crp.me.chipseq
fismutant.crp.me.input
fis.rep1.ee
fis.rep1.me
fis.rep2.ee
fis.rep2.me
fis___U_N0075_r1
fis___U_N0075_r2
fis___U_N0075_r3
fis upregulation, 0.075 ug/ml norfloxacin
fklB__U_N0075_r1
fklB__U_N0075_r2
fklB__U_N0075_r3
fklB upregulation, 0.075 ug/ml norfloxacin
Flask state 1 (IPTG-/aTc-/Ara-)
Flask state 2 (IPTG+/aTc-/Ara-)
Flask state 3 (IPTG-/aTc+/Ara-)
Flask state 4 (IPTG+/aTc+/Ara-)
Flask state 5 (IPTG-/aTc-/Ara+)
Flask state 6 (IPTG+/aTc-/Ara+)
Flask state 7 (IPTG-/aTc+/Ara+)
Flask state 8 (IPTG+/aTc+/Ara+)
flhD-glucose
flhD-mannose
flhD-mucus-P1
flhD-mucus-P2
fliY KO rep1
fliY KO rep2
fliY KO rep3
florfenicol treatment
Florfenicol_treatment_plasmidmappedreads_statistical_output.txt: NC_012692.1
Flor_treatment_genomemappedreads_statistical_output.txt: NC_000913.2
Fluorescence intensities of oligonucleotide spots were extracted from the scanned images using the Feature Extraction software (V11.0, Agilent Technologies). Then data were processed with dedicated scripts based on C++ and Delphi languages. For each probe, median intensity value of the 3 replicates was conserved and used as the probe signal value. The SNR (Signal-to-Noise Ratio), similar to the detection threshold response (positive hybridization) and corresponding to the probe signal value divided by the local background intensity value, was calculated for each probe. The SNR thresholds were set to 3 for 25-mer probes and 6 for 54-mer probes. Such SNR threshold values ensured a very specific response of the FibroChip, except for genes belonging to very close strains from the same species. Results for 25- and 54-mer probes were treated independently and for each probe type, a gene was considered as detected when 65% of probes were positive. The SNR value of a detected gene was then calculated by the mean of the SNR of all 25- or 54-mer probes targeting this gene, meeting or not the defined SNR threshold.
fluorescent labeling and hybridization and scanning of the microarray images (Balazsi et al.
fnr- aerobic
fnr- aerobic  AN rep 1
fnr- aerobic  AN rep 2
fnr- aerobic  AN rep 3
fnr- aerobic rep 1
fnr- aerobic rep 2
fnr- aerobic rep 3
fnr- anaerobic
FNR - Anaerobic - A
FNR - Anaerobic - Affinity Purified - A
FNR - Anaerobic - Affinity Purified - B
fnr- anaerobic  AN rep 1
fnr- anaerobic  AN rep 2
fnr- anaerobic  AN rep 3
FNR - Anaerobic - B
FNR - Anaerobic - C
fnr- anaerobic plus NO2
fnr- anaerobic plus NO2 
fnr- anaerobic plus NO2  AN rep 1
fnr- anaerobic plus NO2  AN rep 2
fnr- anaerobic plus NO2  AN rep 3
fnr- anaerobic plus NO2 rep 1
fnr- anaerobic plus NO2 rep 2
fnr- anaerobic plus NO2 rep 3
fnr- anaerobic plus NO3
fnr- anaerobic plus NO3  AN rep 1
fnr- anaerobic plus NO3  AN rep 2
fnr- anaerobic plus NO3  AN rep 3
fnr- anaerobic plus NO3 rep 1
fnr- anaerobic plus NO3 rep 2
fnr- anaerobic plus NO3 rep 3
fnr- anaerobic rep 1
fnr- anaerobic rep 2
fnr- anaerobic rep 3
FNR-_Anaerobic_RNAseq_A_Tag_Count.txt: U00096.2
FNR-_Anaerobic_RNAseq_A_WIG.wig: U00096.2
FNR-_Anaerobic_RNAseq_B_Tag_Count.txt: U00096.2
FNR-_Anaerobic_RNAseq_B_WIG.wig: U00096.2
∆fnr - Anaeroibc
FNR ChIP DNA from ∆hns/∆stpA E. coli MG1655
∆fnr ChIP DNA from PK4854
FNR ChIP DNA from WT Escherchia coli MG1655 K-12
FNR - ∆hns∆stpA A
FNR - ∆hns∆stpA B
FNR INPUT from PK8263 with 16 µM INPUTTG
FNR INPUT from PK8263 with 4 µM INPUTTG
FNR INPUT from PK8263 with 8 µM INPUTTG
FNR INPUT from WT Escherichia coli MG1655 K-12
FNR IP ChIP-seq Anaerobic A
FNR_IP_ChIP-seq_Anaerobic_A_WIG.wig: U00096.2
FNR IP ChIP-seq Anaerobic B
FNR_IP_ChIP-seq_Anaerobic_B_WIG.wig: U00096.2
FNR IP from PK8263 with 16 µM IPTG
FNR IP from PK8263 with 4 µM IPTG
FNR IP from PK8263 with 8 µM IPTG
FNR IP from WT Escherichia coli MG1655 K-12
folA__U_N0075_r1
folA__U_N0075_r2
folA__U_N0075_r3
folA upregulation, 0.075 ug/ml norfloxacin
Following \
Following background subtraction, spot signal intensities were calculated as percentages of total signal intensities of Cy-3 or Cy-5 signals on each microarray, as a means of normalization. Spots with low intensities were excluded.
Following incubation, roots had been gently rinsed to remove loosely attached bacteria and roots were cut directly into 100 ml ice cold stop solution (5 % H2O-saturated phenol, pH 4.3, in 95% ethanol).  Root extracts were filtered using 0.5 µm filters to separate bacteria cells from plant cells in order to prevent interference of the cDNA labeling. Qiagen RNA protect solution was used to stabilize RNA during extraction. Bacteria had been collected by shaking and washing and stored in -80°C until using for RNA isolation.
For 3C-seq: ≈ 1-2 x 109 crosslinked cells (7% formaldehyde, unless otherwise stated ) are suspended in 600 μl Tris 10 mM EDTA 0.5 mM (TE) (pH 8) with 4 μl of lysozyme (35 U/μl; Tebu Bio), and incubated at RT for 20 minutes. SDS is added to the mix (final concentration 0.5%) and the cells are incubated for 10 minutes at RT. 50μl of lysed cells are then transferred in 8 tubes containing 450μL of digestion mix (1X NEB 1 buffer, 1% triton X-100, and 100U HpaII enzyme). DNA is digested for 3 hours at 37°C, split in 4 aliquots, and diluted in 8 ml ligation buffer (1X ligation buffer NEB without ATP, 1 mM ATP, 0.1 mg/ml BSA, 125 Units of T4 DNA ligase 5 U/μl). Ligation is then performed at 16°C for 4 hours, followed by incubation overnight (ON) at 65°C in presence of 250 μg/ml proteinase K and 5 mM EDTA. Precipitation of DNA is performed using an equal volume of 3 M Na-Acetate (pH 5.2) and two volumes of iso-propanol. After one hour at -80°C, DNA is pelleted, suspended in 500μl 1X TE buffer, and incubated for 30 minutes at 37°C in presence of RNAse A (0.03 mg/ml). DNA is then transferred into 2 ml centrifuge tubes, extracted twice with 500 μl phenol-chloroform pH 8.0, precipitated, washed with 1 ml cold ethanol 70% and diluted in 30 μl 1X TE buffer. All tubes are pooled and the resulting 3C library is quantified on gel using Quantity One software (BioRad).
For alignment of the reads contained within the fastq files to the E. coli MG1655 reference genome (RefSeq NC_U00096.3), the short read alignment tool Bowtie2 was utilized under default settings.  Bowtie parameters were set to include only perfect matches and map once reads that map to more than one genome location, i.e., uniquely mapped reads are retained. The output Bowtie2 was a SAM files for each sample.
For alignment of the SAET reads to the E. coli MG1655 reference genome (RefSeq NC_000913), the short read alignment tool Bowtie ver. 1.8 (Langmead, et al., PMID 19261174) was utilized in three consecutive passes for each sample dataset. For the first pass, we use paired end color space mapping with a distance cutoff of 350 bases between read mates. Bowtie parameters were set to include only perfect matches and suppress reads that map to more than one genome location, i.e., uniquely mapped reads are retained. In practice we found the efficiency of paired end mapping was between 3 and 10%. To improve the overall alignment we mapped the orphan 5’ and 3’ end reads in two additional passes with Bowtie. The output of the three passes through Bowtie was three SAM files for each sample. Overall, we achieved 40-60% mapping efficiency with this three-pass strategy.
For all the samples; when 1/3 of the maximum OD600 was reached, cells were harvested by centrifugation (7,500 rcf for 5 min) and frozen. DNA was isolated using the Wizard Genomic DNA Purification Kit (Promega).
For all the samples; when 1/3 of the maximum OD600 was reached, cells were harvested by centrifugation (7,500 rcf for 5 min) and frozen. For RNA isolation, cells were lysed by bead beating and RNA was purified using phenol-chloroform extractions and ethanol precipitations. DNA was removed from the sample with RNase-free DNase I (Fermentas) treatment for 45 min. Ribolock (Fermentas) was added to avoid RNA degradation.
For analysis of ChIP-seq data, Hiseq 2500 Illumina short reads (50 bp) were mapped back to the Caulobacter NA1000 reference genome (NCBI Reference Sequence: NC-011916.1) using Bowtie 1 (Langmead et al., 2009) and the following command:bowtie -m 1 -n 1 --best --strata -p 4 --chunkmbs 512 NA1000-bowtie --sam *.fastq > output.sam. Subsequently, the sequencing coverage at each nucleotide position was computed using BEDTools (Quinlan and Hall, 2010) using the following command: bedtools genomecov -d -ibam output.sorted.bam -g NA1000.fna > coverage_output.txt. For analysis of E. coli ChIP-seq data, reference genomes were first reconstructed in silico by inserting the nucleotide sequence of parS and apramycin antibiotic resistance cassette to the ybbD locus of E. coli MG1655 genome. Afterwards, Hiseq 2500 Illumina short reads were mapped back to these reconstructed reference genomes using Bowtie 1. Sequence coverage at each nucleotide position was also computed using BEDTools. Finally, ChIP-seq profiles were plotted with the x-axis representing genomic positions and the y-axis is the number of reads per base pair per million mapped reads (RPBPM) using custom R scripts.
For analysis of IDAP-seq data, Hiseq 2500 Illumina short reads (50 bp) were mapped back to the Caulobacter NA1000 reference genome (NCBI Reference Sequence: NC-011916.1) using Bowtie 1 (Langmead et al., 2009) and the following command:bowtie -m 1 -n 1 --best --strata -p 4 --chunkmbs 512 NA1000-bowtie --sam *.fastq > output.sam. Subsequently, sequencing reads were sorted to either being mapped to the upper DNA strand or to the lower strand of the reference genome, as suggested in the original IDAP-seq publication (Belitsky and Sonenshein, 2013). The number of 5’ end of reads that were mapped to the upper strand was counted for each nucleotide position along the Caulobacter genome using BEDTools (Quinlan & Hall, 2010) and the following command: bedtools genomecov -d -5 -strand + -ibam output.sorted.bam -g NA1000.fna > upper_strand_output.txt. To count the number of 5’ end of reads that were mapped to the lower strand, the following command was used instead: bedtools genomecov -d -5 -strand - -ibam output.sorted.bam -g NA1000.fna > lower_strand_output.txt. The IDAP-seq profile was then plotted using R. The sequence in between the summit of upper strand profile and that of the lower strand profile defines the minimal parS sequence required for binding to ParB.
For ChIP-seq experiments E. coli culture were fixed with formaldehyde (1% final concentration); for NorfliP experiments TopoIV was crosslinked with Norfloxacin (2µM)
For chromatin immunoprecipitation, cells were fixed with formaldehyde and glycine and sheared via sonication. Sheared DNA from lysate was immunoprecipitated (IP) out using an anti-FLAG mAb (Sigma). DNA was washed with IPP150 buffer and purified via ProteinaseK digestion and Qiaquick PCR purification kit (Qiagen - Cat. No. 28106).
For control and test RNAs, the synthesis of target cRNA probes and hybridization were performed using Agilent’s Low Input Quick Amp WT Labeling Kit, one color (Agilent Technology, USA) according to the manufacturer’s instructions. Briefly, each 0.2ug total RNA was mixed with WT primer mix and incubated at 65ºC for 10min. cDNA master mix (5X First strand buffer, 0.1M DTT, 10mM dNTP mix, RNase-Out, and MMLV-RT) was prepared and added to the reaction mixer. The samples were incubated at 40ºC for 2 hours and then the RT and dsDNA synthesis was terminated by incubating at 70ºC for 15min.
For cross-linking, 30 mL of cells were mixed with 300 uL 1M sodium phosphates (pH 7.6) and 810 uL 37% formaldehyde. Cross-linking was quenched by addition of 2 mL 2M glycine. Protein-DNA complexes were isolated from cells grown to early (2.4 x 10^7 CFU/ml) or late (2.4 x 10^8 CFU/ml) exponential phase.  Batch cultures of E. coli MDS42 were grown to early exponential phase.  To obtain tiling-resolution RNA measures across the E. coli genome, wild-type cells were grown in biological duplicate in LB to early exponential phase. The cultures were moved to ice, and the Qiagen RNeasy kit (P/N 74104) was used to isolate total cellular RNA.
For DMS-MaPSeq, reads were aligned to the 5’UTR of cspA using bowtie2 and an alignment seed of 12nt.  Low sequence quality bases (Q score < 20%) and missing bases due to truncated reads were set to question marks. Reads that consisted of more than 20% question marks were filtered out. Only mutations that agreed between the forward and the reverse read were considered true mutations. Mutation rate per base was calculated as number of reads with a mutation at the base divided by total number of reads covering the base.
For each biological replicate, frozen aliquots (500μl) of E. coli K12 stock cultures were subcultured in 10 ml of Brain Heart Infusion (BHI) and incubated overnight at 37°C. Cells were then sub-cultured (1% v/v) into 50ml BHI broth and incubated at 37°C for 24h under constant agitation (150 rpm). The bacterial suspensions were then inoculated (1% v/v) in 200ml BHI broth and grown in the same conditions to stationary phase (OD600nm of 0.9).
For each biological RNA-Seq replicate E coli K-12 MG1655 was subcultured from cyrostorage on Luria-Bertani (LB) agar overnight at 37°C. A half-dozen well-isolated colonies were used to inoculate a 20 ml starter culture in Neidhardt MOPS Minimal Medium (NM3) (Neidhardt et al., 1974, J Bacteriol) (0.2% final glucose concentration) supplemented with 20 mg/L uracil and 500 µg/L thiamine, which was incubated at 37°C with shaking at 250 rpm overnight (~18 hr). The overnight starter culture was diluted 1:30 to initiate the experimental culture and divided into three 500 ml flasks with 100 ml NM3 in each, which were incubated at 37°C with shaking at 250 rpm.
For each co-ordinate coverage was calculated as the number of reads which was aligned againist the position. The coverage was normalized and converted into a z score. Z score threshold of 12 was selected to identify H-NS binding regions.
For each of the 4 libraries (2 bacterial samples x 2 treatments), we counted the number of times each nucleotide position was the first in a sequence read using a simple script (unpubl. resource). The forward and reverse strands were then processed separately.
For each peak detected with MACE, binding intensity was calculated by averaging read counts from two biological replicates and dividing by background intensity.
For each sample, 500 mL liquid cultures were grown in 2.8 L flasks with shaking (180 rpm) at 37 °C from an OD (600 nm) 0.05 to OD 0.45 ± 0.05. Cells were grown in MOPS EZ rich defined medium with 0.2% glucose (Teknova).
For each uniquely mapped fragment (ribozero treated samples) or all mapped fragments (total RNA samples), at all aligned positions a count was added.
foreground and background, and the median Cy3 (green) foreground and background
foreground (f_g) and background (b_g) intensity. The position of each probe within a block,
For further analyses the processed signal intensities of all coding regions and RNA genes were extracted and used. Variance stabilization and normalization of the extracted intensities were performed with the vsn packages of the R software environment (R Development Core Team, 2007) and back-transformed to normal intensity scale. For each probeset, e.g. all probes representing for example, a single coding gene, outliers were removed by boxplot statistics and the outlier-removed probe intensities were averaged in a robust way by computing the Tukey biweight.
For immunoprecipitation, 800 μl of collected chromatin (~1000 μg of protein) were incubated on a rotating wheel over night at 4°C with 10 μg of either rabbit anti-Dps antibodies (experimental sample) or rabbit pre-immune IgG (negative control). Next day 30 μl of Ultra Link Protein A/G beads (Thermo Scientific, USA) were added to the samples, and incubation was allowed for a further 2 hours at 4°C on a rotating wheel. The beads were washed 3 times with 1 ml of the low-salt buffer (50 mM HEPES pH 7.5, 140 mM NaCl, 1% Triton X-100, 1xPIC) and then with 1ml of the high-salt buffer (500 mM NaCl). Immunoprecipitated DNA-protein complexes were removed from the beads by 3 h shaking at 65°C and 1000 rpm in 110 μl of freshly prepared elution buffer, containing 100 mM NaHCO3 and 1% SDS. After centrifugation at 3000 rpm for 5 minutes, 100 μl of the supernatant was transferred to a new tube, and the DNA was purified with a PCR Purification Kit (Qiagen, Germany). The DNA concentration was measured on Qubit 2.0 using Qubit dsDNA HS Assay kit. A total of 8-10 identical samples were combined and concentrated to a volume of 30-50 μl containing 5-10 ng of the DNA.
For in vivo DMS modification, 15 mL of E. coli culture was incubated with 750 µL DMS. Incubation was performed for 2 min at 37°C or for 45 min at 10°C. DMS was quenched by adding 30 mL 0°C stop solution (30% β-mercaptoethanol, 25% isoamyl alcohol), after which cells were quickly put on ice, collected by centrifugation at 8000 x g, 4 °C for 2 min, and washed with 8 mL 30% BME solution. Cells were then resuspended in 450 µL total RNA lysis buffer (10 mM EDTA, 50 mM sodium acetate pH 5.5), and total RNA was purified with hot acid phenol (Ambion).
For in vivo DMS modification, 15 mL of exponentially growing E. coli were incubated with 750 µL DMS for 2 min at 37°C. For kasugamycin (ksg) experiments, ksg was added to a final concentration of 10 mg/mL to ΔgcvB cells for 2 min at 37°C prior to DMS modification. DMS was quenched by adding 30 mL 0°C stop solution (30% β-mercaptoethanol, 25% isoamyl alcohol). For in vitro DMS modifications, mRNA was denatured at 95 °C for 2 min, cooled on ice and refolded in 90 µL RNA folding buffer (10 mM Tris pH 8.0, 100 mM NaCl, 6 mM MgCl2) at 37°C for 30 min then incubated in either .2% DMS for 1 min (95°C) or 4% DMS for 5 min (37°C).
Formaldehyde was added to a final concentration of 1%. After incubation for 20 minutes, glycine was added to a final concentration of 0.5 M and incubated for 5 minutes.
For metagene analyses (gene-segment analyses and codon-type analyses), pseudogenes and genes not represented in one or more datasets were excluded, leaving 3048 genes in the \
For proteolysis, affinity gel obtained after the last centrifugation step was diluted with TES buffer up to final volume 200 μl, proteinase K (Sigma-Aldrich) was added (0.5 mg/ml) and samples were incubated at 55°C for at least 3 hours. After this step samples were centrifuged (2 minutes, 2000xg at room temperature) and supernatants were collected for DNA extraction.
For quantification of gene expression (read counting), the alignments generated with the Genomics Workbench were exported in BAM format. Read counting was then performed with the FeatureCounts v. 1.5.0-p1 program using the following parameters; Level : meta-feature leve. Paired-end : no. Strand specific : yes. Multimapping reads : counted (as fractions). Multi-overlapping reads : not counted. Overlapping bases : 30. Read orientations : fr
For REC-Seq (restriction enzyme cleavage–sequencing) 1 ug of genomic DNA from C.  crescentus NA1000 and S. meliloti Rm2011 was cleaved with HinfI, a blocked (5’biotinylated)  specific adaptor was ligated to the ends and the ligated fragments were then sheared to an average size  of 150-400 bp (Fasteris SA, Geneva, CH). Illumina adaptors were then ligated to the sheared ends  followed by deep-sequencing using a Hi-Seq Illumina sequencer, and the (50 bp single end) reads  were quality controlled with FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/).
For ribozero treated samples, counts at all positions were log2 transformed and a cleavage ratio was calculated (+ MazF - empty vector) for assessing MazF cleavage in transcripts.
For RNA isolation, 0.5 mL of the cultures were mixed with 1 mL RNA protect (Qiagen, Ontario, Canada) and RNA was isolated using the RNeasy Mini kit (Qiagen). RNA was quantified with a Nanodrop Spectrophotometer (Thermo scientific, Wilmington, USA) and RNA quality was determined with a Bioanalyzer 2100 (Agilent Technologies, Santa Clara, USA). RNA samples (approximately 30 µg) were treated with 1U RNase free DNase I (Ambion, Ontario, Canada) at 37°C for 30 min and 1U RNase inhibitor (Ambion) was added prior to storage at 4°C. RNA was reverse-transcribed using the Array 900MPX Expression Array Detection Kit (Genisphere, Hatfield, USA) according to the instructions of the manufacturer. The cDNA was purified using the MinElute PCR Purification Kit (Quiagen), and the purified DNA was used for microarray and qPCR experiments.
For RNA-Seq analysis, the fastq file produced from the machine was demultiplexed into a separate file for each sample.
For RNA-seq: total RNA was extracted using RNeasy Protect Bacteria according to manufacturer instructions (QIAGEN - # 74524)
For the first batch (from WT_LB_1 to lacA_M9_2), fresh colonies of E. coli cells were taken and inoculated in 1 ml LB and grown for 8 h at 37°C. 20 µL of grown culture was taken and transferred to 3 ml LB/M9 medium supplemented with 0.3% glucose and grown for 12 h at 37°C. At 12 h, cells were harvested for the RNA-seq. For the second batch (from WT_1 to aspC_3), a 1:100 dilution from an overnight culture in M9 0.4% glucose was done. When the late stationary phase was reached, the samples were harvested.
For the Illumina GAII platform, the directional RNA-seq libraries were constructed by following an Illumina’s instruction using their Small RNA Sample Prep Kit with some modifications. For the HiSeq 2000 platform, the directional RNA-seq libraries were constructed using Illumina’s TruSeq Small RNA Sample Prep Kit.
For the whole-transcriptome analysis, sequencing was verified using FASTQC (version 0.11.2) to confirm base-call quality in each indexed file.
For total RNA extraction, cells were pelleted in 4 °C.
For total RNA isolation, the bacteria were inoculated in 5 ml LB broth at 37℃with shaking for 16 h. 50 µl of the above culture was inoculated in 5 ml fresh LB broth and the culture was shaken at 37°C for about 2.5 h until the OD600 reached 0.6. 500 µl of the culture were mixed with 1 ml RNA protect bacterial reagent (Qiagen, Hilden, Germany) to stabilize RNA according to the manufacturer’s instructions.
Forward- and reverse-read mate-pairs were assembled and aligned to the Escherichia coli MG1655 K-12 genome using Bowtie2 (Langmead and Salzberg, 2012, Nat Methods). SAMtools (Li et al., 2009, Bioinformatics) was used to convert Bowtie2 output (.bam file) to SAM format.
Four ml of the bacterial suspension in RNALater II and Medium E growth medium were spun down at 200g for 5 min. The supernatant was discarded and the pellet were resuspended in 200ul PBS and mixed by pipetting. 100ul aliquots were taken out for DNA and RNA extraction from the same sample. RNA extraction was done using Qiagen RNeasy mini kit (Qiagen, Hilden, Germany) with on-column DNase digestion. Final elution was made in 30 μL dH2O. The concentration and integrity of the total RNA was estimated by Quant-iT™ RiboGreen® RNA Assay Kit  (ThermoFisher Scientific, Waltham, MA), and Agilent 2100 Bioanalyzer (Applied Biosystems, Carlsbad, CA), respectively.
Four morphologic states of ESBL019 were used during the experiments. A first ESBL019 morphological state was prepared by resuspension of ESBL019 in cell culture medium (CCM) without ceftibuten supplementation prior to its inoculation of primary human bladder epithelial cells (HBEP) (designated; ESBL019 Coliform). A second ESBL019 morphological state was prepared by resuspension in CCM and then used to inoculate HBEP cells with ceftibuten supplementation (480ng/mL) (designated; ESBL019 Transition). This transition from coliform into filamented occurs in the presence of HBEP cells. A third ESBL019 morphological state was prepared by resuspension and pre-incubation for 3 hours in CCM with ceftibuten in a tube, in order to induce complete filamentation of all bacteria. The third pre-filamented ESBL019 fraction was used to inoculate HBEP cells in the presence of ceftibuten to keep the bacteria filamented (designated; ESBL019 Filamented). The CCM of the pre-filamented ESBL019 fraction was replaced with CCM without ceftibuten and the filamented ESBL019 were allowed to revert completely back to its coliform during 1 hour in a tube prior to the inoculation of HBEP cells without ceftibuten (designated; ESBL019 Reverted). Prior to inoculation the bacterial concentrations of all fractions were adjusted in order to inoculate HBEP cells with a multiplicity of infection (MOI) of 10. All inoculated cells were incubated for 4 hours in 5% CO2 at 37oC after which supernatants were collected and centrifuged 5 min at 5000 x g to collect the bacteria.
FPKM were calculated using Cufflinks v.2.0.2 with upper-quartile normalization and fr-firststrand for library type
fraction: input DNA
fraction: input DNA, SeqA ChIP supernatant
fraction: input DNA, σ32 ChIP supernatant
Fragmentation and reverse transcription of RNA with random primers was carried out using the NEB First Strand Synthesis Module (New England Biolabs). Second strand synthesis was done with the NEBNext Ultra Directional RNA Second Strand Synthesis Module (New England Biolabs), then purified with 1.7x AMPURE Bead XP (Beckman Coulter). DNA end repair was carried out with the NEBNext end repair module, dA-tailing used the NEBNext dA-Tailing Module and adapter ligation used the NEBNext Quick Ligation module (New England Biolabs). PCR amplification was carried out for 10 rounds of synthesis using the NEBNext High-Fidelity PCR Master Mix with NEBNext USER Enzyme (New England Biolabs), samples were purified with 1.0x AMPURE Bead XP (Beckman Coulter). Library quality was verified on a Bio-Analyzer DNA chip (Agilent).
Fragments Per Kilobase of exon per Megabase of library size (FPKM) were calculated using cufflinks v.1.3.0
FRIK2000 Cy3 rep1 vs EDL933 pool Cy5
FRIK2000 Cy3 rep3 vs EDL933 pool Cy5
FRIK2000 Cy5 rep2 vs EDL933 pool Cy3
FRIK2000 Cy5 rep4 vs EDL933 pool Cy3
FRIK966 Cy3 rep1 vs EDL933 pool Cy5
FRIK966 Cy3 rep3 vs EDL933 pool Cy5
FRIK966 Cy5 rep2 vs EDL933 pool Cy3
FRIK966 Cy5 rep4 vs EDL933 pool Cy3
From the cells cultured in LB media at 37 ℃, total RNA was extracted using RNAsnapTM method, followed by the ethanol precipitation. rRNA was removed using ribo-zeroTM magnetic kit for bacteria in accordance with manufacturer’s instruction (Epicentre). rRNA removal was confirmed using ExperionTM system. Subsequently, 4 µg of the purified RNA was fragmented to sizes of ~300 bp using RNA fragmentation reagent (Ambion, Grand Island, NY).
From the rRNA depleted RNA samples, first-strand cDNA was synthesized using a N6 randomized primer. After fragmentation, the Illumina TruSeq sequencing adapters were ligated in a strand specific manner to the 5' and 3' ends of the cDNA fragments. The cDNA was finally amplified with PCR (15 PCR cycles) using a proof reading enzyme. For Illumina sequencing, cDNA libraries were pooled in a 25:1 ratio. The library pool was fractionated in the size range of 250-500 bp using a differential clean- up with the Agencourt AMPure kit. The cDNA pool was sequenced on an Illumina NextSeq 500 system using 75 bp read length.
Frozen bacteria were grown overnight in 18mm test tubes containing DMga medium, 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for 12 hours 37°C, 250rpm. Extraction was performed just after.
Frozen bacteria were grown overnight in 18mm test tubes containing DMga medium, 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for 12hours 37°C, 250rpm. Extraction was performed just after.
Frozen bacteria were grown overnight in 18mm test tubes containing DMga medium, 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for 18 hours 37°C, 250rpm. Extraction was performed just after.
Frozen bacteria were grown overnight in 18mm test tubes containing DMga medium, 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for 18hours 37°C, 250rpm. Extraction was performed just after.
Frozen bacteria were grown overnight in 18mm test tubes containing DMga medium, 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for 3.5 hours 37°C, 250rpm. Extraction was performed just after.
Frozen bacteria were grown overnight in 18mm test tubes containing DMga medium, 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for 4 hours 37°C, 250rpm. Extraction was performed just after.
Frozen bacteria were grown overnight in 18mm test tubes containing DMga medium, 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for 4hours 37°C, 250rpm. Extraction was performed just after.
Frozen bacteria were grown overnight in 18mm test tubes containing DMga medium, 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for 7hours 37°C, 250rpm. Extraction was performed just after.
Frozen cell pellets were lyzed with lysozyme (Sigma Aldrich) and proteinase K (Qiagen Inc.) at room temperature. Total RNA was isolated from cell lysates using RNeasy Midi Kit according to the manufacturer's instructions (Qiagen Inc.). All RNA samples were then treated with DNase I (Ambion, Life technologies) before a phenol/chloroform purification and an overnight precipitation at -20°C in absolute ethanol containing LiCl 8M. After centrifugation, RNA pellets were air-dried in a vacuum concentrator ( vacufuge plus; Eppendorf).
Functional annotation was done using the Database for Annotation, Visualization and Integrated Discovery (DAVID) Bioinformatics Resources 6.7, NIAID, NIH (http://david.abcc.ncifcrf.gov).
∆fur Aerobic A
∆fur Aerobic B
∆fur Anaerobic A
∆fur Anaerobic B
∆fur Anaerobic [IP vs nput]
furanone-free control
FUR_CPR_1
FUR_CPR_2
Furfural-tolerant IrrE mutant F1-37, biological rep1
Furfural-tolerant IrrE mutant F1-37, biological rep2
Furfural-tolerant IrrE mutant F1-37, biological rep3
Fur IP ChIP-Seq Aerobic A
Fur IP ChIP-Seq Aerobic B
Fur IP ChIP-Seq Aerobic C
Fur IP ChIP-Seq Anaerobic A
Fur IP ChIP-Seq Anaerobic B
Fur IP ChIP-Seq Anaerobic C
Fur IP ChIP-Seq Anaerobic, Iron Deficient A
Fur IP ChIP-Seq Anaerobic, Iron Deficient B
Fur-minus_cDNA_Aerobic
Fur-minus_cDNA_Anaerobic
Fur-minus_RyhB-minus_cDNA_Aerobic
Fur-minus_RyhB-minus_cDNA_Anaerobic
fur mutant pBAD-ryhB#1 + arabinose
fur mutant pBAD-ryhB#2 + arabinose
fur mutant pNM12#1 + arabinose
fur mutant pNM12#2 + arabinose
FUR_noCPR_1
FUR_noCPR_2
∆fur ∆ryhB Aerobic A
∆fur ∆ryhB Aerobic B
∆fur ∆ryhB Anaerobic A
∆fur ∆ryhB Anaerobic B
further analysis if the foreground intensity of less than 50% of the pixels within the spot
further processing
Fur with DPD 1 (ChIP-exo)
Fur with DPD 2 (ChIP-exo)
Fur with Fe 1 (ChIP-exo)
Fur with Fe 2 (ChIP-exo)
G21 MG1655GFP_pD864_3
G23 MG1655GFP_pLys_M1_3
G28 MG1655GFP_pD864_3
G29 DH10BGFP_None_3
G2, osmotolerant mutant
G2 Replicate 1
G2 Replicate 2
G3, osmotolerant mutant
G3 Replicate 1
G3 Replicate 2
G4H14
G4H14 strain
G500_1
G5 DH10BGFP_Lux_3
G5, osmotolerant mutant
G5 Replicate 1
G5 Replicate 2
G6 DH10BGFP_pD864_LacZ_3
G6, osmotolerant mutant
G6 Replicate 1
G6 Replicate 2
gabT KO rep1
gabT KO rep2
gabT KO rep3
Galaxy1-[CV104_pHDB3_5.txt]
Galaxy2-[CV104_pLCV1_5.txt]
Galaxy3-[CV104_pLCV1_10.txt]
Galaxy4-[CV104_pHDB3_20.txt]
Galaxy5-[CV104_pLCV1_20.txt]
Galaxy6-[CV104_pHDB3_10.txt]
galE KO rep1
galE KO rep2
galE KO rep3
galF__U_N0075_r1
galF__U_N0075_r2
galF__U_N0075_r3
galF upregulation, 0.075 ug/ml norfloxacin
GATC
GATC software for read mapping on MG1655
Gave a pseudocount of 0.01 to all values of 0
GCOS 1.0
GCOS was used to obtain detection calls for each microarray.  The statistical difference for mRNA expression were analyzed using CarmaWeb. Affymetrix GeneChip analysis was performed using MAS for background correction, VSN for normalization, MAS for PM correction and Medianpolish for Expression.  VSN normalized data not provided by submitter.
GCRMA method
GCRMA normalized
gcvR__U_N0075_r1
gcvR__U_N0075_r2
gcvR__U_N0075_r3
gcvR upregulation, 0.075 mg/mL norfloxacin
gcvT-ala-1
gcvT-ala-2
gcvT mutant in Ala media
gcvT mutant in Gln media
gDNA 520
gDNA 521
gDNA_A_cy5
gDNA B02
gDNA B05
gDNA_B_cy3
gDNA C01
gDNA C02
gDNA_EColi_520
gDNA_EColi_521
gDNA_EColi_B02
gDNA_EColi_B05
gDNA_EColi_C01
gDNA_EColi_C02
gDNA_EColi_F01
gDNA_EColi_F02
gDNA_EColi_H01
gDNA_EColi_H02
gDNA_EColi_H03
gDNA_EColi_H04
gDNA_EColi_H05
gDNA_EColi_H12
gDNA_EColi_H23
gDNA_EColi_H27
gDNA_Ecoli_K12
gDNA_EColi_S04
gDNA_EColi_S05
gDNA_EColi_S13
gDNA F01
gDNA F02
gDNA from E.coli K12 cyanine 3
gDNA H01
gDNA H02
gDNA H03
gDNA H04
gDNA H05
gDNA H12
gDNA H23
gDNA H27
gDNA K12
gDNA S04
gDNA S05
gDNA S13
Gene annotation was obtained from the EcoCyc E. coli Database (https://ecocyc.org/).
GeneChip Operating Software (MAS 5.0) using Affymetrix default analysis settings and global scaling as normalization method, genes with a p-value of less than 0.0025 or greater than 0.9975 were considered statistically significant based on Wilcoxon signed rank test and Tukey Byweight, labeled as I and D in the attached txt file. To ensure the significance of microarray data, an additional criterion was applied to only select the genes with an expression ratio of 2 or high from this group as induced and repressed genes.
GeneChips were washed and stained with an FS450 fluidics machine and scanned using a GeneChip Scanner 3000
gene counting: HTSeq-Count 0.6.0
Gene expression analysis was performed using a strand-specific, paired-end RNA-seq protocol using the dUTP method (Levin et al., 2010).  Total RNA was isolated and purified using the Qiagen Rneasy Kit with on-column DNase treatment.
Gene expression (based on known genes) was determined using Cufflinks 2.0.2, only PF reads were retained
Gene expression data (3 biological replicates per strain) were analyzed in the statistical software program R (www.r-project.org ) using the EdgeR package (3). Data were normalized using the CQN package, which accounts for both gene length and GC content effects (4). Differentially expressed genes were determined by comparing expression values under anaerobic and aerobic conditions. Those genes with adjusted P values less than 0.01 (i.e., false discovery rate less than 1%) were identified as significantly differentially expressed genes. Finally, gene annotations were automatically made using the biomaRt package (5) together with the annotation files available at the Ensembl database (www.ensembl.org) and gene set enrichment analysis (GSEA) was performed using the piano package (6). All R packages used in this study are available in Bioconductor (www.bioconductor.org).
gene expression sum normalized to 1 at each time point
Gene expression was calculated as reads per gene by determining the number of reads that overlapped with the annotated gene loci using HTSeq (Anders et al., 2015, doi: 10.1093/bioinformatics/btu638) with the option 'intersection-nonempty'.
GenePix Pro (v 6.1) was used for background subtraction and normalization.
GenePix software (Axon Instruments, Union City, CA) version 5.1 was used to process the scanned data and generate the gpr files.
generation of coverage graphs representing the number of pAA plasmid-associated mapped reads per nucleotide using READemption 0.3.7
Gene selection was done using the False Discovery Rate (FDR) correction procedure for adjusting genes with p-value smaller than 0.05 and Fold Change greater than 2.
Genes from the amplified regions in O500 (12-fold) and P500 (two-fold) strains are significantly over-expressed relative to the reference: average log Fold Change for concentrations is +3.6 and +0.8 (both with p-values<10-20), respectively.
GeneSpring GX v.13.1
Genes with BH (Benjamini and Hochberg) adjusted p-values below 0.05 threshold were selected as DE genes.
Genetic background: fnr-
genetic background: O157 H19
Genetic background:wt
Genetic background: wt
Genetic background: wtGrowth conditions: aerobic
genetic modification: empty plasmid (LJ110/pTM30)
genetic modification: PdhR knockout mutant (LJ110deltapdhR)
genetic modification: PdhR overexpression strain (LJ110/pTM30PdhRhis)
genetic modification: wild type LJ110
Gene wise natural spline interpolation of temporal data from initial time points to a dataset of 10 minutes steps (see processed data files). Expression values at the time points of the raw data are not affected by the interpolation.
genome accession: GCA_000752975
genome accession: GCA_000753215
genome accession: GCA_000753275
genome accession: GCA_000936225
genome accession: GCA_000936245
genome accession: GCA_000936475
genome accession: GCA_000937275
genome accession: GCA_000938695
genome accession: GCA_000938995
genome accession: GCA_000939195
genome accession: GCA_000939755
genome accession: GCA_000939955
genome accession: GCA_000941395
genome accession: GCA_000941895
genome accession: GCA_000946755
genome accession: GCA_000947315
genome accession: GCA_000951835
genome accession: GCA_000951875
genome accession: GCA_000951915
genome accession: GCA_000965545
genome accession: GCA_000965555
genome accession: GCA_000965575
genome accession: GCA_000965625
genome accession: GCA_000965635
genome accession: GCA_000965655
genome accession: GCA_000965665
genome accession: GCA_000965705
genome accession: GCA_000965715
genome accession: GCA_000966935
genome accession: PVRW00000000
Genome Build:
Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1))
Genome_build: ASM1938v1
genome build: ASM584v1
Genome_build: ASM584v1
Genome_build: ASM584v1; Reference genome for E. coli MG1655 (RefSeq NC_000913). Paper title:Escherichia coli K-12: a cooperatively developed annotation snapshot--2005
Genome_build: ASM584v1, U00096.2
Genome_build: ASM584v2
Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf )
Genome_build: ASM666v1; NC_002655.2
Genome_build: ATCC8739
Genome_build: CFT073(AE014075.1)
Genome_build: CFT073 E. coli
Genome_build: CP009273.1
Genome_build: CP018801 (https://www.ncbi.nlm.nih.gov/nuccore/CP018801)
Genome_build: DL4201_in_lab_reference_genome (available on series record)
Genome_build: E.coli K12 BW25113
Genome build: E. coli [K-12 MG1655 strain (U00096.2)
Genome_build: E. coli K-12 MG1655 (U00096.3)
Genome_build: E. coli MG1655 GenBank: U00096.2,total length : 4639675 bp
Genome_build: E. coli: NC_000913
Genome_build: E. coli strain BW25113
Genome_build: Escherichia coli B str. REL606; NC_012967.1
Genome_build: Escherichia coli (DH10B)
Genome_build: Escherichia coli K12 MG1655 NC000913.3
Genome_build: Escherichia coli K12 str MG1655
Genome_build: Escherichia coli K-12 substr. DH10B ASM1942v1
Genome_build: Escherichia coli K-12, substr. MG1655 (assembly ASM584v2)
Genome_build: Escherichia coli MG1655 K-12 genome version U00096.2
Genome_build: Escherichia coli MG1655 reference genome (NC_00091313-Feb-2011
Genome_build: Escherichia coli (NC000913.2)
Genome_build: Escherichia coli strain K12 sub-strain MG1655 genome (GenBank accession no. U00096.2)
Genome_build: Escherichia coli str. K-12 substr. MG1655
Genome_build: Escherichia coli str. K-12 substr. MG1655, NCBI Reference Sequence: NC_000913.3
Genome_build: Escherichia coli str. K-12 substr. MG1655 (U00096.3)
Genome_build: Escherichia coli W3110 MuSGS (on the basis of NC_007779.1). FASTA and GFF are included on series record.
Genome_build: FM180568
Genome_build: FM180569
Genome_build: FM180570
Genome_build: gi|387825439
Genome_build: http://www.ncbi.nih.gov/nuccore/AP009048.1
Genome_build: K12 - MG1655
Genome_build: K-12 subst. MG1655 genome (NC_000913.3)/ASM584v1
Genome_build: K-12 substr. MG1655 genome (NC_000913.3)/ASM584v1
Genome_build: NC_000913
Genome_build: NC_000913.2
Genome_build: NC000913.2
Genome_build: NC000913.2 MG1655
genome build: NC_000913.3
Genome_build: NC_000913.3
Genome_build: NC_000913.3 E. coli K12 substr. MG1655
Genome_build: NC_000913/ASM584v1
Genome_build: NC_002655
Genome_build: NC_002655.2
Genome_build: NC_007779.1
Genome_build: NC007779.1 (UCSC Archaeal Genome Browser)
Genome_build: NC_010473.1
Genome_build: NC_011741 (E.coli strain IAI1), NC_000913.2 (E.coli strain MG1655), TW09308 (E.coli strain TW09308), and TW11588 (E.coli strain TW11588)
Genome_build: NC_011916.1
Genome_build: NC_012967.1 plus small RNAs as annotated in Rfam 11.0 database
Genome_build: NC_016856.1
Genome_build: NC_017644.1 (Escherichia coli NA114)
Genome_build: NC_018220 and NC_000913
Genome_build: NC_018658.1, NC_018659.1, NC_018660.1, NC_018666.1
Genome_build: NCBI reference sequence: NC_000913.2
Genome_build: NCBI reference sequence (NC_017626.1)
Genome_build: pPR9 plasmid (ref is Kashlec et al., 1989, PMID: 2547695)
Genome_build: Reference genome for E. coli MG1655 (RefSeq NC_000913.3).
Genome_build: Reference genome used: Escherichia coli K12 MG1655, version: iGenome
Genome_build: reference sequence is REL606
Genome_build: RefSeq NC_000913.3
Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit.
Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit.
Genome_build: strain MG1655, version U00096.2, downloaded from NCBI
Genome_build: Streptococcus pneumoniae D39 (assembly ASM1436v1)
Genome_build: The reference genomes used for E. coli K12 strain BW25113 and S. coelicolor A3(2) strain M145 were U00096.2 and AL645882, respectively.
genome build: U00096.2
Genome_build: U00096.2
Genome_build: U00096.2 (GenBank)
Genome_build: U00096.3
Genome_build: U00096.3 (E. coli K12) and NC_001604.1 (T7), excluding ribosomal genes, and with recoded gene 10 sequence (Bull, 2012, PMCID: PMC3457771) in place of wild-type sequence for analysis of recoded and evolved strains
Genome_build: UCSC mm10
Genome_build: W3110  (NC_007779)
Genome_build:  NC_000913
Genome mapping using Bowtie, version 0.12.9, parameters for samples 1-5: -v 2 --best --strata -m 1, parameters for samples 6-9: -v 3 --best --strata -m 1
Genome mapping using Bowtie, version 1.1.2, parameters for samples 1-2: -v 2 --best --strata -m 1
Genomic bacterial DNA was extracted following the protocol described in Maniatis Sambrook (Sambrook et al., 1989). DNA was sonicated in a Bioruptor (Diagenode, Liege, Belgium) to obtain fragments of approximately 500 bp.
genomic dna
genomic DNA
Genomic DNA control
Genomic DNA control from E. coli K-12 MG1655 cells
Genomic DNA control from E. coli K-12 MG1655 cells treated with 100ug/ml rifampicin
Genomic DNA control from E. coli K-12 MG1655 cells treated with 20ug/ml bicyclomycin
Genomic DNA control from E. coli K-12 MG1655 cells, untreated
Genomic DNA control from E. coli K-12 MG1655 HA3::nusG cells
Genomic DNA E. coli EDL933
Genomic DNA Extraction: Genomic DNA was extracted according to Current Protocols in Molecular Biology.  Protein-DNA complex isolation: Protein-DNA complexes were isolated by phenol extraction with 150 μL 10 mM Tris and 500 μL 25:24:1 phenol : chloroform : isoamyl alcohol.  A white disk was readily discernible at the aqueous/organic interface. To purify this interface, all aqueous and organic liquid was removed by pipetting. A second extraction was performed by adding 500 μL 10 mM Tris and 450 μL 24:1 chloroform: isoamyl alcohol, vortexing and centrifuging.  Again, all liquid was removed from the interface by pipetting, and residual liquid was removed. For cross-link reversal: the interface was suspended in 500 μL 10 mM Tris and 50 μL 10% SDS, and placed at ~100 ˚C for 30 minutes. The tubes were placed on ice, then moved to 65 ˚C for 3 hours following addition of 5 μL proteinase K (20 mg/mL). After heat treatment, the solutions were phenol/chloroform extracted and ethanol precipitated in the presence of glycogen to purify the DNA.  RNA extraction: the Qiagen RNeasy kit (P/N 74104) was used to isolate total cellular RNA. Immediately following elution in RNase-free water, residual DNA was removed by treatment with DNaseI at 37 °C for 15 minutes. The samples were treated again using the RNeasy kit, resuspended in 40 μl RNase-free water, and stored at -20 °C.
Genomic DNA from EDL933
Genomic DNA from O111 strain 10828
Genomic DNA from O111 strain 11109
Genomic DNA from O111 strain 11117
Genomic DNA from O111 strain 11128
Genomic DNA from O111 strain 11619
Genomic DNA from O111 strain 11711
Genomic DNA from O111 strain 11788
Genomic DNA from O111 strain 11845
Genomic DNA from O111 strain 12009
Genomic DNA from O111 strain 13369
Genomic DNA from O111 strain ED71
Genomic DNA from O111 strain PMK5
Genomic DNA from O157 strain 980551
Genomic DNA from O157 strain 980706
Genomic DNA from O157 strain 980938
Genomic DNA from O157 strain 981456
Genomic DNA from O157 strain 981795
Genomic DNA from O157 strain 982243
Genomic DNA from O157 strain 990281
Genomic DNA from O157 strain 990570
Genomic DNA from O26 strain 11044
Genomic DNA from O26 strain 11368
Genomic DNA from O26 strain 11656
Genomic DNA from O26 strain 12719
Genomic DNA from O26 strain 12929
Genomic DNA from O26 strain 13065
Genomic DNA from O26 strain 13247
Genomic DNA from O26 strain ED411
Genomic DNA from O55:H6 strain ICC219
Genomic DNA from O55:H6 strain ICC221
Genomic DNA from O55:H6 strain ICC222
Genomic DNA from O55:H7 strain st58
Genomic DNA from O55:H7 strain st957
Genomic DNA from O55:H7 strain TB182A
Genomic DNA from O55:H7 strain WC211
Genomic DNA from O55:H7 strain WC416
Genomic DNA isolation according to Grimberg et al. Nucleic acids research 1989, 17(21):8893
Genomic DNA of all strains (degraders and non-degraders) isolated individually and mixed in equal ratio (500ng each)
Genomic DNA of EDL933
Genomic DNA of Escherichia coli DH5α
Genomic DNA of mixed culture containing only non-degraders in equal ratio
Genomic DNA of mixed culture (Degraders and non-degraders in 2:1 ratio)
Genomic DNA of mixed culture (Degraders: NM-05, IITR-02, RHA1; Non-degraders: DH5α, BL21 and K12 in equal ratio)
Genomic DNA purified from wild type bacteri
Genomic DNA purified from wild type bacteria
Genomic DNA served as a universal reference
Genomic DNA was extracted by standard phenol-chloroform method (Sambrook, J, Molecular Cloning, 3rd Edition)
Genomic DNA was extracted from 4 bacteria strains. Strains Fibrobacter succinogenes S85 (ATCC 19169), Ruminococcus albus 20 (ATCC 27211) and Bacteroides xylanisolvens XB1A (DSM 18836T) were grown 15 h under strictly anaerobic conditions (Hungate, 1950) in a complex medium containing 20% of clarified rumen fluid (Béra-Maillet et al., 2000) and 0.2 g of cellobiose (Sigma-Aldrich) as carbon source, at 39°C for the two first ones and 37°C for the third one. The strain Escherichia coli K12 (ATCC 10798) was cultivated 15 h at 37°C in Luria-Bertani medium under shaking and aerobic conditions. (
Genomic DNA was extracted using an SDS lysis/phenol/chloroform method described by (Syn CK, Swarup S (2000) A scalable protocol for the isolation of large-sized genomic DNA within an hour from several bacteria. Anal Biochem 278: 86-90) with slight modifications as follows:  subsequent to DNA precipitation, spun pellets were treated with 50μg mL-1 DNAse-free RNAse A and incubated at 37°C for 30 min.  Samples were then re-extracted once with phenol:chloroform (3:1), once with phenol:chloroform (1:1), twice with chloroform, reprecipitated and then resuspended in TE, pH 8.0.
Genomic DNA was extracted using the Epicentre DNA extraction kit according to the manufacturer's protocols.
Genomic DNA was extracted using Ultra Clean Soil DNA (MoBio Laboratories, Solana Beach, CA).
Genomic DNA was isolated by lysozyme and proteinase K treatment.
Genomic DNA was isolated by lysozyme and proteinase K treatment.  
Genomic DNA was purified from exponentially growing cells by lysis in lysozyme/mutanolysin, incubation in proteinase K/SDS, followed by a standard phenol/chloroform extraction procedure. Final pellets were dissolved in TE (10 mM Tris-HCl at pH 8.0, 1 mM EDTA). Genomic DNA was digested to completion with Sau3A1 (Promega) and purified by phenol/chloroform extraction. Synthesis and degradation of RNA were stopped by adding 1/4 volume of stop-solution (95% ethanol/5% phenol). Cells were harvested by centrifugation (4,000 rpm, 20 min) at 4°C and resuspended in 0.5 mL of  lysis buffer (0.5 mg/mL lysozyme, 10% SDS, Tris-EDTA buffer,  3 M sodium acetate, pH 5.2). Phenol (0.5 ml, pH 4.5) was added, and the samples were vortexed vigorously before incubation at 64 °C for 6 min. After placing the samples on ice, the aqueous layer was extracted with 1:1 phenol:chloroform and with chloroform, and the RNA was precipitated with ethanol at -80°C. After resuspension, RNA concentration and purity was assessed by NanoDrop ND-1000 UV spectrophotometer (Nanodrop Technologies, Wilmingon, DE) and Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA), respectively.
Genomic DNA was purified using a 20/G genomic-tip kit (Qiagen) according to manufacturer's instructions and was sonicated to an average size of ~500 bp.
Genomic DNA was purified using the Genomic-tip 100/G and Genomic DNA buffer set (Qiagen) according to the manufacturer's instruction.
Genomic Library of E. coli was enriched via serial transfers. The cells were grown in M9 minimal media (5 g/L glucose), and in increasing concentration of n-butanol (0.5, 0.9, 1.3 and 1.7% v/v).
genomic_ref1
genomic_ref2
genomic_ref3
genomic_ref4
genomic_ref5
genomic_ref6
Genomic response analysis of E.coli during coexpression of a bacteriocin release protein
genotype: 285c rpoD mutation
genotype: AB1157 ybbD::parS scrambled site 3 pUTC18::parB (G101S)
genotype: AB1157 ybbD::parS scrambled site 3 pUTC18::parB (WT)
genotype: AB1157 ybbD::parS site 1 pUTC18::parB (WT)
genotype: AB1157 ybbD::parS site 2 pUTC18::parB (G101S)
genotype: AB1157 ybbD::parS site 2 pUTC18::parB (WT)
genotype: AB1157 ybbD::parS site 3 pUTC18::parB (G101S)
genotype: AB1157 ybbD::parS site 3 pUTC18::parB (WT)
genotype: AB1157 ybbD::parS site 4 pUTC18::parB (G101S)
genotype: AB1157 ybbD::parS site 4 pUTC18::parB (WT)
genotype: AB1157 ybbD::parS site 5 pUTC18::parB (G101S)
genotype: AB1157 ybbD::parS site 5 pUTC18::parB (WT)
genotype: AB1157 ybbD::parS site 6 pUTC18::parB (WT)
genotype: AB1157 ybbD::parS site 7 pUTC18::parB (G101S)
genotype: AB1157 ybbD::parS site 7 pUTC18::parB (WT)
genotype: ArgR-8myc
genotype: BW27784 delta_recD lacZ::XXX mhpR::XXX proA::ISceIcs  tsx::ISceIcs  PBAD-sbcDC  lacZ+ cynX::GmR  lacIq  lacZX-
genotype: BW27784 delta_recD lacZ::XXX mhpR::XXX proA::ISceIcs  tsx::ISceIcs  PBAD-sbcDC  lacZ:: pal246 cynX::GmR  lacIq  lacZX-
genotype: BW27784 lacZ::XXX mhpR::XXX proA::ISceIcs  tsx::ISceIcs  PBAD-sbcDC  lacZ+ cynX::GmR  lacIq  lacZX-
genotype: BW27784 lacZ::XXX mhpR::XXX proA::ISceIcs  tsx::ISceIcs  PBAD-sbcDC  lacZ::pal246 cynX::GmR  lacIq  lacZX-
genotype: crpfis mutant background
genotype: crp mutant background
genotype: CV108
genotype: cya mutant
genotype: cya mutant background
genotype: del-fis
genotype: del-hns
genotype: del rpoS
genotype: del rsd
genotype: del rsd; del ssrS
genotype: del ssrS
genotype: delta-cra Knock-out strain
genotype: delta-crp Knock-out strain
genotype: delta dicF, lacIq
genotype: delta-fis
genotype: deltahmp deltanrfA deltanorVW
genotype: {delta}hns
genotype: delta-hns
genotype: {delta}nusG
genotype: delta_ompR
genotype: delta-rac
genotype: delta_recG263::KanR lacZ::χχχ mhpR::χχχ proA::ISceIcs  tsx::ISceIcs  PBAD-sbcDC  lacZ+ cynX::GmR  lacIq  lacZχ-
genotype: delta_recG263::KanR lacZ::χχχ mhpR::χχχ proA::ISceIcs  tsx::ISceIcs  PBAD-sbcDC  lacZ:: pal246 cynX::GmR  lacIq  lacZχ-
genotype: {delta}rho
genotype: DH1 ΔhisC::cat ΔintC::Ptrc-rfp-tetR-zeocinr ΔgalK::PtetA-gfp-hisC-kanr
genotype: DH1 ΔhisC::cat ΔintC::Ptrc-rfp-tetR-zeocinr ΔgalK::PtetA-gfp-kanr
genotype: dnaC2
genotype: dnaC2, pMQ430
Genotype: E. coli K12
genotype: E. coli [supE44 hsdS20(rB-mB-) recA13 ara-14 proA2 lacY1 galK2 rpsL20 xyl-5 mtl-1]
genotype: ethanol-tolerant mutant E1 of IrrE
genotype: EvgSc KO
genotype: EvgSc ompR KO
genotype: ∆fadE with overexpression of 'tesA and MlfabH via an IPTG-inudcible promoter
genotype: ∆fadE with overexpression of 'tesA via an IPTG-inudcible promoter
genotype: fis::3xFLAG
genotype: fis mutant background
genotype: F- lambda- ilvG- rfb-50 rph-1
genotype: F- lambda- ilvG- rfb-50 rph-1 [delta]fis::frt-kan-frt
genotype: F- lambda- ilvG- rfb-50 rph-1 [delta]hns::frt- kan -frt
genotype: F- lambda- ilvG- rfb-50 rph-1 [delta]matP::frt-cam-frt
genotype: F- lambda- ilvG- rfb-50 rph-1 [delta]mukB::frt- kan
genotype: F- lambda- ilvG- rfb-50 rph-1 [delta]zapB::frt-kan-frt
genotype: F- lambda- ilvG- rfb-50 rph-1 matP[delta]C20::frt-cam-frt
genotype: F- lambda- ilvG- rfb-50 rph-1 phi80+ [delta]hupA::frt- kan -frt [delta]hupB::frt-cam-frt
genotype: F- lambda- ilvG- rfb-50 rph-1phi80+ [delta]mukB::frt- apra [delta]matP::frt-cam-frt
genotype: F-, lambda-, rph-1
Genotype: F- ompT hsdSB(rB-mB-) gal dcm (DE3)
genotype: furfural-tolerant mutant F1-37 of IrrE
genotype: Fusion of venus to the 3' end of rpoC in E. coli wild-type MG1655
genotype: gadE-8myc
genotype: gadW-8myc
genotype: gadX-8myc
genotype: Galaxy1-[CV104_pHDB3_5]
genotype: Galaxy2-[CV104_pLCV1_5]
genotype: Galaxy3-[CV104_pLCV1_10]
genotype: Galaxy4-[CV104_pHDB3_20]
genotype: Galaxy5-[CV104_pLCV1_20]
genotype: Galaxy6-[CV104_pHDB3_10]
genotype: GATC-cluster::hisA
genotype: GATC-cluster::srlA
genotype: GATC-cluster::ter
genotype: GATC-cluster::tnaA
genotype: gss mutant
genotype: hns::3xFLAG
genotype: lacZ::χχχ mhpR::χχχ proA::ISceIcs  tsx::ISceIcs  PBAD-sbcDC  lacZ+ cynX::GmR  lacIq  lacZχ-
genotype: lacZ::χχχ mhpR::χχχ proA::ISceIcs  tsx::ISceIcs  PBAD-sbcDC  lacZ:: pal246 cynX::GmR  lacIq  lacZχ-
genotype: Lrp-8myc
genotype: luxS
genotype: ∆mazEF
genotype: ∆mazEFlexA3
genotype: mfd-
genotype: Mfd++
genotype: MG1655
genotype: MG1655 DdksA
genotype: MG1655 del ssrS
genotype: MG1655 wild-type
genotype: mutant hhahha2
genotype: mutant hhs
genotype: mutant hns2
genotype: mutant hnshns2
genotype: n/a
genotype: ompR-8myc
genotype: ompR deletion mutant
genotype: ompR KO
genotype: Pck over-expressed
genotype: pHDB3
genotype: plasmid cured strain
genotype: pLCV1
genotype: PNPase mutant
genotype: PurR-8myc
genotype: RNase II mutant
genotype: RNase R mutant
genotype: rne-3071 (ts)
genotype: rne wild-type
genotype: rng mutant
genotype: rng wild-type
genotype: rpoC K370_A396dup mutant
genotype: rpoH-8myc
genotype: rpoN mutant (EcJR-8)
genotype: rpoS
genotype: rpoS mutant
genotype: SgrR
genotype: sgrS
genotype: TolC defective (TolC-)
genotype: triclosan tolerant mutant
genotype: TrpR-8myc
genotype: tynA-
genotype/varation: mutant
genotype/varation: wild-type
genotype/variaion: bla
genotype/variaion: lacZ
genotype/variaion: mMaple3
genotype/variaion: Mut
genotype/variaion: neo
genotype/variaion: phoA
genotype/variaion: WT
genotype/variaion: WTKas
genotype/variation: 42 deletions
genotype/variation: 42 deletions, ΔnusA*
genotype/variation: 42 deletions, ΔnusG
genotype/variation: 43 deletions, ΔnusA*
genotype/variation: 43 deletions, ΔnusG
genotype/variation: AB1157
genotype/variation: AB1157 deltamatP
genotype/variation: AB1157 matP-3xflag
genotype/variation: AB1157 mukB-3xflag
genotype/variation: AB1157 mukB-3xflag deltamatP
genotype/variation: AB1157 mukBDA-3xflag
genotype/variation: AB1157 mukBEQ-3xflag
genotype/variation: AB1157 mukBEQ-3xflag deltamatP
genotype/variation: Adaptive mutant
genotype/variation: adhE mutant
genotype/variation: AR1-/AR2-
genotype/variation: aspC knockout
genotype/variation: coding for QnrS1
genotype/variation: Combined input
genotype/variation: cpxA mutant
genotype/variation: cra-8myc-tagged
genotype/variation: cra KO; BW25113 Dcra
genotype/variation: cysA knockout
genotype/variation: cysG knockout
genotype/variation: cysH knockout
genotype/variation: cysQ mutant
genotype/variation: dcd knockout
genotype/variation: delta_cra
genotype/variation: {delta}cspABCEG
genotype/variation: {delta}cspABEG
genotype/variation: {delta}cspBG
genotype/variation: delta-gadE
genotype/variation: delta-gadW
genotype/variation: delta-gadX
genotype/variation: {delta}lacZ, {delta}tonB, {delta}feoA, {delta}zupT K12
genotype/variation: delta-oxyR
genotype/variation: {delta}perC::kanR, coisogenic to WT
genotype/variation: delta ptsN
genotype/variation: {delta}rnr
genotype/variation: delta-soxR
genotype/variation: delta-soxS
genotype/variation: {delta}tonB, {delta}feoA, {delta}zupT K12
genotype/variation: DH1DilvE::(dsred.T3-cat)
genotype/variation: DH1DleuB::(gfpuv5-Kmr)
genotype/variation: DH1 (GB:AP012030)
genotype/variation: dnaJ mutant
genotype/variation: DnaK deletant
genotype/variation: EDL 933
genotype/variation: empty vector (pCA24N)
genotype/variation: entF knockout
genotype/variation: expressing pFlagRhlBP238L
genotype/variation: expressing pFlagRhlBwt
genotype/variation: fadR knockout
genotype/variation: fepA knockout
genotype/variation: flhD
genotype/variation: fliY knockout
genotype/variation: fur-8myc
genotype/variation: fur-knockout mutant
genotype/variation: gabT knockout
genotype/variation: galE knockout
genotype/variation: galT mutant
genotype/variation: gcvT mutant
genotype/variation: harboring ArcA-8myc
genotype/variation: harboring Fnr-8myc
genotype/variation: hfq mutant
genotype/variation: Irp mutant
genotype/variation: K100Q
genotype/variation: K100R
genotype/variation: K-12 delta-rnr mutant (JW5741-1)
genotype/variation: K-12 wild type
genotype/variation: kefB knockout
genotype/variation: khc knockout
genotype/variation: lacA knockout
genotype/variation: lacking the small RNA RyhB
genotype/variation: lacking the transcription factor Fur
genotype/variation: lacking the transcription factor Fur and the small RNA RyhB
genotype/variation: lplA knockout
genotype/variation: LuxS mutant
genotype/variation: marR deletion and coding for QnrS1
genotype/variation: MC4100 ∆tig::kan pTig-TEV-Avi
genotype/variation: MG1655star
genotype/variation: mgtA knockout
genotype/variation: mhpD knockout
genotype/variation: mntR KO; BW25113 DmntR
genotype/variation: mqsR/pBS(Kan)-mqsR
genotype/variation: mqsR/pBS(Kan)-mqsR 2-1
genotype/variation: mutant M.HpyAVIB
genotype/variation: nac KO; BW25113 Dnac
genotype/variation: null polyphosphate metabolism
genotype/variation: overexpression of arT (pCA24N_arT)
genotype/variation: overexpression of dosP (pCA24N_dosP)
genotype/variation: overexpression of empty vector (pCA24N)
genotype/variation: oxyR-8myc-tagged
genotype/variation: PEN205
genotype/variation: pFlag-only control
genotype/variation: pgi mutant
genotype/variation: PhoB_FLAG
genotype/variation: PhoB knock-out
genotype/variation: polyphosphate accumulation
genotype/variation: polyphosphate depleted levels
genotype/variation: ppk knockout
genotype/variation: putP knockout
genotype/variation: rfbA knockout
genotype/variation: rnc- deletion mutant
genotype/variation: sdhA deletion mutant
genotype/variation: sdhC knockout
genotype/variation: Ser83Leu substitution in GyrA and coding for QnrS1
genotype/variation: soxR-8myc-tagged
genotype/variation: soxS-8myc-tagged
genotype/variation: trpD knockout
genotype/variation: ugpC knockout
genotype/variation: W3110 rpoC-6xHis::kan gal490
genotype/variation: W3110 rpoC-6xHis::kan greA::tet, greB::amp
genotype/variation: wild type
genotype/variation: wild-type
genotype/variation: Wild-type
genotype/variation: wild type (control)
genotype/variation: wild type; MG1655
genotype/variation: wild type M.HpyAVIB
genotype/variation: Wild type strain
genotype/variation: WT
genotype/variation: wzc knockout
genotype/variation: ydcR (b1439) MUTANT
genotype/variation: yghD knockout
genotype/variation: yjiR (b4340) MUTANT
genotype/variation: ΔarcA
genotype/variation: Δfnr
genotype/variation: Δfur
genotype/variation: Δhns
genotype/variation: ΔmqsRA
genotype/variation: Δrac
genotype/variation: Δrac ΔnusG
genotype/variation: σ70 mutation
genotype: wildtype
genotype: wild type
genotype: wild_type
genotype: wild-type
genotype: Wildtype
genotype: Wild-type
genotype: Wild Type
genotype: wild type IrrE
genotype: Wild-type strain
genotype: Wildtype with vector
genotype: wt
genotype: WT
genotype: yajL mutant
genotype: ybjN mutant
genotype: ybjN over-expression
genotype: ΔbolA
genotype: ΔrpoN
genotype: ΔrpoS
genotype: ΔseqA
genotype: Δ(yjjP-yjjQ-bglJ)
genotype: Δ(yjjP-yjjQ-bglJ) ΔleuO
genotype: Δ(yjjP-yjjQ-bglJ) ΔrcsB
genotyp/variation: deltacrp JW5702-4 background with a K100Q mutant of CRP (CRP Q) inserted into paaH gene locus
genotyp/variation: deltacrp JW5702-4 background with a K100R mutant of CRP (CRP R) inserted into paaH gene locus
genotyp/variation: deltacrp JW5702-4 background with a wild type CRP (CRP N) inserted into paaH gene locus
genotyp/variation: wild type
Genowiz 4.0.5.6 normalized, background subtracted data obtained from log2 of processed Red signal/processed Green signal. Agilent software was used.
genoype: dFNR
genoype: Wild-Type
Gentamicin-1, biological rep1
Gentamicin-2, biological rep2
Gentamicin-3, biological rep3
gentamycin concentration (ug/ml): 25
gentamycin concentration (ug/ml): 50
gentamycin concentration (ug/ml): 75
Germfree rat's caecum, biological rep1
Germfree rat's caecum, biological rep2
Germfree rat's caecum, biological rep3
get raw counts for reads mapped with htseq-count
GGG10, steady-state continuous cultured experimental samples at 37°C
GGG10, steady-state continuous cultured experimental samples at 37°C and then 15 minutes heatshock at 50 °C
GHA507
GLBRCE1_ACSH_Exp
GLBRCE1, ACSH, Exp
GLBRCE1_ACSH_Exp_rep318_1
GLBRCE1_ACSH_Exp_rep320_1
GLBRCE1_ACSH_Exp_rep327_1
GLBRCE1_ACSH_Stat
GLBRCE1, ACSH, Stat1
GLBRCE1_ACSH_Stat1_rep318_1
GLBRCE1_ACSH_Stat1_rep320_1
GLBRCE1_ACSH_Stat1_rep327_1
GLBRCE1, ACSH, Stat2
GLBRCE1_ACSH_Stat2_rep318_1
GLBRCE1_ACSH_Stat2_rep320_1
GLBRCE1_ACSH_Stat2_rep327_1
GLBRCE1_ACSH_Trans
GLBRCE1, ACSH, Trans
GLBRCE1_ACSH_Trans_rep318_1
GLBRCE1_ACSH_Trans_rep318_2
GLBRCE1_ACSH_Trans_rep320_1
GLBRCE1_ACSH_Trans_rep327_1
GLBRCE1_pBBR_ACSH_Exp
GLBRCE1_pBBR_ACSH_Stat
GLBRCE1_pBBR_ACSH_Trans
GLBRCE1, SynH, Exp
GLBRCE1_SynH_Exp_rep318_1
GLBRCE1_SynH_Exp_rep318_2
GLBRCE1_SynH_Exp_rep320_1
GLBRCE1_SynH_Exp_rep327_1
GLBRCE1, SynH_LT, Exp
GLBRCE1_SynH_LT_Exp_rep318_1
GLBRCE1_SynH_LT_Exp_rep320_1
GLBRCE1_SynH_LT_Exp_rep327_1
GLBRCE1, SynH_LT, Stat1
GLBRCE1_SynH_LT_Stat1_rep318_1
GLBRCE1_SynH_LT_Stat1_rep320_1
GLBRCE1_SynH_LT_Stat1_rep327_1
GLBRCE1, SynH_LT, Stat2
GLBRCE1_SynH_LT_Stat2_rep318_1
GLBRCE1_SynH_LT_Stat2_rep320_1
GLBRCE1_SynH_LT_Stat2_rep327_1
GLBRCE1, SynH_LT, Trans
GLBRCE1_SynH_LT_Trans_rep318_1
GLBRCE1_SynH_LT_Trans_rep320_1
GLBRCE1_SynH_LT_Trans_rep327_1
GLBRCE1, SynH, Stat1
GLBRCE1_SynH_Stat1_rep318_1
GLBRCE1_SynH_Stat1_rep320_1
GLBRCE1_SynH_Stat1_rep327_1
GLBRCE1, SynH, Stat2
GLBRCE1_SynH_Stat2_rep327_1
GLBRCE1, SynH, Trans
GLBRCE1_SynH_Trans_rep318_1
GLBRCE1_SynH_Trans_rep320_1
GLBRCE1_SynH_Trans_rep327_1
gluconate_growth: MURI_091
gluconate_growth: MURI_092
gluconate_growth: MURI_093
gluconate_growth: MURI_094
gluconate_growth: MURI_095
gluconate_growth: MURI_096
Glucose time course, 168 hour time point, biological replicate 1
Glucose time course, 168 hour time point, biological replicate 2
Glucose time course, 168 hour time point, biological replicate 3
Glucose time course, 168 hour time point, biological replicate 3, rRNA not depleted
Glucose time course, 24 hour time point, biological replicate 1
Glucose time course, 24 hour time point, biological replicate 2
Glucose time course, 24 hour time point, biological replicate 3
Glucose time course, 24 hour time point, biological replicate 3, rRNA not depleted
Glucose time course, 336 hour time point, biological replicate 1
Glucose time course, 336 hour time point, biological replicate 2
Glucose time course, 336 hour time point, biological replicate 3
Glucose time course, 336 hour time point, biological replicate 3, rRNA not depleted
Glucose time course, 3 hour time point, biological replicate 1
Glucose time course, 3 hour time point, biological replicate 2
Glucose time course, 3 hour time point, biological replicate 3
Glucose time course, 3 hour time point, biological replicate 3, rRNA not depleted
Glucose time course, 48 hour time point, biological replicate 1
Glucose time course, 48 hour time point, biological replicate 2
Glucose time course, 48 hour time point, biological replicate 3
Glucose time course, 48 hour time point, biological replicate 3, rRNA not depleted
Glucose time course, 4 hour time point, biological replicate 1
Glucose time course, 4 hour time point, biological replicate 2
Glucose time course, 4 hour time point, biological replicate 3
Glucose time course, 4 hour time point, biological replicate 3, rRNA not depleted
Glucose time course, 5 hour time point, biological replicate 1
Glucose time course, 5 hour time point, biological replicate 2
Glucose time course, 5 hour time point, biological replicate 3
Glucose time course, 5 hour time point, biological replicate 3, rRNA not depleted
Glucose time course, 6 hour time point, biological replicate 1
Glucose time course, 6 hour time point, biological replicate 2
Glucose time course, 6 hour time point, biological replicate 3
Glucose time course, 6 hour time point, biological replicate 3, rRNA not depleted
Glucose time course, 8 hour time point, biological replicate 1
Glucose time course, 8 hour time point, biological replicate 2
Glucose time course, 8 hourt ime point, biological replicate 3
Glucose time course, 8 hourt ime point, biological replicate 3, rRNA not depleted
glucose_time_course: MURI_016
glucose_time_course: MURI_017
glucose_time_course: MURI_018
glucose_time_course: MURI_019
glucose_time_course: MURI_020
glucose_time_course: MURI_021
glucose_time_course: MURI_022
glucose_time_course: MURI_023
glucose_time_course: MURI_024
glucose_time_course: MURI_025
glucose_time_course: MURI_026
glucose_time_course: MURI_027
glucose_time_course: MURI_028
glucose_time_course: MURI_029
glucose_time_course: MURI_030
glucose_time_course: MURI_031
glucose_time_course: MURI_032
glucose_time_course: MURI_033
glucose_time_course: MURI_097
glucose_time_course: MURI_098
glucose_time_course: MURI_099
glucose_time_course: MURI_100
glucose_time_course: MURI_101
glucose_time_course: MURI_102
glucose_time_course: MURI_103
glucose_time_course: MURI_104
glucose_time_course: MURI_105
Glutamate addition
Glutamine addition
Glycerol replicate 1
Glycerol replicate 2
Glycerol replicate 3
Glycerol stocks of E. coli K12 strain MG1655 were inoculated into LB media  grown at 37 ℃ with constant agitation overnight. Cultures were diluted 1:100 into fresh minimal medium and then cultured at 37 ℃ to mid-exponential phase (OD600 nm ~ 0.6).
glycerol_time_course: MURI_034
glycerol_time_course: MURI_035
glycerol_time_course: MURI_036
glycerol_time_course: MURI_037
glycerol_time_course: MURI_038
glycerol_time_course: MURI_039
glycerol_time_course: MURI_040
glycerol_time_course: MURI_041
glycerol_time_course: MURI_042
glycerol_time_course: MURI_043
glycerol_time_course: MURI_044
glycerol_time_course: MURI_045
glycerol_time_course: MURI_046
glycerol_time_course: MURI_047
glycerol_time_course: MURI_048
glycerol_time_course: MURI_049
glycerol_time_course: MURI_050
glycerol_time_course: MURI_052
glycerol_time_course: MURI_053
glycerol_time_course: MURI_054
glycerol_time_course: MURI_055
glycerol_time_course: MURI_056
glycerol_time_course: MURI_057
glycerol_time_course: MURI_058
glycerol_time_course: MURI_059
Glycine addition
go to the directory:
GPR files were analyzed further with Acuity 4.0 software (Molecular Devices, USA) starting with lowess normalization. Normalized log2 ratio data from biological replicates and technical replicates (dye swap) were averaged and the statistical significance (p-value) was calculated.
gpt_0_Hx Rep1
gpt_0_Hx Rep2
gpt_0_Hx Rep3
gpt_120 (Low Dilution) Rep1
gpt_120 (Low Dilution) Rep2
gpt_120 (Low Dilution) Rep3
gpt_15 (Low Dilution) Rep1
gpt_15 (Low Dilution) Rep2
gpt_15 (Low Dilution) Rep3
gpt_30 (Low Dilution) Rep1
gpt_30 (Low Dilution) Rep2
gpt_30 (Low Dilution) Rep3
gpt_45 (Low Dilution) Rep1
gpt_45 (Low Dilution) Rep2
gpt_45 (Low Dilution) Rep3
gpt_60 (Low Dilution) Rep1
gpt_60 (Low Dilution) Rep2
gpt_60 (Low Dilution) Rep3
gpt strain with hypoxanthine
gpt strain w/o hypoxanthine 120 min at low dilution protocol
gpt strain w/o hypoxanthine 15 min at low dilution protocol
gpt strain w/o hypoxanthine 30 min at low dilution protocol
gpt strain w/o hypoxanthine 45 min at low dilution protocol
gpt strain w/o hypoxanthine 60 min at low dilution protocol
gram status: Gram-negative
graphics.off()
group (hus/non-hus): HUS
group (hus/non-hus): Non-HUS
Grow bacteria overnight in LB medium, reinoculate in M9 minimal medium at an initial OD600 of 0.005. After eight hours growth at 34°C in M9 medium, 2 mL of RNA Protect Reagent (Qiagen) was added to 1 ml bacterial cultures (at OD600 of about 0.5-0.8) to stabilize RNA. Centrifuge for 10 min at 4000 g. Decant the supernatant.
growing condition: M9 minimal medium
Growing  t=1 hour
Grown in Davis's Mineral Salts medium (Gibco BRL Life Technologies Inc.) with 0.1% D-glucose at 25 C (100 r.p.m. shaking) until an OD (550 nm) of 0.6.
Grown in glucose M9 media supplemented with 0.55 M NaCl
Grown in glucose M9 media with or without supplementation of 0.6 M NaCl
grown to OD600=1.0 in DMEM
grown to OD600=1.0 in DMEM with 50 uM epinephrine
grown to OD600=1.0 in DMEM with AI3
grown to OD600=1.0 in DMEM with AI3 signaling molecule
grown to OD600=1.0 in DMEM with Epinephrine
grown to OD600=1.0 in LB
Growth: Anaerobic to early exponential growth
growth condition: 16 µM IPTG
growth condition: 25 μl into K-medium
growth condition: 4 µM IPTG
growth condition: 50 µl into K-medium + 0.3M NaCl
growth condition: 75 µl into K-medium + 0.6M urea
growth condition: 8 µM IPTG
growth condition: Adenine
growth condition: Aerobic
growth condition: Aerobic Cultures
growth condition: anaerobic
growth condition: Anaerobic
growth condition: Anaerobic Cultures
growth condition: early-exponential
growth condition: Exponential + O2
growth condition: glucose
growth condition: Inside Acanthamoeba
growth condition: LB at 30°C
growth condition: LB at 37°C
growth condition: LB broth alone (control)
growth condition: LB broth supplemented with cranberry PACs (100 µg/mL)
growth condition: mid-exponential
growth condition: MM + 0.12% casaminoacids +0.4% glucose at 22°C
growth condition: MM + 0.12% casaminoacids +0.4% glucose at 30°C
growth condition: normal condtion (5% w/v glucose)
growth condition: osmotic stress condtion (12% w/v glucose)
growth condition: Outside Control
Growth conditions: aaerobic
Growth conditions: aerobic
Growth conditions: anaerobic
Growth conditions: anaerobic plus NO2
Growth conditions: anaerobic plus NO3
growth conditions: LB growth OD 0,3
growth conditions: LB growth OD 0,5
growth conditions: Minimal Medium A  supplemented with casaminoacids (0,1%) and succinate (0,2%),  OD 0,2 at 40°C
growth condition: Static + O2
growth condition: stationary
growth condition: steady-state continuous cultivation (dilution rate of 0.4 h-1), aerobic
growth condition: transition-to-stationary
Growth curves of all selected evolved colony types and the ancestor were obtained by growing them under their evolved environmental conditions in LB medium until Log-phase. For this, optical density was recorded at 600nm at a value of 0.6 to 0.7.
grow | The E. coli K-12 MG1655 bacterial strains used in this work are the following: E. coli MG1655 (F- lambda- ilvG- rfb-50 rph-1); MG1655 hns (hns::Kanr); MG1655 fis (fis::Kanr); MG1655 hns-FLAG (hns::3xFLAG::Kanr); MG1655 fis-FLAG (fis::3xFLAG::Kanr). Luria-Bertani (0.5% NaCl) broth and agar (15 g/liter) were used for routine growth. Where needed, ampicillin, kanamycin, and chloramphenicol were used at final concentrations of 100, 30, and 30 ug/ml respectively.
growth environment: Aerobic
growth environment: Anaerobic
growth media: DMEM growth media
growth media: LB
growth media: LB; 0.8% bile salts
growth media: LB medium
growth medium: Combined input
growth medium: LB+glycerol medium
growth medium: LB medium
growth medium: liquid culture
Growth medium: MOPS minimal, 0.4% glucose, 0.5% casamino acids
growth medium: MOPS minimal glucose media containing 10 µM FeSO4
growth medium: MOPS minimal glucose media containing 1 µM FeSO4
growth mode: planktonic culture in annular reactor
growth phase: 30 min post stationary
growth phase: Early exponential
growth phase: Early Exponential
growth phase: Exp
growth phase: Exp1
growth phase: Exp2
growth phase: Exp3
growth phase: exponential
growth phase: Exponential
Growth phase: exponential
growth phase: exponential growth phase
growth phase: Exponential Phase
growth phase: Late exponential/Early stationary (OD ~1.8)
growth phase: late_stationary
growth phase: Late Stationary
growth phase: logarithmic growth
growth phase: log phase
growth phase: Log phase OD 0.4
growth phase: Mid exponential
growth phase: Mid-Exponential
growth phase: mid-log
growth phase: mid-log phase
growth phase: mid-log phase (OD600 = 0.3)
Growth phase: OD600=0.3
growth phase: Stat
growth phase: stat 1
growth phase: Stat1
growth phase: stat 2
growth phase: Stat2
growth phase: stationary
growth phase: Stationary
growth phase: stationary growth phase
growth phase: Stationary phase
growth phase: stationary phase (grown to an OD600nm of 0.9)
growth phase: Trans
growth phase: transition
growth phase: transition growth phase
growth phase: Transition to Stationary
growth protocol: Bacteria liquid culture
growth protocol: biofilm grown on glass wool, 37C
growth protocol: control
growth protocol: Controls grown to an optimal temperature of 37°C
growth protocol: grown in LB+glycerol to 0.8OD
growth protocol: grown in LB to 0.8OD
growth protocol: heat shock
growth protocol: in the caecal content of rats associated with the human microbiota
growth protocol: logarithmic phase in DMEM-MOPS
growth protocol: Log-phase culture (LB broth, Miller formulation) inoculated with one blue colony and grown for 5 hr at 37 degrees celsius
growth protocol: Log-phase culture (LB broth, Miller formulation) inoculated with one pale colony and grown for 5 hr at 37 degrees celsius
growth protocol: steady growth
growth protocol: transition phase in DMEM-MOPS
growth protocol: Treatment 1 (58°C F = 2)
growth protocol: Treatment 2 (58°C F = 3)
growth protocol: Treatment 3 (60°C F = 3)
growth protocol: Treatment 4 (core temperature of 71°C)
growth stage: log phase
growth stage: log-phase
growth stage: mid exponetial phase
growth stage: mid-log phase
growth temperature: 22°C
growth temperature: 30C
growth temperature: 37°C
growth time: 7-day
growth time (hours): 10
growth time (hours): 14
growth time (hours): 168
growth time (hours): 24
growth time (hours): 26
growth time (hours): 27
growth time (hours): 28
growth time (hours): 29
growth time (hours): 3
growth time (hours): 336
growth time (hours): 4
growth time (hours): 48
growth time (hours): 5
growth time (hours): 5.5
growth time (hours): 6
growth time (hours): 6.5
growth time (hours): 7
growth time (hours): 8
growth time (hours): 9
growth type: amino acid starvation
growth type: log phase
GSH-sepharose 4b purification
gss-1
gss-2
gss-3
GST control Protoarray replicate 1
Guanosine addition
gut origin: Human colon
gyrase binding (ChIP-chip) no. 1
gyrase binding (ChIP-chip) no. 2
gyrase binding (ChIP-chip) no. 3
gyrase binding (ChIP-chip) no. 4
gyrase binding (ChIP-chip) no. 5
gyrase binding (ChIP-chip) no. 6
gyrase binding (ChIP-chip) no. 7
gyrase binding (ChIP-chip) no. 8
Gyrase Cleavage Sites (GCSs) were called using custom script (GCSs_calling.py, github: https://github.com/sutormin94/Gyrase_Topo-seq) that takes 4 files (tetrade) as input: +A+IP, +A-IP, -A+IP, -A-IP
gyrA__U_N0075_r1
gyrA__U_N0075_r2
gyrA__U_N0075_r3
gyrA upregulation, 0.075 mg/mL norfloxacin
gyrI__U_N0075_r1
gyrI__U_N0075_r2
gyrI__U_N0075_r3
gyrI upregulation, 0.075 mg/mL norfloxacin
H2O2
H500_1
Harvested by chloramphenicol pre-treatment and centrifugation; DSP treated ex vivo; Affinity purified TF crosslinked RNC footprints
Harvested by chloramphenicol pre-treatment and centrifugation; DSP treated ex vivo; Total footprints
Harvested by rapid filtration; DSP treated ex vivo; Affinity purified TF crosslinked RNC footprints
Harvested by rapid filtration; DSP treated ex vivo; Total footprints
Harvested by rapid filtration; EDC treated ex vivo; Affinity purified TF crosslinked RNC footprints
Harvested by rapid filtration; EDC treated ex vivo; Total footprints
Harvested cells (4 × 6 ml) were immediately combined with 6 ml RNAlater (Life Technologies, Grand Island, NY, USA), centrifuged for 15 min at 12 000 r.p.m., washed with 1 ml RNAlater (3 min at 15 000 r.p.m.), re-suspended in 0.5 ml RNAlater and stored at −20 °C. For RNA extraction the RiboPure-Bacteria Kit (Life Technologies) was used according to the manufacturer’s instructions. To achieve high RNA yields several reactions for each sample were done in parallel and pooled at the end of the procedure. An additional DNase treatment step with TURBO DNase (Life Technologies) was included to assure no genomic DNA contamination. Messenger RNA was enriched using the RiboMinus Bacteria Kit (Life Technologies) according to the manufacturer’s instructions.
HB101, biological rep2
HB101, biological rep3
HB101, exposed to C. elegans and Giardia, biological rep1
HB101, exposed to C. elegans and Giardia, biological rep2
HB101, exposed to C. elegans and Giardia, biological rep3
HB101, exposed to C. elegans, biological rep1
HB101, exposed to C. elegans, biological rep2
HB101, exposed to C. elegans, biological rep3
HB101, exposed to Giardia, biological rep1
HB101, exposed to Giardia, biological rep2
HB101, exposed to Giardia, biological rep3
HCl replicate 1
HCl replicate 3
heat sensitivity: resistant
heat sensitivity: sensitive
heat shock response in the minimal medium
heat shock time: 0min
heat shock time: 10min
heat shock time: 20min
heat shock time: None
HEK293T/17 cells (ATCC CRL-11268) were cultured in DMEM (Mediatech) supplemented with 10% FBS and L-glutamine/penicillin/streptomycin.
hfq-gln-1
hfq-gln-2
hfq mutant in Ala media
hfq mutant in Gln media
Hfq mut exp mRNA
Hfq mut exp RPF
Hfq- RpoE overexpression (20 min)
hfq+ Wild type control (20 min)
Hfr-2xSFX-
High succinic acid tolerance E.coli_rep Dn
High succinic acid tolerance E.coli_rep Up
HisC rewired strain exponentially grown in the absence of histidine
HisC rewired strain exponentially grown in the presence of histidine (1 mM)
Hiseq 2500 Illumina short reads (50 bp) were mapped back to the Caulobacter NA1000 reference genome (NCBI Reference Sequence: NC-011916.1) using Bowtie 1 (Langmead et al., 2009) and the following command: bowtie -m 1 -n 1 --best --strata -p 4 --chunkmbs 512 NA1000-bowtie --sam *.fastq > output.sam. Subsequently, the sequencing coverage for each nucleotide position was computed using BEDTools (Quinlan & Hall, 2010) and the following command: bedtools genomecov -d -ibam output.sorted.bam -g NA1000.fna > coverage_output.txt. Finally, the ratio between the number of reads of libraries generated from pMCS1-Tn5-ME-R6Kγ-kanR-ME or pMCS1-Tn5-ME-R6Kγ-kanR-parS456-ME were calculated. Results were binned over 1 kb and represented as a log10 scale.
His-tagged DNA extracted from biofilm cells of E. coli K-12 wild type BW25113/pCA24N (empty vector) after 24 hours of growth in LB with glasswool at 37oC under 2 mM IPTG
His-tagged DNA extracted from biofilm cells of E. coli K-12 wild type BW25113/pCA24N-mqsR after 24 hours of growth in LB with glasswool at 37oC under 2 mM IPTG
His-tagged DNA extracted from planktonic cells of E. coli K-12 wild type BW25113//pBAD-Myc-His C (empty vector) after 24 hours of growth in LB at 37oC with induction of 0.5% L-arabinose suspension cell
His-tagged DNA extracted from planktonic cells of E. coli K-12 wild type BW25113/pBAD-Myc-His C-mqsA after 24 hours of growth in LB at 37oC with induction of 0.5% L-arabinose suspension cell
Histidine addition
hlpA__U_N0075_r1
hlpA__U_N0075_r2
hlpA__U_N0075_r3
hlpA upregulation, 0.075 mg/mL norfloxacin
HNCE3 is an isogenic mutant derived from hyper-resistant AG102 (marR1).  It contains a nonpolar mutation at the acrA locus which allows read-through for acrB expression and results in a multidrug efflux negative phenotype.
HNCE4 is an isogenic mutant derived from drug sensitive AG102MB (marR1, AcrB::kan). It contains an additional mutation at the emrAB locus (marR1, acrB::kan, emrAB::cat) resulting in a multidrug efflux negative phenotype.
hns_1
Hns – 120 min
Hns -180 min
hns_2
Hns – 420 min
Hns – 60 min
HNS - Aerobic A
HNS - Aerobic B
HNS - Anaerobic A
HNS - Anaerobic B
H-NS ChIP DNA from MG1655 cells
HNS ChIP DNA from WT Escherichia coli MG1655 K-12
HNS ChIP DNA from WT Escherichia coli MG1655 K-12 Replicate B
H-NS, EE
H-NS flag tagged cells with bcm treatment
H-NS flag tagged cells without bcm treatment
H-NS, ME
H-NS, S
H-NS, TS
holD__U_N0075_r1
holD__U_N0075_r2
holD__U_N0075_r3
holD upregulation, 0.075 mg/mL norfloxacin
Hot phenol extraction of total RNA.
Hot phenol RNA extraction as described in Aiba, Adhya and Crombrugge. J. Bio Chem. 1981, 256: p11905-11910
Hot phenol RNA extraction as described in Aiba. Adhya and Crombrugghe. J. Bio Chem. 1981, 256: p. 11905-11910.
Hot phenol (Sharma et al. 2010, Bloomberg 1990, EMBO J)
HP1
HP2
HP3
HP4
HS15min_r1_HiSeq
HS15min_r2_HiSeq
HS15min_r3_GAII
HS30min_r1_HiSeq
HS30min_r2_HiSeq
HS60min_r1_HiSeq
HS60min_r2_HiSeq
hscA__U_N0075_r1
hscA__U_N0075_r2
hscA__U_N0075_r3
hscA upregulation, 0.075 mg/mL norfloxacin
HT873-Con1
HT873-Con2
HT873-Con3
HT873-PA1
HT873-PA2
HT873-PA3
HT875-Con1
HT875-Con2
HT875-Con3
HT875-PA1
HT875-PA2
HT875-PA3
HTseq-derived raw count data were used as input after a non-specific filtering step that removed residual rRNAs and tRNAs  and low coverage genes with fewer than 2 counts per million (16-20 reads) in more than 25% of the dataset.
HTSeq is used to generate expression count for each gene.
(http://david.abcc.ncifcrf.gov/home.jsp)
Human
Human III versus MG1655 technical replicate 1
Human III versus MG1655 technical replicate 2
Human II versus MG1655 technical replicate 1
Human II versus MG1655 technical replicate 2
Human intestinal microbiota associated rat's caecum, biological rep1
Human intestinal microbiota associated rat's caecum, biological rep2
Human intestinal microbiota associated rat's caecum, biological rep3
Human I versus MG1655 technical replicate 1
Human I versus MG1655 technical replicate 2
Human sewage isolate H1
Human sewage isolate H2
Human sewage isolate H3
hybridization buffer (formamide content): 0% formamide
hybridization buffer (formamide content): 10% formamide
hybridization buffer (formamide content): 15% formamide
hybridization buffer (formamide content): 20% formamide
hybridization buffer (formamide content): 25% formamide
hybridization buffer (formamide content): 32.5% formamide
hybridization buffer (formamide content): 45% formamide
hybridization buffer (formamide content): 5% formamide
hybridization buffer (total rna): 50 ng
hybridization buffer (total rna): 5 ng
Hydrocortisone Treatment
IA-co1
IA-co2
IAI1 batch
IAI1 chemostat
IAI1 starvation
IAI1 transcriptome from batch growth_1
IAI1 transcriptome from batch growth_2
IAI1 transcriptome from chemostat growth_1
IAI1 transcriptome from chemostat growth_2
IAI1 transcriptome from starvation growth_1
IAI1 transcriptome from starvation growth_2
IA-log
IA-starve
Identical to Channel 1 with no arabinose added
IE-co1
IE-co2
IE-log
IE-starve
IFNB Multi SeV0 Rep1 Plasmid
IFNB Multi SeV10 Rep1 Plasmid
IFNB Single SeV10 Rep1 Plasmid
IHF - Anaerobic A
IHF - Anaerobic B
IHF ChIP DNA from WT Escherichia coli MG1655 K-12
IHF ChIP DNA from WT Escherichia coli MG1655 K-12 Replicate B
IHF___U_N0075_r1
IHF___U_N0075_r3
IHF upregulation, 0.075 mg/mL norfloxacin
ik_H2_T2.5_r1
ik_H2_T3.5_r1
ik_H2_T3_r1
ik_H2_T4.5_r1
ik_H2_T4_r1
ik_H2_T5.5_r1
ik_H2_T5_r1
ik_H2_T6_r1
ik_H2_T8_r1
ik_L2_T2.5_r1
ik_L2_T3.5_r1
ik_L2_T3_r1
ik_L2_T4.5_r1
ik_L2_T4_r1
ik_L2_T5.5_r1
ik_L2_T5_r1
ik_L2_T6_r1
ik_L2_T8_r1
Illumina Casava1.7 software used for basecalling.
Illumina Casava 1.8.2 software used for basecalling with default parameter.
Illumina Casava 1.8 software was used for basecalling.
Illumina Casava software used for basecalling.
Illumina Casava v1.8 used for basecalling.
Illumina fastq files were submitted to the galaxy pipeline => grooming => mapping to NC_002655 using bowtie2 (default but seed 19 nt & zero mismatches within seed)
Illumina GAII reads were filtered by SGA version 0.9.9 with the following options: sga preprocess -q 10 -f 10 -m 25 (quality trim 10, quality filter 10, minimal length 25)
Illumina read were aligned to NC_000913 using Bowtie 1 with 2 mismatches allowed per read alignment
Illumina Ribozero rRNA removal followed by NEB Next RNA library Prep set.
Illumina sequencing instruments generate per-cycle BCL base call files as primary sequencing output in bcl2 format. Conversion of the bcl2 file to gzipped fastq files was performed using the bcl2fastq script v. 2.18.0.12 provided by Illumina.
Image analysis was performed with GenePix Pro 7 software (Molecular Device), background was defined with the “Local features background median” method. Quantile normalization was applied on the total number of spots in R (version 2.11.1) with the LIMMA software package. Spots corresponding to the E. coli MG1655 K12 species were extracted.
Images Analysis using Agilent Feature Extraction Software Version 11.5 to obtain raw data.Probe intensities generated from feature extraction raw data were split based on channel type and  analysis was performed.
Images were analyzed using a combination of GenePix Pro 6.0, the freely available TIGR TM4 software suite (www.tm4.org ) and Microsoft Excel.  Spots with an intensity: background ratio > 1.5 and overall intensity > 350 in the reference channel and an intensity:background ratio of > 1.0 in the experimental channel were considered acceptable for downstream processing.  Local background was subtracted for each spot, the corresponding log2 ratios were normalized using total intensity normalization, and replicate spots were averaged using TIGR MIDAS.  Genes that had missing data (i.e. unacceptable spots) for more than one-third of the samples were excluded from the downstream analysis leaving 3993 ORFs in the final data set.  Each sample was hybridized twice and the results averaged in Microsoft Excel after processing with MIDAS.  A strict cutoff of log2 ratio > 0.9 or < 0.9 was applied for the determination of gene amplifications and gene absences, respectively.
Images were quantified and normalized using extraction protocol GE2_107_Sept09 and Agilent Feature Extraction Software (version 10.7.3.1).
Images were quantified using Agilent Feature Extraction Software (10.5.1.1) and obtained background subtracted and spatially detrended Processed Signal intensities.
Images were quantified using Agilent Feature Extraction Software (version 9.5.1.1 & 10.5.1.1) and obtained background subtracted and spatially detrended Processed Signal intensities.
Images were quantified using Feature Extraction Software ( Agilent). Feature extracted raw data was analyzed using GeneSpring GX Version  software from Agilent. Normalization of the data was done in GeneSpring GX using the 75th percentile shift
Images were quantified using GenePix Pro software
Image was analized with Genepix 6 pro followed by background substration and global LOWESS normalization in R environment (KTH package). Spots with signal to noise ratio lower that 3 and/or relative standard deviation between parallel spots greater than 20% were removed.
Immediately after turning off oxygen
Immunoprecipitated DNA
imp mutation: contains a 23 codon deletion allele in imp (increased membrane permeability),substitution of the 93th codon of fabI, NTG treatment; fabI(G93V), substitution of Gly(the 93th codon) of fabI with Val, NTG treatment to be high resistance to triclosan
imp mutation: contains a 23 codon deletion allele in imp (increased membrane permeability),substitution of the 94th codon of fabI, NTG treatment; fabI(G93V), substitution of Gly(the 94th codon) of fabI with Val, NTG treatment to be high resistance to triclosan
imp mutation: contains a 23 codon detion allele in imp (increased membrane permeability),substitution of the 93th codon of fabI; fabI(G93V), substitution of Gly(the 93th codon) of fabI with Val
imp mutation: contains a 23 codon detion allele in imp (increased membrane permeability),substitution of the 94th codon of fabI; fabI(G93V), substitution of Gly(the 94th codon) of fabI with Val
incubated with: Drosophila immune proteins
incubated with: GST alone (3 μM; control)
Incubation and RNA harvesting were carried out for all samples simultaneously and under RNase-free conditions to minimize biological variability in gene expression between each sample. Bacterial concentrations were equalized to the same density (by OD600).
incubation condition: In the dark, 5h, 20°C, 150 rpm
incubation duration: 10 min
incubation medium: 10 mM NaCl
incubation medium: 10 mM NaCl + 100mg/l TiO2 nanoparticles
Incubation temperature = 37C
incubation time: 0 min
incubation time: 10 min
incubation time: 5 hr
incubation time: n/a
Index and sort alignments with samtools version 1.2
Index sequences accompanying with reads were compared with pre-designed barcodes, allowing two base mismatches at most.
Indices corresponding to the same sample were merged, and then uploaded to a cloud-based variant of Galaxy named RNA23 Rocket
individual: CF patient
Individual clones of E. coli DH1 were grown in M9 MOPS media in 300 mL media in 1 L baffled flasks
Individual colonies were inoculated into MOPS EZ Rich Defined Medium (Teknova, CA, M2105) with 0.2% glycerol carbon source and 50 μg/mL kanamycin (Gold Biotechnology, MO, K-120-5) and grown overnight for 16 hours at 37 °C and 1000 RPM in V-bottom 96-well plates (Nunc, Roskilde, Denmark, 249952) in an ELMI Digital Thermos Microplates shaker incubator (Elmi Ltd, Riga, Latvia). The following day, cultures were diluted 178-fold (two serial dilutions of 15 µL into 185 µL) into EZ Rich glycerol with kanamycin, and grown under the same ELMI shaker incubator conditions for three hours. Cells were diluted 658-fold (4.56 µL into 3 mL) into culture tubes (Falcon 14 mL round-bottom polypropylene tubes; Corning, MA, 352059) containing EZ Rich glycerol with kanamycin and inducers. For Erlenmeyer flask assays (Pyrex 250 mL; Cole-Palmer, IL, 4980-250), cells were diluted 658-fold (76 µL into 50 mL) into EZ Rich glycerol with kanamycin and inducers. Eight inducer combinations were used that cover the presence or absence of 0.5 mM IPTG, 10 ng/mL aTc, and 5 mM L-arabinose. Culture tubes were then grown in an Innova 44 shaker (Eppendorf, CT) at 37 °C and 250 rpm for five hours.
Individual colonies were inoculated into MOPS EZ Rich Defined Medium (Teknova, CA, M2105) with 0.2% glycerol carbon source and 50 μg/mL kanamycin (Gold Biotechnology, MO, K-120-5) and grown overnight for 16 hours at 37 °C and 1000 RPM in V-bottom 96-well plates (Nunc, Roskilde, Denmark, 249952) in an ELMI Digital Thermos Microplates shaker incubator (Elmi Ltd, Riga, Latvia). The following day, cultures were diluted 178-fold (two serial dilutions of 15 µL into 185 µL) into EZ Rich glycerol with kanamycin, and grown under the same ELMI shaker incubator conditions for three hours. For culture tube assays (Falcon 14 mL round-bottom polypropylene tubes; Corning, MA, 352059), cells were diluted 658-fold (4.56 µL into 3 mL) into EZ Rich glycerol with kanamycin and inducers. For Erlenmeyer flask assays (Pyrex 250 mL; Cole-Palmer, IL, 4980-250), cells were diluted 658-fold (76 µL into 50 mL) into EZ Rich glycerol with kanamycin and inducers. Eight inducer combinations were used that cover the presence or absence of 0.5 mM IPTG, 10 ng/mL aTc, and 5 mM L-arabinose. Culture tubes and Erlenmeyer flasks were then grown in an Innova 44 shaker (Eppendorf, CT) at 37 °C and 250 rpm for five hours.
individual: healthy child
Indole treated at specific growth rate 0.5h-1 0h
Indole treated at specific growth rate 0.5h-1 10h
Indole treated at specific growth rate 0.5h-1 16h
Indole treated at specific growth rate 0.5h-1 5h
Indole treated at specific growth rate 0.5h-1 8h
Induced from E. coli strain 3538 with mitomycin C
induced/non-induced: Induced
induced/non-induced: Non-induced
induction: 0.2% arabinose
induction: induced 50 µM IPTG
induction: None
Infected kidney solutions were centrifuged at 5000xg for 10 min to separate bacteria (pellet) from kidney (surface of RNA-later solution) cells.  The kidney cells were evacuated from the top of the solution, and the remaining solution was spun once more at 12000xg for 10 min, followed by disposal of the supernatant.  Pelleted cells were resuspended in TE buffer and treated with lysozyme (Sigma) at 1mg/ml final concentration for 5 min, and samples of 3-5 infected mice were pooled together for each infection group.  Nucleic acids were extracted via the RNA extraction protocol and products of the RNAeasy kit (Qiagen).  Following column purification, RNA samples were treated with DNAse Turbo (Ambion) for 30 min at 37C, followed by quantification of RNA using a spectrophotometer.  Remaining polyadenylated eukaryotic RNA was depleted from the samples following the MicroEnrich (Ambion) protocol and resuspended in 20l of TE buffer.  RNA was quantified spectrophotometrically and equal amounts (~300-500ng) of KMD and PC1012 RNA samples were subjected to the MessageAmp (Ambion) RNA amplification protocol.  Resultant amplified RNA was quantified and equal amounts were used in the Affymetrix protocol for prokaryotic cDNA synthesis and biotin labeling.
infection: T7
infinity. These values were eliminated using the find, imag, and isfinite functions in Matlab.
inhibitor: 20uM ME0052
inhibitor: 20uM ME0053
inhibitor: 20uM ME0054
inhibitor: 20uM ME0055
Initial data analysis was performed using the GeneChip® Operating Software. Microarray quality control parameters were as follow: noise (RawQ) less than 5, background signal less than 40 (100 target intensity for array scaling), consistent numbers of genes detected as present across arrays.
in Microsoft Excel, containing the following information for each of the 14,352 entries: block
In order to distinguish between 3’ ends of transient products of RNA metabolism and stable 3’ ends, we developed an algorithm to call coverage peaks. The algorithm will be discussed in detail in an upcoming manuscript, and the scripts used are available upon request from the authors. In short, positions in the E. coli genome were considered in descending order of coverage and assigned a p-value based on a Poisson distribution parameterized by the mean coverage of all covered bases in the genome. Peaks were rejected if their p-values exceeded 1e-4 or if there existed a >10-bp window containing the peak in which all positions were within 2-fold coverage of the peak position. Parameters were chosen based on analysis of annotated 3’ ends as well as qualitative analysis of peaks. This resulted in 20,019 peaks.
In order to generate the VBNC state in E. coli O157:H7, 20 mL of the exponential-phase cell suspensions in a 50 mL sterile glass tube was treated by HPCD at 5 MPa and 25℃ for 40 min.
INPUT ChIP DNA from ∆hns/∆stpA, no antibody control
INPUT ChIP DNA from PK9416, no ArcA control
INPUT ChIP DNA from WT Escherchia coli MG1655 K-12, no antibody control
INPUT ChIP DNA from WT Escherchia coli MG1655 K-12, no antibody control, Replicate B
INPUT ChIP DNA from WTPK4854, no antibody control
Input ChIP-Seq
INPUT_ChIP-seq_Aerobic_WIG.wig: U00096.2
INPUT_ChIP-seq_Anaerobic_WIG.wig: U00096.2
input DNA
INPUT DNA B
Input DNA from DdksA cells
Input DNA from E. Coli MG1655
Input DNA from E. Coli MG1655 ΔseqA
Input DNA from heat-shocked condition without rifampicin treatment
Input DNA from MDS42 cells
Input DNA from MDS42 ΔnusA* cells
Input DNA from MDS42 ΔnusG cells
Input DNA from MG1655 cells
Input DNA from MG1655 Δhns cells
Input DNA from mid-exponential condition without rifampicin treatment
Input DNA from mid-exponential condition with rifampicin treatment
Input DNA from nitrogen-limiting condition without rifampicin treatment
Input DNA from SeqA ChIP supernatant
Input DNA from starved DdksA cells
Input DNA from starved wt cells
Input DNA from stationary condition without rifampicin treatment
Input DNA from wt cells
Input DNA from ΔseqA-SeqA ChIP supernatant
Input DNA from σ32 ChIP supernatant
Input ∆fur Anaerobic
Input_hns-F_bcm-#1
Input_hns-F_bcm+#1
Input_hns-F_bcm-#2
Input_hns-F_bcm+#2
Input ParC-flag 1
Input ParE-flag 1
Input ParE-flag 2
Input ParE-flag G1
Input ParE-flag G2
Input ParE-flag S20min
Input ParE-flag S40min
input signal frequency: 1/1200 Hz
input signal frequency: 1/2400 Hz
input signal frequency: 1/3600 Hz
input signal frequency: 1/600 Hz
input signal frequency: 1/900 Hz
intensities, respectively. In some cases, when the intensity of the background was higher
Intensity measures in wild type strain, replicate 1
Intensity measures in wild type strain, replicate 2
Intensity measures in yajL mutant strain, replicate 1
Intensity measures in yajL mutant strain, replicate 2
In the 15 ml centrifuge tube (Corning, 430791), the overnight culture was diluted to 2ml in fresh LB medium containing Ampicillin (50 ng/μl), Chloramphenicol (170 ng/μl) and IPTG (0.5mM) to reach OD600 = 0.01. The LED tube was screwed into the centrifuge tube and connected with the control box. Then the power of the control box was turned on and the LED frequency input was generated. At last, the 15 ml centrifuge tube with LED tube was put into the Thermomixer comfort (Eppendorf) and shaken at 650 rpm and 37°C for 10 hours.
In vitro RNA preparation: The 5.7 kb RNA was purified from the digested DNA, NTPs, abortive oligo-RNA products, and proteins by Acidic phenol extraction, G50 spin column, followed by EtOH precipitation.
In vitro transcription reactions were performed in a final volume of 50 µl. Each reaction contained 2 µl E. coli RNA Polymerase Holoenzyme (NEB, cat. M0551S), 5 µl E. coli RNA Polymerase Buffer (10X), 1 µl SUPERase• In™ RNase Inhibitor (Ambion, cat. AM2696), and 500 ng template DNA. Reactions were incubated at 37°C for 5 minutes to allow formation of the RNA Polymerase-DNA binary complex. Transcription was started by addition of 1 µl NTPs (25 mM each), and incubated at 37°C for 5 minutes. Transcription was stopped by addition of 1 µl DNase I (50 U/µl) and Actinomycin D (Sigma Aldrich, cat. A1410, dissolved in DMSO to 5 μg/μl) to a final concentration of 25 ng/μl. Reactions were diluted by addition of 50 μl E. coli RNA Polymerase Buffer 1X. DMS (Sigma Aldrich, cat. D186309) was diluted 1:6 in 100% Ethanol to a final concentration of 1.76 M. Diluted DMS was added to reactions to a final concentration of 100 mM. For control samples, an equal volume of a 1:6 dilution of nuclease-free water in 100% Ethanol was added. Samples were incubated with moderate shaking (800 RPM) at 25°C for 2 minutes, after which reactions were immediately transferred to ice. Two volumes of ice-cold RNA Binding Buffer from RNA Clean & Concentrator™-5 kit (Zymo Research, cat. R1014) supplemented with DTT (Sigma Aldrich, cat. 43815) to a final concentration of 0.7 M, were added to quench DMS, and samples were vigorously vortexed for 10 seconds.
in vivo
In vivo RNA preparation: The cells in 200 ml culture were harvested and resuspended with a solution containing 0.5% SDS, 20 mM sodium acetate (pH 5.5), and 10 mM EDTA. The suspended cells were mixed with an equal volume of pre-warmed saturated phenol (20 mM sodium acetate, 10 mM EDTA pH 5.5) and incubated for 5 min at 60  C. The mixture was centrifuged, and RNA and DNA were precipitated with ethanol from the supernatant. The pellet was dissolved in DNase I buffer with 10U of DNaseI and incubated for 30 min. RNA was separated from the digested DNA by acidic phenol extraction followed by G-50 Micro column (GE Healthcare) purification, and then precipitated with ethanol. The pellet was dissolved in diethylpyrocarbonate-treated water and used for cDNA synthesis.
Ionic silver stock solutions were prepared from AgNO3 powder (Fisher Scientific Bioblock) as previously described (Saulou, Jamme et al., 2013) and stored in darkness. The final tested concentrations (5.0, 6.5, and 8.5 µM) were obtained by diluting the corresponding AgNO3 stock solution directly into the M9 growth medium. Control experiment was simultaneously performed by adding deionised water into the M9 broth. In both cases, a stabilization period of 24 h (at 37 °C and 120 rpm) was carried out before cell inoculation.
Ion Xpress barcoded libraries were constructed using the Ribo-Zero Magnatic Kit (Gram-negative bacteria, Epicentre )and IonXpress RNA-seq v2 (Life Technologies) kits according to the manufacturer's directions.
ip antibody: affinity purified anti-Fur antibody
IP ∆fur Anaerobic
IPOD_early_log_1
IPOD_early_log_2
IPOD_late_log_1
IPOD_late_log_2
IPOD_MDS42
IP ParC-flag 1
IP ParE-flag 1
IP ParE-flag 2
IP ParE-flag G1
IP ParE-flag G2
IP ParE-flag S20min
IP ParE-flag S40min
Irp mutant in Ala media
Irp mutant in Gln media
isolate: bovine isolate of e coli o157: H7 FRIK2000 lineage II
isolate: bovine isolate of e coli o157: H7 FRIK966 lineage II
isolate: clinical isolate e coli o157: H7 lineage I
isolated by chloroform extraction and precipitation by isopropanol. Precipitated RNA
Isolated from feces of a HUS patient from an outbreak in China in 1999
Isolate: EDL933
Isolate G 1/2 of Symbioflor2 probiotic product from Symbiopharm
Isolate G 3/10 of Symbioflor2 probiotic probiotic from Symbiopharm
Isolate G 3/10 of Symbioflor2 probiotic product from Symbiopharm
Isolate G 4/9 of Symbioflor2 probiotic product from Symbiopham
Isolate G 4/9 of Symbioflor2 probiotic product from Symbiopharm
Isolate G5 of Symbioflor2 probiotic product from Symbiopharm
Isolate: MDS42
Isolate: MG1655
isolate: UR40
Isolate W3110 of K-12 strain
isolation source: Mixed culture
isolation source: Pure culture
Isoleucine addition
IspG1
IspG1 strain
Iterative alignment, Min-leght=20, step=5, bowtie2 --very-sensitive
Jaguar
JCB570
JM109-1, biological rep1
JM109-2, biological rep2
JM109-3, biological rep3
JM109 GLY-1, biological rep1
JM109 GLY-2, biological rep2
JM109 GLY-3, biological rep3
JO2057 (WT)
JO2057 (WT), exponential phase, repetition1
JO2057 (WT), exponential phase, repetition2
JO2057 WT, LB, exponential phase, repetition1
JO2057 WT, LB, exponential phase, repetition2
JO2057 WT, LB, stationary phase, repetition1
JO2057 WT, LB, stationary phase, repetition2
JO2057 WT, LB, transition phase
JO2057 (WT), Min Glucose, exponential phase
JO2057 WT, Min Glucose, exponential phase
JO2057 (WT), Min Glucose, stationary phase
JO2057 WT, Min Glucose, stationary phase
JO2057 (WT), Min Glycerol, exponential phase
JO2057 WT, Min Glycerol, exponential phase
JO2057 (WT), Min Glycerol, stationary phase
JO2057 WT, Min Glycerol, stationary phase
JO2057 (WT), stationary phase, repetition1
JO2057 (WT), stationary phase, repetition2
JO2057 (WT), transition phase
JO2081 (hupA)
JO2081 (hupA), exponential phase
JO2081 hupA, LB, exponential phase
JO2081 hupA, LB, stationary phase
JO2081 hupA, LB, transition phase
JO2081 (hupA), stationary phase
JO2081 (hupA), transition phase
JO2083 (hupB)
JO2083 (hupB), exponential phase
JO2083 hupB, LB, exponential phase
JO2083 hupB, LB, stationary phase
JO2083 hupB, LB, transition phase
JO2083 (hupB), stationary phase
JO2083 (hupB), transition phase
JO3020 (hupAB)
JO3020 (hupAB), exponential phase, repetition1
JO3020 (hupAB), exponential phase, repetition2
JO3020 hupAB, LB, exponential phase, repetition1
JO3020 hupAB, LB, exponential phase, repetition2
JO3020 hupAB, LB, stationary phase, repetition1
JO3020 hupAB, LB, stationary phase, repetition2
JO3020 hupAB, LB, transition phase
JO3020 (hupAB), Min Glucose, exponential phase
JO3020 hupAB, Min Glucose, exponential phase
JO3020 (hupAB), Min Glucose, stationary phase
JO3020 hupAB, Min Glucose, stationary phase
JO3020 (hupAB), Min Glycerol exponential phase
JO3020 hupAB, Min Glycerol exponential phase
JO3020 (hupAB), Min Glycerol stationary phase
JO3020 hupAB, Min Glycerol stationary phase
JO3020 (hupAB), stationary phase, repetition1
JO3020 (hupAB), stationary phase, repetition2
JO3020 (hupAB), transition phase
JQ004 (rraA)
K100Q
K100Q rep 1
K100Q rep 2
K100Q rep 3
K100R
K100R rep 1
K100R rep 2
K100R rep 3
K12 EMG2 on LB with 0.2 percent glucose, 2.5 hours post-incubation
K12 EMG2 on LB with 0.2 percent glucose, 3.5 hours post-incubation
K12 EMG2 on LB with 0.2 percent glucose, 3 hours post-incubation
K12 EMG2 on LB with 0.2 percent glucose, 4.5 hours post-incubation
K12 EMG2 on LB with 0.2 percent glucose, 4 hours post-incubation
K12 EMG2 on LB with 0.2 percent glucose, 5.5 hours post-incubation
K12 EMG2 on LB with 0.2 percent glucose, 5 hours post-incubation
K12 EMG2 on LB with 0.2 percent glucose, 6 hours post-incubation
K12 EMG2 on LB with 0.2 percent glucose, 8 hours post-incubation
K12 EMG2 on LB with 0.4 percent glucose, 2.5 hours post-incubation
K12 EMG2 on LB with 0.4 percent glucose, 3.5 hours post-incubation
K12 EMG2 on LB with 0.4 percent glucose, 3 hours post-incubation
K12 EMG2 on LB with 0.4 percent glucose, 4.5 hours post-incubation
K12 EMG2 on LB with 0.4 percent glucose, 4 hours post-incubation
K12 EMG2 on LB with 0.4 percent glucose, 5.5 hours post-incubation
K12 EMG2 on LB with 0.4 percent glucose, 5 hours post-incubation
K12 EMG2 on LB with 0.4 percent glucose, 6 hours post-incubation
K12 EMG2 on LB with 0.4 percent glucose, 8 hours post-incubation
K12 MG1655 with 10 mM of heptanoic acid
K12 MG1655 without heptanoic acid
K12 strain MG1655, 100 mcg/ml bicyclomycin 20 min, exponential phase
K12 strain MG1655, 10 mcg/ml bicyclomycin 20 min, exponential phase
K12 strain MG1655, 25 mcg/ml bicyclomycin 20 min, exponential phase
K12 strain MG1655, control sample, exponential phase
K-12 strain_wild type
K-12 strain, wild type
K12 WT 3110
K12 Δ(yjjP-yjjQ-bglJ) + ctrl
K12 Δ(yjjP-yjjQ-bglJ) + ctrl, biological replicate 1
K12 Δ(yjjP-yjjQ-bglJ) + ctrl, biological replicate 2
K12 Δ(yjjP-yjjQ-bglJ) + ctrl, biological replicate 3
K12 Δ(yjjP-yjjQ-bglJ) + ctrl, biological replicate 4
K12 Δ(yjjP-yjjQ-bglJ) + pBglJ
K12Δ(yjjP-yjjQ-bglJ) + pBglJ
K12 Δ(yjjP-yjjQ-bglJ) + pBglJ, biological replicate 1
K12 Δ(yjjP-yjjQ-bglJ) + pBglJ, biological replicate 2
K12Δ(yjjP-yjjQ-bglJ) + pBglJ, biological replicate 3
K12 Δ(yjjP-yjjQ-bglJ) + pBglJ, biological replicate 4
K12 Δ(yjjP-yjjQ-bglJ) + pLeuO
K12 Δ(yjjP-yjjQ-bglJ) + pLeuO, biological replicate 1
K12 Δ(yjjP-yjjQ-bglJ) + pLeuO, biological replicate 2
K12 Δ(yjjP-yjjQ-bglJ) + pLeuO, biological replicate 3
K12 Δ(yjjP-yjjQ-bglJ) + pLeuO, biological replicate 4
K12 Δ(yjjP-yjjQ-bglJ) ΔleuO + ctrl
K12 Δ(yjjP-yjjQ-bglJ) ΔleuO + ctrl, biological replicate 1
K12 Δ(yjjP-yjjQ-bglJ) ΔleuO + ctrl, biological replicate 2
K12 Δ(yjjP-yjjQ-bglJ) ΔleuO + ctrl, biological replicate 3
K12 Δ(yjjP-yjjQ-bglJ) ΔleuO + ctrl, biological replicate 4
K12 Δ(yjjP-yjjQ-bglJ) ΔleuO + pBglJ
K12 Δ(yjjP-yjjQ-bglJ) ΔleuO + pBglJ, biological replicate 1
K12 Δ(yjjP-yjjQ-bglJ) ΔleuO + pBglJ, biological replicate 2
K12 Δ(yjjP-yjjQ-bglJ) ΔleuO + pBglJ, biological replicate 3
K12 Δ(yjjP-yjjQ-bglJ) ΔleuO + pBglJ, biological replicate 4
K12 Δ(yjjP-yjjQ-bglJ) ΔrcsB + ctrl
K12 Δ(yjjP-yjjQ-bglJ) ΔrcsB + ctrl, biological replicate 1
K12 Δ(yjjP-yjjQ-bglJ) ΔrcsB + ctrl, biological replicate 2
K12 Δ(yjjP-yjjQ-bglJ) ΔrcsB + ctrl, biological replicate 3
K12 Δ(yjjP-yjjQ-bglJ) ΔrcsB + ctrl, biological replicate 4
K12 Δ(yjjP-yjjQ-bglJ) ΔrcsB + pBglJ
K12 Δ(yjjP-yjjQ-bglJ) ΔrcsB + pBglJ, biological replicate 1
K12 Δ(yjjP-yjjQ-bglJ) ΔrcsB + pBglJ, biological replicate 2
K12 Δ(yjjP-yjjQ-bglJ) ΔrcsB + pBglJ, biological replicate 3
K12 Δ(yjjP-yjjQ-bglJ) ΔrcsB + pBglJ, biological replicate 4
KCN
kefB KO rep1
kefB KO rep2
kefB KO rep3
khc KO rep1
khc KO rep2
khc KO rep3
KMD 1
KMD 2
KMD 3
KSL2000, 0.1 % arabinose
KSL2000, no arabinose
KSL2000 plus pTrc99A
KSL2000 plus pTrc99A-RraA
KSL2000-Rne depletion
KSL2000-RraA overexpression
KSL2009, 0.1% arabinose
KSL2009, no arabinose
KSL2009-N-Rne depletion
KSL2009 plus pTrc99A
KSL2009 plus pTrc99A-RraA
KSL2009-RraA overexpression
lacA KO LB rep1
lacA KO LB rep2
lacA KO M9 rep1
lacA KO M9 rep2
LA-co1
LA-co2
lactate_growth: MURI_085
lactate_growth: MURI_086
lactate_growth: MURI_087
lactate_growth: MURI_088
lactate_growth: MURI_089
lactate_growth: MURI_090
Lactobacillus acidophilus
lacZ_0min
lacZ_10min
lacZ_15min
lacZ_1min
lacZ_2min
lacZ_4min
lacZ_6min
lacZ_8min
lacZ_K12_0_r1
lacZ_K12_120_r1
lacZ_K12_30_r1
lacZ_K12_60_r1
lacZ_K12_90_r1
lacZ_MG1063_0_r1
lacZ_MG1063_0_r2
lacZ_MG1063_120_r1
lacZ_MG1063_30_r1
lacZ_MG1063_30_r2
lacZ_MG1063_60_r1
lacZ_MG1063_60_r2
lacZ_MG1063_90_r1
lacZ_MG1063_90_r2
lacZ_W1863_0_r1
lacZ_W1863_30_r1
lacZ_W1863_60_r1
lacZ_W1863_90_r1
LA-log
LA-log-tr
Lambda phage
LA-starve
late log phase grown e coli 966 into RNAprotect solution, RNA extracted with qiagen RNA bacteria kits
late log phase grown e coli EDL933 into RNAprotect solution, RNA extracted with qiagen RNA bacteria kits
late stationary culture
LA_TP1_repl1
LA_TP1_repl2
LA_TP1_repl3
LA_TP1_repl4
LA_TP1_repl5
LA_TP2_repl1
LA_TP2_repl2
LA_TP2_repl3
LA_TP2_repl4
LA_TP2_repl5
LA_TP3_repl1
LA_TP3_repl2
LA_TP3_repl3
LA_TP3_repl4
LA_TP3_repl5
LA_TP4_repl1
LA_TP4_repl2
LA_TP4_repl3
LA_TP4_repl4
LA_TP4_repl5
LB
LB 0.4 B1 TEX neg L1 GA
LB 0.4 B1 TEX pos L1 GA
LB 0.4 B2 TEX neg L1 HS1
LB 0.4 B2 TEX neg L1 HS2
LB 0.4 B2 TEX pos L1 HS1
LB 0.4 B2 TEX pos L1 HS2
LB 2.0 B1 TEX neg L1 GA
LB 2.0 B1 TEX neg L2 HS2
LB 2.0 B1 TEX pos L1 GA
LB 2.0 B1 TEX pos L2 HS2
LB 2.0 B2 TEX neg L1 HS1
LB 2.0 B2 TEX neg L1 HS2
LB 2.0 B2 TEX neg L2 HS2
LB 2.0 B2 TEX pos L1 HS1
LB 2.0 B2 TEX pos L1 HS2
LB 2.0 B2 TEX pos L2 HS2
LB, 37°C, 220 rpm, OD600=0.5, 2.0, 2.0+6 h
LB (5 ml) was inoculated by a frozen stock of WT or perC-mutant strain and incubated at 37°C with 225 rpm shaking. Flasks containing low-glucose DMEM were inoculated 1:100 with the overnight culture and incubated at 37°C with 225 rpm shaking to mid-exponential phase (OD600 0.3-0.5).
LB agar plates, 37°C for 18 h
LB, biological rep1
LB, biological rep2
LB, biological rep3
LB+glycerol, biological rep1
LB+glycerol, biological rep2
LB+glycerol, biological rep3
LB-grown overnight cultures were pelleted by centrifugation, washed, and resuspended in M9-glutamine of M9-alanine media.  Cultures were shaken at 250 rpm at 37C.  Samples were taken in mid-exponential phase (OD600 =0.15 for glutamine and OD600=0.2 for alanine on an Ultraspec 3100 pro) after ~5 generations of growth in the media.
LB media
LB medium, 180 rpm shaking, at 37°C, between exponential and stationary phase
LB medium, 37°C, airated, constant pH 7.5
LB medium at 37ºC with 200rpm agitation.
LB mRNA
LB mRNA biological replicate
LB mRNA technical replicate
LBO
LB(OD=0.87)
LB RPF
LB RPF biological replicate
LBTMP50_10min
LBTMP50_120min
LBTMP50_30min
LBTMP50_60min
LC1
ldrA__U_N0075_r1
ldrA__U_N0075_r2
ldrA__U_N0075_r3
ldrA upregulation, 0.075 mg/mL norfloxacin
LE-co1
LE-co2
LELab_ChIP_seq_TLS1637_anti_FLAG
LELab_ChIP_seq_TLS1638_anti_FLAG
LELab_ChIP_seq_TLS1639_anti_FLAG
LELab_ChIP_seq_TLS1640_anti_FLAG
LELab_ChIP_seq_TLS1641_anti_FLAG
LELab_ChIP_seq_TLS1642_anti_FLAG
LELAb_ChIP_seq_TLS1643_anti_FLAG
LELab_ChIP_seq_TLS1644_anti_FLAG
LELab_ChIP_seq_TLS1645_anti_FLAG
LELab_ChIP_seq_TLS1646_anti_FLAG
LELab_ChIP_seq_TLS1647_anti_FLAG
LELab_ChIP_seq_TLS1648_anti_FLAG
LELab_ChIP_seq_TLS1649_anti_FLAG
LELab_ChIP_seq_TLS1650_anti_FLAG
LE-log
LE-log-tr
LE-starve
-Leu t=0
-Leu t=0 charged
-Leu t=0 total
-Leu t=17
-Leu t=17 charged
-Leu t=17 total
-Leu t=2
-Leu t=2 charged
-Leu t=2 total
-Leu t=32
-Leu t=32 charged
-Leu t=32 total
-Leu t=7
-Leu t=7 charged
-Leu t=7 total
lexA 10' after UV vs. 0', MG1655
lexA 10 min after UV treatment, 25 ug total RNA, 2 ug pdN6
lexA 20' after NOuv vs. 0', MG1655
lexA 20' after UV vs. 0', MG1655
lexA 20 min after NOuv, 25 ug total RNA, 2 ug pdN6
lexA 20 min after UV treatment, 25 ug total RNA, 2 ug pdN6
lexA 40' after UV vs. 0', MG1655
lexA 40 min after UV treatment, 25 ug total RNA, 2 ug pdN6
lexA 5' after UV vs. 0', MG1655
lexA 5 min after UV treatment, 25 ug total RNA, 2 ug pdN6
lexA 60' after NOuv vs. 0', MG1655
lexA 60' after UV vs. 0', MG1655
lexA 60 min after NOuv, 25 ug total RNA, 2 ug pdN6
lexA 60 min after UV treatment, 25 ug total RNA, 2 ug pdN6
lexA___U_N0025_r1
lexA___U_N0025_r2
lexA___U_N0025_r3
lexA upregulation, amp 50ug/ml, 0.0125% arabinose, 0.025ug/ml norfloxacin OD ~0.3
lexA vs. wt, before UV treatment, MG1655
L-form, brain heart infusion agar+Sucrose+MgSO4+Pen G, rep 1
L-form, brain heart infusion agar+Sucrose+MgSO4+Pen G, rep 2
L-form, brain heart infusion agar+Sucrose+MgSO4+Pen G, rep 3
L-form colony morphology
Libraries for Illumina HiSeq 1000 sequencing using the Truseq kit were prepared using protocols recommended by the manufacturer.
Libraries of RNA fractions were constructed with the ScriptSeq V2 RNA-Seq Library Prep Kit (Illumina) according to the manufacturers guidelines.
Libraries were constructed by vertis Biotechnologie AG, Germany (www.vertis-biotech.com) as a service that included treating an aliquot of each RNA sample with TAP. The 5'-sequencing adaptor was ligated to transcripts prior to fragmentation, thereby allowing the 5' ends of both long and short transcripts to be detected. Each of the 4 libraries was constructed using a different barcode.
Libraries were prepared according to Illumina's instructions accompanying the DNA Sample Kit (FC-104-5001). Briefly, DNA was end-repaired using a combination of T4 DNA polymerase, E. coli DNA Pol I large fragment (Klenow polymerase) and T4 polynucleotide kinase. The blunt, phosphorylated ends were treated with Klenow fragment (32 to 52 exo minus) and dATP to yield a protruding 3- 'A' base for ligation of Illumina's adapters which have a single 'T' base overhang at the 3’ end. After adapter ligation DNA was PCR amplified with Illumina primers for 15 cycles and library fragments of ~250 bp (insert plus adaptor and PCR primer sequences) were band isolated from an agarose gel. The purified DNA was captured on an Illumina flow cell for cluster generation. Libraries were sequenced on the Genome Analyzer following the manufacturer's protocols.
Libraries were prepared according to Illumina's instructions accompanying the genomic DNA Sample Kit. Briefly, cDNA was sonicated in a biorupter sonicator, cleaned up/concentrated through a Qiagen PCR column, and end-repaired. The blunt DNA was treated with Klenow fragment (exo minus) to add an A-overhang, and ligated to the relevant Illumina adapter sequence (either with our without a barcode).  Adaptered-DNA was then size-selected on a agarose gel and PCR amplified. The purified PCR was captured on an Illumina flow cell for cluster generation. Libraries were sequenced on the Genome Analyzer following the manufacturer's protocols.
Libraries were prepared according to Illumina's instructions accompanying the genomic DNA Sample Kit. Briefly, gDNA was sonicated in a biorupter sonicator, cleaned up/concentrated through a Qiagen PCR column, and end-repaired. The blunt DNA was treated with Klenow fragment (exo minus) to add an A-overhang, and ligated to the relevant Illumina adapter sequence (either with our without a barcode).  Adaptered-DNA was then size-selected on a agarose gel and PCR amplified. The purified PCR was captured on an Illumina flow cell for cluster generation. Libraries were sequenced on the Genome Analyzer following the manufacturer's protocols.library strategy
Libraries were prepared for sequencing using standard Illumina protocols
Library constructed using KAPA Kit.
library construction followed Illumina manufacturer protocol for bacteria using the Nextera XT DNA Library Preparation Kit
Library construction was based on the method described by Rhee et al. (doi:10.1016/j.cell.2011.11.013).
Library construction was performed as described in Oh et al. 2011, Cell 147(6):1295-1308 (PMCID: PMC3277850).  Briefly, fragments of total mRNA or ribosome protected mRNA fragments were size selected via gel purification, and ligated to a 5' adenylated DNA oligo. After reverse transcription, the single stranded DNA was circularized and amplified by PCR.
Library construction was performed as described in Parkhomchuk et al. 2009, Nucleic Acids Res 37: e123. Briefly, ribosome-depleted RNA was fragmented and used as template for cDNA synhtesis. dUTP was included in the second strand synthesis reaction in addition to dTTP to chemically mark the second strand. cDNAs were size-selected and ligated to sequencing adapters followed by dUTP cleavage to generate adapter-ligated single-stranded cDNAs.
Library construction was performed by processing in vitro samples to generate a library of short inserts (the DNA Colonies Template Library) by Fasteris SA, Switzerland
Library minipreps were performed with the Zyppy Miniprep kit (Zymo Technologies) and quantified using the Qubit dsDNA BR kit (Invitrogen) and the Nanodrop spectrophotometer (Thermo Scientific)
Library preparation was performed by vertis Biotechnologie AG, according to the following protocol: RNA samples were first treated with rDNase. From the total RNA samples, ribosomal RNA molecules were depleted using the Ribo-Zero rRNA Removal Kit (Bacteria, Epicentre). the rRNA depleted RNA samples were fragmented with ultrasound (2 pulses of 30 sec at 4°C). Firststrand cDNA synthesis was primed with a N6 randomized primer. Then, Illumina TruSeq sequencing adapters were ligated to the 5' and 3' ends of the cDNA. The cDNA was finally amplified with PCR (16-18 cycles, depending on sample) using a proof reading enzyme. Aliquots of each library were analyzed by capillary electrophoresis.
Library preparation was performed by vertis Biotechnologie AG, according to the following protocol: the DNA samples were treated with ultrasound (3-5 pulses of 30 sec at 4°C). After end-repair, TruSeq sequencing adapters were ligated to the DNA fragments. Finally, the DNA was PCR-amplified to about 20-30 ng/μl using a high fidelity DNA polymerase (9-11 cycles, depending on the sample). Aliquots of the PCR amplified libraries were examined by capillary electrophoresis.
Library preparation was performed using the Nextera XT kit from Illumina [Cat No FC-131-1096] starting from 1 ng of total cDNA. The original protocol was modified where 3 min tagmentation and 13 cycles of step-limited PCR were used. Ampure beads from Beckman Coulter [Cat No A63880] were used for library purification. Library quality assessment and quantification was performed with Agilent 2100 Bioanalyzer and Agilent high sensitivity DNA analysis kit [Cat No 5067-4626]. Finally all 90 samples were pooled together in the same reaction tube at a final concentration of 1 nM.
Library preparation was performed with TruSeq Stranded Total RNA HT Sample Prep Kit (Illumina). Libraries were sequenced with 50 bp single read configuration on a HiSeq 2500 system (Illumina).
Library preparation were performed with Epicentre ScriptseqTM v2 RNA-Seq Library preparation kit with 50 ng of depleted RNA; Strand orientated RNA-Seq
Library strategy: 3C-seq
library strategy: 3'-end RNA-seq
library strategy: ChIP-exo
Library strategy: ChIP-exo
library strategy: ChIP-seq (ChIP-exo)
library strategy: DMS-seq
Library strategy: REC-Seq
Library strategy: Ribo-Seq
Library strategy: RIBO-seq
library strategy: Ribosome profiling
library strategy: Selective ribosome profiling
library strategy: SPET-seq
ligation, rt-PCR, PCR
LIMS477_S1_T10
LIMS477_S1_T3
LIMS477_S1_T6
LIMS477_S2_T4
LIMS477_S2_T6
LIMS477_S2_T8
LIMS477_S3_T11
LIMS477_S3_T3
LIMS477_S3_T6
LIMS477_S5_T4
LIMS477_S5_T6
LIMS477_S5_T8
LIMS484_S1_T3
LIMS484_S1_T6
LIMS484_S1_T8
LIMS484_S2_T2
LIMS484_S2_T6
LIMS484_S2_T8
LIMS484_S5_T2
LIMS484_S5_T6
LIMS484_S5_T8
LIMS484_S6_T4
LIMS484_S6_T6
LIMS484_S6_T8
Linearly scaled so that intensity values in gDNA_A_cy5, cDNA_A_cy3, gDNA_B_cy3, and cDNA_B_cy5 are comparable
Linearly scaled so that intensity values in Sigma70_ChIP_control_A_cy3, Sigma70_ChIP_A_cy5, Sigma70_ChIP_control_B_cy3, Sigma70_ChIP_B_cy5, Beta_ChIP_control_A_cy3, Beta_ChIP_A_cy5, Beta_ChIP_control_B_cy3, Beta_ChIP_B_cy5 are comparable
LJ110 del pdhr LBo
LJ110 del pdhr MMAcetat
LJ110 del pdhr MMPyruvat
LJ110 LBo
LJ110 MMAcetat
LJ110 MMPyruvat
LJ110 pTM30 LBo
LJ110 pTM30 MMAcetat
LJ110 pTM30 MMPyruvat
LJ110 pTM30pdhr LBo
LJ110 pTM30pdhr MMAcetat
LJ110 pTM30pdhr MMPyruvat
Local Background Substracted Signal Corrected for unequal Dye incorporation or unequal load of labelled product
location: Earth
location: Space
Log10 mRNA concentration (pM) data are provided as a supplementary file. Expression levels were normalized using the quantile normalization method (Bolstad et al., 2003).
log10 mRNA concentration (pM) data are provided as a supplementary file on the SERIES record.
log2 ratio of isolate/control
Logarithmic phase sample 1
Logarithmic phase sample 2
Logarithmic phase sample 3
Logarithmic phase sample 4
LogData = createData(Data, n.rep=1, log.trans=TRUE)
log phase 1
log phase 2
log phase 3
log phase 4
log phase 5
Log-phase cultures (LB broth, Miller formulation) inoculated with either blue or pale colonies were grown for 5 hr at 37 degrees celsius.  Cells were pelleted by centrifugation and flash frozen on dry ice.
lon___U_N0025_r1
lon___U_N0025_r2
lon___U_N0025_r3
lon upregulation, amp 50ug/ml, 0.0125% arabinose, 0.025ug/ml norfloxacin OD ~0.3
LOWESS normalised data that represents the average of the three replicate experiments
LOWESS normalized, background subtracted data obtained from log2 of processed Red signal/processed Green signal. Agilent software GX 7.3 was used.
LOWESS normalized, background subtracted data obtained from signals. Agilent GeneSpring GX 7.3 was used.
LOWESS normalized data obtained from log2 of processed Red signal (treated)/processed Green signal (control) are given in the data table below. All microarray data were analyzed using R software and Limma package (part of Bioconductor). All the probes encoding for positive and negative controls were not used and have been removed. Only raw data superior to background values and with homogeneous fluorescent signals were considered (H < 0.2). Red and green signal heterogeneity was estimated as followed: H = |(trimmed mean of raw intensity - median of raw intensity)|/|(0.5*(trimmed mean of raw intensity + median of raw intensity)). After LOWESS normalization, the differences between the four heat-treatments were tested by Analysis of Variance (ANOVA) followed by a priori tests (P-value < 0.0001 and P-value FDR after Benjamini Yekutieli adjustment < 0.01). Six contrasts (Contrast1:T1 vs T2, Contrast2:T1 vs T3, Contrast3: T1 vs T4, Contrast4: T2 vs T3, Contrast5: T2 vs T4, Contrast6: T3 vs T4) were performed. Normalized Log2 ratio between treatments and the results of the statistical analysis have been linked as a supplementary file on the Series record.
Lowess normalized data. Resultant data is log2 normalized.
Lowly expressed genes (<1 read per million) were removed.
Low quality reads were trimmed with CutAdapt
LP1
LP2
LP3
LP4
lplA KO rep1
lplA KO rep2
lplA KO rep3
lrp-gln-1
lrp-gln-2
Lrp_Leu_1
Lrp_Leu_2
Lrp_Leu_3
lrp- + Leu vs. lrp-  - Leu
lrp- - Leu vs. wt - Leu
lrp- + Leu vs. wt - Leu
Lrp_NH4Cl_1
Lrp_NH4Cl_2
Lrp_NH4Cl_3
L-threonine producing strain
L-threonine producing strain vs control strain
L, TP1
L, TP2
L, TP3
L, TP4
luc2_U_N0000_r1
luc2_U_N0000_r2
luc2_U_N0025_r1
luc2_U_N0025_r2
luciferase 0.025ug/ml norfloxacin
luciferase no drug
luc___U_N0000_r1
luc___U_N0000_r2
luc___U_N0000_r3
luc___U_N0025_r1
luc___U_N0025_r2
luc___U_N0025_r3
luc___U_N0075_r1
luc___U_N0075_r2
luc___U_N0075_r3
luc upregulation, 0.000 ug/ml norfloxacin
luc upregulation, 0.075ug/ml norfloxacin
luc upregulation, amp 50ug/ml, 0.0125% arabinose, 0.025ug/ml norfloxacin OD ~0.3
Luria broth (LB) medium under aeration, exponential phase OD600 = 0.3.
luxS mutants, 10% H2O2
luxS mutants, 30% H2O2
luxS mutants, without H2O2
Lysates were diluted with 1 ml of TES buffer and 100 μl of ANTI-FLAG® M2 affinity gel (Sigma-Aldrich) was added. Immunoprecipitation was performed for 1.5-2 hours at room temperature with moderate mixing, then affinity gel was washed 4 times by repeating steps of centrifugation (1.5 minute, 1000xg at room temperature) and resuspention (x2 with 1 ml of TESS buffer, x1 with 1 ml of TES buffer, x1 with 1 ml of TE buffer).
Lysine addition
M1655 wild type at t0, rep1
M1655 wild type at t0, rep2
M1655 wild type at t10, rep1
M1655 wild type at t10, rep2
M1655 wild type at t2, rep1
M1655 wild type at t2, rep2
M1655 wild type at t4, rep1
M1655 wild type at t4, rep2
M1655 wild type at t6, rep1
M1655 wild type at t6, rep2
M1655 wild type at t8, rep1
M1655 wild type at t8, rep2
M1655 with deletion in soxR at t0, rep1
M1655 with deletion in soxR at t10, rep1
M1655 with deletion in soxR at t2, rep1
M1655 with deletion in soxR at t4, rep1
M1655 with deletion in soxR at t6, rep1
M1655 with deletion in soxR at t8, rep1
M63 0.4 B1 TEX neg L1 GA
M63 0.4 B1 TEX pos L1 GA
M63 0.4 B2 TEX neg L1 HS1
M63 0.4 B2 TEX neg L1 HS2
M63 0.4 B2 TEX pos L1 HS1
M63 0.4 B2 TEX pos L1 HS2
M9 defined medium (0.6% Na2HPO4, 0.3% KH2PO4, 0.05% NaCl, 0.01% NH4Cl, 0.1 mM CaCl2, 1 mM MgSO4, 5 x 10−4% Thiamin) supplemented with 0.5% glucose and 0.1% amino acids was used for RNA-seq experiments.
M9 mineral medium containing (D)-xylose as the only carbon source (100 ml in 500 ml shake flasks) was inoculated from exponentially growing wild-type cells or synthetic cells (cultivated on xylose M9 medium) to adjust an OD of ~0.1. Cultures were incubated at 37°C under shaking until OD reached ~1. Then they were split into two 50 ml aliquots and further cultivated in 250 ml shake flasks in the presence or absence of 10 mM glycolaldehyde. After 30 min of incubation, 1 ml of the cell suspension was withdrawn and centrifuged at 1500 x g (Eppendorf 5415D) for 5 min. The supernatant was removed and the cell pellets were directly subject to RNA extraction. Experiment were repeated three times.
M9 minimal complete media, cultures grown aerobically at 30 degrees C in a gyratory water bath shaking at 240 rpm
M9TMP5_10min
M9TMP5_120min
M9TMP5_30min
M9TMP5_60min
M9TMP5_90min
M9TMP5_AdAA_10min
M9TMP5_AdAA_120min
M9TMP5_AdAA_30min
M9TMP5_AdAA_60min
M9TMP5_AdAA_90min
M9_TMP5_THY_Ad_AA_10min
M9_TMP5_THY_Ad_AA_120min
M9_TMP5_THY_Ad_AA_30min
M9_TMP5_THY_Ad_AA_60min
M9TMP_AA_10min
M9TMP_AA_120min
M9TMP_AA_30min
M9TMP_AA_60min
M9TMP_Ad_10min
M9TMP_Ad_120min
M9TMP_Ad_30min
M9TMP_Ad_60min
MACE software (https://code.google.com/p/chip-exo/) was used to detect peaks with aligned output from bowtie mapping.
MACS v2.0.10.20131216 was used for peak calling with parameters --llocal=10000 -g 4639675 --bw 300 -p 0.05 --slocal=1000 --keep-dup=20
Mapped R1 reads in single-end mode using Bowtie2 2.1.0 with the –k 1 option
Mapped read counts were analyzed for differential expression (false discovery rate of < 0.01, fold-change > 2) using the baySeq package in R (Hardcastle and Kelly, 2010, BMC Bioinformatics). Within baySeq, two-way comparisons using quantile normalization were made for all three biological replicate transcriptomes over time for HgCl2 exposure or PMA exposure versus the unexposed control.
Mapped reads per annotated gene were counted by Bam2readcount.
Mapped reads were counted using the Python package HTSeq (v. 0.6.1) using the following parameters; htseq-count -m union -r pos -i gene_name -a 10
Mapped reads were quality checked with SAMstat (version 1.08), and transcripts were assembled in Cufflinks (version 2.0.2)
mapping: bowtie (Galaxy Version 1.1.2); 28 nt seed length, maximal two mismatches in the seed, a maximal threshold of 70 for the sum of the quality values at mismatched positions.
mapping of non-rRNA and tRNA reads to E. coli O104:H4 chromosome and plasmids using READemption 0.3.7 and segemehl 0.2.0
mapping of reads to E. coli O104:H4 rRNAs and tRNAs using READemption 0.3.7 and segemehl 0.2.0
Mapping of the trimmed reads to the reference sequences was also performed with the CLC Genomics Workbench 9.0 using the 'Map Reads to Reference' tool with standard parameters.
Mapping was performed using BWA tool (version 0.5.9) against the reference genome
Map reads to theEscherichia coli MG1655 K-12 genome, Bowtie 2
Map RNA-Seq reads to reference genomes using Bowtie  (Langmead et al., 2009) with alignment parameters (-n 2-e 70-l 28 –best)
Map to MG1655 reference using BWA 0.7.4 (bwa mem, default parameters)
map trimmed reads to reference sequence in indexes file with bowtie2
Marvinbryantia formatexigens DSM 14469
MAS 5.0
MAS5.0
MAS 5.0 Expression Analysis Default Setting
MAS 5.0 Expression Analysis Default Setting.
MasterPure RNA purification Kit
MasterPure RNA purification Kit per manufacturers protocol
material type: whole_organism
MATLAB v. R2012b program using GCRMA algorithm
MatP 37°C
∆mazEF 0 μg/ml NA rep1
∆mazEF 0 μg/ml NA rep2
∆mazEF 100 μg/ml NA rep1
∆mazEF 100 μg/ml NA rep2
∆mazEF 100 μg/ml NA rep3
∆mazEF 10 μg/ml NA rep1
∆mazEF 10 μg/ml NA rep2
∆mazEFlexA3 0 μg/ml NA rep1
∆mazEFlexA3 0 μg/ml NA rep2
∆mazEFlexA3 100 μg/ml NA rep1
∆mazEFlexA3 100 μg/ml NA rep2
∆mazEFlexA3 10 μg/ml NA rep1
∆mazEFlexA3 10 μg/ml NA rep2
mazF_chpA upregulation, amp 50ug/ml, 0.0125% arabinose, 0.025ug/ml norfloxacin OD ~0.3
MazF_mRNA_5m_rep1
MazF_mRNA_5m_rep2
MazF_totalRNA_30m_rep1
MazF_totalRNA_30m_rep2
MazF_totalRNA_5m_rep1
MazF_totalRNA_5m_rep2
MazF_totalRNA_60m_rep1
MazF_totalRNA_60m_rep2
mazF___U_N0025_r1
mazF___U_N0025_r2
mazF___U_N0025_r3
MBC of CYA, biological rep1
MBC of CYA, biological rep2
MBC of CYA, biological rep3
MBC of OLA, biological rep1
MBC of OLA, biological rep2
MBC of OLA, biological rep3
mcrB__U_N0075_r1
mcrB__U_N0075_r2
mcrB__U_N0075_r3
mcrB upregulation, 0.075 mg/mL norfloxacin
mcrC__U_N0075_r1
mcrC__U_N0075_r2
mcrC__U_N0075_r3
mcrC upregulation, 0.075 mg/mL norfloxacin
MC_Val_G1
MC_Val_G2
MC_Val_G3
MC_Val_G5
MDS42
MDS42 1
MDS42 2
MDS42 + 20 ug/ml bicyclomycin
MDS42 + 20 ug/ml bicyclomycin 1
MDS42 + 20 ug/ml bicyclomycin 2
MDS42, biological rep 1
MDS42, biological rep 2
MDS42, biological rep 3
MDS42, biological rep 4
MDS42, biological rep 5
MDS42, biological rep 6
MDS42, biological rep 7
MDS42 DNA isolated from early-phase DNA-protein complexes
MDS42 exponentially grown in the minimal medium
MDS42, heat shock, biological rep 1
MDS42, heat shock, biological rep 2
MDS42, heat shock, biological rep 3
MDS42 RNAP 1
MDS42 RNAP 2
MDS42 ΔnusA*
MDS42 ΔnusA* 1
MDS42 ΔnusA* 2
MDS42 ΔnusA* RNAP 1
MDS42 ΔnusA* RNAP 2
MDS42 ΔnusG
MDS42 ΔnusG 1
MDS42 ΔnusG 2
MDS42 ΔnusG RNAP 1
MDS42 ΔnusG RNAP 2
ME0052
ME0053
ME0054
ME0055
media: Defined MOPS Minimal + 0.4% Glycerol
media: Defined MOPS Minimal + 0.4% Glycerol +0.5% 2-DG
media: Defined MOPS Minimal + 0.4% Glycerol +0.5% aMG
media: Defined MOPS Rich + 0.2% Glucose
media: Defined MOPS Rich+ 0.4% Glycerol
media: Defined MOPS Rich + 0.4% Glycerol +0.5% aMG
media: fully supplemented MOPS glucose media
media: LB
media: LB + 0.5% aMG
media: LB broth
media: M9
media: MEM-HEPES supplemented with 0.1% Glucose and 250nM Fe(NO3)2
Media:Minimal salts + 20 mM trimethylamine-N-oxide
Media:Minimal salts + 20 mM trimethylamine-N-oxide +2.5 mM sodium nitrite
media: MOPS EZ Rich Defined Media
Median of intensity data was extracted, LOESS normalized and an ANOVA model was fit using the MAANOVA package in R. The Log (Cy5/Cy3) values were extracted from the VG matrix of the model fit.
media: Tryptone broth buffered to pH 7 supplemented with 22 mM glucose
medium: ACSH
medium: defined mineral medium with 1 g/l glucose
medium: LB
medium: M63
medium: M9 medium supplemented with 0.2% glucose and 5% LB
medium: MOPS
medium: Neidhardt's EZ Rich Defined Medium (Teknova, USA)
medium: SB broth
medium: SynH
medium: SynH_Acids_Amides
medium: SynH_LT
medium: SynH + LTs
medium: SynH w/o osmoprotectants
medium: SynH w/o osmoprotectants + LTs
menB__U_N0075_r1
menB__U_N0075_r2
menB__U_N0075_r3
menB upregulation, 0.075 mg/mL norfloxacin
menC__U_N0075_r1
menC__U_N0075_r2
menC__U_N0075_r3
menC upregulation, 0.075 mg/mL norfloxacin
Merge the replicates for each sample. For example, for sample HS15min, merge HS15min_r1.HiSeq.fastq.gz, HS15min_r2.HiSeq.fastq.gz and HS15min_r3.HiSeq.fastq.gz to one fastq file
metabolic response: BL21(DE3) is very susceptible to heptanoic acid, because several acid resistance systems stay inactive under this stress condition
metabolic response: K12 MG1655 activates various acid resistance systems under heptanoic acid stress
Metabolome data for these cultures are also provided in the supplementary file \
Methionine addition
Methylation in 0 min dnaC2 rep1
Methylation in 0 min dnaC2 rep2
Methylation in 15 min dnaC2 rep1
Methylation in 15 min dnaC2 rep2
mev data obtained from the feature extraction file used, no further normalization needed
mfd_1
MFD++_1
mfd_2
MFD++_2
mfd_3
mg1655
MG1655
MG1655 1
MG1655_1
MG1655 2
MG1655_2
MG1655 + 20 ug/ml bicyclomycin
MG1655 + 20 ug/ml bicyclomycin 1
MG1655 + 20 ug/ml bicyclomycin 2
MG1655 2' post rif
MG1655_3
MG1655 4' post rif
MG1655 6' post rif
MG1655 8' post rif
MG1655-aMG_1
MG1655+aMG_1
MG1655-aMG_2
MG1655+aMG_2
MG1655-aMG_3
MG1655+aMG_3
MG1655 at 30 Degrees
MG1655 batch
MG1655, biological rep 1
MG1655, biological rep 2
MG1655, biological rep 3
MG1655, biological rep 4
MG1655, biological rep 5
MG1655, biological rep 6
MG1655, biological rep 7
MG1655 chemostat
MG1655 ∆cspABCEG
MG1655 ∆cspABEG
MG1655 ∆cspBG
MG1655 DNA isolated from early-phase DNA-protein complexes
MG1655 DNA isolated from late-phase DNA-protein complexes
MG1655 exponentially grown in the minimal medium
MG1655, exponential phase, LB
MG1655 G181D NusA BR1, treated
MG1655 G181D NusA BR2, treated
MG1655 G181D NusA BR, treated
MG1655 G181D NusA, treated
MG1655 genomic DNA
MG1655, heat shock, biological rep 1
MG1655, heat shock, biological rep 2
MG1655, heat shock, biological rep 3
MG1655 H-NS 1
MG1655 H-NS 2
MG1655 hns-FLAG cells were grown in liquid LB medium with and without bicyclomycin (BCM) at 37 degree with shaking at 200rpm
MG1655 HPA 0mM
MG1655 HPA 10mM
MG1655_LB
MG1655_LB1
MG1655_LB2
MG1655_minus_aMG_1
MG1655_minus_aMG_2
MG1655_minus_aMG_3
MG1655 pCA24N and MG1655 pCA24N-Mfd cells were grown to an OD560 of approximately 0.25 and treated with 100 μM IPTG for 1 hour.
MG1655 PhtpG::lacZ delta lacX74/pTG2 (vector carrying inducible Ptrc::rpoH)
MG1655 PhtpG::lacZ delta lacX74/ptrc99A (control vector)
MG1655_plus_aMG_1
MG1655_plus_aMG_2
MG1655_plus_aMG_3
MG1655 R258C NusA BR1, treated
MG1655 R258C NusA BR2, treated
MG1655 R258C NusA BR, treated
MG1655 R258C NusA, treated
MG1655 (Repaired MCM 3416) in M9 + 0.2% Glucose
MG1655 (Repaired MCM 3416) in M9 + 0.2% Glucose 8' post rif
MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose
MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose 2' post rif
MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose 4' post rif
MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose 6' post rif
MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose 8' post rif
MG1655 RNA
MG1655 RNAP 1
MG1655 RNAP 2
MG1655 ∆rnr
MG1655 rpoHp3::lacZ delta lacX74
MG1655 rpoHp3::lacZ delta lacX74 hfq1::omega(Km;BclI) (hfq-)
MG1655 rpoHp3::lacZ delta lacX74 hfq1::omega(Km;BclI) (hfq-)/pLC245 (vector carrying inducible Ptrc::rpoE)
MG1655 rpoHp3::lacZ delta lacX74 hfq2::omega(Km;KpnI) (hfq+)
MG1655 rpoHp3::lacZ delta lacX74 hfq2::omega(Km;KpnI) (hfq+)/pLC245 (vector carrying inducible Ptrc::rpoE)
MG1655 rpoHp3::lacZ delta lacX74 hfq2::omega(Km;KpnI) (hfq+)/ptrc99A (control vector)
MG1655 rpoHp3::lacZ delta lacX74 nadB::Tn10 drseA
MG1655 rpoHp3::lacZ delta lacX74/pLC245 (vector carrying inducible Ptrc::rpoE)
MG1655 rpoHp3::lacZ delta lacX74/ptrc99A (control vector)
MG1655 rpoS mutants
MG1655, SD197,SB227,SF301 and SS046
MG1655,SD197,SB227,SF301 and SS046
MG1655_standard_condition_rep1
MG1655_standard_condition_rep2
MG1655star-glucose
MG1655star-mannose
MG1655star-mucus-P1
MG1655star-mucus-P2
MG1655 starvation
MG1655, stationary phase, LB
MG1655 strain of E. coli K-12
MG1655 transcriptome from batch growth_1
MG1655 transcriptome from batch growth_2
MG1655 transcriptome from chemostat growth_1
MG1655 transcriptome from chemostat growth_2
MG1655 transcriptome from starvation growth_1
MG1655 transcriptome from starvation growth_2
MG1655_under_ColdShock_rep1
MG1655_under_ColdShock_rep2
MG1655_under_HeatShock_rep2
MG1655_under_Low_pH_rep1
MG1655_under_minimal_C&N_source_rep1
MG1655_under_minimal_C&N_source_rep2
MG1655_under_minimal_C_source_rep1
MG1655_under_minimal_C_source_rep2
MG1655_under_minimal_N_source_rep1
MG1655_under_minimal_N_source_rep2
MG1655_under_Osmotic_Stress_rep1
MG1655_under_Osmotic_Stress_rep2
MG1655_under_Oxidative_Stress_rep1
MG1655_under_Oxidative_Stress_rep2
MG1655_UV_Treatment_rep1
MG1655_UV_Treatment_rep2
MG1655_vector_1
MG1655_vector_2
MG1655 wild type
MG1655 WT NusA BR1, control
MG1655 WT NusA BR2, control
MG1655 WT NusA BR, control
MG1655 WT NusA, control
MG1655 Δhns RNAP 1
MG1655 Δhns RNAP 2
mg+2 (levels): baseMg
mg+2 (levels): highMg
mg+2 (levels): lowMg
mg+2 (mm): 0.005
mg+2 (mm): 0.01
mg+2 (mm): 0.02
mg+2 (mm): 0.04
mg+2 (mm): 0.08
mg+2 (mm): 0.8
mg+2 (mm): 200
mg+2 (mm): 400
mg+2 (mm): 50
mg+2 (mm): 8
MG6_replicated
MgSO4_stress_high: MURI_106
MgSO4_stress_high: MURI_107
MgSO4_stress_high: MURI_108
MgSO4_stress_high: MURI_109
MgSO4_stress_high: MURI_110
MgSO4_stress_high: MURI_111
MgSO4_stress_high: MURI_112
MgSO4_stress_high: MURI_113
MgSO4_stress_high: MURI_114
MgSO4_stress_high: MURI_115
MgSO4_stress_high: MURI_116
MgSO4_stress_high: MURI_117
MgSO4_stress_high: MURI_118
MgSO4_stress_high: MURI_119
MgSO4_stress_high: MURI_120
MgSO4_stress_high: MURI_121
MgSO4_stress_high: MURI_122
MgSO4_stress_high: MURI_123
MgSO4_stress_high: MURI_124
MgSO4_stress_high: MURI_125
MgSO4_stress_high: MURI_126
MgSO4_stress_high: MURI_127
MgSO4_stress_high: MURI_128
MgSO4_stress_high: MURI_129
MgSO4_stress_high: MURI_130
MgSO4_stress_high: MURI_131
MgSO4_stress_high: MURI_132
MgSO4_stress_high: MURI_133
MgSO4_stress_high: MURI_134
MgSO4_stress_high: MURI_135
MgSO4_stress_high: MURI_136
MgSO4_stress_high: MURI_137
MgSO4_stress_high: MURI_138
MgSO4_stress_high: MURI_139
MgSO4_stress_high: MURI_140
MgSO4_stress_high: MURI_141
MgSO4_stress_low: MURI_142
MgSO4_stress_low: MURI_143
MgSO4_stress_low: MURI_144
MgSO4_stress_low: MURI_145
MgSO4_stress_low: MURI_146
MgSO4_stress_low: MURI_147
MgSO4_stress_low: MURI_148
MgSO4_stress_low: MURI_149
MgSO4_stress_low: MURI_150
MgSO4_stress_low: MURI_151
MgSO4_stress_low: MURI_152
MgSO4_stress_low: MURI_153
MgSO4_stress_low: MURI_154
MgSO4_stress_low: MURI_155
MgSO4_stress_low: MURI_156
MgSO4_stress_low: MURI_157
MgSO4_stress_low: MURI_158
MgSO4_stress_low: MURI_159
MgSO4_stress_low: MURI_160
MgSO4_stress_low: MURI_161
MgSO4_stress_low: MURI_162
MgSO4_stress_low: MURI_163
MgSO4_stress_low: MURI_164
MgSO4_stress_low: MURI_165
MgSO4_stress_low: MURI_166
MgSO4_stress_low: MURI_167
MgSO4_stress_low: MURI_168
MgSO4_stress_low: MURI_169
MgSO4_stress_low: MURI_170
MgSO4_stress_low: MURI_171
mgtA KO rep1
mgtA KO rep2
mgtA KO rep3
mhpD KO rep1
mhpD KO rep2
mhpD KO rep3
MIC of OLA, biological rep1
MIC of OLA, biological rep2
MIC of OLA, biological rep3
Microarray analysis including pre-processing, normalisation anmd statistical analysis were performed using R (R, 2007) version 2.6 and Bioconductor (Gentleman et al. 2004, Genome Biol. 5:R80) version 2.1 as previously described by Morris et al.(2009, Physiol. Genomics 39:28-37). Propagating uncertainty in microarray analysis (puma) method was used to estimate fold changes and P-like values of differential gene expression analysis (Pearson et al. 2009, BMC Bioinformatics 10:211).
Microarray data analyses were performed using Acuity 4.0 software. Slides were normalized using standard ratio-based methods. Data were analyzed based upon Log ratio (635/532) values. Genes were included in the final dataset that exhibit significance based upon a very conservative FDR less than 2.5% [27] and at least 2.0-fold comparative regulation.
Microarray data analysis was performed with free software genArise, developed in the Computing Unit of Cellular Physiology Institute of UNAM (http://www.ifc.unam.mx/genarise/). GenArise carry out a number of transformations: background correction, normalization, intensity filter, replicates analysis and selecting differentially expressed genes. The goal of genArise is to identify which genes show good evidence of being differentially expressed. The software identifies differential expressed genes by calculating an intensity-dependent z-score. Using a sliding window algorithm to calculate the mean and standard deviation within a window surrounding each data point, and define a z-score where z measures the number of standard deviations a data is from the mean.
Microarray data normalization
Microarray data were processed using a custom R software for the finite hybridisation (FH) model (Ono et al., 2008, Bioinformatics 24, p1278).
Microarray data were processed using custom scripts written in R based on the finite hybridisation (FH) model (Ono et al, 2008) and the thermodynamic model of non-specific binding (NSB) on short nucleotide microarrays (Furusawa et al, 2009).
Microarray data were processed using custom scripts written in R based on the finite hybridisation (FH) model (Ono et al, 2008) and the thermodynamic model of non-specific binding (NSB) on short nucleotide microarrays (Furusawa et al, 2009). The log10 mRNA concentration (pM) data are provided as a supplementary file on the SERIES record.
Microarray data were processed using custom scripts written in R based on the finite hybridisation (FH) model (Ono et al (2008) An improved physico-chemical model of hybridization on high-density oligonucleotide microarrays. Bioinformatics 24: 1278-1285.) and the thermodynamic model of non-specific binding (NSB) on short nucleotide microarrays (Furusawa et al, 2009).
Microarray normalization is carried out using maanova function in R program version 2.2.1. Eight arrays in one slide were globally normalized using glowess method.
Microarray suit 5.0 (Affymetrix Inc.) was used to average the scans and process the data, further data analysis was conducted using Affymetrix® Data Mining Tool (DMT 3.0).
Microarray suite 5.0
Microcin B17 Rep 1 +A-IP
Microcin B17 Rep 1 +A+IP
Microcin B17 Rep 2 +A-IP
Microcin B17 Rep 2 +A+IP
Microcin B17 Rep 3 +A-IP
Microcin B17 Rep 3 +A+IP
Microcin_IN_50mkM_3
Microcin_IN_Mu_10mkM_1
Microcin_IN_Mu_10mkM_2
Microcin_IP_50mkM_3
MIcrocin_IP_Mu_10mkM_1
Microcin_IP_Mu_10mkM_2
Mid log_cra KO_glc minimal media_aerobic
Mid log_cra KO_glc minimal media + L-tryptophan_aerobic
Mid log cultures were treated with Qiagen RNA Protect reagent following the vendor's protocol. Cells were centrifuged and stored at -80 °C for <30 days prior to use.
Mid log_mntR KO_glc minimal media_aerobic
Mid log_mntR KO_glc minimal media_anaerobic
Mid log_nac KO_glc minimal media + adenine_aerobic
Mid log_nac KO_glc minimal media_aerobic
Mid log_wildtype_glc minimal media + adenine_aerobic
Mid log_wildtype_glc minimal media_aerobic rep1
Mid log_wildtype_glc minimal media_aerobic rep2
Mid log_wildtype_glc minimal media_aerobic rep3
Mid log_wildtype_glc minimal media_anaerobic rep1
Mid log_wildtype_glc minimal media_anaerobic rep2
Mid log_wildtype_glc minimal media_anaerobic rep3
Mid log_wildtype_glc minimal media + L-tryptophan_aerobic
minD__U_N0075_r1
minD__U_N0075_r2
minD__U_N0075_r3
minD upregulation, 0.075 mg/mL norfloxacin
minE__U_N0075_r1
minE__U_N0075_r2
minE__U_N0075_r3
minE upregulation, 0.075 mg/mL norfloxacin
MiSeq for base calling
Mixed model analysis was conducted as previously described (Madsen, et al., 2006) excluding slide region and slide-by-region interaction effects. The value column was not used for analysis or in publication. The normalized values for duplicate spots were averaged within each array to produce one normalized measure of expression for each of the probe sequences and each of the RNA samples. [mean log transformed median centered lowess normalized signal intensity]
MMAcetat
mMaple3_0min
mMaple3_10min
mMaple3_15min
mMaple3_1min
mMaple3_2min
mMaple3_4min
mMaple3_6min
mMaple3_8min
MMPyruvat
mntR KO
mntR KO -O2
Mock community
molecule subtype: DMS-modified mRNA
molecule subtype: In vitro synthesized RNase P (rnpB) RNA
molecule subtype: mRNA
molecule subtype: nascent 3' RNA
molecule subtype: ribosome-depeleted RNA
molecule subtype: ribosome protected mRNA
molecule subtype: Ribosome protected mRNA
molecule subtype: rRNA-depleted total RNA
molecule subtype: total RNA
molecule subtype: Total RNA
molecule subtype: Total RNA (Cytosolic fraction)
molecule subtype: Total RNA (Nucleoid fraction)
molecule subtype: total RNA (ribosome-depleted)
molecule subtype: total RNA, rRNA depleted
Monoclonal antibody for HA (12CA5)
Monoclonal antibody for NusA (1NA1)
Monoclonal antibody for RNA polymerase Beta' subunit (NT73)
Monoclonal antibody for Sigma70 (2G10)
morphology: a
morphology: b
morphology: c
morphology: Coliform
morphology: Filamented
morphology: Reverted (reverted back from a Filamented shape into a coli shape)
morphology: Transition (from Coli into Filamented)
mouse feces
Mouse kidneys were homogonized in RNALater solution (Ambion) and bacterial titers were taken.  Samples were pooled, and centrifuged as described below
M-P0h_r1_HiSeq
M-P0h_r2_HiSeq
M-P2h_r1_HiSeq
M-P2h_r2_HiSeq
M-P4h_r1_HiSeq
M-P4h_r2_HiSeq
M-P4h_r3_HiSeq
mRNA
mRNA fragments were size selected via gel purification, and ligated to 5' adenylated DNA oligo. After reverse transcription, the single stranded DNA was circularized, and PCR amplified (Oh et al., 2011; Li et al., 2014; Rouskin et al., 2014).
mRNA-seq 10 min after shift to 10°C in WT cells
mRNA-seq 2 hr after shift to 10°C in WT cells
mRNA-seq 30 min after shift to 10°C in WT cells
mRNA-seq 37°C in WT with control plasmid
mRNA-seq 37°C in WT with plasmid expressing mini-ORF CUA
mRNA-seq 37°C in WT with plasmid expressing mini-ORF CUG
mRNA-seq 3 hr after shift to 10°C in WT cells
mRNA-seq 4 hr after shift to 10°C in WT cells
mRNA-seq 6 hr after shift to 10°C in WT cells
mRNA-seq 8 hr after shift to 10°C in ∆cspABEG cells
mRNA-seq 8 hr after shift to 10°C in WT cells
mRNA-seq at 37°C in ∆cspABCEG cells
mRNA-seq at 37°C in WT cells_1
mRNA-seq at 37°C in WT cells_2
mRNA-seq in rich defined media
mRNA-seq MicL-S t0
mRNA-seq MicL-S t10
mRNA-seq MicL-S t20
mRNA-seq MicL-S t4
mRNA-seq MicL t0
mRNA-seq MicL t10
mRNA-seq MicL t20
mRNA-seq MicL t4
mRNA-seq Vector t0
mRNA-seq Vector t20
mRNA-seq with barcode (Illumina  TruSeq Index 1-5)
mRNA-seq WT t10
mRNA-seq WT t4
mrna synthesis: in vitro MgCl2
mrna synthesis: in vitro MgCl2 +GreAB
mrna synthesis: in vitro MnCl2
mrna synthesis: in vitro MnCl2 +GreAB
mrna synthesis: in vivo
MT_12h_rep1
MT_12h_rep2
MT_24h_rep1
MT_24h_rep2
MT_48h_rep1
MT_48h_rep2
MT_6h_rep1
MT_6h_rep2
MukB 22°C
MukB 37°C
MukBDA 22°C
MukB deltamatP 22°C
MukBEQ 22°C
MukBEQ deltamatP 22°C
murI__U_N0075_r1
murI__U_N0075_r2
murI__U_N0075_r3
murI upregulation, 0.075 mg/mL norfloxacin
musgs presence: -
musgs presence: MuSGS
mutant
Mutant B8_0.8%Bu_1.5h_rep1
Mutant B8_0.8%Bu_1.5h_rep2
Mutant B8_0.8%Bu_1.5h_rep3
Mutant B8, 0.8%butanol,1.5h,replicate 1
Mutant B8, 0.8%butanol,1.5h,replicate 2
Mutant B8, 0.8%butanol,1.5h,replicate 3
mutant E1, biological rep1
mutant E1, biological rep2
mutant E1, biological rep3
mutant E. coli, after butanol treatment
mutant E. coli, before butanol treatment
Mutant E. coli O157 treated with 6 ug/ml triclosan for 30 min, biological rep 1
Mutant E. coli O157 treated with 6 ug/ml triclosan for 30 min, biological rep 2
Mutant E. coli O157 treated with 6 ug/ml triclosan for 30 min, biological rep 3
Mutant E. coli O157 untreated, biological rep 1
Mutant E. coli O157 untreated, biological rep 2
Mutant E. coli O157 untreated, biological rep 3
Mutant (EP61) T0 RNA rep 1
Mutant (EP61) T0 RNA rep 2
Mutant (EP61) T0 RP rep 1
Mutant (EP61) T0 RP rep 2
Mutant (EP61) T1 RNA rep 1
Mutant (EP61) T1 RNA rep 2
Mutant (EP61) T1 RP rep 1
Mutant (EP61) T1 RP rep 2
Mutant (EP61) T2 RNA rep 1
Mutant (EP61) T2 RNA rep 2
Mutant (EP61) T2 RP rep 1
Mutant (EP61) T2 RP rep 2
Mutant (RL2325) RNA-seq
mutant SdiA1E11
MutRep1_0min
MutRep1_10min
MutRep1_15min
MutRep1_20min
MutRep1_2min
MutRep1_4min
MutRep1_6min
MutRep1_8min
MutRep2_0min
MutRep2_10min
MutRep2_15min
MutRep2_20min
MutRep2_2min
MutRep2_4min
MutRep2_6min
MutRep2_8min
MW30 (rpoS)
MW30 (rpoS), LB, exponential phase
MW30 rpoS, LB, exponential phase
MW30 (rpoS), LB, stationary phase
MW30 rpoS, LB, stationary phase
MY4_replicated
N172-1
N172-2
N30-1
N30-2
N30-3
N30-4
N3433 (rne deletion) pBADRNE in LB at 30 degrees C
N3433 (rne deletion) pBAD-RNE w/out Arabinose in LB at 30 degrees C
N3433 (rne deletion) pNRNE5 at 30 degrees C
N3433 (rne deletion) pRNG3 at 30 degrees C
N3433 (rng deletion) in LB at 30 degrees C
N3433 (rng deletion) LB at 30 C
N3433 (wt) in LB at 30 degrees C
N3433 (wt) pPM30 in LB at 30 degrees C
N3433 (wt) pRNG3 in LB at 30 degrees
N3433 (wt) vs N3433 (rne deletion) pBADRNE in LB at 30 degrees C Trial B *
N3433 (wt) vs N3433 (rne deletion) pBAD-RNE w/out Arabinose in LB at 30 degrees Trial A
N3433 (wt) vs N3433 (rne deletion) pNRNE5 at 30 degrees C Trial A *
N3433 (wt) vs N3433 (rne deletion) pNRNE5 at 30 degrees C Trial B *
N3433 (wt) vs N3433 (rne deletion) pRNG3 at 30 degrees C Trial A *
N3433 (wt) vs N3433 (rne deletion) pRNG3 at 30 degrees C Trial B *
N3433 (wt) vs N3433 (rng deletion) in LB at 30 degrees C Trial B
N3433 (wt)  vs N3433 (rng deletion) LB at 30 C Trial A *
N3433 (wt) vs N3433 (wt) pRNG3 in LB at 30 degrees Trial A *
N3433 (wt) vs N3433 (wt) pRNG3 in LB at 30 degrees Trial B *
NA
N/A
na+1 (levels): baseNa
na+1 (levels): highNa
na+1 (mm): 100
na+1 (mm): 200
na+1 (mm): 300
na+1 (mm): 5
Nac_ChIPSeq
nac KO
nac KO + ade
NaCl replicate 1
NaCl replicate 2
NaCl replicate 3
NaCl_stress: MURI_061
NaCl_stress: MURI_063
NaCl_stress: MURI_064
NaCl_stress: MURI_065
NaCl_stress: MURI_066
NaCl_stress: MURI_067
NaCl_stress: MURI_068
NaCl_stress: MURI_069
NaCl_stress: MURI_070
NaCl_stress: MURI_071
NaCl_stress: MURI_072
NaCl_stress: MURI_073
NaCl_stress: MURI_074
NaCl_stress: MURI_075
NaCl_stress: MURI_076
NaCl_stress: MURI_077
NaCl_stress: MURI_079
NaCl_stress: MURI_080
NaCl_stress: MURI_081
NaCl_stress: MURI_082
NaCl_stress: MURI_083
NaCl_stress: MURI_084
Nac_RNASeq
NaOH replicate 1
NaOH replicate 3
narXL anaerobic plus NO2
narXLP anaerobic plus NO2
narXLP rep 1
narXLP rep 2
narXLP rep 3
narXL rep 1
narXL rep 2
narXL rep 3
narXL rep 4
n-Butanol (0.8%, v/v) was added at 0.8 OD660 and further incubated for 1.5 h.
NC
neo_0min
neo_10min
neo_15min
neo_1min
neo_2min
neo_4min
neo_6min
neo_8min
Next, a linear model was built for each comparison using the R LIMMA package and statistics for differential expression analysis were computed. To filter for differential expression, two fold or three-fold change with a FDR ≤0.05 were used as the threshold.
Next, data were normalized, by averaging the log ratios resulting from all spots printed by a
NEXTflexRapid Directional RNA-Seq library kit
NFNT
ngs platform: Illumina HiSeq
ngs platform: Illumina MiSeq
NimbleScan software package, version 2.5 (Roche NimbleGen) was used to extract the scanned data, which was subsequently qunatile normalized using the statistical program R. The sample data table contains the log2 ratio of the IP/Input after data was quantile normalized.
Nineteen hours after experiment start, antibiotic (Gentamicin Sulfate (MP Biomedical, Cat No. 1676045, Santa Ana, CA, USA)) was introducing into the cultures. Antibiotic concentration varied from one sample to the next from 0 to 150 ug/mL in 25 ug/mL steps. Thirty hours later, samples were fixed in RNA Later II ((ACROS, Cat. No. 41678, New Jersey, USA)). Samples were stored at -75C until return to Earth for analyses.
NN2_0018_1
NN2_0018_2
(-NO)1
(+NO)1
(-NO)2
(+NO)2
(-NO)3
(+NO)3
No further treatment was applied.
no inhibitor: equivalent volume of DMSO added
Non-challenged Library
Non-crosslinked DNA
None
non-sorted E. coli cells from culture 1
non-sorted E. coli cells from culture 2
Non-treated, fur mutant sample at T0, biological rep 1
Non-treated, fur mutant sample at T0, biological rep 2
Non-treated, WT control at T0, biological rep 1
Non-treated, WT control at T0, biological rep 2
Non-treatment
NorflIP Input ParC-flag 1
NorflIP Input ParC-flag 2
NorflIP Input ParE-flag 1
NorflIP IP ParC-flag 1
NorflIP IP ParC-flag 2
NorflIP IP ParE-flag 1
NormalData=transform.madata(LogData, method=c(\
Normalisation: Counts were normalised by applying a single, sample-specific scaling factor.  To calculate this scaling factor, we implemented the median of ratios normalisation of DESeq software (Anders, S. and Huber, W. (2010) Differential expression analysis for sequence count data. Genome Biol, 11, R106) using R.
Normalization factors were calculated using a non-linear Loess model using csaw (Bioconductor)
Normalization is performed by TREBAX, using MA-plots. MA-plots can reveal the spot artifacts globally and show the intensity-dependent logarithmic ratio of raw microarray data. In MA-plots, we calculate two parameters, average of logarithmic transferred intensity As=(log(Ts)+log(Rs))/2 and logarithmic ratio of intensity Ms=log(Ts/Rs) Here, Ts and Rs are the intensity of target and control experiments for sth spot, respectively.By plotting values of As on the abscissa and Ms on the ordinate of a coordinate system, it is possible to evaluate the bias error with respects to the average logarithmic intensities. Normalized log ratio M’’s is estimated as the difference between Ms and baseline M’s. Here, using a relation between Ms and As, (Ms=f(As)+es, es is the difference between Ms and f(As) for gene s) by MA plot; the baseline for sth spot is estimated by M’=f(A). The genes whose signal intensity is regarded as zero are eliminated in the present analysis. With this methodology, it is assumed that there is no large error due to expression intensity in the majority of the spots and that expression change does not occur on the majority of the spots.
normalization of graphs to the total number of mapped reads per library using READemption 0.3.7
normalization subtracting array-median log2 ratio.
normalized as described before (Tong et al. 2004 BBRC). Briefly, spots were excluded from
Normalized decay values with average of stable genes ssrA, ssrS, and rnpB
Normalized FPKM values were generated from the raw gene counts by custom scripts that calculated and applied a trimmed mean of M-values (TMM) factor using edgeR version 3.8.6.
Normalized log (2) ratio of Cy5/Cy3, normalized using lowess
normalized using lcDNA
normalizing: convert counts in RPKM using Excel
norm.temp<-cbind(NormalData$metarow, NormalData$metacol,NormalData$row, NormalData$col, NormalData$geneID, NormalData$data)
No specific treatment was done. Samples were collected in the mid-log growth phase for expression analysis
no treatment
No treatment
No treatment (control sample).
No treatment, just comparison of RNAs from wild type and mutant.
No treatment were studied in this experience
No triclosan treatment
nrdA__U_N0075_r1
nrdA__U_N0075_r2
nrdA__U_N0075_r3
nrdA upregulation, 0.075 mg/mL norfloxacin
nrdB__U_N0075_r1
nrdB__U_N0075_r3
nrdB upregulation, 0.075 mg/mL norfloxacin
N-RNaseE (BZ453)  in   M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
N-RNaseE (BZ453)  in  M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
N-RNaseE (BZ453) in   M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
N-RNaseE (BZ453) in  M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 1.5' post rif
N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 3' post rif
N-RNaseE (BZ453)  in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 4.5' post rif
N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 4.5' post rif
N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 6' post rif
NsrR_ChIPSeq_rep1
NsrR_ChIPSeq_rep2
NsrR_ChIPSeq_rep3
NsrR_Flagtag_rep1
NsrR_Flagtag_rep2
NsrR_Flagtag_rep3
NsrR_input
NTG-treated E. coli imp fabI(G93V) [E. coli IFN4]
NTG-treated E. coli imp fabI(G93V) [E. coli IFN5]
ntg treatment: yes
NtrC_ChIPSeq
nucleic_acid_extraction | ChIP was performed as previously described (Grainger et al, 2004) with some modifications to the protdegree Col. Cells were grown aerobically at 37degree C to the desired OD600 and formaldehyde was added to a final concentration of 1%. After 20 min of incubation, glycine was added to a final concentration of 0.5 M to quench the reaction and incubated for a further 5 min. Cross-linked cells were harvested by centrifugation and washed twice with ice-cold TBS (pH 7.5). Cells were resuspended in 1 ml of lysis buffer (10 mM Tris [pH 8.0], 20% sucrose, 50 mM NaCl, 10 mM EDTA, 20 mg/ml lysozyme and 0.1 mg/ml RNase A) and incubated at 37degree C for 30 min. Following lysis, 3 ml immunoprecipitation (IP) buffer (50 mM HEPES-KOH [pH 7.5], 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, 0.1% sodium dodecyl sulfate [SDS] and PMSF [final concentration 1 mM]) was added and the lysate passed through a French pressure cell twice. 2 ml aliquots were removed and the DNA sheared to an average size of ~200 bp using a Bioruptor (Diagenode) with 30 cycles of 30 sec on/off at high setting. Insoluble cellular matter was removed by centrifugation for 10 min at 4degree C, and the supernatant was split into two 800 microl aliquots. The remaining 400 microl was kept to check the size of the DNA fragments.<br><br>Each 800 microl aliquot was incubated with 20 microl Protein A/G UltraLink Resin (Pierce) on a rotary shaker for 45 min at room temperature to get rid of complexes binding to the resin non-specifically. The supernatant was then removed and incubated with either no antibody (mdegree Ck-IP), FLAG mouse mondegree Clonal antibody (Sigma-Aldrich) or RNAP Beta subunit mouse mondegree Clonal (Nedegree Clone) and 30 microl Protein A/G UltraLink Resin, pre-incubated with 1mg/ml bovine serum albumin (BSA) in TBS, on a rotary shaker at 4degree C overnight (FLAG antibody) or at room temperature for 90 min (RNAP Beta subunit antibody). Samples were washed once with IP buffer, twice with IP buffer + 500 mM NaCl, once with wash buffer (10 mM Tris [pH 8.0], 250 mM LiCl, 1 mM EDTA, 0.5% Nonidet P-40 and 0.5% sodium deoxycholate) and once with TE (pH 7.5). Immunoprecipitated complexes were eluted in 100 microl elution buffer (10 mM Tris [pH 7.5], 10 mM EDTA and 1% SDS) at 65degree C for 20 min.
Numer of reads per gene were counted using Bioconductor Rsubread package v1.12.6
nupC__U_N0075_r1
nupC__U_N0075_r2
nupC__U_N0075_r3
nupC upregulation, 0.075 mg/mL norfloxacin
NusA ChIP-chip in E. coli K-12 MG1655 cells (Dataset 56226)
NusA ChIP-chip in E. coli K-12 MG1655 cells (Dataset 61392)
NusA ChIP-chip in E. coli K-12 MG1655 cells (Dataset 64131)
NusA ChIP in E. coli K-12 MG1655 cells
NusG ChIP-chip in E. coli K-12 MG1655 cells (Dataset 70568)
NusG ChIP-chip in E. coli K-12 MG1655 HA3::nusG cells (Dataset 62261)
NusG ChIP-chip in E. coli K-12 MG1655 HA3::nusG cells (Dataset 62263)
NusG ChIP in E. coli K-12 MG1655 cells
NusG ChIP in E. coli K-12 MG1655 HA3::nusG cells
∆nusG UvsW_replicate1
∆nusG UvsW_replicate2
∆nusG UvsW_replicate3
NZ502_12%Glu
NZ502_5%Glu
O103 no.1 (strain 10828) replicate 1
O103 no.1 (strain 10828) replicate 2
O103 no.2 (strain 11117) replicate 1
O103 no.2 (strain 11117) replicate 2
O103 no.3 (strain 11711) replicate 1
O103 no.3 (strain 11711) replicate 2
O103 no.4 (strain 11845) replicate 1
O103 no.4 (strain 11845) replicate 2
O103 no.5 (strain 12009) replicate 1
O103 no.5 (strain 12009) replicate 2
O103 no.6 (strain PMK5) replicate 1
O103 no.6 (strain PMK5) replicate 2
O111 no.1 (strain 11109) replicate 1
O111 no.1 (strain 11109) replicate 2
O111 no.2 (strain 11128) replicate 1
O111 no.2 (strain 11128) replicate 2
O111 no.3 (strain 11619) replicate 1
O111 no.3 (strain 11619) replicate 2
O111 no.4 (strain 11788) replicate 1
O111 no.4 (strain 11788) replicate 2
O111 no.5 (strain 13369) replicate 1
O111 no.5 (strain 13369) replicate 2
O111 no.6 (strain ED71) replicate 1
O111 no.6 (strain ED71) replicate 2
O157_CL MC fraction vs control
O157:H7 cells were grown to mid-log phase in Luria broth with or without 0.8% bile salts.
O157:H7 EDL933 in LB
O157:H7 EDL933 sdhA in LB
O157:H7 EDL933 sdhA in LB with FA
O157:H7 strain EDL933, 100 mcg/ml bicyclomycin 20 min, exponential phase
O157:H7 strain EDL933, control sample, exponential phase
O157 no.2 (strain 980938) replicate 1
O157 no.2 (strain 980938) replicate 2
O157 no.3 (strain 980706) replicate 1
O157 no.3 (strain 980706) replicate 2
O157 no.4 (strain 990281) replicate 1
O157 no.4 (strain 990281) replicate 2
O157 no.5 (strain 980551) replicate 1
O157 no.5 (strain 980551) replicate 2
O157 no.6 (strain 990570) replicate 1
O157 no.6 (strain 990570) replicate 2
O157 no.7 (strain 981456) replicate 1
O157 no.7 (strain 981456) replicate 2
O157 no.8 (strain 982243) replicate 1
O157 no.8 (strain 982243) replicate 2
O157 no.9 (strain 981795) replicate 1
O157 no.9 (strain 981795) replicate 2
O157 strain Sakai
O26 no.1 (strain 11044) replicate 1
O26 no.1 (strain 11044) replicate 2
O26 no.2 (strain 11368) replicate 1
O26 no.2 (strain 11368) replicate 2
O26 no.3 (strain 11656) replicate 1
O26 no.3 (strain 11656) replicate 2
O26 no.4 (strain 12719) replicate 1
O26 no.4 (strain 12719) replicate 2
O26 no.5 (strain 12929) replicate 1
O26 no.5 (strain 12929) replicate 2
O26 no.6 (strain 13065) replicate 1
O26 no.6 (strain 13065) replicate 2
O26 no.7 (strain 13247) replicate 1
O26 no.7 (strain 13247) replicate 2
O26 no.8 (strain ED411) replicate 1
O26 no.8 (strain ED411) replicate 2
O500_1
O500_2
O55:H6 ICC219 replicate 1
O55:H6 ICC219 replicate 2
O55:H6 ICC221 replicate 1
O55:H6 ICC221 replicate 2
O55:H6 ICC222 replicate 1
O55:H6 ICC222 replicate 2
O55:H7 st58 replicate 1
O55:H7 st58 replicate 2
O55:H7 st957 replicate 1
O55:H7 st957 replicate 2
O55:H7 TB182A replicate 1
O55:H7 TB182A replicate 2
O55:H7 WC211 replicate 1
O55:H7 WC211 replicate 2
O55:H7 WC416 replicate 1
O55:H7 WC416 replicate 2
OD :0.1
OD: 0.1
OD :0.3
OD: 0.3
OD :0.4
OD: 0.4
OD: 0.5
OD :0.6
OD: 0.6
od: 0.7
od: 0.8
OD :1.0
OD: 1.0
OD :1.3
OD: 1.3
OD :1.7
OD: 1.7
OD :2.7
OD: 2.7
OD :4.5
OD 4.5
OD: 4.5
OD :4.7
OD: 4.7
OD :4.8
OD: 4.8
od600: 0.4
OD600 15 units of cells were harvested for each ChIP procedure. Cells were harvested by centrifugation at 4,000 rpm for 8 min at room temperature and resuspended in 50 ml of pre-warmed PBS (37°C) in a 250 ml flask. DNA-protein and protein-protein interactions were cross-linked by adding 1,351 µl of formaldehyde drop-wise to a final concentration of 1%. Samples were cross-linked at room temperature with stirring for 30 min. Glycine was added to a final concentration of 0.125 M with stirring for 5 min at room temperature. Cells were centrifuged at 4,000 rpm for 8 min at 4°C and the supernatant removed. The pellet was re-suspended in 0.6 ml of lysis buffer containing 50 mM Tris-HCl, 10 mM EDTA, 1% SDS and incubated on ice for 10 min. 1.4 ml of IP dilution buffer (20 mM Tris-HCl pH 8.1, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.01% SDS, Roche protease inhibitor cocktail) was added and the chromatin was sonicated on ice in a 5ml tube to reduce the DNA length to an average size of approximately 500 bp using the Sanyo/MES Soniprep sonicator (8 bursts at an amplitude 10 microns for 30 seconds, with 1 minute cooling between bursts). This was transferred to a 2 ml microfuge tube and spun at 13,200 rpm for 10 min at 4°C. Supernatant was removed and 1 ml dilution buffer added.The chromatin material was precleared by adding 50 µl of normal rabbit immunoglobulin G (IgG, 1 mg/ml, Millipore). Samples were incubated for 1 h at 4°C on a rotating wheel. 100 µl of homogenous protein G-agarose (Roche) was added to the precleared chromatin and the samples were incubated for 3-5 h at 4°C on a rotating wheel. Samples were centrifuged at 4,000 rpm for 2 min at 4°C and this supernatant was used to set up immunoprecipitation reactions. 200 µl chromatin was removed and used as an input sample. Experimental immunoprecipitation were set up using 1,350 µl chromatin and 3.3 µg/µl of anti-FLAG antibody (Sigma). Mock immunoprecipitation 1,350 µl chromatin and 10 µg of normal mouse IgG (Millipore). Samples were incubated overnight on a rotating wheel at 4°C. Samples were centrifuged at 13,000 rpm for 5 min at 4°C and the supernatant was transferred to 2 ml microfuge tubes. 50 µl of protein G-agarose was added to each sample and incubated at 4°C for 3 h. The samples were centrifuged at 7,500 rpm for 2 min at 4°C to pellet the protein G-agarose beads. The supernatant was removed and the protein G-agarose beads were carefully washed. 91 For each wash, the wash buffer was added; the samples were vortexed briefly and were centrifuged at 7,500 rpm for 2 min at 4°C. The samples were left to stand on ice for 1 min before removing the supernatant. The washes were carried out in the following sequence: The beads were washed twice with 750 µl of cold IP wash buffer 1 containing 20 mM Tris-HCl (pH 8.1), 50 mM NaCl, 2mM EDTA, 1% Triton X-100, 0.1% SDS. The beads were transferred to a 1.5 ml microfuge tube after the first wash. The beads were washed once with 750 µl of cold IP wash buffer 2 containing 10 mM Tris-HCl (pH 8.1), 250 mM LiCl, 1 mM EDTA, 1% NP-40, 1% deoxycholic acid. The beads were washed twice with 750 µl of ice-cold TE buffer containing 10 mM Tris base (pH 8) and 1 mM EDTA. DNA-protein-antibody complexes were eluted from the protein G-agarose beads by adding 225 µl of IP elution buffer containing 100 mM NaHCO3 and 1% SDS. The beads were resuspended in IP elution buffer, briefly vortexed and centrifuged at 7,500 rpm for 2 min at room temperature. The supernatant was collected in fresh 1.5 ml microfuge tubes. The bead pellets in the original tubes were resuspended in 225 µl of IP elution buffer again and briefly vortexed and centrifuged at 7,500 rpm for 2 min. IP and input samples were thawed on ice. 0.1 µl of RNase A (10 mg/ml, ICN Biochemicals) and 16 µl of 5 M NaCl (to a final concentration of 0.3 M) was added to the input sample. Similarly, 0.2 µl of RNase A and 27 µl of 5 M NaCl (to a final concentration of 0.3 M) was added to each IP sample. All samples including the input DNA were incubated at 65°C for 6 h to reverse cross-links. 9 µl of Proteinase K (10 mg/ml, GibcoBRL) was added to each sample and incubated overnight at 45°C. 2 µl of yeast tRNA (5mg/ml, Invitrogen) was added to each sample followed by 250 µl of phenol (pH 8, Sigma) and 250 µl of chloroform. Samples were centrifuged at 13,000 rpm for 5 min at room temperature. The aqueous layer was collected in fresh 1.5 ml centrifuge tubes and 500 µl of chloroform was added. The samples were vortexed and centrifuged at 13,000 rpm for 5 min and room temperature. The aqueous layer was transferred to a 2 ml microfuge tube. 5 µg of glycogen (5 mg/ml, Roche), 1 µl of tRNA (5 mg/ml, Invitrogen) and 50 µl of 3 M NaAc (pH 5.2) was added to each sample and mixed well. The DNA was precipitated with 1,375 µl of 95% ethanol and incubated at -80°C for 1 h. The samples were centrifuged at 13,000 rpm for 20 min at 4°C. The DNA pellets were washed with 500 µl of ice-cold 70% ethanol and centrifuged at 13,000 rpm for 5 min at 4°C. The supernatant was removed and the samples were air-dried for 10-15 min. DNA pellets of IP samples were resuspended in 50 µl nuclease-free H2O. Input DNA samples were resuspended in 100 µl of nuclease-free H2O. Samples were incubated at 37°C for 1 h.
OD :OD 0.1
of (F_r-B_r)/(F_g-B_g), where F_r, B_r, F_g and B_g represent the median Cy5 (red)
Omega17_1
Omega17_2
Omega76_1
Omega76_2
OmpFrecode_f.wig: NC_000913.2
OmpFrecode_r.wig: NC_000913.2
ompR_1
ompR_2
OmpR_ChIPSeq
ompR mutant rep 1
ompR mutant rep 2
OmpR NaCl 1
OmpR NaCl 2
∆ompR pH 5.6 A
∆ompR pH 5.6 B
∆ompR pH 5.6 C
∆ompR pH 7.2+15% sucrose A
∆ompR pH 7.2+15% sucrose B
One cell pellet from each condition and sampling time was thawed on ice; total RNA was isolated by RNAsnap™ (Stead et al., 2012, Nucleic Acids Res). DNA contamination was removed by two treatments with Turbo-DNase (Ambion; Life Technologies). Ribosomal RNA depletion was performed with the Ribo-Zero™ rRNA removal kit for Gram-negative bacteria (Epicentre) and concentrated using RNA Clean and Concentrator™ -5 columns (Zymo Research) following the manufacturer’s instructions.
One conditions: 1% (v/v) hydrogen peroxide (H2O2), 37 Ceilsus degree
One conditions: 5% (v/v) isooctane, 37 Ceilsus degree, 250rpm
One hundred µl tris-EDTA buffer (10 mM Tris-Cl, 1 mM EDTA, ph 8.0; Promega; Madison, WI) containing lysozyme (3 mg/ml; Sigma-Aldrich; St. Louis, MO) was added to each cell pellet.  The pellet was thoroughly mixed and incubated at room temperature for 10 min.  Buffer RLT (350 µl) was combined with the tris-EDTA/lysozyme cell suspension to further lyse cells.  The total volume was combined with 250 µl of 200 proof ethanol (Aaper Alcohol; Shelbyville, KY) to solubilize the cell lysate, and the entire sample was transferred to the RNeasy Mini Spin Column in a collection tube and centrifuged at 8000 x g for 15 sec at room temperature.  The silica-based membrane efficiently binds up to 100 µg of RNA longer than 200 bases.  The collection tube and eluate were discarded, and the spin column was placed in a new collection tube.  Buffer RW1 (700 µl) was applied to the column, centrifuged, and flow-through was discarded as described previously.  Twice, 500 µl of buffer RPE was applied to the spin column allowing 5 min prior to centrifugation at 8000 x g for 15 sec.  The spin column was placed in a 1.5 ml collection tube that was used for long-term storage.  In order to elute RNA from the spin column, 30 µl RNase-free water was applied directly to the membrane and centrifuged at 8000 x g for 15 sec.  The RNA eluate was stored at -80°C until evaluated for quantity, quality, and purity.
One set of fermentations were exposed to 5 mM IPTG and one set was not exposed to IPTG.  Samples were taken 0, 1, and 4 hours post-synchronization (Time S0, S1, and S4).
One volume of bacterial culture was added to two volumes of RNAprotect Bacteria Reagent (Qiagen) and RNA was extracted using RNeasy mini kit (Qiagen).  All samples were on-column treated with DNase I.
Only ideal correspondence of sequence reads to the genome in both cases was permitted. The profiles obtained for experimental and control samples were normalized by the scaling method initially offered by Affymetrix for microarray data analysis and later implemented in several other approaches. This method assumes unaffected protein occupancy at most genomic positions and quantifies the scaling factor on the basis of corrected mean values obtained after removal of 2% signals with highest and lowest intensities from both control and experimental sets.
optA1_0_Hx Rep1
optA1_0_Hx Rep2
optA1_0_Hx Rep3
optA1_120 (Low Dilution) Rep1
optA1_120 (Low Dilution) Rep2
optA1_120 (Low Dilution) Rep3
optA1_15 (Low Dilution) Rep1
optA1_15 (Low Dilution) Rep2
optA1_15 (Low Dilution) Rep3
optA1_30 (Low Dilution) Rep1
optA1_30 (Low Dilution) Rep2
optA1_30 (Low Dilution) Rep3
optA1_45 (Low Dilution) Rep1
optA1_45 (Low Dilution) Rep2
optA1_45 (Low Dilution) Rep3
optA1_60 (Low Dilution) Rep1
optA1_60 (Low Dilution) Rep2
optA1_60 (Low Dilution) Rep3
optA1_gpt_0_Hx Rep1
optA1_gpt_0_Hx Rep2
optA1_gpt_0_Hx Rep3
optA1_gpt_120 (High Dilution) Rep1
optA1_gpt_120 (High Dilution) Rep2
optA1_gpt_120 (High Dilution) Rep3
optA1_gpt_120 (Low Dilution) Rep1
optA1_gpt_120 (Low Dilution) Rep2
optA1_gpt_120 (Low Dilution) Rep3
optA1_gpt_15 (Low Dilution) Rep1
optA1_gpt_15 (Low Dilution) Rep2
optA1_gpt_15 (Low Dilution) Rep3
optA1_gpt_180 (High Dilution) Rep1
optA1_gpt_180 (High Dilution) Rep2
optA1_gpt_180 (High Dilution) Rep3
optA1_gpt_240 (High Dilution) Rep1
optA1_gpt_240 (High Dilution) Rep2
optA1_gpt_240 (High Dilution) Rep3
optA1_gpt_300 (High Dilution) Rep1
optA1_gpt_300 (High Dilution) Rep2
optA1_gpt_300 (High Dilution) Rep3
optA1_gpt_30 (Low Dilution) Rep1
optA1_gpt_30 (Low Dilution) Rep2
optA1_gpt_30 (Low Dilution) Rep3
optA1_gpt_360 (High Dilution) Rep1
optA1_gpt_360 (High Dilution) Rep2
optA1_gpt_360 (High Dilution) Rep3
optA1_gpt_360 (Low Dilution) Rep1
optA1_gpt_360 (Low Dilution) Rep2
optA1_gpt_360 (Low Dilution) Rep3
optA1_gpt_45 (Low Dilution) Rep1
optA1_gpt_45 (Low Dilution) Rep2
optA1_gpt_45 (Low Dilution) Rep3
optA1_gpt_60 (Low Dilution) Rep1
optA1_gpt_60 (Low Dilution) Rep2
optA1_gpt_60 (Low Dilution) Rep3
optA1 gpt strain with hypoxanthine
optA1 gpt strain w/o hypoxanthine 120 min at high dilution protocol
optA1 gpt strain w/o hypoxanthine 120 min at low dilution protocol
optA1 gpt strain w/o hypoxanthine 15 min at low dilution protocol
optA1 gpt strain w/o hypoxanthine 180 min at high dilution protocol
optA1 gpt strain w/o hypoxanthine 240 min at high dilution protocol
optA1 gpt strain w/o hypoxanthine 300 min at high dilution protocol
optA1 gpt strain w/o hypoxanthine 30 min at low dilution protocol
optA1 gpt strain w/o hypoxanthine 360 min at high dilution protocol
optA1 gpt strain w/o hypoxanthine 360 min at low dilution protocol
optA1 gpt strain w/o hypoxanthine 45 min at low dilution protocol
optA1 gpt strain w/o hypoxanthine 60 min at low dilution protocol
optA1 strain with hypoxanthine
optA1 strain w/o hypoxanthine 120 min at low dilution protocol
optA1 strain w/o hypoxanthine 15 min at low dilution protocol
optA1 strain w/o hypoxanthine 30 min at low dilution protocol
optA1 strain w/o hypoxanthine 45 min at low dilution protocol
optA1 strain w/o hypoxanthine 60 min at low dilution protocol
ORF1_1
ORF1_1_IPTG
ORF1_2
ORF1_2_IPTG
Original prototroph DH1 cells at log phase in monoculture
Original prototroph DH1 cells at log phase in monoculture, a technical replicate
originate during array printing, as well as during the collection and processing of samples,
origin of isolation: patient with hemolytic uremic syndrome (HUS)
OSU11, histidine depleted, >10 hrs
OSU11, histidine depleted, >10 hrs, rep 1
OSU11, histidine depleted, >10 hrs, rep 2
OSU11, histidine depleted, >10 hrs, rep 3
OSU11, histidine depleted, 10 min
OSU11, histidine depleted, 10 min, rep 1
OSU11, histidine depleted, 10 min, rep 2
OSU11, histidine depleted, 10 min, rep 3
OSU11, histidine depleted, 2 hrs
OSU11, histidine depleted, 2 hrs, rep 1
OSU11, histidine depleted, 2 hrs, rep 2
OSU11, histidine depleted, 2 hrs, rep 3
OSU11, histidine supplied, 1 mM
OSU11, histidine supplied, 1 mM, rep 1
OSU11, histidine supplied, 1 mM, rep 2
OSU11, histidine supplied, 1 mM, rep 3
OSU11, nurishment, biological rep 1
OSU11, nurishment, biological rep 2
OSU11, nurishment, biological rep 3
OSU11, starved, biological rep 1
OSU11, starved, biological rep 2
OSU11, starved, biological rep 3
OSU12-hisA, histidine depleted, >10 hrs
OSU12-hisA, histidine depleted, >10 hrs, rep 1
OSU12-hisA, histidine depleted, >10 hrs, rep 2
OSU12-hisA, histidine depleted, >10 hrs, rep 3
OSU12-hisA, histidine depleted, 10 min
OSU12-hisA, histidine depleted, 10 min, rep 1
OSU12-hisA, histidine depleted, 10 min, rep 2
OSU12-hisA, histidine depleted, 10 min, rep 3
OSU12-hisA, histidine depleted, 2 hrs
OSU12-hisA, histidine depleted, 2 hrs, rep 1
OSU12-hisA, histidine depleted, 2 hrs, rep 2
OSU12-hisA, histidine depleted, 2 hrs, rep 3
OSU12-hisA, histidine supplied, 1 mM
OSU12-hisA, histidine supplied, 1 mM, rep 1
OSU12-hisA, histidine supplied, 1 mM, rep 2
OSU12-hisA, histidine supplied, 1 mM, rep 3
OSU12-hisB, histidine depleted, >10 hrs
OSU12-hisB, histidine depleted, >10 hrs, rep 1
OSU12-hisB, histidine depleted, >10 hrs, rep 2
OSU12-hisB, histidine depleted, >10 hrs, rep 3
OSU12-hisB, histidine depleted, 10 min
OSU12-hisB, histidine depleted, 10 min, rep 1
OSU12-hisB, histidine depleted, 10 min, rep 2
OSU12-hisB, histidine depleted, 10 min, rep 3
OSU12-hisB, histidine depleted, 2 hrs
OSU12-hisB, histidine depleted, 2 hrs, rep 1
OSU12-hisB, histidine depleted, 2 hrs, rep 2
OSU12-hisB, histidine depleted, 2 hrs, rep 3
OSU12-hisB, histidine supplied, 1 mM
OSU12-hisB, histidine supplied, 1 mM, rep 1
OSU12-hisB, histidine supplied, 1 mM, rep 2
OSU12-hisB, histidine supplied, 1 mM, rep 3
OSU12-hisC, histidine depleted, >10 hrs
OSU12-hisC, histidine depleted, >10 hrs, rep 1
OSU12-hisC, histidine depleted, >10 hrs, rep 2
OSU12-hisC, histidine depleted, >10 hrs, rep 3
OSU12-hisC, histidine depleted, 10 min
OSU12-hisC, histidine depleted, 10 min, rep 1
OSU12-hisC, histidine depleted, 10 min, rep 2
OSU12-hisC, histidine depleted, 10 min, rep 3
OSU12-hisC, histidine depleted, 2 hrs
OSU12-hisC, histidine depleted, 2 hrs, rep 1
OSU12-hisC, histidine depleted, 2 hrs, rep 2
OSU12-hisC, histidine depleted, 2 hrs, rep 3
OSU12-hisC, histidine supplied, 1 mM
OSU12-hisC, histidine supplied, 1 mM, rep 1
OSU12-hisC, histidine supplied, 1 mM, rep 2
OSU12-hisC, histidine supplied, 1 mM, rep 3
OSU12-hisC, nurishment, biological rep 1
OSU12-hisC, nurishment, biological rep 2
OSU12-hisC, nurishment, biological rep 3
OSU12-hisC, starved, biological rep 1
OSU12-hisC, starved, biological rep 2
OSU12-hisC, starved, biological rep 3
OSU12-hisD, histidine depleted, 10 min
OSU12-hisD, histidine depleted, 10 min, rep 1
OSU12-hisD, histidine depleted, 10 min, rep 2
OSU12-hisD, histidine depleted, 10 min, rep 3
OSU12-hisD, histidine depleted, 2 hrs
OSU12-hisD, histidine depleted, 2 hrs, rep 1
OSU12-hisD, histidine depleted, 2 hrs, rep 2
OSU12-hisD, histidine depleted, 2 hrs, rep 3
OSU12-hisD, histidine supplied, 1 mM
OSU12-hisD, histidine supplied, 1 mM, rep 1
OSU12-hisD, histidine supplied, 1 mM, rep 2
OSU12-hisD, histidine supplied, 1 mM, rep 3
OSU12-hisF, histidine depleted, >10 hrs
OSU12-hisF, histidine depleted, >10 hrs, rep 1
OSU12-hisF, histidine depleted, >10 hrs, rep 2
OSU12-hisF, histidine depleted, >10 hrs, rep 3
OSU12-hisF, histidine depleted, 10 min
OSU12-hisF, histidine depleted, 10 min, rep 1
OSU12-hisF, histidine depleted, 10 min, rep 2
OSU12-hisF, histidine depleted, 10 min, rep 3
OSU12-hisF, histidine depleted, 2 hrs
OSU12-hisF, histidine depleted, 2 hrs, rep 1
OSU12-hisF, histidine depleted, 2 hrs, rep 2
OSU12-hisF, histidine depleted, 2 hrs, rep 3
OSU12-hisF, histidine supplied, 1 mM
OSU12-hisF, histidine supplied, 1 mM, rep 1
OSU12-hisF, histidine supplied, 1 mM, rep 2
OSU12-hisF, histidine supplied, 1 mM, rep 3
OSU12-hisG, histidine depleted, 10 min
OSU12-hisG, histidine depleted, 10 min, rep 1
OSU12-hisG, histidine depleted, 10 min, rep 2
OSU12-hisG, histidine depleted, 10 min, rep 3
OSU12-hisG, histidine depleted, 2 hrs
OSU12-hisG, histidine depleted, 2 hrs, rep 1
OSU12-hisG, histidine depleted, 2 hrs, rep 2
OSU12-hisG, histidine depleted, 2 hrs, rep 3
OSU12-hisG, histidine supplied, 1 mM
OSU12-hisG, histidine supplied, 1 mM, rep 1
OSU12-hisG, histidine supplied, 1 mM, rep 2
OSU12-hisG, histidine supplied, 1 mM, rep 3
OSU12-hisI, histidine depleted, >10 hrs
OSU12-hisI, histidine depleted, >10 hrs, rep 1
OSU12-hisI, histidine depleted, >10 hrs, rep 2
OSU12-hisI, histidine depleted, >10 hrs, rep 3
OSU12-hisI, histidine depleted, 10 min
OSU12-hisI, histidine depleted, 10 min, rep 1
OSU12-hisI, histidine depleted, 10 min, rep 2
OSU12-hisI, histidine depleted, 10 min, rep 3
OSU12-hisI, histidine depleted, 2 hrs
OSU12-hisI, histidine depleted, 2 hrs, rep 1
OSU12-hisI, histidine depleted, 2 hrs, rep 2
OSU12-hisI, histidine depleted, 2 hrs, rep 3
OSU12-hisI, histidine supplied, 1 mM
OSU12-hisI, histidine supplied, 1 mM, rep 1
OSU12-hisI, histidine supplied, 1 mM, rep 2
OSU12-hisI, histidine supplied, 1 mM, rep 3
OTHER
other extracted using alkalyne lysis preparation. Plasmid DNA was clean and concentrated using Zymo Clean & Concentrated -5 kit
outbreak: 2011 outbreak centered in Northern Germany
overexpression: -
overexpression: BglJ
overexpression: LeuO
overexpression of arT (pCA24N_arT)
overexpression of dosP (pCA24N_dosP)
overexpression of empty vector (pCA24N)
Overnight bacterial culture in BHI broth.
overnight bacterial culture in Luria Broth at 37C with shaking
overnight colony growth
Overnight culture
Overnight culture in LB medium was innoculated from a single colony. The overnight culture was diluted 1/200 into MOPS minimal medium (Neidhardt, J. Bacteriol., 1974) and incubated with shaking at 37 C until OD600=0.5 or OD600=0.3. Total culture volume 10 ml.
Overnight culture of E. coli BW25113 in LB was diluted in M9 minimal medium with supplements to OD600=0.02 and was incubated at 37 Ceilsus degree with shaking at 250rpm until its OD600 reached 0.1.
Overnight culture of E. coli in LB was diluted in LB supplemented with 0.8% glucose to OD600=0.02 and was continuously incubated at 30 degree celcius with shaking until its OD600 reached 1.0
Overnight culture of E. coli W3110 in LB was diluted in M9 minimal medium with supplements to OD600=0.01 and was incubated at 37 Ceilsus degree witouth shaking until its OD600 reached 0.1.
Overnight cultures from isolated colonies were diluted in fresh medium to an initial OD600~0.03 and grown to exponential phase (OD600~0.3) at 37ºC, with shaking at 200 rpm in Luria-Bertani (LB) medium supplemented with thymine (50 mg ml-1). When required, antibiotics were present at the following concentrations: kanamycin, 50 mg ml-1; tetracycline, 20 mg ml-1; streptomycin/spectinomycin 20 µg ml-1.
Overnight cultures in M9 glucose were inoculated into 100 mL fresh M9 glucose to a final OD600 of 0.02. The flasks were incubated at 37 °C with shaking at 200 rpm. Cells were collected by centrifugation at the early exponential (OD600 ~0.3), mid-exponential (OD600 ~0.8), transition to stationary (OD600 ~1.6), stationary (16 hrs, OD600 ~2), and late stationary (48 hrs, OD600 ~1.6) phases of growth.
Overnight cultures of bacteria were diluted 1:100 in fresh LB broth and grown to logarithmic phase at an OD600 of about 0.8.
Overnight cultures of E. coli MG1655  grown at 37°C with shaking at 200 rpm were diluted 1:625 into 50 ml of LB broth (Roth), and incubated at 37°C with shaking at 200 rpm.
Overnight cultures of ESBL7 from the original isolate, or isolates pre-exposed 20 times to CORM-2 or vehicle, were used to inoculate MS-medium, (OD620) of 0.1, followed by exposure to CORM-2 (250 µM) or vehicle for 30 min at 37 °C.
Overnight cultures of strain JM83 were diluted 1/100 in LB medium and grown in microtiter plates. To study the effects of trimethoprim, cells grown without antibiotics were compared to cells grown with 0.5 μg/ml trimethoprim.
Overnight cultures of the dnaB-Ts single mutant (strain 2429) and the dnaB-Ts ΔahpC double mutant (strain 3780) were diluted 100-fold into fresh SB medium (3.2% peptone, 2% yeast extract and 1% NaCl), and they were then grown at 30 °C to early-log phase (OD600 = 0.15).  Next these log-phase cultures were diluted 20-fold into 200 ml pre-warmed, fresh SB medium, and they were grown at 30 °C for another 60 min.
overnight culture subcultured in either of the SCFA mixes (or the sodium chloride controls) at 37C, static with 5%CO2 to OD600 of 1
Overnight cultures were inoculated 1:100 into 20ml of EZ Rich Defined Medium (Neidhardt et al., 1974) in 125 ml Erlenmeyer flasks and grown at 37oC and 250 rpm in a reciprocating water bath.
Overnight cultures were resuspended in fresh medium and TMP was added when the optical density (O.D. 600 nm) of the culture reached 0.3-0.4.
overnight in Luria-Bertani (LB) broth with continuous agitation
overnight in Lurie-Bertani (LB) broth with continuous agitation
oxic/anoxic: anoxic (NO3)
oxic/anoxic: oxic
Oxidative stress 200 ug/ml of 30% pre-warmed hydrogen peroxide (Fluka) was added to 150 ml constantly stirred (330 rpm) cultures kept in 1000 ml flasks. Cold stress Cultures were transferred from 37oC into an ice cold water bath in order to lower the temperature, while stirring, to 16oC in less than 2 min, heat stress Cultures were transferred from 37oC to a 50oC water bath. While stirring, the temperature of each culture was raised to 45oC in less than 2 min. The constantly stirring (330rpm) cultures were then transferred to a 45oC water bath to maintain this temperature glucose lactose shift Carbon source concentrations of 0.15% lactose and 0.05% glucose were used (150 ml culture in 1000 ml flasks, 330 rpm stirring).
Oxidative stress in E. coli K-12 #1
Oxidative stress in E. coli K-12 #2
Oxidative stress in E. coli K-12 #3
Oxidative stress in E. coli O157 (Sakai) #1
Oxidative stress in E. coli O157 (Sakai) #2
Oxidative stress in E. coli O157 (Sakai) #3
Oxo_IN_120mkM_3
Oxo_IN_Mu_120mkM_1
Oxo_IN_Mu_120mkM_2
Oxo_IP_120mkM_3
Oxo_IP_Mu_120mkM_1
Oxo_IP_Mu_120mkM_2
Oxolinic acid Rep 1 +A-IP
Oxolinic acid Rep 1 +A+IP
Oxolinic acid Rep 2 +A-IP
Oxolinic acid Rep 2 +A+IP
Oxolinic acid Rep 3 +A-IP
Oxolinic acid Rep 3 +A+IP
oxygen condition: aerobic
oxygen condition: anaerobic
oxygen_down_0min
oxygen_down_12min
oxygen_down_20min
oxygen_down_28min
oxygen_down_44min
oxygen_down_4min
oxygen_down_8min
oxygen down shift, 0min
oxygen down shift, 12min
oxygen down shift, 20min
oxygen down shift, 28min
oxygen down shift, 44min
oxygen down shift, 4min
oxygen down shift, 8min
oxygen regime: daily shift between shaking and static (no shaking) conditions
oxygen regime: transfers in constant static conditions
oxygen regime: transfers under constant shaking (200rpm)
oxygen_Up_0min
oxygen_Up_12min
oxygen_Up_20min
oxygen_Up_28min
oxygen_Up_44min
oxygen_Up_4min
oxygen_Up_8min
oxygen up shift, 0min
oxygen up shift, 12min
oxygen up shift, 20min
oxygen up shift, 28min
oxygen up shift, 44min
oxygen up shift, 4min
oxygen up shift, 8min
oxyR-8myc-tagged_PQ treated
OxyR PQ 1
OxyR PQ 2
P2-08
P2-08_R1
P2-08_R2
P2-08_R3
P2-51
P2-51_R1
P2-51_R2
P2-51_R3
P2-58
P2-58_R1
P2-58_R2
P2-58_R3
P2-66
P2-66_R1
P2-66_R2
P2-66_R3
P2-77
P2-77_R1
P2-77_R2
P2-77_R3
P4XB2 Mutant (1992) in Arginine
P4XB2 Mutant (1993) in Arginine
P4XB2 Mutant (1994) in Arginine
P4X Wild Type (1753) Reference
P4X Wild Type (1754) in Arginine
P4X Wild Type (1765) Reference
P4X Wild Type (1766) in Arginine
P4X Wild Type (1989) Reference
P4X Wild Type (1990) in Arginine
P500_1
PA20 cultures
PA20 cultures for RNA-seq were grown on T-agar with and without added Sulfamethoxazole-  Trimethoprim at designated levels for the indicated times and temperatures. Working stocks were tested and maintained using LB (Miller formulation) or LB agar. Plasmid pSE380 derivatives were induced by IPTG.
Paired-end reads mapped to MG1655 genome using bowtie2 with default settings. Any adapter sequences were removed prior to mapping.
paired end sequencing with Illumina HiSeq 2500 Sequencer
Paired-end, strand-specific RNAseq libraries were generated using the dUTP method {Levin JZ et al. 2010, Nat Methods} with the following modifications. rRNA was removed with Epicentre’s Ribo-Zero rRNA Removal Kit. Subtracted RNA was fragmented for 3 min using Ambion’s RNA Fragmentation Reagents. cDNA was generated using Invitrogen’s SuperScript III First-Strand Synthesis protocol with random hexamer priming.
Pale_1
Pale_3
Paraquat was added to growing cultures at a final concentration of 250 ?M. Samples (1.4ml) were taken every 2 minutes following paraquat treatment for the length of the time course, and flash-frozen by immersion of the tubes in liquid nitrogen.  The cells were collected by centrifugation for 1 minute at 13,000 rpm,
parental_temperature_Up_0min
parental_temperature_Up_16min
parental_temperature_Up_44min
parental temperature up shift 0min
parental temperature up shift 16min
parental temperature up shift 44min
Parent LB rep1
Parent LB rep2
Parent M9 rep1
Parent M9 rep2
parent strain: BW27785
Parent strain of experimental evolution
Parent strain of experimental evolution as adaptive evolved E. coli W3110 strain to M9 synthetic medium without ethanol stress
passage: 4
Pause sites in E. coli wild-type strain identified by RNET-seq
Pause sites in E. coli ΔgreAB strain identified by RNET-seq
PC 1
PC 2
PC 3
pCA24N-hns biofilm
pCA24N-hnsK57N biofilm
PCA analysis was performed using the top 500 genes with the most variations.
PCK_glucose-minimal medium_early log phase
PCK_LB-GlC medium_D=0.1 h-1
PCK over
pControl_exponential growth phase_1 ml cell pellet
pControl_stationary growth phase_1 ml cell pellet
pControl_transition growth phase_1 ml cell pellet
Peak calling was done using SPAT
Peak-calls were done using GPS within the GEMS software package (v2.3) adapted for ChIP-exo data
Peak detection and count of coverage were done using SEQMONK version 0.21.0 by Fasteris SA
Peaks on opposing strands were paired with Genetrack (u=0, d=80, b=2, m=mode)
peaks were called using MACS2 with default parameters
Peaks were called with GeneTrack 1.0.3 (s=5, e=10)
Peconic LLC performed data processing
PEN205
PEN205 strain first repetition
PEN205 strain second repetition
PEN205 strain third repetition
PF2-04
PF2-04_R1
PF2-04_R2
PF2-04_R3
PF2-08
PF2-08_R1
PF2-08_R2
PF2-08_R3
PF2-12
PF2-12_R1
PF2-12_R2
PF2-12_R3
pFlag-only control
pgi-ala-1
pgi-ala-2
pgi mutantin Ala media
pgi mutantin Gln media
pGIT1
pGIT1.1
pGIT1.1 + NO2
pGIT1.2
pGIT1.2 + NO2
pGIT1.3
pGIT1.3 + NO2
pGIT1.4
pGIT1.4 + NO2
pGIT1 + NO2
pGIT8
pGIT8.1 + NO2
pGIT8.2 + NO2
pGIT8.3 + NO2
pGIT8.4 + NO2
pGIT8 + NO2
PGRP-1, biological rep1
PGRP-2, biological rep2
PGRP-3, biological rep3
pH = 5.3
ph: 5.6
pH = 5.7
ph: 7.2
phage DNA
phage: Lambda
phase: early stationary phase
phase: logarithmic phase
phase: log phase
phase of growth: 15 min post stationary
phase of growth: 180 min post stationary
phase of growth: 30 min post stationary
phase of growth: Late log phase OD 1.6
phase of growth: Log phase OD 0.1
phase of growth: Log phase OD 0.2
phase of growth: Log phase OD 0.3
phase of growth: Log phase OD 0.4
phase of growth: Log phase OD 0.8
phase of growth: Log phase OD 1.4
pHDB3_1
pHDB3_2
pHDB3_3
phenotype: 0.6% n-butanol tolerance
phenotype: 2% n-butanol tolerance
phenotype: Blue colony-color (prion-containing)
phenotype: lacking FNR protein
phenotype: normal
phenotype: Pale colony-color (prion-lacking)
phenotype: small improvement in methyl ketone production
Phenylalanine addition
phoA_0min
phoA_10min
phoA_15min
phoA_1min
phoA_2min
phoA_4min
phoA_6min
phoA_8min
PhoB_ChIP, rep1
PhoB_ChIP, rep2
PhoB_ChIP, rep3
PhoB knock-out strain, rep1
PhoB knock-out strain, rep2
phoU_1
phoU_2
phoU_3
phoU gene mutant
phoU gene mutant; minimal medium
Physiological perturbations were carried out under a controlled environment in the context of bioreactor (Bioflo 110, New Brunswick Scientific) growth. Thermoelectric sensors and heaters were used to shift temperature profiles between 250 C and 370 C, and polarographic dissolved oxygen sensors (Mettler Toledo) and nitrogen gas was used to rapidly change oxygen saturation between anaerobic (0% dissolved oxygen) and aerobic (16-21% dissolved oxygen) condition.
P is defined by the pair of integers (X,Y). Log ratios were defined as the base 10 logarithm
Pixel intensities were extracted using the “Feature Extraction” software (Agilent Technologies, Palo Alto, CA). No normalization step was performed and the retained intensity value for each probe was the ratio between the spot’s median intensity signals and the median of background signals.
planktonic cells
Planktonic cultures of E. coli were harvested and resuspended in RNAlater and kept in 4C fridge overnight. Suspended cells were removed from petri dishes and biofilms were washed three times with fresh 10% LB before being craped from the bottom surface of petri dishes. Biofilms were also re-suspeded into RNAlater and kept at 4C overnight. Both planktonic and biofilm samples were homogenized for 2 min on ice with an Omni TH homogenizer. Cells were then aliquoted into vials containing around 2x10^8 cells. Cells in each vial were then re-suspended in nuclease-free phosphate buffered saline, incubated with anti-E. coli antibody and microbeads, followed by separation on a MACS separator (Miltenyi, Auburn, CA) at 4 degree C. Sorted cells were re-suspended into RNAlater.
plasmid cured rep1
plasmid cured rep2
Plasmid DNA, after n-butanol selection
Plasmid DNA, BWG post conjugation
Plasmid DNA, BWY post conjugation
Plasmid DNA, donor, XL1-Blue
Plasmid DNA, post conjugation
plasmid: Donor Library
plasmid: empty vector
plasmid: G181D NusA
plasmid: G324D Rho mutant
plasmid: Initial Recipient Library (BWG)
plasmid: Initial Recipient Library (BWY)
plasmid: N340S Rho mutant
plasmid: None
plasmid: pBAD
plasmid: pBAD30-empty
plasmid: pBAD30-MazF
plasmid: pBADsigma32I54N
plasmid: pBADsigma32wt
plasmid: pBAD-tosR
plasmid: pControl
plasmid: PD864
plasmid: pKEDR13
plasmid: pKESK22
plasmid: pKETS1
plasmid: pLCenvZM, pPCB (mutation)
Plasmid pLCenvZ or pLCenvZM was co-transformed with pPCB into the competent cells of E. coli JW3367 and spread on LB agar plates containing Ampicillin (50 ng/μl) and Chloramphenicol (170 ng/μl) at 37°C overnight. A single colony was diluted in 2.5ml LB medium containing Ampicillin (50 ng/μl) and Chloramphenicol (170 ng/μl) and was shaken at 250 rpm and 37°C overnight.
plasmid: pLCenvZ, pPCB (wild type)
plasmid: pLPLσ
plasmid: PLYS
plasmid: pMicL
plasmid: pMicL-S
Plasmid pool
plasmid: pPROEx-CAT
plasmid: PSB1C3
plasmid: R258C NusA
plasmid: R258C NuSA
plasmid source: Initial Recipient Library
plasmid source: Post Selection Library
plasmid: wild type NusA
plasmid: WT Rho
platform_id design: EcFS_1
platform_id design: EcFS_2
platform_id_id design: EcFS_1
platform_id_id design: EcFS_2
platform_id_id design: EcFS_3
pLCV1_1
pLCV1_2
pLCV1_3
pLPLσ_exponential growth phase_1 ml cell pellet
pLPLσ_stationary growth phase_1 ml cell pellet
pLPLσ_transition growth phase_1 ml cell pellet
plus Symbioflor
∆pnp_RNA-Seq
Pnp- (YHC012)  in  M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
Pnp- (YHC012) in   M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
Pnp- (YHC012) in  M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
Pnp- (YHC012)) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 1.5' post rif
Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 3' post rif
Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 4.5' post rif
Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 6' post rif
Poly
Polyclonal antibody for NusG (raised for this study)
Polyclonal antibody for Rho (gift from Jeff Roberts)
polyphosphate kinase 1 (PPK1) mutant
Polysomes were digested with MNase, monosomes were purified by sucrose gradient ultracentrifugation, and the resulting mRNA fragments were extracted with phenol chloroform and gel-purified.
pooled reference RNA
pooled RNA from all conditions including the control, reference
pool of aliquots from all samples
Pool of eight independent cultures
population: 1
population: 2
population: 3
population: 4
population: 5
population: 6
population: 7
population: A2
population: A4
population: G2
population: G3
population: G5
population: G6
Post-processing of the sequencing reads from RNA-seq experiments for each sample was performed using HudsonAlpha’s unique in-house RNA-seq data analysis pipeline. Briefly, quality control checks on raw sequence data for each sample were performed using FastQC (Babraham Bioinformatics, Cambridge, UK). Data-analysis was performed using the CLC Genomics Workbench (Version 7.5.1, CLC Bio, Aarhus, Denmark). The reference genome Escherichia coli (DH10B) sequence was downloaded from the UCSC genome browser. For read mapping, the following parameters were used: mismatch cost = 2, insertion and deletion cost = 3, length fraction: 0.8, similarity fraction = 0.8, global alignment = no, auto-detect paired distances = yes. Samples were grouped and differential expression of genes was calculated on the basis of fold changes (using the default cut-off ≥ ±2.0) observed in comparisons between defined conditions.
postscript(file=\
PPC_glucose-minimal medium_early log phase
PPC_LB-GlC medium_D=0.1 h-1
PPK1-PPX double mutant
ppk KO LB rep1
ppk KO LB rep2
ppk KO M9 rep1
ppk KO M9 rep2
∆ppk parent Sample 24
∆ppk parent Sample 43
∆ppk parent Sample 5
ppk suppressor 1-1 Sample 25
ppk suppressor 1-1 Sample 44
ppk suppressor 1-1 Sample 6
ppk suppressor 2-1 Sample 26
ppk suppressor 2-1 Sample 45
ppk suppressor 2-1 Sample 7
ppk suppressor 3-1 Sample 27
ppk suppressor 3-1 Sample 46
ppk suppressor 3-1 Sample 8
ppsA mutant 15 min (1) slide 1
ppsA mutant 15 min (1) slide 2
ppsA mutant 1 hour (1) slide 1
ppsA mutant 1 hour (1) slide 2
ppsA mutant 1 hour (2) slide 1
ppsA mutant 1 hour (2) slide 2
ppsA mutant 1 hour (3) slide 1
ppsA mutant 1 hour (3) slide 2
ppsA mutant 2 hour (1) slide 1
ppsA mutant 2 hour (1) slide 2
ppsA mutant 2 hour (2) slide 1
ppsA mutant 2 hour (2) slide 2
ppsA mutant 2 hour (3) slide 1
ppsA mutant 2 hour (3) slide 2
ppsA mutant 30 min (1) slide 1
ppsA mutant 30 min (1) slide 2
ppsA mutant 3 hour (1) slide 1
ppsA mutant 3 hour (1) slide 2
ppsA mutant 3 hour (2) slide 1
ppsA mutant 3 hour (2) slide 2
ppsA mutant 3 hour (3) slide 1
ppsA mutant 3 hour (3) slide 2
ppsA mutant 4 hour (1) slide 1
ppsA mutant 4 hour (1) slide 2
ppsA mutant 4 hour (2) slide 1
ppsA mutant 4 hour (2) slide 2
ppsA mutant 4 hour (3) slide 1
ppsA mutant 4 hour (3) slide 2
ppsA mutant 5 hour (1) slide 1
ppsA mutant 5 hour (1) slide 2
ppsA mutant 5 hour (2) slide 1
ppsA mutant 5 hour (2) slide 2
ppsA mutant 5 min (1) slide 1
ppsA mutant 5 min (1) slide 2
ppsA mutant 6 hour (1) slide 1
ppsA mutant 6 hour (1) slide 2
ppsA mutant 6 hour (2) slide 1
ppsA mutant 6 hour (2) slide 2
preprocessed RNA-Seq reads were mapped to the reference Escherichia coli strain K12 sub-strain MG1655 genome (GenBank accession no. U00096.2) by BWA toolkit version 0.5.9-r16 with the following options: bwa aln -q 20
print tip, and subtracting the resulting average from all the individual log ratios
Prior to total RNA extraction harvested bacterial cells were stored at -80.0°C in an equal volume of RNAlater.
Probabilistic expression counting was performed using the RNA-Seq by Expectation-Maximization (RSEM) version 1.2.4 (Li and Dewey, 2011)
Probe signal intensities were preprocessed using robust multichip averaging (RMA) in the program ArrayStar (DNASTAR), and the resulting gene expression signals were quantile-normalized across all samples using the normalize.quantiles function in the Bioconductor package for R.
Procedures to calculate the value of log2 ratio:
product: Butanol
Progesterone Treatment
Proline addition
Promega RNase-free DNase
Protein DNA interactions were crosslinked for 10 min at 22.5C with 1% formaldehyde and quenched using glycine to a final concentration of 0.5M
protein: GST expressed in E. coli BL21(DE3) from pGEX-4T-3
protocol: late log phase, LB
protocol: late log phase, LB, 30 min after butanol treatment
protocol: M9
protocol: M9 supplemented with 0.6 M NaCl
protocol: small RNA DicF
protocol: vector control
pseudoalignment and quantitation with kallisto v0.42.5 with parameters --single -l 450 -s 250
Ptac::fnr - A - 16 µM IPTG
Ptac::fnr - A - 4 µM IPTG
Ptac::fnr - A - 8 µM IPTG
Ptac::fnr - B - 16 µM IPTG
Ptac::fnr - B - 4 µM IPTG
Ptac::fnr - B - 8 µM IPTG
Ptac::fnr - C - 16 µM IPTG
ptsN mutant replicate 1
ptsN mutant replicate 2
Pure culture in LB
purification: Protein purified using GSH-sepharose 4b (GE Life Sciences)
Purified total RNA was depleted of rRNA using a Ribo-Zero (Bacteria) rRNA Removal Kit (Illumina).  cDNA libraries were constructed and sequenced on an Illumina NextSeq 500 sequencer at the Harvard Biopolymers Facility.
PurR_Adenine_1
PurR_Adenine_2
PurR_glucose_1
PurR_glucose_2
putP KO rep1
putP KO rep2
putP KO rep3
pyrC__U_N0075_r1
pyrC__U_N0075_r2
pyrC__U_N0075_r3
pyrC upregulation, 0.075 mg/mL norfloxacin
qC: We checked the quality of the raw reads data for each sample using FastQC (version 0.11.3) to identify features of the data that may indicate quality problems (e.g. low quality scores, over-represented sequences, inappropriate GC content, etc.).
Qiagen Genomic Tip 500/G (Qiagen, Hilden, Germany) and the Genomic DNA Buffer set (Qiagen)
Qiagen RNA extraction kit
Qiagen Rneasy column
Qiagen RNeasy Midikit
Qiagen Rneasy mini kit
Qiagen RNeasy mini Kit
Quality and adapter trimming was performed with the CLC Genomics Workbench 9.0 software package using the 'Trim Sequences' tool with standard parameters.
Quality control and microarray data analysis of all 60 chips was done using R/Bioconductor (http://www.bioconductor.org/). Signal intensity files (CEL files) of all 60 chips were summarized using RMA (robust multi array average) as processing algorithm and quantile normalization. A modified t-test using limma was performed for comparison of experimental conditions. See also additional files containing only E.coli K-12 MG1655 probes with P-values and ratio.
Quality control processing of sequence data was performed using Galaxy (https://galaxyproject.org). The FASTX tools in Galaxy (http://hannonlab.cshl.edu/fastx_toolkit) were used for filtering by quality (80% of sequence > quality score of 20), then reads were trimmed at both 5’ and 3’ ends using a window and step size of 1 with quality score > 20.
Quality trimming of 3' end at Read Segment Quality Control Indicator.
Quality trimming using FASTX-toolkit, version 0.0.13.2, parameters -v -t 20 -l 10
Quantification of gene expression and analysis of gene differential expression were performed using Fragment Per Kilo bases per Million reads (FPKM) value based rsem software version 1.2.4 and edgeR version 3.4.2 (Bioconductor), respectively
Quantification of the scans were performed with ImaGene (Version 6.0.1; BioDiscovery; El Segundo, CA; www.biodiscovery.com); with the results presented in the associated text files.  The normalized data VALUE was generated using LOWESS normalization with rank invariant selection, as implemented in lcDNA (receptor.seas.ucla.edu/lcDNA; Hyduke DR, Rohlin L, Kao KC, Liao JC. 2003 A software package for cDNA microarray data normalization and assessing confidence intervals. OMICS 7(3):227-234.)
Quantification of the scans were performed with ImaGene (Version 6.0.1; BioDiscovery; El Segundo, CA; www.biodiscovery.com); with the results presented in the associated text files. The normalized data VALUE was generated using LOWESS normalization with rank invariant selection, as implemented in lcDNA (receptor.seas.ucla.edu/lcDNA; Hyduke DR, Rohlin L, Kao KC, Liao JC. 2003 A software package for cDNA microarray data normalization and assessing confidence intervals. OMICS 7(3):227-234.)
R11 DH10BGFP_pLys_1
R16 MG1655GFP_pLys_M1_1
R19 MG1655GFP_Lux_1
R26 MG1655GFP_Lux_1
R27 MG1655GFP_pD864_LacZ_1
R29 DH10BGFP_None_1
R2 DH10BGFP_pLys_M1_1
R3 DH10BGFP_pSB1C3_1
R6 DH10BGFP_pD864_LacZ_1
ration of median(635/532)
Ratio of median
ratio set to missing where SNR (feature mean - backround mean /  background SD) less than 2 in both channels ;
Raw CEL files were analyzed using robust multi-array average for normalization and calculation of probe intensities. The processed probe signals derived from each microarray were averaged for both the wild type and deletion mutant strains. This was done using the GCRMA package (version 2.13) from Bioconductor in R.
Raw counts of mapped reads per reference base pair were then calculated using SAMtools software (with parameter –d set to 10^6).
Raw counts were derived for each gene based on the respective annotations available from UCSC genome browser (http://genome.ucsc.edu) for the chosen reference sequence applying HTseq-count v. 0.6.1 in the intersection-nonempty mode.
Raw data (.pair files) was analyzed using Matlab (The MathWorks, Natick, MA).  For each probe, the average intensity of three replicates were calculated after the elimination of outliers based on a standard deviation test. The average of control (Nonsense) probes was subtracted from all averages to obtain background-corrected results.
Raw data were created by analyzing 16-bit tiff files with the Scan Array Express imaging software (microarray analysis system, version 3.0.0.0016, PerkinElmer, Massachusetts, USA; adaptive treshold method, total normalization method).
Raw data were normalized and log2 transformed with the Acuity 4.0 software package, and data with low fluorescence intensities were eliminated. Genes were considered to be differentially expressed if the absolute values of log2 mean expression ratios were ≥ 1.
Raw data were normalized (quantile method), merged and filtered by Feature Extraction Software (Agilent Technologies Inc.). For the sibiling probes (multiple probes to one gene), we used the median indensity for representation.
Raw data were quality filtered on the Galaxy server (Filter by Quality tool, Q≥20) providing 99% probability of correct sequencing for all nucleotides in each read. As a result, the sets contain 31,656,551 and 45,396,252 sequences in the control and immunoprecipitated samples of the first experiment, and, respectively, 7,493,528 and 8,214,737 reads for the second experiment.
Raw .fastq files were mapped to the reference genome (NC000913.2) using BWA (version 0.7). Mapped reads were then converted to read count per gene using bedtools (version 2).  In the case of Ion torrent data .bam files were converted using BWA.
Raw fluorescence intensity data were normalized in R (http://cran.r-project.org/) using the Limma (Bioconductor) package
Raw Microarray data evaluation including preprocessing, normalization, grouping the differentially expressed genes and statistical analyses with Moderated T-test and Bonferroni FWER was carried out with GeneSpring 13.0 Software.
Raw microarray intensity data were normalized per chip to the same mean value, which is recommended by the manufacturer.
Raw, not normalised
Raw probe intensities ( .pair files three replicates for each growth condition with respectively 0, 5.0, 6.5 and 8.5 µM of AgNO3 in the medium) was processed and analyzed with R computing environment using the affy and limma package of Bioconductor. Raw data were submitted to a RMA-base background correction [Irizarry et al, 2003, Biostatistics 4(2): 249-264]. After background correction, intra-replicate quantil normalization was performed for each growth condition. A set of probes in the background for which the ranks were roughly invariant across all the twelve arrays was selected. The median value of the invariant probeset intensities on each array was used as a scaling factor for normalization between growth conditions.
Raw probe intensities were normalized across all samples using the Robust Multichip Average (RMA) algorithm in the NimbleScan software package (version 2.5).
Raw probe intensities were normalized across samples using RMA analysis implemented in the NimbleScan software package (v.2.4).
Raw read counts of transcripts were obtained by aligning samples 1-14 to the reference genome and counting mapped reads per feature using Rockhopper v2.0.3.
Raw reads were aligned to the E. coli w3110 MuSGS genome (containing a strong gyrase binding site from bacteriophage Mu) with BWA MEM (default settings)
Raw reads were trimmed by two nt from the 5' end (to remove any non-templated nts added by reverse transcriptase), and were then mapped using the Burrows-Wheeler Aligner to the Escherichia coli MG1655 genome (NCBI accession NC_000913).
Raw sequence data obtained in the fastq format were aligned to the genome of E. coli K12 MG1655 (NC_000913.2) using the Burrows-Wheeler matching program BWA. Reads mapping uniquely to the genome were selected.
Raw sequence data obtained in the fastq format were aligned to the genome of E. coli K12 MG1655 (NC_000913.2) using the Burrows-Wheeler matching program BWA. Reads mapping uniquely to the genome were selected. Files were coverted to .bam format using samtools. The MACS 2.1.0 software was used to call peaks. Peaks overlapping in both replicates were selected for further analysis.
Raw sequence data obtained in the fastq format were aligned to the genome of E. coli K12 MG1655 (NC_000913.2) using the Burrows-Wheeler matching program BWA. Reads mapping uniquely to the genome were selected. Files were coverted to .bam format using samtools. The MACS 2.1.0 software was used to call peaks. Peaks overlapping in both replicates were selected for further analysis. 
Raw sequence data obtained in the fastq format were aligned to the genome of E. coli K12 MG1655 using the Burrows-Wheeler matching program BWA. Reads mapping uniquely to the genome were selected and the number of reads mapping to each gene was computed using custom scripts.
Raw sequencing reads (FASTQ)were processed by Xpression and only the uniquely mapped reads were subjected to further analysis.
Raw signal data were extracted from the TIFF image with Agilent Feature Extraction Software (V10.7.1.1). The data analysis is done using a microarray specialized analysis software, Genespring GX. In this experiment, the microarray type used is a slide having 8 arrays with 60 thousand features per array. The exact number of features in the each array, inclusive of control probes, is 10,751 features. The microarray has a specific Agilent identifier called an AMADID which is used to identify what kind of array is being used; in this experiment the AMADID used is the design ID 020097.
Read alignment was performed with BWA (version 0.6.2) with default parameter.
Read counting using bedtools, version 2.17.0, parameter: -s, the middle nucleotide of each read was taken
Read counts for each host and circuit gene was carried out using the htseq-count command of the HTSeq toolkit with user-defined GFF annotations of the reference sequences and the options '-s reverse -a 10 -m union'.
Read counts per gene determined using HTseq count before normalized using DESeq2
Read counts were normalized by million mapped reads for each nucleotide
Read count was calculated for each genomic position from sequence alignment, and 95% strongest intensity was used as background intensity.
Read coverage maps and RPKM data was subsequently generated by Geneious.
Read mapping using segemehl version 0.13 (TRAPL)
Read mapping using segemehl (via READemption)
Read-mapping was done with soap2.21. Mapping towards genes was done by the following parameters -m 0 -x 1000 -s 28 -l 32 -v 5 -r 2 -p 3
reads aligned to the reference genome of E. coli K-12 Mg1655 using BWA, with quality threshold of 20
Reads aligning to each protein-encoding gene family with strand-specific mapping quality above 23 were counted using HTSeq-count
Reads longer than 25 nt and ≤ 2 N (ambiguous nucleotides) were preserved.
Reads mapped to more than one locus were discarded. The mapped position obtained from the SAM output file from BWA lists was taken and the position was extended to 280 bp which is the average length of DNA fragments submitted for sequencing.
Reads mapped to reference using BWA versiopn 0.7.4 with default settings
Reads per kilobase of exon model per million mapped reads (RPKM) was used as a normalized metric to present the gene expression levels.(Nature methods 2008, 5: 621-628)
Reads Per Kilobase of exon per Megabase of library size (RPKM) were calculated using a protocol from Chepelev et al., Nucleic Acids Research, 2009.
Reads Per Kilobase of exon per Megabase of library size (RPKM) were calculated using a protocol from Chepelev et al., Nucleic Acids Research, 2009. In short, exons from all isoforms of a gene were merged to create one meta-transcript. The number of reads falling in the exons of this meta-transcript were counted and normalized by the size of the meta-transcript and by the size of the library. For the S. pneumoniae samples this was done internally by Rockhopper version 1.21 after aligning reads.
Reads Per Kilobase of exon per Megabase of library size (RPKM) were calculated using cufflinks v.1.3.0
Reads per kilobase of gene per million mapped sequence reads (RPKM) were calculated for normalization.
Reads were adapter removed and trimmed to 40Bp using trimmomatic 0.32 with parameters ILLUMINACLIP:/Trimmomatic-0.32/adapters/TruSeq3-PE-2.fa:2:30:10 HEADCROP:8 CROP:40 SLIDINGWINDOW:6:5 MINLEN:40
Reads were aligned to E.coli rRNA and tRNA using Bowtie v.0.12.0 allowing for one mismatch and reads aligning to more than one position in the genome were randomly assigned to one of those positions
Reads were aligned to GenBank ID U00096.2
Reads were aligned to the MG1655 genome with Bowtie.
Reads were aligned using MG15655 as reference genome (NC000913.2) using Bowtie2 tool.
Reads were end-to-end aligned, with no mismatches allowed, to the respective draft genomes using Bowtie2 with default settings
reads were mapped to the E. coli K12 MG1655 (NC000913.3) genome using Novoalign version 2.07  (www.novocraft.com) - Example: (novoalign -f DL4900_clip_clp.fasta -d NC000913.3.nix -r Random > DL4900.novo)
Reads were mapped to the NC_000913.2 reference genome using the default settings in bowtie2 (Langmead and Salzberg, 2012). Datasets were quantified using cuffdiff in the cufflinks package to generate FPKM (Framents Per Kilobase per Million reads mapped) values for all genes (Trapnell et al., 2013).
Reads were mapped using BWA 0.7.5a
Reads were trimmed and adaptors removed using the fastx_toolkit.
Reads were trimmed for quality using Trimmomatic-0.32 with a cutoff quality score of 20
Read using bedtools, version 2.17.0, parameter: -s, for samples 1-5 the middle nucleotide of each read was taken, for samples 6-9 the first nucleotide was taken and the read count was assigned to the nucleotide 5' of the first nucleotide see {Kertesz, 2010} for details
recA730_vs_recA730,dcd
recA730_vs_recA730,ndk
recA deletion 0.05 ug/ml norfloxacin
recA deletion 0 ug/ml norfloxacin
recA deletion 1.0 ug/ml norfloxacin
recA_D_N0000_r1
recA_D_N0000_r2
recA_D_N0050_r1
recA_D_N0050_r2
recA_D_N1000_r1
recA_D_N1000_r2
recA___U_N0025_r1
recA___U_N0025_r2
recA___U_N0025_r3
recA upregulation, amp 50ug/ml, 0.0125% arabinose, 0.025ug/ml norfloxacin OD ~0.3
Recombinant, high cell density, Time 0, no IPTG
Recombinant, high cell density, Time 1 h, 5 mM IPTG
Recombinant, high cell density, Time 1 h, no IPTG
Recombinant, high cell density, Time 4 h, no IPTG
Recombinant, high cell density, Time S0, no IPTG, 1
Recombinant, high cell density, Time S0, no IPTG, 2
Recombinant, high cell density, Time S0, no IPTG, 3
Recombinant, high cell density, Time S1, IPTG, 1
Recombinant, high cell density, Time S1, IPTG, 2
Recombinant, high cell density, Time S1, IPTG, 3
Recombinant, high cell density, Time S1, no IPTG, 1
Recombinant, high cell density, Time S1, no IPTG, 2
Recombinant, high cell density, Time S1, no IPTG, 3
Recombinant, high cell density, Time S4, no IPTG, 1
Recombinant, high cell density, Time S4, no IPTG, 2
Recombinant, high cell density, Time S4, no IPTG, 3
Reduced genome strain MDS42, 100 mcg/ml bicyclomycin 20 min, exponential phase
Reduced genome strain MDS42, control sample, exponential phase
Reduced genome strain MDS42, deletion of nusA gene, OD600=0.3
Reduced genome strain MDS42, deletion of nusG gene, OD600=0.3, overnight culture
referece: The three genomes contributing to the ORFs on the microarray.
reference 0', min +.2% glu, 25 ug RNA
Reference Design timecourse c_t10.1
Reference Design timecourse c_t10.2
Reference Design timecourse c_t1.1
Reference Design timecourse c_t11.1
Reference Design timecourse c_t11.2
Reference Design timecourse c_t1.2
Reference Design timecourse c_t2.1
Reference Design timecourse c_t2.2
Reference Design timecourse c_t3.1
Reference Design timecourse c_t3.2
Reference Design timecourse c_t4.1
Reference Design timecourse c_t4.2
Reference Design timecourse c_t5.1
Reference Design timecourse c_t5.2
Reference Design timecourse c_t6.1
Reference Design timecourse c_t6.2
Reference Design timecourse c_t7.1
Reference Design timecourse c_t7.2
Reference Design timecourse c_t8.1
Reference Design timecourse c_t8.2
Reference Design timecourse c_t9.1
Reference Design timecourse c_t9.2
reference DNA
Reference DNA genomic DNA
reference: E. coli TOP10 containing pBAD18 vector with no arabinose added
Reference files for the genome sequence being queried, Escherichia coli BL21(DE3) genome (NC_012971) were uploaded.
reference genome: U00096.2
Reference genome used: Escherichia coli K12 MG1655, version: iGenome
Reference genomic DNA
Reference Genomic DNA
REference genomic DNA
reference: Input DNA
reference: input Genomic DNA control
Reference Pool
References
References:
reference sample harvested immediately prior to glucose to acetate shift
Reformat Illumina files to Sanger format, FASTQ Groomer
REL606, exponential phase, LB
REL606_glucose-limited minimal medium_168 hr
REL606_glucose-limited minimal medium_168 hr_rRNA not depleted
REL606_glucose-limited minimal medium_24 hr
REL606_glucose-limited minimal medium_24 hr_rRNA not depleted
REL606_glucose-limited minimal medium_336 hr
REL606_glucose-limited minimal medium_336 hr_rRNA not depleted
REL606_glucose-limited minimal medium_3 hr
REL606_glucose-limited minimal medium_3 hr_rRNA not depleted
REL606_glucose-limited minimal medium_48 hr
REL606_glucose-limited minimal medium_48 hr_rRNA not depleted
REL606_glucose-limited minimal medium_4 hr
REL606_glucose-limited minimal medium_4 hr_rRNA not depleted
REL606_glucose-limited minimal medium_5 hr
REL606_glucose-limited minimal medium_5 hr_rRNA not depleted
REL606_glucose-limited minimal medium_6 hr
REL606_glucose-limited minimal medium_6 hr_rRNA not depleted
REL606_glucose-limited minimal medium_8 hr
REL606_glucose-limited minimal medium_8 hr_rRNA not depleted
REL606, stationary phase, LB
relE___U_N0025_r1
relE___U_N0025_r2
relE___U_N0025_r3
relE upregulation, amp 50ug/ml, 0.0125% arabinose, 0.025ug/ml norfloxacin OD ~0.3
Remaining linker-1 reads (CTGTAGGCACCATCAAT) were removed from fastq files using fastx_clipper
Removal of PCR duplicates based on the 20 first bp of the read containing a 6 nt random tag (home made script).
Removal of un-informative events (uncuts, loops etc) as described in Cournac et al. BMC 2012.
Remove non-protein coding counts
replicate: 1
Replicate 1 - timepoint 1 (4.5h)
Replicate 1 - timepoint 1 (4.5h) - dye swap
Replicate 1 - timepoint 2 (6h)
Replicate 1 - timepoint 2 (6h) - dye swap
Replicate 1 - timepoint 3 (9h)
Replicate 1 - timepoint 3 (9h) - dye swap
replicate: 2
Replicate 2 - timepoint 1 (4.5h)
Replicate 2 - timepoint 1 (4.5h) - dye swap
Replicate 2 - timepoint 2 (6h)
Replicate 2 - timepoint 2 (6h) - dye swap
Replicate 2 - timepoint 3 (9h)
Replicate 2 - timepoint 3 (9h) - dye swap
replicate: 3
replicate: 4
replicates: ORF1 replicate 1 / induced
replicates: ORF1 replicate 1 / not induced
replicates: ORF1 replicate 2 / induced
replicates: ORF1 replicate 2 / not induced
replicates: Svi3-3 replicate 1 / induced
replicates: Svi3-3 replicate 1 / not induced
replicates: Svi3-3 replicate 2 / induced
replicates: Svi3-3 replicate 2 / not induced
replicates: WT replicate 1 / induced
replicates: WT replicate 2 / induced
reporter: CRE multi-hit
reporter: CRE single-hit
reporter: IFNB multi-hit
reporter: IFNB single-hit
Require peaks to be present in at least 2 replicates and conform to a peak shape by visual inspection
Respiratory defecient E. coli mutant (ECOM4), M9 media with 4 g/L glucose, aerobic, log phase
Resulting mRNA was reverse-transcribed to cDNA libraries via SuperScript III First Strand reverse transcription kit (Invitrogen, Carlsbad, CA, 18080051) as per the manufacturer’s instructions. The cDNA libraries were multiplexed to distinguish replicates from one another, barcoded for sequencing, and then amplified with random hexamers for 15 PCR cycles. Transcripts were sequenced for 50 bases in single-end fashion within one lane of an Illumina Hiseq 2000 flow cell. This yielded roughly 30 million reads per sample.
Resulting read count matrix was used as input for the differntial expression analysis in edgeR (version 3.12.1).
Resulting reads were aligned to the published E. coli K-12 MG1655 genome (U00096.2) using the software package SOAP (Li et al, 2009), allowing no more than two mismatches (Supplemental File).  Reads aligning to repeated elements in the genome (e.g. rRNA) were removed from analysis.  For reads that had no mapping locations for the first 36 bp, the 3-30 bp subsequences were used in the subsequent mapping to the reference genome.  Reads that had unique mapping locations and did not match annotated rRNA genes were used for further analysis.  For each gene, the tag density was estimated as the number of aligned sequencing tags divided by gene size in kb.  Per-gene tag density was normalized using quantile normalization (Supplemental Files).  The tag density data were analyzed for statistically significant differential expression using BaySeq (Hardcastle & Kelly, 2010) with a FDR of 0.01, and genes were organized into operons using data from EcoCyc (Keseler et al, 2011).
Resulting SAM files were processed with custom script (SAM_to_coverage_and_N5E_N3E.py, github: https://github.com/sutormin94/Gyrase_Topo-seq), giving coverage depth of the genome and N3E values (number of DNA fragments 3'-ends) for every position
re-suspended in 200 ul Trizol and combined for a total volume of 1 ml, then promptly
RF2*_exp1_mRNA
RF2*_exp1_ribosome
RF2*_exp3_mRNA
RF2*_exp3_ribosome
RF2*∆RF3_exp2_repA_mRNA
RF2*∆RF3_exp2_repA_ribosome
RF2*∆RF3_exp2_repB_mRNA
RF2*∆RF3_exp2_repB_ribosome
RF2*∆RF3_exp3_mRNA
RF2*∆RF3_exp3_ribosome
RF2*∆RF3_exp4_repA_mRNA
RF2*∆RF3_exp4_repA_ribosome
RF2*∆RF3_exp4_repB_mRNA
RF2*∆RF3_exp4_repB_ribosome
∆RF3_exp1_mRNA
∆RF3_exp1_ribosome
∆RF3_exp3_mRNA
∆RF3_exp3_ribosome
∆RF3_minimal_mRNA
∆RF3_minimal_ribosome
rfbA KO rep1
rfbA KO rep2
rfbA KO rep3
RhIB wild type
RhlBP238L mutant
RhlBP238L vs flag only 1
RhlBP238L vs flag only 2
RhlBP238L vs flag only 3
RhlB- (SU02)  in  M9  0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
RhlB- (SU02)  in  M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
RhlB- (SU02)  in  M9 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
RhlB- (SU02) in   M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
RhlB- (SU02) in  M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 1.5' post rif
RhlB- (SU02)  in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 3' post rif
RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 3' post rif
RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 4.5' post rif
RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 6' post rif
RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 Mid Log 6' post rif
RhlBwt vs flag only 1
RhlBwt vs flag only 2
RhlBwt vs flag only 3
Rho ChIP-chip in E. coli K-12 MG1655 cells (Dataset 3421602)
Rho ChIP-chip in E. coli K-12 MG1655 cells (Dataset 70261)
Rho ChIP in E. coli K-12 MG1655 cells
Rhodococcus jostii RHA1
∆rho UvsW_replicate1
∆rho UvsW_replicate2
∆rho UvsW_replicate3
Ribosomal RNA (rRNA) was removed using Ribo-Zero™ Gold (Yeast) kit (Epicenter, Madison, WI) using manufacturer's recommended protocol. Immediately after the rRNA removal the RNA was fragmented and primed for the first strand synthesis using the NEBnext First Strand synthesis module (New England BioLabs Inc., Ipswich, MA). Directional second strand synthesis was performed using NEBNExt Ultra Directional second strand synthesis kit. Following this the samples were taken into standard library preparation protocol using NEBNext® DNA Library Prep Master Mix Set for Illumina® with slight modifications. Briefly, end-repair was done followed by polyA addition and adapter ligation. Post-ligated materials were individually barcoded with primers and amplified through 12 cycles of PCR. Final library quantity was assessed by Quant-iT™ PicoGreen® dsDNA Assay Kit and the library quality was estimated on LabChip® GX (Caliper, PerkinElmer, Waltham, MA). Accurate quantification of the final libraries for sequencing applications was determined using the qPCR-based KAPA Biosystems Library Quantification kit (Kapa Biosystems, Inc., Woburn, MA). Each library was diluted to a final concentration of 12.5 nM and pooled equimolar prior to clustering. Paired-End (PE) sequencing was performed on an Illumina HiSeq2500 sequencer (Illumina, Inc.).
Ribosomal RNA was first removed using the Ribozero rRNA Removal Meta-Bacteria kit. Enriched mRNAs were then converted into  indexed libraries using the into ScriptSeqTM v2 RNA-Seq Library Preparation Kit
Ribosomal RNA was removed from 1 μg of total RNA using Ribozero rRNA Removal Meta-Bacteria Kit (Epicentre Biotechnologies) and the mRNA-enriched fraction was converted to indexed RNA-seq libraries with the ScriptSeq™ v2 RNA-Seq Library Preparation Kit (Epicentre Biotechnologies).
Ribosome profiling 10 min after shift to 10°C in WT cells_1
Ribosome profiling 10 min after shift to 10°C in WT cells_2
Ribosome profiling 15 min after shift to 10°C in WT cells
Ribosome profiling 2 hr after shift to 10°C in WT cells
Ribosome profiling 30 min after shift to 10°C in WT cells
Ribosome profiling 3 hr after shift to 10°C in WT cells
Ribosome profiling 4 hr after shift to 10°C in WT cells
Ribosome profiling 5 min after shift to 10°C in WT cells
Ribosome profiling 6 hr after shift to 10°C in WT cells
Ribosome profiling 8 hr after shift to 10°C in ∆cspABEG cells
Ribosome profiling 8 hr after shift to 10°C in WT cells
Ribosome profiling at 37°C in ∆cspABCEG cells
Ribosome profiling at 37°C in WT cells_1
Ribosome profiling at 37°C in WT cells_2
ribosome profiling in rich defined media
ribosome profiling MicL t0
ribosome profiling MicL t20
Ribosome protected and total mRNA fragments were size selected via gel purification. Fragments were ligated to 5' adenylated DNA oligo. After reverse transcription, the single stranded DNA was circularized, and PCR amplified [Oh et al,. Cell 147, 1295 (2011)]. More details at MS Guo, TB Updegrove, et al, Genes Dev. (2014).
Ribosome protected mRNA fragments were size selected via gel purification, and ligated to 5' adenylated DNA oligo. After reverse transcription, the single stranded DNA was circularized, and PCR amplified [Oh et al,. Cell 147, 1295 (2011)]. More at G.W. Li, D. Burkhardt, C.A. Gross, J. S. Weissman (Cell).
Ribosome protected mRNA fragments were size selected via gel purification, and ligated to 5' adenylated DNA oligo. After reverse transcription, the single stranded DNA was circularized, and PCR amplified [Oh et al,. Cell 147, 1295 (2011)]. More at G.W. Li, E. Oh, and J.S. Weissman, Nature (in press)
ribosome-protected: No
ribosome-protected: Yes
ribozero: No
ribozero: Yes
Rifampicine Ciprofloxacin Rep 1 -A-IP
Rifampicine Ciprofloxacin Rep 1 +A-IP
Rifampicine Ciprofloxacin Rep 1 +A+IP
Rifampicine Ciprofloxacin Rep 2 +A-IP
Rifampicine Ciprofloxacin Rep 2 +A+IP
Rifampicine Ciprofloxacin Rep 3 +A-IP
Rifampicine Ciprofloxacin Rep 3 +A+IP
RifCfx_IN_Mu_122mkM_10mkM_1
RifCfx_IN_Mu_122mkM_10mkM_2
RifCfx_IN_Mu_122mkM_10mkM_3
RifCfx_IP_Mu_122mkM_10mkM_1
RifCfx_IP_Mu_122mkM_10mkM_2
RifCfx_IP_Mu_122mkM_10mkM_3
Rif_IN_Mu_122mkM_1
rimI__U_N0075_r1
rimI__U_N0075_r2
rimI__U_N0075_r3
rimI upregulation, 0.075 mg/mL norfloxacin
rip antibody: Monoclonal ANTI-FLAG^=AE M2 antibody produced in mouse, Sigma, F1804-200UG,SLBG5673V
riplot(LogData, onScreen=FALSE)
riplot(NormalData, onScreen=FALSE)
RIP-Seq
RMA normalization was performed on CELL files using the Partek Genomic Suite 6.5. Additional statistical analysis was carried out using the Spotfire software package (Somerville, MA, USA) and custom Matlab (R2010B) routines.
RMA normalized probe data was uploaded into the Mochiview visualization software where data cooresponding to the plus and minus strands were subtracted to get a strand-specific probe intesenity per base as reported in the processed data files.
RMA with quartile normalization according to method of Irizarry et al, 2003. The raw .cel files were processed in RMA using Bioconductor R package: affy Version:1.8.1 Date:2005-09-03, with the option Filter.genes containing a subset of probesets corresponding to MG1655 genes and intergenic regions listed in the matrix data. Replicates were averaged for ratio calculations.
RNA_1
RNA_2
RNA degradation was stopped using Qiagen's RNAprotect reagent
RNAeasy
RNAEasy with RNAProtect(Qiagen)
RNA extracted according to QiAgen RNeasy MiniKit protocol for bacterial samples
RNA extracted by hot phenol choloroform folled by Qiagen RNA Midi column.
RNA extracted from biofilm cells of BW25113 wild type after 24h of growth in LBglu with glass wool
RNA extracted from biofilm cells of BW25113 ymgB mutant after 24h of growth in LBglu with glass wool
RNA extracted from biofilm cells of E. coli K-12 BW25113 tnaA mutant after 7 hours of growth in LB with glasswool and 100 uM indole at 37ºC
RNA extracted from biofilm cells of E. coli K-12 BW25113 tnaA mutant after 7 hours of growth in LB with glasswool and DMF at 30ºC
RNA extracted from biofilm cells of E. coli K-12 BW25113 tnaA mutant after 7 hours of growth in LB with glasswool and DMF at 37ºC
RNA extracted from biofilm cells of E. coli K-12 BW25113 tnaA mutant after 7 hours of growth in LB with glasswool and with 100 uM indole at 30ºC
RNA extracted from biofilm cells of E. coli K-12 BW25113 w/t after 7 hours of growth in LB with glasswool at 30ºC
RNA extracted from biofilm cells of E. coli K-12 hha mutant after 15 hours of growth at 37C in LB glu with glasswool
RNA extracted from biofilm cells of E. coli K-12 hha mutant after 24 hours of growth at 37C in LB glu with glasswool
RNA extracted from biofilm cells of E. coli K-12 hha mutant after 4 hours of growth at 37C in LB glu with glasswool
RNA extracted from biofilm cells of E. coli K-12 hha mutant after 4 hours of growth at 37C in LB with glasswool
RNA extracted from biofilm cells of E. coli K-12 sdiA mutant after 7 hours of growth in LB with glasswool at 30ºC with 1 mM indole presence.
RNA extracted from biofilm cells of E. coli K-12 sdiA mutant after 7 hours of growth in LB with glasswool at 30ºC with DMF presence.
RNA extracted from biofilm cells of E. coli K-12 wild type after 15 hours of growth at 37C in LB glu with glasswool
RNA extracted from biofilm cells of E. coli K-12 wild type after 24 hours of growth at 37C in LB glu with glasswool
RNA extracted from biofilm cells of E. coli K-12 wild type after 4 hours of growth at 37C in LB glu with glasswool.
RNA extracted from biofilm cells of E. coli K-12 wild type after 4 hours of growth at 37C in LB with glasswool.
RNA extracted from biofilm cells of EHEC wild type after 7h of growth in LB and 0.1 % DMF with glass wool
RNA extracted from biofilm cells of EHEC wild type after 7h of growth in LB and 1000 micro M 7-hydroxyindole with glass wool
RNA extracted from biofilm cells of EHEC wild type after 7h of growth in LB and 250 micro M isatin with glass wool
RNA extracted from biofilm cells of K-12 sdiA-no SdiA 1 after 12h of growth in LB + 1 mMIPTG and 30 microM Cm with glass wool at 30oC
RNA extracted from biofilm cells of K-12 sdiA-SdiA1E11 after 12h of growth in LB + 1 mMIPTG and 30 microM Cm with glass wool at 30oC
RNA extracted from biofilm cells of K-12 sdiA-WTSdiA after 12h of growth in LB + 1 mMIPTG and 30 microM Cm with glass wool at 30oC
RNA extracted from cells of BW25113 at OD 1.0 after contacting for 10 min with 2 mM H2O2 in LB at 37oC.
RNA extracted from cells of BW25113 at OD 1.0 after contacting for 10 min with water (negative control) in LB at 37oC.
RNA extracted from cells of BW25113 ychH at OD 1.0 after contacting for 10 min with 2 mM H2O2 in LB at 37oC.
RNA extracted from cells of BW25113 ychH at OD 1.0 after contacting for 10 min with water (negative control) in LB at 37oC.
RNA extracted from cells of BW25113 ygiW at OD 1.0 after contacting for 10 min with 2 mM H2O2 in LB at 37oC.
RNA extracted from cells of BW25113 ygiW at OD 1.0 after contacting for 10 min with water (negative control) in LB at 37oC.
RNA extracted from cells of TG1/pBS(Kan)/pMMB277 after contacting for 2 h with cis-DCE (1 mM) in Tris-HNO3 buffer with succinate (5 mM), IPTG (0.5 mM) at 37oC
RNA extracted from cells of TG1/pBS(Kan)-TOM-Green/pMMB277-IsoILR1-GSHI after contacting for 2 h with cis-DCE (1 mM) in Tris-HNO3 buffer with succinate (5 mM), IPTG (0.5 mM) at 37oC
RNA extracted from cells of TG1/ pMMB206-TOM-Green/pBS(Kan) after contacting for 2 h with cis-DCE (1 mM) in Tris-HNO3 buffer with succinate (5 mM), IPTG (0.5 mM) at 37oC.
RNA extracted from cells of TG1/pMMB206-TOM-Green/pBS(Kan)-EchA F108L/I219L/C248I after contacting for 2 h with cis-DCE (1 mM) in Tris-HNO3 buffer with succinate (5 mM), IPTG (0.5 mM) at 37oC
rna extracted from e. coli o157: H7 EDL933 cells grown (7 hrs incubation) in LB at 37ºC
rna extracted from e. coli o157: H7 EDL933 cells grown (7 hrs incubation) in LB at 37ºC with 0.05 mg/ml Phloretin
RNA extracted from e. coli o157: H7 EDL933 cells grown (7 hrs incubation) in LB at 37ºC with 0.1 mg/ml of IAAld
rna extracted from e. coli o157: H7 EDL933 cells grown (7 hrs incubation) in LB at 37ºC with 0.5% honey
RNA extracted from e. coli o157: H7 EDL933 cells grown (7 hrs incubation) in LB at 37ºC with DMSO
RNA extracted from free living cells of E. coli K-12 BW25113 luxS mutant (when growth to OD600 0.5 at 30ºC in LB, 100 uM AI2 was added in and 3-h further incubation was applied)
RNA extracted from free living cells of E. coli K-12 BW25113 luxS mutant (when growth to OD600 0.5 at 30ºC in LB, no AI2 was added in and 3-h further incubation was applied)
RNA extracted from free living cells of E. coli K-12 BW25113 luxS mutant (when growth to OD600 0.5 at 37ºC in LB, 100 uM AI2 was added in and 3-h further incubation was applied)
RNA extracted from free living cells of E. coli K-12 BW25113 luxS mutant (when growth to OD600 0.5 at 37ºC in LB, no AI2 was added in and 3-h further incubation was applied)
RNA extracted from free living cells of E. coli K-12 BW25113 sdiA mutant when growth to OD600 4.0 at 30ºC in LB
RNA extracted from free living cells of E. coli K-12 BW25113 wild type when growth to OD600 4.0 at 30ºC in LB
RNA extracted from suspension cells of E. coli K-12 BW25113 mqsR deleted mutant after OD600=0.5 of growth in LB at 37oC
RNA extracted from suspension cells of E. coli K-12 BW25113/pCA24N (empty vector) after OD600=0.5 of growth, then 2 mM IPTG for 15 min short time in LB at 37oC
RNA extracted from suspension cells of E. coli K-12 BW25113/pCA24N (empty vector) after OD600=0.5 of growth with 2 mM IPTG in LB at 37oC
RNA extracted from suspension cells of E. coli K-12 BW25113/pCA24N-mqsR after OD600=0.5 of growth, then 2 mM IPTG for 15 min short time in LB at 37oC
RNA extracted from suspension cells of E. coli K-12 BW25113/pCA24N-mqsR after OD600=0.5 of growth with 2 mM IPTG in LB at 37oC
RNA extracted from suspension cells of E. coli K-12 BW25113 wild type after OD600=0.5 of growth in LB at 37oC
RNA extracted from suspension cells of E. coli K-12 BW25113 w/t after 7 hours of growth in LB with glasswool at 30ºC
RNA extracted from suspension cells of EHEC wild type after 7 h of growth in LB and 0.1 % DMF with glass wool
RNA extraction: A hot-phenol procedure was used to extract total RNA. Cell pellets were lysed with 500 μl TE (pH8.0), 50 μl 10% SDS and lysozyme (0.5 mg/ml). Total RNA was extracted sequentially with phenol/chloroform (preheated to 640 C), followed by chloroform/isoamyl alcohol. RNA was precipitated with 1/10 volume of 3M NaOAc (pH 5.2) and 2 volumes of ethanol. After incubating overnight at –200 C, samples were spun down and pellets were washed with ice cold 70% ethanol (prepared with DEPC- H2O). RNA was resuspended in water, DNase treated (RQ1 RNase-free DNase/ Promega, WI) and purified using an RNeasy purification kit (Qiagen, CA).
RNA extraction Kit
RNA extractions were performed using RiboPure™­Bacteria Kit (Ambion, Austin, TX), according to the manufacturer's recommendations
RNA extraction was performed according to the manufacturer's (Qiagen) instructions.
RNA extraction was performed using phenol treatment.
RNA extraction was performed using RiboPure-BacteriaTM Bacteria kit according to the manufacturer's protocol (Ambion, Life Technologies). DNase I treatment was applied to eliminate genomic DNA contamination as per the manufacturer's recommendations.
RNA extraction was performed using the RNeasy Mini Kit (Qiagen, Hilden, Germany).
RNA from 1% isobutanol treated sample and untreated sample were mixed after RNA purification
RNA from E. coli 0.5 hours after inoculation
RNA from E. coli 1.5 hours after inoculation
RNA from E. coli 2 hours after inoculation
RNA from E. coli 3.5 hours after inoculation
RNA from E. coli 3 hours after inoculation
RNA from E. coli 4 hours after inoculation
RNA from E. coli expressing synthetic protein DX for 0.5 hours
RNA from E. coli expressing synthetic protein DX for 1.5 hours
RNA from E. coli expressing synthetic protein DX for 1 hours
RNA from E. coli expressing synthetic protein DX for 2 hours
RNA from E. coli expressing synthetic protein DX for 3.5 hours
RNA from E. coli expressing synthetic protein DX for 3 hours
RNA from E. coli expressing synthetic protein DX for 4 hours
RNA from Escherichia coli
RNA from late log phase E coli EDL933 pooled reference
RNA from late log phase E coli FRIK2000 rep 1
RNA from late log phase E coli FRIK2000 rep 2
RNA from late log phase E coli FRIK2000 rep 3
RNA from late log phase E coli FRIK2000 rep 4
RNA from late log phase E coli FRIK966 rep 1
RNA from late log phase E coli FRIK966 rep 2
RNA from late log phase E coli FRIK966 rep 3
RNA from late log phase E coli FRIK966 rep 4
RNA isolation was performed using an RNeasy mini kit (Qiagen Technologies, Hilden, Germany), according to the manufacturer’s protocol. DNA decontamination treatment was performed using Turbo DNase (Qiagen) and the quantity and purity of the purified RNA samples were determined using a spectrophotometer Nanodrop-1000 (Nanodrop Technologies Inc., Wilmington, DE, USA) by measuring the absorbance (A260, 230, 280) and calculating absorbance ratios (A260/A230 and A260/A280). All samples had A260/A230 and A260/A280 ratios above 1.9. The RNA integrity was analysed using Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA) in conjunction with RNA 6000 Nano LabChip kit (Agilent Technologies) according to the manufacturer’s protocol. RNA integrity number (RIN) values were > 8.5 for all samples.
RNA isolation was performed using an RNeasy mini kit (Qiagen Technologies, Hilden, Germany), according to the manufacturer’s protocol. DNA decontamination treatment was performed using Turbo DNase (Qiagen) and the quantity and purity of the purified RNA samples were determined using a spectrophotometer Nanodrop-1000 (Nanodrop Technologies Inc., Wilmington, DE, USA) by measuring the absorbance (A260, 230, 280) and calculating absorbance ratios (A260/A230 and A260/A280). All samples had A260/A230 and A260/A280 ratios above 1.9. The RNA integrity was analysed using Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA) in conjunction with RNA 6000 Nano LabChip kit (Agilent Technologies) according to the manufacturer’s protocol. RNA integrity number (RIN) values were > 9 for all samples.
RNAlater was removed from cells by filtration. Total RNA was extracted from cells using a hot SDS/phenol protocol (http://www.genome.wisc.edu/pub/reprints/) with an additional 1-min bead-beating. Chemical extractions were performed in phase lock gels (Fisher Scientific, Pittsburgh, PA).
RNA libraries were prepared for sequencing by the company Vertis Biotechnologie AG in Germany
RNA libraries were prepared for sequencing using standard Illumina protocols
RNA libraries were prepared for sequencing using standard Illumina protocols.
RNA libraries were prepared for sequencing using standard Illumina protocols; rRNAs were removed by Ribozero (gram negative), libraries were prepared using TruSeq protocol.
RNAP beta subunit ChIP DNA from E. coli CC72 10 min after osmotic stress
RNAP beta subunit ChIP DNA from E. coli CC72 20 min after osmotic stress
RNAP beta subunit ChIP DNA from E. coli CC72 45 min after osmotic stress
RNAP beta subunit ChIP DNA from E. coli CC72 at early-exponential phase
RNAP ChIP DNA from DdksA cells
RNAP ChIP DNA from MDS42 cells
RNAP ChIP DNA from MDS42 ΔnusA* cells
RNAP ChIP DNA from MDS42 ΔnusG cells
RNAP ChIP DNA from MG1655 cells
RNAP ChIP DNA from MG1655 Δhns cells
RNAP ChIP DNA from starved DdksA cells
RNAP ChIP DNA from starved wt cells
RNAP ChIP DNA from wt cells
RNAP ChIP DNA, old protocol
RNAP_DdksA_SHX_rep1
RNAP_DdksA_SHX_rep2
RNAP_DdksA_untreated_rep1
RNAP_DdksA_untreated_rep2
RNAP old rep1
RNAP old rep2
RNA polymerase (Beta') ChIP-chip in E. coli K-12 MG1655 cells (Dataset 100040)
RNA polymerase (Beta) ChIP-chip in E. coli K-12 MG1655 cells (Dataset 3427302)
RNA polymerase (Beta') ChIP-chip in E. coli K-12 MG1655 cells (Dataset 56706)
RNA polymerase (Beta’) ChIP-chip in E. coli K-12 MG1655 cells (Dataset 62215)
RNA polymerase (Beta') ChIP-chip in E. coli K-12 MG1655 cells treated with 100ug/ml rifampicin (Dataset 81586)
RNA polymerase (Beta) ChIP-chip in E. coli K-12 MG1655 cells treated with 20ug/ml bicyclomycin (Dataset 3428302)
RNA polymerase (Beta') ChIP-chip in E. coli K-12 MG1655 cells treated with 20ug/ml bicyclomycin (Dataset 94828)
RNA polymerase (Beta') ChIP in E. coli K-12 MG1655 cells
RNA polymerase (Beta’) ChIP in E. coli K-12 MG1655 cells
RNA polymerase (Beta') ChIP in E. coli K-12 MG1655 cells treated with 100ug/ml rifampicin
RNA polymerase (Beta') ChIP in E. coli K-12 MG1655 cells treated with 20ug/ml bicyclomycin
RNA polymerase (Beta) ChIP in E. coli K-12 MG1655 cells treated with 20ug/ml bicyclomycin
RNA polymerase (Beta') ChIP in E. coli K-12 MG1655 cells, untreated
RNA polymerase (Beta) ChIP in E. coli K-12 MG1655 cells, untreated
RNA produced by in vitro transcription, with RNA polymerase E σ70, of 2 ug of genomic DNA from E. coli MG1655 digested with EcoRI
RNA produced by in vitro transcription, with RNA polymerase E σS, of 2 ug of genomic DNA from E. coli MG1655 digested with EcoRI
RNAP_wt_SHX_rep1
RNAP_wt_SHX_rep2
RNAP_wt_untreated_rep1
RNAP_wt_untreated_rep2
RNA quality was confirmed with the Bioanalyzer system (Agilent Technologies, Santa Clara, CA, USA) and sequencing (50 cycles, pooling eight bar-coded samples per lane) was performed on the Illumina HiSeq platform (Illumina, San Diego, CA, USA) at the Research Technology Support Facility (RTSF) at Michigan State University.
RNA samples were extracted via Invitrogen RNAeasy Kit and treated with DNaseI to remove all DNA
RNA-Seq
RNA-seq 37C LB rep1
RNA-seq 37C LB rep2
RNA-seq data were mapped to the E. coli O157:H7 Sakai genome using the Subjunc aligner program from the Subread package (v1.4.6)   (http://bioinf.wehi.edu.au/subread/).
RNAseq_delAr1delAr2_glycerol_NH4Cl_O2_1
RNAseq_delAr1delAr2_glycerol_NH4Cl_O2_2
RNAseq_delAr1delAr2_glycerol_NH4Cl_O2_3
RNAseq_delAr1_glycerol_NH4Cl_O2_1
RNAseq_delAr1_glycerol_NH4Cl_O2_2
RNAseq_delAr1_glycerol_NH4Cl_O2_3
RNAseq_delAr2_glycerol_NH4Cl_O2_1
RNAseq_delAr2_glycerol_NH4Cl_O2_2
RNAseq_delAr2_glycerol_NH4Cl_O2_3
RNAseq_delta-crp_fructose_NH4Cl_O2_1
RNAseq_delta-crp_fructose_NH4Cl_O2_2
RNAseq_delta-crp_fructose_NH4Cl_O2_3
RNAseq_delta-crp_glucose_NH4Cl_O2_1
RNAseq_delta-crp_glucose_NH4Cl_O2_2
RNAseq_delta-crp_glucose_NH4Cl_O2_3
RNAseq_delta-crp_glycerol_NH4Cl_O2_1
RNAseq_delta-crp_glycerol_NH4Cl_O2_2
RNAseq_delta-crp_glycerol_NH4Cl_O2_3
RNA-seq libraries were prepared by Vertis AG (Freising-Weihenstephan, Germany). Briefly, RNA was polyadenylated with poly(A) polymerase, 5’-triphosphates were removed with tobacco acid pyrophosphatase followed by ligation of a 5’-adapter. First-strand cDNA synthesis was performed with the use of an oligo(dT) barcoded adapter primer and the M-MVL reverse transcriptase. The resulting cDNA was PCR-amplified with a high fidelity DNA polymerase. cDNA was purified with the Agencourt AMPure XP kit (Beckman Coulter Genomics).
RNA-Seq of E. coli were done using blind and fit-only parameter in DE-Seq pakage
RNA-seq of E. coli wt cells in stationary phase 30°C (30h)
RNA-seq of E. coli wt cells in stationary phase 30°C (30h) -Replicate 1
RNA-seq reads were aligned to the CFT073 genome using bowtie (version 0.12.8)
RNA-seq reads were aligned to the W3110 genome  using CASAVA 1.8.2
RNA-seq reads were mapped to the E. coli K-12 MG1655 genome (GenBank ID U00096.2) using short oligonucleotide alignment program (SOAP)
RNA-Seq reads were mapped to the reference genome using EDGE-Pro (Magoc T, Wood D and Salzberg SL, 2013) ) with default parameters
RNA sequences from each of the two differential analyses were processed and mapped to the corresponding genomes as a service provided by vertis Biotechnologie AG, Germany (www.vertis-biotech.com). This involved trimming adaptor sequence and masking for low-quality sequence.
RNA sequences were quality assessed and trimmed using FastQC version 0.10.1 (www.bioinformatics.babraham.ac.uk/projects/fastqc/). The identification of differentially expressed genes was performed using cufflinks version 2.0.2 to analyse the trimmed sequences as a time course. Briefly, trimmed reads were aligned to the E. coli MG1655 reference genome (NC_000913 13-Feb-2011) using Tophat version 2.0.7. Aligned reads were assembled for differential expression using cufflinks version and merged using cuffmerge with an ‘assemblies’ file containing the transcript.gtf output files from culfflinks. Differential expression analysis was performed using the merged.gtf output file from cuffmerge.
RNA-Seq was performed by the DOE Joint Genome Institute using the dUTP method. Briefly, ribosome-depleted RNA was fragmented in a buffered zinc solution, then purified using AMPure SPRI beads. First-strand cDNAs were then synthesized from the fragmented RNA using Superscript II reverse transcriptase, followed by a second bead purification. dUTP was included in the second strand synthesis reaction in addition to dTTP to chemically mark the second strand.  Two further bead purification steps using different ratios of beads to cDNA (85/100, then 140/100) selected cDNAs in a range between 150-350 bp. cDNAs were then A-tailed using Exo- Klenow, followed by ligation of sequencing adapter oligos. Following bead purification, dUTP was cleaved from the second strand using AmpErase Uracil N-glycosylase, resulting in adaptor ligated single stranded cDNAs.
RNAseq_wt_fructose_NH4Cl_O2_1
RNAseq_wt_fructose_NH4Cl_O2_2
RNAseq_wt_glucose_NH4Cl_O2_1
RNAseq_wt_glucose_NH4Cl_O2_2
RNAseq_wt_glucose_NH4Cl_O2_3
RNAseq_wt_glycerol_NH4Cl_O2_1
RNAseq_wt_glycerol_NH4Cl_O2_2
RNA-size selection and generation of the cDNA libraries was performed as described {Ingolia, 2009}
RNAsnap
RNAsnap followed by purification through Zymo RNA clean and concentrator.
RNAsnap followed by RiboZero rRNA removal kit for gram-negative bacteria (Epicentre)
rna treatment: no RNA treatment
rna treatment: rRNA depleted
rna treatment: rRNA depleted; Terminal Exonuclease
RNA was dephosphorylated, ligated to an adaptor, reverse transcribed, circularized then amplified with Illumina adaptors and barcodes.
RNA was extracted and purified using a Masterpure RNA purification kit (Epicentre Technologies).
RNA was extracted and purified using a Masterpure RNA purification kit (Epicentre Technologies).  
RNA was extracted from each sample using a QIAGEN RNA extraction kit according to the manufacturer’s instruction
RNA was extracted from harvested cultures using a hot lysis buffer and acid phenol-based extraction method and isopropanol precipitation. Following RNA extraction, Turbo DNase (Ambion, USA) was used to treat the samples as per manufacturer’s instructions. Each sample was split into five 20 μL aliquots and two rounds of DNase treatment were performed on each aliquot. Following DNase treatment, RNA samples were purified using the RNeasy Mini kit (Qiagen, Germany) as per the manufacturer’s instructions. For each sample, the DNase-treated aliquots were pooled together before purification. RNA quality was measured using the Agilent 2100 Bioanalyzer (Agilent Technologies, USA) with the RNA 6000 Nano Chip kit according to the manufacturer’s instructions while RNA was quantified using the Quant-iT RNA Assay kit (Life Technologies) and measured on a Qubit® 2.0 fluorometer. RNA was sequenced on the Illumina HiSeq 2000 platform  at BGI (Shenzen, China).
RNA was extracted from samples using hot phenol. The integrity of total RNA was determined from agarose gels.
RNA was extracted from the harvested cells using Trizol reagent. Depending upon the concentration of total RNA, sample were treated with Dnase and ribocleanup was given according to the instruction manual.
RNA was extracted from two biological replicates (30 mL) of each bacterial culture isolated at each time point. The 30 mL culture was aliquoted into three 15 mL tubes containing 5 mL of ice-cold EtOH/Phenol stop solution (5% water-saturated phenol pH 4.2 [Invitrogen] in 100% ethanol). Cells were collected by centrifugation (4,000 rpm, 5 min, 4°C) and the pellet suspended in 800 µL TE pH 8.0 supplemented with 0.5 mg/mL lysozyme. SDS (80 µL at 10% (w/v)) was added, samples mixed by inversion, and incubated (65°C, 2 min), before the addition of 88 µL 1 M NaOAc (pH 5.2). Each sample was added to an equal volume (1mL) of water-saturated phenol (pH 4.2, 65°C) and incubated (65°C, 6 min). The solution was separated into layers by centrifugation (14,000 rpm, 10 min, 4°C) and the upper aqueous RNA containing layer removed and transferred into a fresh tube.  RNA was cleaned by three extractions with phenol:CHCl3:IAA (25:24:1, pH 8.0) before being precipitated (-80°C, O/N) following the addition of 1/10 volume of 3M NaOAc (pH 5.2) and 2 volumes of ice cold 100% EtOH. RNA was pelleted (14,000 rpm, 25 min, 4°C), the supernatant removed and the pellet washed with 1 mL 75% cold EtOH (made with DEPC-treated water).
RNA was extracted from two biological replicates (30 mL) of each bacterial culture isolated at each time point. The 30 mL culture was aliquoted into three 15 mL tubes containing 5 mL of ice-cold EtOH/Phenol stop solution (5% water-saturated phenol pH 4.2 [Invitrogen] in 100% ethanol). Cells were collected by centrifugation (4,000 rpm, 5 min, 4°C) and the pellet suspended in 800 µL TE pH 8.0 supplemented with 0.5 mg/mL lysozyme. SDS (80 µL at 10% (w/v)) was added, samples mixed by inversion, and incubated (65°C, 2 min), before the addition of 88 µL 1 M NaOAc (pH 5.2). Each sample was added to an equal volume (1mL) of water-saturated phenol (pH 4.2, 65°C) and incubated (65°C, 6 min). The solution was separated into layers by centrifugation (14,000 rpm, 10 min, 4°C) and the upper aqueous RNA containing layer removed and transferred into a fresh tube.  RNA was cleaned by three extractions with phenol:CHCl3:IAA (25:24:1, pH 8.0) before being precipitated (-80°C, O/N) following the addition of 1/10 volume of 3M NaOAc (pH 5.2) and 2 volumes of ice cold 100% EtOH. RNA was pelleted (14,000 rpm, 25 min, 4°C), the supernatant removed and the pellet washed with 1 mL 75% cold EtOH (made with DEPC-treated water).   RNA was pelleted (14,000 rpm, 5 min, 4°C) and air dried before suspension in 80 µL RNAse free water (Invitrogen) and treatment with TURBO DNAse (Ambion) according to the manufacturer’s instructions. Briefly, 0.1 V of 10 X Turbo DNAse buffer (Ambion) was added to the RNA solution. 1 µL of TURBO DNAse was added to the solution, which was then incubated (30 min, 37 °C). Following incubation, 0.1 V of DNase Inactivation Reagent (Ambion) was added and then incubated (5 min, RT) with occasional mixing. RNA was isolated and transferred into a fresh microfuge tube.  RNA quality tested using the the Agilent RNA 6000 Nano Kit (Agilent Technologies) and quality analysed using the Agilent 2100 Bioanalyzer (Agilent Technologies).
RNA was extracted using an RNeasy kit (Qiagen) and after 1st and 2nd strand cDNA synthesis, linker ligation and size selection subjected to shotgun sequencing using single read 40bp read length runs on an Illumina Genome Analyzer GAII.
RNA was extracted using QIAGEN RNeasy Mini Kit following manufacturer's instructions.
RNA was extracted using Qiagen’s RNeasy minikit Cat#74106
RNA was extracted using RNAeasy columns (Qiagen) following the manufacturer's recommendations. RNA was quantified using a NanoDrop-1000 spectrophotometer and quality was monitored with the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA).
RNA was extracted using RNAeasy mini-Kit Qiagen and hybridizated on Affymatrix microarrays.
RNA was extracted using the Qiagen RNeasy Mini Kit (74104) and mechanical cell disruption with glass beads but without enzymatic lysis. This was carried out in the Qiagen RNeasy kit lysis RLT buffer with beta-mercaptethanol, according to the manufacturer’s recommendations. Mechanical cell disruption was completed through shaking for five min using a Retsch mill (Retsch MM200) on maximum speed. RNA was subsequently cleaned on-column with an additional DNase treatment (Qiagen 79254). The quality of extracted RNA was determined with an Agilent 2100 bioanalyzer having used an Agilent RNA 6000 Nano Kit according to the manufacturer’s recommendations.
RNA was extracted using the RNeasy Mini Kit (QIAGEN). The SuperScript indirect cDNA labeling system (Invitrogen) was used to generate cDNA.
RNA was extracted using Trizol and chloroform in conjunction with Qiagen’s RNeasy Mini kit (Qiagen, Valencia, CA) following the A. Untergasser protocol (http://www.molbi.de/protocols/rna_prep_comb_trizol_v1_0.htm) with one modification: Phase Lock Gel tubes (Eppendorf, Westbury, NY) were used to better separate organic and aqueous phases after the addition of chloroform. DNA was digested with Ambion rDNAse I (Life Technologies, Carlsbad, CA) for 30 min at 37°C. Total RNA was further cleaned using the RNeasy Mini kit and quality was assessed by the RNA ScreenTape Assay on the TapeStation 2200 (Agilent Technologies, Santa Clara, CA). Samples with RIN values greater than 8.0 were treated with the Ambion MICROBExpress Bacterial mRNA Enrichment Kit (Life Technologies, Carlsbad, CA) and were used for library construction.
RNA was extracted using Trizol (Invitrogen)
RNA was extracted using Trizol (Invitrogen) and Direct-zol RNA MiniPrep kit (Zymo).
RNA was extracted using TRIzol (Invitrogen), following the manufacturer's protocol. Total RNA was treated with DNAse I (Invitrogen, Cat No. 18068-015) according to the manufacturer's protocol. Further precipitation of RNA and ribosomal RNA cleanup was achieved by Ambion MICROBExpress bacterial mRNA purification Kit (cat. no. AM1905) according to the manufacturer's protocol. The RNA was finally suspended in 10 μL RNAse free water.
RNA was fragmented using the NEBNext Magnesium RNA Fragmentation Module (New England Biolabs). Then, RNA was phosphorylated using T4 polynucleotide kinase and prepared using the NEBNext Small RNA Library Prep Set for Illumina (Multiplex Compatible). DNA fragments greater than 100 bp were excised from a 4% agarose gel after library preparation and recovered using the Zymoclean Gel DNA Recovery Kit (Zymo Research).
RNA was isolated following cell lysis and phenol:chloroform extraction as previously described (Andrade, Pobre et al. 2012). After precipitation step in ethanol and 300 mM sodium acetate, RNA was resuspended in MilliQ-water. The integrity of RNA samples was evaluated by agarose gel electrophoresis. Turbo DNase (Ambion) treatment was used to remove contaminant DNA.
RNA was isolated from late exponential cultures, or from late exponential cells heat-shocked by exposure to 50°C for 15 min.
RNA was isolated from samples using the RNeasy Mini Kit (Qiagen). Prior to lysis all samples were incubated for 30 min on ice in RNA stop solution (0.1% SDS, 1% Acidic phenol, 19% ethanol, ice cold). The lysis and digestion protocol was followed with two 50 μl ddH20 elutions. Each sample was treated with 2 μl of DNase (Ambion, Austin, TX) at 37°C for 30 min. Samples were purified and concentrated using Microcon YM-30 columns (Millipore, Billerica, MA), and the quantity and purity were determined using an ND-1000 spectrophotometer (Nanodrop, Wilmington, DE). Samples were determined to be free of contaminating genomic DNA by absence of a band on a DNA electrophoresis gel after 30 rounds of PCR.
RNA was isolated from the culture by using the Qiagen RNeasy mini-prep kit.cDNA was synthesized using 5-10 µg/ml of RNA and the first strand cDNA synthesis kit from Invitrogen (Invitrogen Bioservices India Pvt. Ltd., Bangalore).
RNA was isolated from the pellet of E. coli cells using a well-established, published protocol (Kime et al. 2008. In RNA Turnover in Bacteria, Archaea and Organelles, Vol 447 (ed. LE Maquat, CM Arraiano), pp. 215). The cell pellet of S. coelicolor was resuspended in Kirby mix (Kieser et al. 2000. Practical Streptomyces Genetics. The John Innes Foundation, Norwich.), 100 µL per 1 O.D.600nm unit, and transferred to Lysing Matrix B tubes containing fine silica beads (MP Biomedical). Tubes were then placed in a high-speed benchtop homogenizer (Fastprep-24, MP Biomedical; set at 6.5 M/s). Cells were lysed by three cycles of homogenisation for 1 min with cooling between each cycle in an ice-water bath for 1 min. The lysates were extracted using an equal volume of acidic phenol: chloroform: isoamyl alcohol (50: 50: 1) and then chloroform: isoamyl alcohol (49: 1). Nucleic acid in the aqueous phase was precipitated by adding NaCl to 150 mM and 2.5 x volumes of 100% [v/v] ethanol, chilling at -20°C for 1 h, and then harvested by centrifugation (13,000 x g for 30 min at 4°C) . The nucleic acid pellet was washed twice with 700 µL of 70% [v/v] ethanol, air dried for 5 min and resuspended in RNase-free water. Contaminating DNA was removed from both E. coli and S. coelicolor by incubating with DNase as described by the vendor (Ambion) and extracted with phenol: chloroform as described above. The concentration and integrity of RNA samples were determined using a NanoDropTM 1000 spectrophotometer (Thermo Fisher Scientific) and agarose gel electrophoresis (Kime et al. 2008), respectively. Samples were enriched for mRNA using MICROBExpress-Bacteria beads, as described by the manufacturer (Ambion).
RNA was isolated using standard Trizol lysis and aqueous extraction, followed by further purification using a Qiagen RNAeasy kit.
RNA was isolated using the RNeasy Protect Bacteria Mini Kit (Qiagen), following manufacturer's instructions.
RNA was isolated using Trizol reagent (Thermo Fisher Scientific)
RNA was obtained from cells pellets by lysozyme treatment and phenol-chloroform extraction, analyzed by agarose gel electrophoresis to confirm integrity, quantified using a Nanodrop spectrophotometer (Thermo Scientific), and stored at -80°C
RNA was obtained from each culture using Ambion RiboPureTM-bacteria RNA extraction kit according to the manufacturer’s instructions.
RNA was obtained using the RNAeasy MIDI RNA extraction kit (Qiagen) using lysis buffer containing 0.1% beta-mercaptoethanol. RNA was extracted from lysates and purified according to the manufacturer’s standard protocol and subsequently stored at -80°C. RNA quality was assessed with electrophoresis using a RNA bioanalyser 2100 and Lab RNAChip (Agilent Technologies) before progression to microarray hybridization.
RNA was pelleted (14,000 rpm, 5 min, 4°C) and air dried before suspension in 80 µL RNAse free water (Invitrogen) and treatment with TURBO DNAse (Ambion) according to the manufacturer’s instructions. Briefly, 0.1 V of 10 X Turbo DNAse buffer (Ambion) was added to the RNA solution. 1 µL of TURBO DNAse was added to the solution, which was then incubated (30 min, 37 °C). Following incubation, 0.1 V of DNase Inactivation Reagent (Ambion) was added and then incubated (5 min, RT) with occasional mixing. RNA was isolated and transferred into a fresh microfuge tube.  RNA quality tested using the the Agilent RNA 6000 Nano Kit (Agilent Technologies) and quality analysed using the Agilent 2100 Bioanalyzer (Agilent Technologies).
RNA was prepared using the Trizol Reagent and a RiboPure kit (Invitrogen, Carlsbad, CA, USA) following the manufacturer's protocol. RNA integrity was assessed using an Agilent 2100 bioanalyser (Agilent, Palo Alto, CA, USA).
RNA was purified by a standard protocol using Phenol Chloroform.  Ribosomal RNA was removed using Ribo-Zero rRNA Removal Kit (Gram-Negative Bacteria) (Epicentre, Illumina).  Then, the conventional Illumina protocol for mRNA Sequencing Sample Preparation was applied with a few modifications (see original paper).
RNA was purified from 200 µL of overnight culture by pelleting and resuspeding in 500 µL of Trizol at 65°C, followed by purification on a column (Direct-Zol, Zymo Research). Samples received two 30-minute DNase treatments using TURBO DNA-free (Ambion) following the manufacturers instructions. RNA samples were then purified on a column (RNA Clean & Concentrator, Zymo Research). Three samples were prepped from each culture and pooled to generate sufficient RNA.
RNA was purified from lysates by phenol/chloroform method. rRNA was first removed using MICROBExpress following manufacturer’s protocol, except RNA was collected using Zymo’s RNA columns. A second rRNA removal step was performed following the protocol described in Affymetrix Expression Handbook, substituting enzymes MMLV (Ambion), RNase H (NEB), and DnaseI (Amplification grade, Invitrogen).
RNA was purified on RNA Clean & Concentrator™-5 columns following manufacturer’s instructions, and eluted in 6 μl of nuclease-free water. 6 μl of 2X RNA Loading Dye (ThermoScientific, cat. R0641) were added to purified RNA. Both DMS treated and untreated samples were heated at 95°C for 2 minutes, and immediately placed on ice. Samples were resolved on a 10% TBE-Urea polyacrylamide gel, and a gel slice ranging from 50 nt to the full-length product was cut. Gel slices were crushed by centrifugation through a punctured 0.5 ml tube, and resuspended in 500 μl of Diffusion buffer [500 mM Ammonium acetate; 0.05% SDS] supplemented with 60 U SUPERase• In™ RNase Inhibitor, then rotated at 4°C for 16 hours to allow passive diffusion of RNA fragments into buffer. RNA was precipitated by addition of 1 ml Isopropanol, and 2 μl Glycogen (20 μg/μl), and resuspended in 6 μl nuclease-free water.
RNA were isolated from wild type and mutants. Trizol extraction of total RNA was performed according to standard affymetrix labeling protocols.
∆rnb_RNA-Seq
rnc-_time0
rnc-_time10
rnc-_time20
rnc-_time2.5
rnc-_time5
rnc-_time7.5
rne-3071 ts
RNeasy Mini Kit (Qiagen, Austin, TX, USA) with on-column DNase treatment (RNase-Free DNase Set, Qiagen).
rne wild-type
rng mutant
rng wild-type
rnpB SPET-seq (in vitro)
∆rnr_RNA-Seq
Rockhopper version 1.20 (manuscript submitted) was used for alignment, normalization, and quantification. Rockhopper is available for download from http://cs.wellesley.edu/~btjaden/Rockhopper
Rodrigue_10-WT-Ni-3
Rodrigue_1-WT-phiNi-1
Rodrigue_2-WT-Ni-1
Rodrigue_5-WT-Ni-2
Rodrigue_6-WT-phiNi-2
Rodrigue_9-WT-phiNi-3
Roemerine_0min_rep1
Roemerine_0min_rep2
Roemerine_0min_rep3
Roemerine_60min_rep1
Roemerine_60min_rep2
Roemerine_60min_rep3
(-)-Roemerine treatment, 0 min, replicate 1
(-)-Roemerine treatment, 0 min, replicate 2
(-)-Roemerine treatment, 0 min, replicate 3
(-)-Roemerine treatment, 60 min, replicate 1
(-)-Roemerine treatment, 60 min, replicate 2
(-)-Roemerine treatment, 60 min, replicate 3
RP437 persisters treated with BF8 at 5 µg/mL for 1 hour
RP437 was inoculated in 100 mL LB and grown for 18 h (200 rpm, 37oC). Persister cells were isolated by lysing the normal cells with 5 µg/mL Ofloxacin (3.5h, 200 rpm, 37oC), followed by centrifugation and washing with 0.85% NaCl solution.
RPMI 1A, Microarray #1 first duplicate
RPMI 1B, Microarray #1 second replicate
RPMI 2A, Microarray #2, first replicate
RPMI 2B, Microarray #2 second replicate
RpoB ∆cra 1
RpoB ∆cra 2
RpoB ∆crp 1
RpoB ∆crp 2
RpoB with DPD 1 (ChIP-exo)
RpoB with DPD 2 (ChIP-exo)
RpoB with DPD and rifampicin 1 (ChIP-exo)
RpoB with DPD and rifampicin 2 (ChIP-exo)
RpoB with Fe 1 (ChIP-exo)
RpoB with Fe 2 (ChIP-exo)
RpoB with Fe and rifampicin 1 (ChIP-exo)
RpoB with Fe and rifampicin 2 (ChIP-exo)
RpoB WT 1
RpoB WT 2
rpo, delfis, ME
rpo, delhns, ME
RpoE induced (0 min)
RpoE induced (10 min)
RpoE induced (15 min)
RpoE induced (15min)
RpoE induced (20 min)
RpoE induced (2.5 min)
RpoE induced (30 min)
RpoE induced (5 min)
RpoE induced (5min)
RpoE induced (60 min)
RpoH induced (0 min)
RpoH induced (10 min)
RpoH induced (20 min)
RpoH induced (2.5 min)
RpoH induced (5 min)
rpoN mutant grown to logarithmic phase
rpoN mutant grown to transition phase
rpoS_04_rep1
rpoS_04_rep2
rpoS_04_TEX
rpoS_15min_rep1
rpoS_16_rep1
rpoS_180min_rep1
rpoS_30min_rep1
rpoS_30min_rep2
rpoS_30min_TEX
rpoS_EE_1
rpoS_EE_2
rpos level: 0%
rpos level: 100%
rpos level: 26%
rpoS_LS_1
rpoS_LS_2
rpoS_ME_1
rpoS_ME_2
rpoS mutant
rpoS_N_strv
rpoS_N_strv_TEX
rpoS_S_1
rpoS_S_2
rpoS_TS_1
rpoS_TS_2
rpo, wt, ME
rraA deletion, OD600=0.3
rraA deletion, OD600=0.5
rraA deletion, OD600=1.0
rRNA depleted RNA was then primed using random hexamers and reverse transcribed using SuperScript III (Life Technologies).
rRNA depletion, fragmentation, reverse transcription, tagging, barcoding, limited cycle PCR (Illumina)
rRNA depletion: Genomic DNA was removed with TURBO DNAse (Ambion), and then total RNA was run over two MEGAClear columns (Ambion) to deplete tRNAs and 5S rRNA. In between the two column purifications, a second DNAse digestion was performed (Baseline-ZERO Epicenter).  16S and 23S rRNA were depleted using MICROBExpress (Ambion) and custom depletion oligos (Rey et.al. 2010; JBC).
rRNA reduction with EpiCentre Ribo-Zero Gram Negative Ribosomal RNA reduction kit (2.5ug) & TruSeq RNA Library Prep
rRNA was removed from total RNA by using the Ribo-Zero rRNA removal kit. Reverse transcription and cDNA amplification were performed with the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech). Libraries were constructed using the Illumina Nextera XT kit and analyzed for concentration , size distribution and quantification of viable sequencing templates via qPCR.
R scripts (Bioconductor GenomicRanges) and custom scripts were used to calculate RPKMs. Fold-change was calculated as ratio of RPKMs after TF induction to control experiment.
rsd_EE_1
rsd_EE_2
rsd_LS_1
rsd_LS_2
rsd_ME_1
rsd_ME_2
rsd_S_1
rsd_S_2
rsdssrS_EE_1
rsdssrS_EE_2
rsdssrS_LS_1
rsdssrS_LS_2
rsdssrS_ME_1
rsdssrS_ME_2
rsdssrS_S_1
rsdssrS_S_2
rsdssrS_TS_1
rsdssrS_TS_2
rsd_TS_1
rsd_TS_2
R. sphaeroides was phototrophically grown to mid-log phase (100-150 kletts) in Sistrom's minimal medium (Sistrom, W. 1960. Journal of General Microbiology. 22:778-785) amended with 33.9 mM succinate .
rstB__U_N0075_r1
rstB__U_N0075_r2
rstB__U_N0075_r3
rstB upregulation, 0.075 mg/mL norfloxacin
ruvA___U_N0025_r1
ruvA___U_N0025_r2
ruvA___U_N0025_r3
ruvA upregulation, amp 50ug/ml, 0.0125% arabinose, 0.025ug/ml norfloxacin OD ~0.3
ruvC__U_N0075_r1
ruvC__U_N0075_r2
ruvC__U_N0075_r3
ruvC upregulation, 0.075 mg/mL norfloxacin
∆ryhB Aerobic
∆ryhB Anaerobic
RyhB-minus_cDNA_Aerobic_WIG.txt
RyhB-minus_cDNA_Anaerobic_WIG.txt
s70 ChIP DNA from DdksA cells
s70 ChIP DNA from starved DdksA cells
s70 ChIP DNA from starved wt cells
s70 ChIP DNA from wt cells
s70_DdksA_SHX_rep1
s70_DdksA_SHX_rep2
s70_DdksA_untreated_rep1
s70_DdksA_untreated_rep2
s70_wt_SHX_rep1
s70_wt_SHX_rep2
s70_wt_untreated_rep1
s70_wt_untreated_rep2
Sakai grown to OD600 = 1.8 in DMEM-MOPS 0.4% glucose at a 10:1 flask-to-media volume in a rotary shaker (180 RPM).
Sakai (O157:H7)
same cultures used for the viability assay. For each experimental condition, 15 aliquots of
SAM files thus obtained were converted to BAM files using samtools view command
Sample
Sample 1
sample: 1A
Sample 2
sample: 23S
sample: 2A
sample: 32D
sample: 33D
sample: 35B
sample: 3A
sample: 4A
sample: 5A
sample: #6
sample: 6A
Sample 79
sample: 9A
sample: Bio-1
sample: Bio-2
sample: Bio-3
sample: Bio-4
sample: Biopile control
sample: BZ-NT
Sample collection from M9 medium
sample: Composite A
sample: Composite B
sample id: 1a
sample id: 1b
sample id: 1c
sample id: 1d
sample id: 2a
sample id: 2b
sample id: 2c
sample id: 2d
sample id: 3a
sample id: 3b
sample id: 3c
sample id: 3d
sample id: 4a
sample id: 4b
sample id: 4c
sample id: 4d
sample id: 5a
sample id: 5b
sample id: 5c
sample id: 5d
sample id: 6a
sample id: 6b
sample id: 6c
sample id: 6d
sample id: 7a
sample id: 7b
sample id: 7c
sample id: 7d
sample: LC-1
sample: NC
sample: NF-NT
sample: Polygons
sample port: PFR P1
sample port: PFR P3
sample port: PFR P5
sample port: STR
Samples (200-ml) of the above cultures for each strain were split into two aliquots (each 100 ml), and the aliquots were then incubated at 30 °C or 42 °C for another 60 min.
Samples (30 ml) were harvested directly into cold phenol ethanol (187 µl phenol, 3.56 ml ethanol) to stabilize RNA, and total RNA was purified using Qiagen’s RNeasy Mini kit as recommended by suppliers. RNA was quantified using a BioPhotometer (Eppendorf).
Samples 931, 933, 935 and 937 were aligned with bowtie (V 1.1.2) with parameters  --wrapper basic-0 -q -m 1 -l 55 -k 1 -5 3 -3 40 --best -S -p 24, and samples 1311, 1314, 1317 and 1320 were aligned with bowtie (V 1.1.2) with paramters --wrapper basic-0 -q -m 1 -v 2 --best -p 24 -S
Samples for microarray analyses were taken before ciprofloxacin treatment (t0) and then at 1 hour post-treatment (t1). Cell concentration was adjusted to 109 cells/ml and cultures were treated with ciprofloxacin in Erlenmeyer flasks using 20 ml fresh LB. ~109 cells were taken at each timepoint as samples for RNA isolation. In order to stabilize RNA, RNA Bacteria Protect Reagent (Qiagen) was added to the samples according to the instructions of the manufacturer and then samples were stored overnight at -80°C. Total RNA was isolated by using RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. Sample concentration was estimated using the NanoDrop 1000 (Thermoscientific) spectrophotometer.
Samples for microarray analysis were collected as described earlier [1], (Samples were shortly mixed by vortexing, divided in 0.5 mL aliquots and 1. centrifuged for 3 min at 16,100 ×g and +4 °C. The pellets were resuspended in 250 µL of RNALater (Ambion, USA) and stored at -20 °C until analysis. RNA was extracted using the total RNA kit (A&A Biotechnology, Poland) .
Samples for transcriptome analysis were taken from exponentially growing cells. From the cells treated by RNAprotect Bacteria Reagent (Qiagen), total RNA samples were isolated using RNeasy columns (Qiagen) in accordance with manufacturer’s instruction.
Samples of ~7.2 ml bacterial culture were mixed with 0.8 ml stop solution, pelleted and total RNA was purified using RNeasy Mini Kit (Qiagen). DNase treatment was done twice with RQ1 DNase (Promega) to remove genomic DNA. cDNA synthesis was done according to the GeneChip® Expression Analysis Technical Manual of Affymetrix using M-MLV reverse transcriptase (Promega), without DTT addition. 13 µl of EB buffer were used for elution of cDNA after its clean-up with the MiniElute CR purification Kit (Qiagen). cDNA fragmentation was done in a 20-µl reaction containing 3.5 µg cDNA, 2 µl 10x One Phor-All buffer, 2 µl DNase I (diluted to 0.2 U/ µl, Amersham Pharmacia Biotech) in nuclease-free water. After incubation for 4 min at 37°C, DNase I was heat inactivated at 98°C for 10 min.
Samples of magnetic field-treated or sham-treated cells were withdrawn as fast as possible from the bioreactor (not later than 3 min) after the specified treatement period. Samples taken during intermittent exposure were withdrawn in the 4 min exposure break. Unexposed samples were withdrawn as fast as possible during steady-state conditions in the chemostat. In the response control experiment, samples were withdrawn 10 min after addition of 1 mM H2O2 (treated culture) or the equivalent water volume (reference culture).
sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria
sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09049
sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09050
sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09051
sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09052
sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09053
sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09054
sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09055
sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09056
sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09057
sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09058
sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09059
sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09620
sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09621
sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09622
sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09623
sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09624
sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09625
sample source: Fecal pellet from a mouse (c57Bl6) colonized with 8-gut bacteria
sample source: Fecal pellet from a mouse (c57Bl6) colonized with 9-gut bacteria
Samples were aligned to the E. coli K 12 MG1655 reference sequence (version NC000913.2), using BWA (version 0.5) WITH -q 30 parameter for trimming of reads below PHRED quality score of 30.
Samples were background corrected using the normexp() function in the Limma package in R. This was followed by quantile normalization and log2 transformation.
Samples were diluted 1:1 in RNA Protect (Qiagen, Carlsbad, CA) to inhibit RNase activity and then centrifuged (5000 x g, 10 min). Pellets were resuspended in TE/lysozyme (10 mg/ml lysozyme, 0.5% SDS, pH 8.0) with added proteinase K (1.5 mg/ml). RNA was isolated using Qiagen’s RNeasy kit according to manufacturer instructions with slight modification. Before centrifugation, β-mercaptoethanol was added to RNeasy kit buffer RLT (10% v/v). Additionally, during the wash step RNase-free DNase (Qiagen, Carlsbad, CA) was diluted in RNeasy kit buffer RDD (310 Kunitz units/mL), added to the purification column, and incubated for 15 minutes at room temperature (RT). After isolation, spectrophotometric NanoDrop (NanoDrop 1000 v3.8.1; Thermo Fisher) curves were obtained for each total RNA sample and verified for purity, as defined by absorbance ratios at 260/280 nm and 260/230 nm. Total RNA samples were sent to Oregon State University’s Center for Genome Research and Biocomputing. RNA integrity (RIN) measurements were taken using an Agilent Bioanalyzer, resulting in RIN scores of 10, out of a possible 10, for each sample. Ribosomal RNA was depleted using the RiboZero rRNA removal kit (Life Technologies, Eugene, OR).
samples were grown aerobically in rich media
Samples were grown anaerobically in MOPS minimal media supplemented with casamino acids using glucose as the carbon source. 20mM nitrate was added to (+NO) cultures for inducing nitrosative stress.
Samples were grown to mid exponential phase (OD approx 0.5). Cultures were then harvested with rapid filtration and resuspended in RNALater to stop RNA degradation. The Zymo Quick-RNA miniprep kit was used to extract pure RNA for subsequent analysis
Samples were grown to mid exponential phase (OD approx 0.5). Cultures were then quickly chilled to ≤ 4 ºC on dry ice/isopropanol bath, harvested by centrifugation (4470 × g) at 4 ºC and resuspended in RNALater to stop RNA degradation. The Zymo Quick-RNA miniprep kit was used to extract pure RNA for subsequent analysis
Samples were mixed, incubated on ice for 10 min after which cells were collected by centrifugation at 4150 rpm at 4˚C for 10 min.  Cell pellets were snap frozen in an ethanol/dry ice slurry and stored at -80°C until total RNA could be extracted.
Samples were sent to the International Space Station at 4C in FPAs, as described above. Temperature was increased to 37C and 23 hours later, the experiment was started by introducing the inoculum (E. coli ATCC 4157) into the growth medium (Medium E as described in Vogel & Bonner (1956) supplemented with 5 g/L glucose), yielding 3.25 mL of a culture with a starting cell concentration of 1.22e6 cell/mL.
Samples were treated with Prokaryotic Target Preparation protocol (GeneChip Expression Analysis Technical Manual).
Samples were treated with RNAprotect (Qiagen, Hilden, Germany) and stored at -80°C until preparation. rRNA was removed using RiboZero rRNA Removal Kit (Illumina, San Diego, CA), and sequencing libraries were prepared with TruSeq™ RNA Sample Preparation Kitv2 (Illumina)
Samples were used for on-bead enzymatic reactions of the ChIP-exo procedure and Illumina Tru-seq sequencing libraries were construction as described in Rhee and Pugh, 2012
sample type: AT1 digested total RNA
sample type: cDNA produced by RT of RNA deriving from vitro transcription, with RNA polymerase E σ70, of 2 ug of genomic DNA from E. coli MG1655 digested with EcoRI
sample type: cDNA produced by RT of RNA deriving from vitro transcription, with RNA polymerase E σS, of 2 ug of genomic DNA from E. coli MG1655 digested with EcoRI
sample type: control
sample type: E. coli strain MC4100relA+ in mid log phase incubated at 37ºC for 4 hours with 100 μg/ml NA
sample type: E. coli strain MC4100relA+ in mid log phase incubated at 37ºC for 4 hours with 10 μg/ml NA
sample type: E. coli strain MC4100relA+ in mid log phase incubated at 37ºC for 4 hours without treatment.
sample type: E. coli strain MC4100relA+ ∆mazEF in mid log phase incubated at 37ºC for 4 hours with 100 μg/ml NA
sample type: E. coli strain MC4100relA+ ∆mazEF in mid log phase incubated at 37ºC for 4 hours with 10 μg/ml NA
sample type: E. coli strain MC4100relA+ ∆mazEF in mid log phase incubated at 37ºC for 4 hours without treatment
sample type: E. coli strain MC4100relA+ ∆mazEFlexA3 in mid log phase incubated at 37ºC for 4 hours with 100 μg/ml NA
sample type: E. coli strain MC4100relA+ ∆mazEFlexA3 in mid log phase incubated at 37ºC for 4 hours with 10 μg/ml NA
sample type: E. coli strain MC4100relA+ ∆mazEFlexA3 in mid log phase incubated at 37ºC for 4 hours without treatment
sample type: input control
sample type: input DNA
sample type: mock community [artificial bacterial DNA mix]
sample type: no RNA treatment
sample type: plasmid pool
sample type: ribosome protected
sample type: test
sample type: V1 digested total RNA
sample: Vegetated
Sampling by directly placing the culture sample into RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany), following short centrifugation the pellet was stored at −70°C.
SA_TP1_repl1
SA_TP1_repl2
SA_TP1_repl3
SA_TP1_repl4
SA_TP1_repl5
SA_TP2_repl1
SA_TP2_repl2
SA_TP2_repl3
SA_TP2_repl4
SA_TP2_repl5
SA_TP3_repl1
SA_TP3_repl2
SA_TP3_repl3
SA_TP3_repl4
SA_TP3_repl5
SA_TP4_repl1
SA_TP4_repl2
SA_TP4_repl3
SA_TP4_repl4
SA_TP4_repl5
Saturated E. coli cultures were diluted in LB to an OD.of  0.05 OD600, grown at 37 degrees Celsius
Saturated E. coli cultures were diluted in LB toan OD.of  0.05 OD600, grown at 37 degrees Celsius
SB10_1
SB10_2
SB10_3
SB1_1
SB11_1
SB11_2
SB11_3
SB1_2
SB12_1
SB12_2
SB12_3
SB1_3
SB13_1
SB13_2
SB13_3
SB14_1
SB14_2
SB14_3
SB15_1
SB15_2
SB15_3
SB16_1
SB16_2
SB16_3
SB17_1
SB17_2
SB17_3
SB18_1
SB18_2
SB18_3
SB1 genomic DNA
SB2_1
SB2_2
SB2_3
SB3_1
SB3_2
SB3_3
SB5_1
SB5_2
SB5_3
SB6_1
SB6_2
SB6_3
SB7_1
SB7_2
SB7_3
SB8_1
SB8_2
SB8_3
SB9_1
SB9_2
SB9_3
sbcB__U_N0075_r1
sbcB__U_N0075_r2
sbcB__U_N0075_r3
sbcB upregulation, 0.075 mg/mL norfloxacin
Scale data set to 20 million reads
Scanned arrays were analyzed with Affymetrix GCOS 1.4 software to obtain Detection calls and Expression values based on MAS 5.0 algorithms. All arrays were scaled to a target value of 500.
Scanned images were analyzed with GenePix Pro 3.0 software (Axon Instruments, Union City, CA) to obtain gene expression ratios. 
Scanned images were analyzed with GenePix Pro 3.0 software (Axon Instruments, Union City, CA) to obtain gene expression ratios. Logged gene expression ratios were normalized by LOWESS regression (Yang et al., 2002) using the GeneSpring GX 7.3 software (Agilent Technologies).
Scanned spot signals were normalized using internal Protoarray control proteins and Z scores subsequently determined based on comparisons of mean signals for each spot pair to the mean spot intensity for the array. Z scores greater than 3.0 were considered significant
Scatter signal intensity after illumination at 150 ms exposure without normalization, without transformation. The non-normalized signals form the basis of conclusions in the accompanying manuscript.
scraping bacteria, opening with bead beating, Trizol-based RNA isolation, rRNA depletion with RiboZero, DNA digest, SoLiD seq by CeGaT (Tübingen, Germany)
ScriptSeq v2 Complete Kit (EpiCentre)
SD10_1
SD10_2
SD10_3
SD11_1
SD11_2
SD11_3
SD12_1
SD12_2
SD12_3
SD13_1
SD13_2
SD13_3
SD2_1
SD2_2
SD2_3
SD3_1
SD3_2
SD3_3
SD4_1
SD4_2
SD4_3
SD5_1
SD5_2
SD5_3
SD6_1
SD6_2
SD6_3
SD7_1
SD7_2
SD7_3
SD8_1
SD8_2
SD8_3
SD9_1
SD9_2
SD9_3
sdhA_FA_I
sdhA_FA_II
sdhA_FA_III
sdhA_LB_I
sdhA_LB_II
sdhA_LB_III
sdhC KO rep1
sdhC KO rep2
sdhC KO rep3
Second biological repeat 37°C
Second biological repeat 50°C
See publication for complete protocol. Briefly, samples with rRNA subtraction with treated with bacterial Ribo-Zero kit (Illumina). Next, RNA was fragmented with RNA fragmentation reagents (Ambion). First strand cDNA synthesis was conducted using random primers and Superscript III (Invitrogen). To enable strand specificity, second strand synthesis was conducted using dUTP instead of dTTP with RNase H, E. coli DNA ligase, and E. coli DNA polymerase. Ends were repaired with T4 DNA polymerase, Klenow DNA polymerase, and T4 PNK. 3’ ends were adenylated with the Klenow fragment (3’>5’ exo-). Y-shaped adapters were ligated and 9-12 cycles of PCR were conducted with standard Illumina primers with multiplexing indexes. Libraries were extracted from an acrylamide gel and submitted for sequencing at the MIT BioMicro Center using standard Illumina protocols.
See the paper Variation in the Genomic islands of porcine enteropathogenic Escherichia coli strains of serogroup O45 revealed by comparative genomic hybridization and PCR by Bruant and Zhang et al. 2009
Separate E. coli colonies were picked from LB agar plates for each replicate. Overnight cultures (12-16 hrs) were grown at 37°C in M9 media supplemented with 0.1% casamino acids, 0.4% glycerol, 0.4% glucose, 2 mM MgSO4, and 0.1 mM CaCl2. Overnight cultures were back diluted into fresh media and grown 3-4 hours to an OD600 of ~0.35 at 37°C in an orbital shaker at 200 RPM. Cultures were centrifuged, washed, and back diluted into media lacking glucose. After at least 30 minutes of recovery Para was induced by adding arabinose to 0.2%. Cells were harvested by centrifuging 1 mL of culture for 1 minute at maximum speed on a benchtop centrifuge. Pellets were immediately flash frozen in lN2.
SeqA ChIP DNA
SeqA ChIP DNA, new protocol
SeqA ChIP DNA, old protocol
SeqA in 0 min dnaC2 rep1
SeqA in 0 min dnaC2 rep2
SeqA in 15 min dnaC2 LB
SeqA in 15 min dnaC2 LB dam++ rep1
SeqA in 15 min dnaC2 LB dam++ rep2
SeqA in 15 min dnaC2 rep1
SeqA in 15 min dnaC2 rep2
SeqA in 15 min dnaC2 rep3
SeqA in 16 min dnaC2 rep1
SeqA in 16 min dnaC2 rep2
SeqA in 17 min dnaC2 rep1
SeqA in 17 min dnaC2 rep2
SeqA in 35 min dnaC2 rep1
SeqA in 35 min dnaC2 rep2
SeqA in 50 min dnaC2 rep1
SeqA in 50 min dnaC2 rep2
SeqA in 5 min dnaC2 rep1
SeqA in 5 min dnaC2 rep2
SeqA in AB acetate rep1
SeqA in AB acetate rep2
SeqA in hisA GATC cluster rep1
SeqA in hisA GATC cluster rep2
SeqA in srlA GATC cluster rep1
SeqA in srlA GATC cluster rep2
SeqA in ter GATC cluster rep1
SeqA in ter GATC cluster rep2
SeqA in tnaA GATC cluster rep1
SeqA in tnaA GATC cluster rep2
SeqA new deltaSeqA
SeqA new rep1
SeqA new rep2
SeqA old deltaSeqA
SeqA old rep1
SeqA old rep2
Sequence data from BGI had been filtered to remove reads containing ≥ 10% unreadable bases, ≥ 20% low quality (≤ Q20) bases, adapter contamination or duplicate read-pairs
Sequence data was processed by conversion of the sample alignment (BAM) files to strand-specific base count (BigWIG) files. To accomplish this an in-house script was created to extract strand-specific base count data from BAM files (outputs are positive and negative strand BigWIG files).
Sequence data was processed by conversion of the sample alignment (BAM) files to strand-specific base count (WIG) files. To accomplish this an in-house script was created to extract strand-specific base count data from BAM files (outputs are positive and negative strand WIG files). First, the script reads in the paired-end BAM file and counts the nucleotides spanning inserts between the mated 5’ and 3’ reads. Next, the script pulls in the orphan 5’ and 3’ reads from the respective BAM files and increments the base counts at each base location without duplicating the reads already incremented from the paired ends.
Sequenced reads were mapped onto NC_000913 reference genome sequence using bowtie v1.0.0 with parameters -X 1000 -n 2 -3 3 -S
Sequenced reads were trimmed for adaptor sequence.
Sequenced reads were trimmed for adaptor sequence and low-quality sequence using TrimGalore version 0.4.1, then mapped to mm8 whole genome using bwa mem version 0.7.12 with default parameters
Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to CP009273.1 whole genome using bowtie2
Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to E.coli K2 BW25113 whole genome using bowtie v0.12.2
Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to Escherichia coli ATCC8739 genome (GenBank CP000946.1) using Bowtie 2 (version 2.2.5)
Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to Escherichia coli str. K-12 substr. MG1655, complete genome using bowtie2 version 2.0.5 with default parameters.
Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence using FASTX-Toolkit  version 0.0.13 and Perl version 5.8.8
Sequenced reads were trimmed for adaptor sequence and masked for low-complexity sequence, then mapped to E.coli W3110 whole genome.
Sequenced reads were trimmed for adaptor sequences using FastQC v0.11.2.
Sequenced reads were trimmed for adaptor sequence, then mapped to E. coli K12 genome using bowtie v0.12.7 with parameters bowtie -t -v 3 -m 1 --best -S -p 2
Sequenced reads were trimmed for adaptor sequence using Cutadapt v. 1.8.3, then mapped to E. coli K12 substr. W3110 whole genome from NCBI (GenBank: AP009048.1) using the RNA-seq aligner STAR v.2.4.2a.
Sequenced reads were trimmed, the mapped to the Escherichia coli K-12 MG1655 genome (U00096.2) using SOAP.
Sequence reads for cDNA libraries were aligned onto E. coli K12 MG1655 genome, using Mosaik with following arguments: hash size=10, mismatch=0. Only reads that aligned to the unique genomic location were retained.
Sequence reads were aligned to the published E. coli K-12 MG1655 genome (U00096.2) using the software packages SOAP (Li et al, 2009) and ELAND (within the Illumina Genome Analyzer Pipeline Software), allowing at most two mismatches.  Sequence reads with sequences that did not align to the genome, aligned to multiple locations on the genome, or contained more than two mismatches were discarded from further analysis (<10% of reads) (Supplemental Files).  For visualization the raw tag density at each position was calculated using QuEST (Valouev et al, 2008) and normalized as tag density per million uniquely mapped reads.
Sequence reads were obtained and mapped to the W3110 genome (NCBI) using the Illumina Genome Analyzer Pipeline. All reads mapping with two or fewer mismatches were retained. Repeated sequences were ignored (rRNA). The counts in each sample was normalized by ssrA RNA and then converted to logarithmic values. A value of 1 was added to every count before the logarithmic conversion to avoid an undefined logarithm of 0. The lifetime was determined from the inverse of the slope of a linear fit to the logarithmic values.
Sequence reads were trimmed for adaptor reads and mapped to E. coli K12 MG1655 genome using CLC Genomics Workbench 6.0.1
Sequences obtained from the Illumina Genome Analyzer were mapped to both strands of the E. coli K12 MG1655 genome using BLAT allowing no gaps and up to two mismatches. Each alignment was extended to 200bp the approximate average length of DNA fragments on the 3' end. Only reads which mapped to a single region of the genome were considered for further analysis. For each base position on the genome, the number of reads that mapped to that position was calculated.
sequences were aligned to the parent E. coli strain genome template and transcript levels were quantified for triplicate groups of each primary deletion strain and synthetic rescue (i.e. sup) strain using Rockhopper (version 2.0.3)
Sequences were mapped to NC_000913.2 using bowtie2 v2.2.2 with parameters -N 0 --sensitive --minins 130 --maxins 780 -q --no-mixed --no-discordant  --no-unal
sequencing| Immunoprecipitated samples and the sheared DNA following the Bioruptor were de-crosslinked in 0.5x elution buffer containing 0.8 mg/ml Pronase at 42degree C for 2 h followed by 65degree C for 6 h. DNA was purified using a PCR purification kit (QIAGEN). Prior to sequencing, the DNA fragment sizes were checked and gene-specific quantitative PCR (qPCR) was carried out. Prior and post library construction, the concentration of the immunoprecipitated DNA samples was measured using the Qubit HS DNA kit (Invitrogen). Library construction and sequencing was done using the ChIP-Seq Sample Prep kit, Reagent Preparation kit and Cluster Station kit (Illumina). Samples were loaded at a concentration of 10 pM.
Sequencing libraries were constructed using the NEBNext Ultra DNA Library Prep Kit for Illumina (#E7370, NEB) for samples 1 to 3 (37 C) and the WaferGen PrepX ILM ChiP-Seq Library Kit (#400075, WaferGen) on the Apollo 324 System for samples 4 to 10 (22 C).
Sequencing libraries were prepared with Accel NGS 1S kit (Swift Bioscience) in accordanse with manufacturer’s protocol.
sequencing mode: 50 nt single-end read protocol
sequencing mode: paired-end 2*150 nt protocol
Sequencing reads (approximately 13 to 25 million per sample) were imported into Geneious Pro (Biomatters) and assembled to the reference chromosome MG1655 (GenBank Accession Number 000913.2). The assembly process was set to medium/low sensitivity on Geneious, with the following parameters: 10% gaps allowed per read; word length of 18; index word length of 13; words repeated more than 12 times ignored; 20% maximum mismatches per read; and maximum ambiguity of 4
Sequencing reads were aligned to the mg1655 genome (NC_000913.2) or a list of the designed signal peptide fusions using bowtie 0.12.9
Sequencing reads were mapped to the E. coli genome with bowtie2
Sequential Design timecourse t10_t11.1
Sequential Design timecourse t10_t11.2
Sequential Design timecourse t1_t2.1
Sequential Design timecourse t1_t2.2
Sequential Design timecourse t2_t3.1
Sequential Design timecourse t2_t3.2
Sequential Design timecourse t3_t4.1
Sequential Design timecourse t3_t4.2
Sequential Design timecourse t4_t5.1
Sequential Design timecourse t4_t5.2
Sequential Design timecourse t5_t6.1
Sequential Design timecourse t5_t6.2
Sequential Design timecourse t6_t7.1
Sequential Design timecourse t6_t7.2
Sequential Design timecourse t7_t8.1
Sequential Design timecourse t7_t8.2
Sequential Design timecourse t8_t9.1
Sequential Design timecourse t8_t9.2
Sequential Design timecourse t9_t10.1
Sequential Design timecourse t9_t10.2
Serine addition
Serine Hydroxamate stressed, replicate #1
Serine Hydroxamate stressed, replicate #2
Serine Hydroxamate stressed, replicate #3
Serine hydrxamate (100 mg/L final concentration) was added to the cultures in the late-exponential phase at ~11 OD (~5.5 g g dry cell weight per liter).  Samples for DNA microarray analysis were taken 1 hour after the beginning the serine hydrxamate addition (13.2 OD, ~6.6 g dry cell weight per liter, growth rate 0.15 1/h).
serotype O157:H7
serotype O157:H7 
serotype: O157:H7
serotype: o157:H7 clade 2, stx 1 and 2
serotype: o157:H7 clade 2, stx 2
serotype: o157:H7 clade 8, stx 2
serotype: o157:H7 clade 8, stx 2 and 2c
serotype O175:H16
serovar O157:H7 strain EDL933; GenBank accession NC_002655.2
setwd(\
Seven mililiter of phenol/water were added before incubating 10 min at 67°C with occasional stirring. The samples were cooled on ice and spun 10 min at 5000 rpm at 4°C. The aqueous phase was separated and extracted again once the same way and then once with phenol/chloroform (v/v 1:1). One tenth of the volume of 4M NaCl and 2.5 volumes of cold ethanol were then added to the aqueous phase. The tubes were left at -20°C for two hours then spun at 8500rpm at 4°C. The pellet was washed with 70% ethanol, dried under vacuum and resuspened in 300l sterile water and transferred to an eppendord tube. An amount of 34.5l Qiagen RDD buffer and 9.37l of RNase free DNase I (Qiagen) were added. After 15min at room temperature, the tubes were mixed by inversion and deproteinized as shown above with 300l phenol/H2O at room temperature. The RNA was then precipitated with 37.5µl NaCl 4M and 823µl cold ethanol. After 2 hours at -20°C, the tubes were centrifuged 30min at 10,000G at 4°C, the pellets were then washed with 70% ethanol then dried under vacuum and resuspended in 60µl sterile water. The RNAs were stored at -20°C.
SF1a_1
SF1a_2
SF1a_3
SF1b_1
SF1b_2
SF1b_3
SF2b_1
SF2b_2
SF2b_3
SF3_1
SF3_2
SF3_3
SF4a_1
SF4a_2
SF4a_3
SF4b_1
SF4b_2
SF4b_3
SF5
SF5_2
SF5_3
SF6_1
SF6_2
SF6_3
SFx
SFx_2
SFx_3
SFy_1
SFy_2
SFy_3
SgrR_1
SgrR_2
SgrR_3
sgrS_T_1
sgrS_T_2
sgrS_T_3
sgrS_un_1
sgrS_un_2
sgrS_un_3
SH0003 30h
SH0012 20h
SH0012 30h
Sh0012 40h
SH0012 and SH0003 were fermented in a 5.0L jar-fermenter with a 2.0 working voulume of modified R medium (20g/L glucose, 80 g/L glycerol, 1.4g/L MgSDo4, 13.5 g/L KH2PO4, 4.0 g/L (NH4)2HPO4 and 1.7g/L citric acid at 35°C. The agitation was at 1200 rpm and pH was maintained at 7.0 with 5N NH4OH. with the depletion of initial glucose, feeding medium of glycerol (700g/L) was throughout fermentation.
SH0012 no rpm change
SH0012 no vitamin B12
Shigella boydii
Shigella boydii 13
Shigella boydii 14
Shigella boydii 15
Shigella boydii  15
Shigella boydii 16
Shigella boydii 17
Shigella boydii 18
Shigella boydii serogroup 1
Shigella boydii serogroup 2
Shigella boydii serotype 1
Shigella boydii serotype 10
Shigella boydii serotype 11
Shigella boydii serotype 12
Shigella boydii serotype 13
Shigella boydii serotype2
Shigella boydii serotype 2
Shigella boydii serotype3
Shigella boydii serotype 3
Shigella boydii serotype 5
Shigella boydii serotype 6
Shigella boydii  serotype 7
Shigella boydii serotype 7
Shigella boydii serotype 8
Shigella boydii serotype 9
Shigella dysenteriae
Shigella dysenteriae 10
Shigella dysenteriae 11
Shigella dysenteriae 12
Shigella dysenteriae 13
Shigella dysenteriae 2
Shigella dysenteriae 3
Shigella dysenteriae 4
Shigella dysenteriae 5
Shigella dysenteriae 6
Shigella dysenteriae 7
Shigella dysenteriae 8
Shigella dysenteriae 9
Shigella flexneri
Shigella flexneri 1a
Shigella flexneri 1b
Shigella flexneri 2b
Shigella flexneri 3
Shigella flexneri 4a
Shigella flexneri 4b
Shigella flexneri 5
Shigella flexneri 6
Shigella flexneri variant x
Shigella flexneri variant y
SHX-treated Delta dksA Cells
SHX-treated Delta dksA Cells Replicate 1
SHX-treated Delta dksA Cells Replicate 2
SHX-treated Delta dksA Cells Replicate 3
SHX-treated Wild-type Cells
SHX-treated Wild-type Cells Replicate 1
SHX-treated Wild-type Cells Replicate 2
SHX-treated Wild-type Cells Replicate 3
Sig70 in E. coli_exponential aerobic growth_no rifampicin
Sig70 in E. coli, exponential aerobic growth, no rifampicin applied replicate 1 (run 299)
Sig70 in E. coli, exponential aerobic growth, no rifampicin applied replicate 1 (run 423)
Sig70 in E. coli, exponential aerobic growth, no rifampicin applied replicate 2 (run 299)
Sig70 in E. coli, exponential aerobic growth, no rifampicin applied replicate 2 (run 423)
Sig70 in E. coli_exponential aerobic growth_rifampicin
Sig70 in E. coli, exponential aerobic growth, rifampicin applied for 20 minutes, replicate 1 (run 423)
Sig70 in E. coli, exponential aerobic growth, rifampicin applied for 20 minutes, replicate 2 (run 423)
Sig70 in E. coli_static aerobic growth_no rifampicin
Sig70 in E. coli, static aerobic growth, no rifampicin applied replicate 1 (run 299)
Sig70 in E. coli, static aerobic growth, no rifampicin applied replicate 2 (run 299)
Sigma70_ChIP_A_cy5
Sigma70_ChIP_B_cy5
Sigma70 ChIP-chip in E. coli K-12 MG1655 cells (Dataset 56859)
Sigma70 ChIP-chip in E. coli K-12 MG1655 cells (Dataset 62214)
Sigma70 ChIP-chip in E. coli K-12 MG1655 cells (Dataset 64194)
Sigma70 ChIP-chip in E. coli K-12 MG1655 cells treated with 100ug/ml rifampicin (Dataset 84847)
Sigma70_ChIP_control_A_cy3
Sigma70_ChIP_control_B_cy3
Sigma70 ChIP in E. coli K-12 MG1655 cells
Sigma70 ChIP in E. coli K-12 MG1655 cells treated with 100ug/ml rifampicin
Sigma70_IP_ChIP-seq_Aerobic_A_SET_WIG.wig: U00096.2
Sigma70_IP_ChIP-seq_Anaerobic_A_SET_WIG.wig: U00096.2
Sigma70 LB
Sigma70 LB-1
Sigma70 LB-2
Sigma70 LB-3
Sigma70 LP
Sigma70 LP-1
Sigma70 LP-2
Sigma70 LP-3
Signal and p-values for each genomic position interrogated.
Signal intensities were averaged among the technical replicates.  Two types of data analysis were performed: to indentify density-dependent changes in gene expression, single averaged normalized signal intensities for each treatment point were compared to the average of corresponding unstressed control signal intensities.  Genes which showed a relative signal log2ratio (SLR) value above 1.0 or below -1.0 were selected for further analysis. 
Signal intensities were averaged among the technical replicates. Two types of data analysis were performed: to indentify density-dependent changes in gene expression, single averaged normalized signal intensities for each treatment point were compared to the average of corresponding unstressed control signal intensities. Genes which showed a relative signal log2ratio (SLR) value above 1.0 or below -1.0 were selected for further analysis. 
Signal intensities were normalized for spot and slide abnormalities with the spatial Lowess algorithm and analyzed by mixed-effect ANOVA (MAANOVA) (Kerr et al. 2000). Both Lowess and MAANOVA are part of the R/MAANOVA microarray statistical package, available at (http://www.jax.org/staff/churchill/labsite/). The resulting variety-by-gene interaction (VG) values of the control and experimental spot intensities were combined with the residual noise from each spot to obtain the filtered and adjusted expression values (Cui. et. al). Duplicate expression values from each array were combined, averaged and values from MAANOVA were subsequently subjected to significance analysis of microarray (SAM) data with the SAM package (Tusher. et.al). Significantly up- and down-regulated genes were identified based on a 1.5 cutoff threshold, a global false discovery rate lower than 5% (p<0.05). Six arrays representing a total of 12 replicates were analyzed between a treatment and a control.
Signal intensities with all probes are shown in Sample data table. The 'expressed_present_probes.txt (available on Series records) contains Signal intensities with present probes.  Average signal intensities from 3 experiments were used to calculate fold increases in gene expression between treated and control groups, with signal intensity of 39 used as a minimum intensity, using the formula: average intensity in treated group/average intensity in control group (the 'Avg' columns). Transformed Ln (signal intensity) values, shown in columns 'Ln', were used for direct statistical comparisons of expression signals between treated and control groups by t-test (columns 't-test' ). The probes in the expressed_present_probes.txt are arranged in descending order from the highest to the lowest ratio of gene induction in PGRP/control (column 'Ratio' in 'expressed_present_probes.txt').
Signals mapping to non-coding RNA regions were removed from the datasets (see supplementary file).
Signals of each slide were smoothed using the NMPP program (Wang et al., 2006). Normalisation per chip to 50th percentile and further analyses were performed in GeneSpring GX v7.3.1 (Agilent Technologies, Basel, Switzerland).
Single colonies of P. putida strain DOT-T1E and E. coli MG1655 were grown overnight in Luria–Bertani (LB) medium at 30°C. Overnight cultures were diluted to a starting OD600 of 0.01 in the same medium and 50 ml aliquots were disposed in separate 250 ml Erlenmeyer flasks and incubated with shaking at 200 rpm. When cultures reached exponential phase (0.5 at OD600), antibiotics were added at sub-lethal concentrations to the culture medium to reach a final concentration of 1 µg/ml kanamycin, 300 µg/ml ampicillin, 150 µg/ml chloramphenicol, 4 µg/ml tetracycline, 0.5 µg/ml ciprofloxacin, 300 µg/ml spectinomycin, 500 µg/ml rifampicin and 2 µg/ml gentamicin. Then cultures were incubated under the same conditions for one hour more. Cells were harvested by centrifugation at 8000 g for 10 min and suspended immediately in stop solution (95% (v/v) ethanol, 5% (v/v) phenol) and pelleted by centrifugation. After that, total RNA was extracted with Trizol (Invitrogen). Removal of DNA was carried out by treatment with DNase I (Fermentas) in combination with the RNase inhibitor RiboLock (Fermentas). The integrity and quality of total RNA was assessed with an Agilent 2100 Bioanalyzer (Agilent Technologies).
Single colonies were inoculated into 15x100 mm tubes containing 4 ml LB, and grown at 30ºC and 250 rpm overnight. 100 μl seed culture was inoculated into a 100 ml flask containing 10 ml LB medium, and grown at 30ºC and 250 rpm for 5 h.
single mutant in exopolyphosphatase (PPX)
single mutant in polyphosphate kinase 1 (PPK1)
Singleton peaks (standard deviation =0) and peaks without matched peaks on the opposing strand where discarded
Size filtering: discarding reads shorter than 12 nt (TRAPL)
Size filtering: discarding reads shorter than 12 nt (via READemption)
Slide 10_Anaerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 10
Slide 10_Anaerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 5
Slide 10_Anaerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 10
Slide 10_Anaerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 20
Slide 10_Anaerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 2.5
Slide 10_Anaerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 40
Slide 10_Anaerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 5
Slide 10_Anaerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 80
Slide 11_Anaerobic culture_CORM-3_biol rep 1_Cy3 20 Cy5 0
Slide 11_Anaerobic culture_CORM-3_biol rep 1_Cy3 5 Cy5 0
Slide 11_Anaerobic culture_CORM-3_biol rep 2_Cy3 10 Cy5 0
Slide 11_Anaerobic culture_CORM-3_biol rep 2_Cy3 20 Cy5 0
Slide 11_Anaerobic culture_CORM-3_biol rep 2_Cy3 2.5 Cy5 0
Slide 11_Anaerobic culture_CORM-3_biol rep 2_Cy3 40 Cy5 0
Slide 11_Anaerobic culture_CORM-3_biol rep 2_Cy3 5 Cy5 0
Slide 11_Anaerobic culture_CORM-3_biol rep 2_Cy3 80 Cy5 0
Slide 12_Anaerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 20
Slide 12_Anaerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 2.5
Slide 12_Anaerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 40
Slide 12_Anaerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 80
Slide 12_Anaerobic culture_CORM-3_biol rep 1_Cy3 10 Cy5 0
Slide 12_Anaerobic culture_CORM-3_biol rep 1_Cy3 2.5 Cy5 0
Slide 12_Anaerobic culture_CORM-3_biol rep 1_Cy3 40 Cy5 0
Slide 12_Anaerobic culture_CORM-3_biol rep 1_Cy3 80 Cy5 0
Slide 13_Wild type_CORM-3_biol rep 1_Cy3 0 Cy5 120
Slide 13_Wild type_CORM-3_biol rep 1_Cy3 10 Cy5 0
Slide 13_Wild type_CORM-3_biol rep 1_Cy3 120 Cy5 0
Slide 13_Wild type_CORM-3_biol rep 1_Cy3 20 Cy5 0
Slide 13_Wild type_CORM-3_biol rep 1_Cy3 40 Cy5 0
Slide 13_Wild type_CORM-3_biol rep 1_Cy3 60 Cy5 0
Slide 13_Wild type_CORM-3_biol rep 2_Cy3 0 Cy5 10
Slide 13_Wild type_CORM-3_biol rep 2_Cy3 0 Cy5 20
Slide 14_Wild type_CORM-3_biol rep 2_Cy3 0 Cy5 120
Slide 14_Wild type_CORM-3_biol rep 2_Cy3 0 Cy5 40
Slide 14_Wild type_CORM-3_biol rep 2_Cy3 0 Cy5 60
Slide 14_Wild type_CORM-3_biol rep 2_Cy3 10 Cy5 0
Slide 14_Wild type_CORM-3_biol rep 2_Cy3 120 Cy5 0
Slide 14_Wild type_CORM-3_biol rep 2_Cy3 20 Cy5 0
Slide 14_Wild type_CORM-3_biol rep 2_Cy3 40 Cy5 0
Slide 14_Wild type_CORM-3_biol rep 2_Cy3 60 Cy5 0
Slide 15_hemA_CORM-3_biol rep 2_Cy3 120 Cy5 0
Slide 15_hemA_CORM-3_biol rep 2_Cy3 20 Cy5 0
Slide 15_hemA_CORM-3_biol rep 2_Cy3 40 Cy5 0
Slide 15_hemA_CORM-3_biol rep 2_Cy3 60 Cy5 0
Slide 15_Wild type_CORM-3_biol rep 1_Cy3 0 Cy5 10
Slide 15_Wild type_CORM-3_biol rep 1_Cy3 0 Cy5 20
Slide 15_Wild type_CORM-3_biol rep 1_Cy3 0 Cy5 40
Slide 15_Wild type_CORM-3_biol rep 1_Cy3 0 Cy5 60
Slide 16_hemA_CORM-3_biol rep 1_Cy3 120 Cy5 0
Slide 16_hemA_CORM-3_biol rep 1_Cy3 60 Cy5 0
Slide 16_hemA_CORM-3_biol rep 2_Cy3 0 Cy5 10
Slide 16_hemA_CORM-3_biol rep 2_Cy3 0 Cy5 120
Slide 16_hemA_CORM-3_biol rep 2_Cy3 0 Cy5 20
Slide 16_hemA_CORM-3_biol rep 2_Cy3 0 Cy5 40
Slide 16_hemA_CORM-3_biol rep 2_Cy3 0 Cy5 60
Slide 16_hemA_CORM-3_biol rep 2_Cy3 10 Cy5 0
Slide 17_hemA_CORM-3_biol rep 1_Cy3 0 Cy5 10
Slide 17_hemA_CORM-3_biol rep 1_Cy3 0 Cy5 120
Slide 17_hemA_CORM-3_biol rep 1_Cy3 0 Cy5 20
Slide 17_hemA_CORM-3_biol rep 1_Cy3 0 Cy5 40
Slide 17_hemA_CORM-3_biol rep 1_Cy3 0 Cy5 60
Slide 17_hemA_CORM-3_biol rep 1_Cy3 10 Cy5 0
Slide 17_hemA_CORM-3_biol rep 1_Cy3 20 Cy5 0
Slide 17_hemA_CORM-3_biol rep 1_Cy3 40 Cy5 0
Slide 18_Aerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 10
Slide 18_Aerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 20
Slide 18_Aerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 2.5
Slide 18_Aerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 40
Slide 18_Aerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 5
Slide 18_Aerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 80
Slide 18_Aerobic culture_CORM-3_biol rep 1_Cy3 2.5 Cy5 0
Slide 18_Aerobic culture_CORM-3_biol rep 1_Cy3 5 Cy5 0
Slide 19_Aerobic culture_CORM-3_biol rep 1_Cy3 10 Cy5 0
Slide 19_Aerobic culture_CORM-3_biol rep 1_Cy3 20 Cy5 0
Slide 19_Aerobic culture_CORM-3_biol rep 1_Cy3 40 Cy5 0
Slide 19_Aerobic culture_CORM-3_biol rep 1_Cy3 80 Cy5 0
Slide 19_Aerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 10
Slide 19_Aerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 20
Slide 19_Aerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 2.5
Slide 19_Aerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 5
Slide 20_Aerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 40
Slide 20_Aerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 80
Slide 20_Aerobic culture_CORM-3_biol rep 2_Cy3 10 Cy5 0
Slide 20_Aerobic culture_CORM-3_biol rep 2_Cy3 20 Cy5 0
Slide 20_Aerobic culture_CORM-3_biol rep 2_Cy3 2.5 Cy5 0
Slide 20_Aerobic culture_CORM-3_biol rep 2_Cy3 40 Cy5 0
Slide 20_Aerobic culture_CORM-3_biol rep 2_Cy3 5 Cy5 0
Slide 20_Aerobic culture_CORM-3_biol rep 2_Cy3 80 Cy5 0
Slide 25_Aerobic culture_iCORM-3_biol rep 1_Cy3 0 Cy5 10
Slide 25_Aerobic culture_iCORM-3_biol rep 1_Cy3 0 Cy5 20
Slide 25_Aerobic culture_iCORM-3_biol rep 1_Cy3 0 Cy5 2.5
Slide 25_Aerobic culture_iCORM-3_biol rep 1_Cy3 0 Cy5 40
Slide 25_Aerobic culture_iCORM-3_biol rep 1_Cy3 0 Cy5 5
Slide 25_Aerobic culture_iCORM-3_biol rep 1_Cy3 0 Cy5 80
Slide 25_Aerobic culture_iCORM-3_biol rep 1_Cy3 2.5 Cy5 0
Slide 25_Aerobic culture_iCORM-3_biol rep 1_Cy3 5 Cy5 0
Slide 26_Aerobic culture_iCORM-3_biol rep 1_Cy3 10 Cy5 0
Slide 26_Aerobic culture_iCORM-3_biol rep 1_Cy3 20 Cy5 0
Slide 26_Aerobic culture_iCORM-3_biol rep 1_Cy3 40 Cy5 0
Slide 26_Aerobic culture_iCORM-3_biol rep 1_Cy3 80 Cy5 0
Slide 26_Aerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 10
Slide 26_Aerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 20
Slide 26_Aerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 2.5
Slide 26_Aerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 5
Slide 27_Aerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 40
Slide 27_Aerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 80
Slide 27_Aerobic culture_iCORM-3_biol rep 2_Cy3 10 Cy5 0
Slide 27_Aerobic culture_iCORM-3_biol rep 2_Cy3 20 Cy5 0
Slide 27_Aerobic culture_iCORM-3_biol rep 2_Cy3 2.5 Cy5 0
Slide 27_Aerobic culture_iCORM-3_biol rep 2_Cy3 40 Cy5 0
Slide 27_Aerobic culture_iCORM-3_biol rep 2_Cy3 5 Cy5 0
Slide 27_Aerobic culture_iCORM-3_biol rep 2_Cy3 80 Cy5 0
Slide 28_Anaerobic culture_iCORM-3_biol rep 1_Cy3 0 Cy5 2.5
Slide 28_Anaerobic culture_iCORM-3_biol rep 1_Cy3 0 Cy5 5
Slide 28_Anaerobic culture_iCORM-3_biol rep 1_Cy3 10 Cy5 0
Slide 28_Anaerobic culture_iCORM-3_biol rep 1_Cy3 20 Cy5 0
Slide 28_Anaerobic culture_iCORM-3_biol rep 1_Cy3 2.5 Cy5 0
Slide 28_Anaerobic culture_iCORM-3_biol rep 1_Cy3 40 Cy5 0
Slide 28_Anaerobic culture_iCORM-3_biol rep 1_Cy3 5 Cy5 0
Slide 28_Anaerobic culture_iCORM-3_biol rep 1_Cy3 80 Cy5 0
Slide 29_Anaerobic culture_iCORM-3_biol rep 1_Cy3 10 Cy5 0
Slide 29_Anaerobic culture_iCORM-3_biol rep 1_Cy3 20 Cy5 0
Slide 29_Anaerobic culture_iCORM-3_biol rep 1_Cy3 40 Cy5 0
Slide 29_Anaerobic culture_iCORM-3_biol rep 1_Cy3 80 Cy5 0
Slide 29_Anaerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 10
Slide 29_Anaerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 20
Slide 29_Anaerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 2.5
Slide 29_Anaerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 5
Slide 30_Anaerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 40
Slide 30_Anaerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 80
Slide 30_Anaerobic culture_iCORM-3_biol rep 2_Cy3 10 Cy5 0
Slide 30_Anaerobic culture_iCORM-3_biol rep 2_Cy3 20 Cy5 0
Slide 30_Anaerobic culture_iCORM-3_biol rep 2_Cy3 2.5 Cy5 0
Slide 30_Anaerobic culture_iCORM-3_biol rep 2_Cy3 40 Cy5 0
Slide 30_Anaerobic culture_iCORM-3_biol rep 2_Cy3 5 Cy5 0
Slide 30_Anaerobic culture_iCORM-3_biol rep 2_Cy3 80 Cy5 0
Slide 31_Aerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 80
Slide 31_Aerobic culture_CO gas_biol rep 1_Cy3 10 Cy5 0
Slide 31_Aerobic culture_CO gas_biol rep 1_Cy3 20 Cy5 0
Slide 31_Aerobic culture_CO gas_biol rep 1_Cy3 40 Cy5 0
Slide 31_Aerobic culture_CO gas_biol rep 2_Cy3 0 Cy5 10
Slide 31_Aerobic culture_CO gas_biol rep 2_Cy3 0 Cy5 20
Slide 31_Aerobic culture_CO gas_biol rep 2_Cy3 0 Cy5 2.5
Slide 31_Aerobic culture_CO gas_biol rep 2_Cy3 0 Cy5 5
Slide 33_Aerobic culture_CO gas_biol rep 2_Cy3 0 Cy5 40
Slide 33_Aerobic culture_CO gas_biol rep 2_Cy3 0 Cy5 80
Slide 33_Aerobic culture_CO gas_biol rep 2_Cy3 10 Cy5 0
Slide 33_Aerobic culture_CO gas_biol rep 2_Cy3 20 Cy5 0
Slide 33_Aerobic culture_CO gas_biol rep 2_Cy3 2.5 Cy5 0
Slide 33_Aerobic culture_CO gas_biol rep 2_Cy3 40 Cy5 0
Slide 33_Aerobic culture_CO gas_biol rep 2_Cy3 5 Cy5 0
Slide 33_Aerobic culture_CO gas_biol rep 2_Cy3 80 Cy5 0
Slide 34_hemA_iCORM-3_biol rep 1_Cy3 0 Cy5 10
Slide 34_hemA_iCORM-3_biol rep 1_Cy3 0 Cy5 120
Slide 34_hemA_iCORM-3_biol rep 1_Cy3 0 Cy5 20
Slide 34_hemA_iCORM-3_biol rep 1_Cy3 0 Cy5 40
Slide 34_hemA_iCORM-3_biol rep 1_Cy3 0 Cy5 60
Slide 34_hemA_iCORM-3_biol rep 1_Cy3 10 Cy5 0
Slide 34_hemA_iCORM-3_biol rep 1_Cy3 20 Cy5 0
Slide 34_hemA_iCORM-3_biol rep 1_Cy3 40 Cy5 0
Slide 35_hemA_iCORM-3_biol rep 1_Cy3 120 Cy5 0
Slide 35_hemA_iCORM-3_biol rep 1_Cy3 60 Cy5 0
Slide 35_hemA_iCORM-3_biol rep 2_Cy3 0 Cy5 10
Slide 35_hemA_iCORM-3_biol rep 2_Cy3 0 Cy5 120
Slide 35_hemA_iCORM-3_biol rep 2_Cy3 0 Cy5 20
Slide 35_hemA_iCORM-3_biol rep 2_Cy3 0 Cy5 40
Slide 35_hemA_iCORM-3_biol rep 2_Cy3 0 Cy5 60
Slide 35_hemA_iCORM-3_biol rep 2_Cy3 10 Cy5 0
Slide 36_hemA_iCORM-3_biol rep 2_Cy3 120 Cy5 0
Slide 36_hemA_iCORM-3_biol rep 2_Cy3 20 Cy5 0
Slide 36_hemA_iCORM-3_biol rep 2_Cy3 40 Cy5 0
Slide 36_hemA_iCORM-3_biol rep 2_Cy3 60 Cy5 0
Slide 36_hemA vs. WT t=0_biol rep 1_Cy3 hemA Cy5 WT
Slide 36_hemA vs. WT t=0_biol rep 2_Cy3 hemA Cy5 WT
Slide 36_WT vs. hemA t=0_biol rep 1_Cy3 WT Cy5 hemA
Slide 36_WT vs. hemA t=0_biol rep 2_Cy3 WT Cy5 hemA
Slide 37_Aerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 10
Slide 37_Aerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 20
Slide 37_Aerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 2.5
Slide 37_Aerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 40
Slide 37_Aerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 5
Slide 37_Aerobic culture_CO gas_biol rep 1_Cy3 2.5 Cy5 0
Slide 37_Aerobic culture_CO gas_biol rep 1_Cy3 5 Cy5 0
Slide 37_Aerobic culture_CO gas_biol rep 1_Cy3 80 Cy5 0
Slide 39_Anaerobic culture_CO gas_biol rep 1_Cy3 10 Cy5 0
Slide 39_Anaerobic culture_CO gas_biol rep 1_Cy3 20 Cy5 0
Slide 39_Anaerobic culture_CO gas_biol rep 1_Cy3 40 Cy5 0
Slide 39_Anaerobic culture_CO gas_biol rep 1_Cy3 80 Cy5 0
Slide 39_Anaerobic culture_CO gas_biol rep 2_Cy3 10 Cy5 0
Slide 39_Anaerobic culture_CO gas_biol rep 2_Cy3 20 Cy5 0
Slide 39_Anaerobic culture_CO gas_biol rep 2_Cy3 40 Cy5 0
Slide 39_Anaerobic culture_CO gas_biol rep 2_Cy3 80 Cy5 0
Slide 46_Aerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 10
Slide 46_Aerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 20
Slide 46_Aerobic culture_CORM-401_biol rep 2_Cy3 2.5 Cy5 0
Slide 46_Aerobic culture_CORM-401_biol rep 2_Cy3 5 Cy5 0
Slide 48_Aerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 2.5
Slide 48_Aerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 40
Slide 48_Aerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 5
Slide 48_Aerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 80
Slide 48_Aerobic culture_CORM-401_biol rep 2_Cy3 10 Cy5 0
Slide 48_Aerobic culture_CORM-401_biol rep 2_Cy3 20 Cy5 0
Slide 48_Aerobic culture_CORM-401_biol rep 2_Cy3 40 Cy5 0
Slide 48_Aerobic culture_CORM-401_biol rep 2_Cy3 80 Cy5 0
Slide 53_Aerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 10
Slide 53_Aerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 20
Slide 53_Aerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 2.5
Slide 53_Aerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 5
Slide 53_Anaerobic culture_CO gas_biol rep 3_Cy3 0 Cy5 2.5
Slide 53_Anaerobic culture_CO gas_biol rep 3_Cy3 0 Cy5 5
Slide 53_Anaerobic culture_CO gas_biol rep 3_Cy3 40 Cy5 0
Slide 53_Anaerobic culture_CO gas_biol rep 3_Cy3 80 Cy5 0
Slide 54_Aerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 40
Slide 54_Aerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 80
Slide 54_Aerobic culture_CORM-401_biol rep 1_Cy3 10 Cy5 0
Slide 54_Aerobic culture_CORM-401_biol rep 1_Cy3 20 Cy5 0
Slide 54_Aerobic culture_CORM-401_biol rep 1_Cy3 2.5 Cy5 0
Slide 54_Aerobic culture_CORM-401_biol rep 1_Cy3 40 Cy5 0
Slide 54_Aerobic culture_CORM-401_biol rep 1_Cy3 5 Cy5 0
Slide 54_Aerobic culture_CORM-401_biol rep 1_Cy3 80 Cy5 0
Slide 55_Anaerobic culture_CO gas_biol rep 3_Cy3 0 Cy5 10
Slide 55_Anaerobic culture_CO gas_biol rep 3_Cy3 0 Cy5 10 2
Slide 55_Anaerobic culture_CO gas_biol rep 3_Cy3 0 Cy5 20
Slide 55_Anaerobic culture_CO gas_biol rep 3_Cy3 0 Cy5 2.5
Slide 55_Anaerobic culture_CO gas_biol rep 3_Cy3 0 Cy5 40
Slide 55_Anaerobic culture_CO gas_biol rep 3_Cy3 0 Cy5 5
Slide 55_Anaerobic culture_CO gas_biol rep 3_Cy3 2.5 Cy5 0
Slide 55_Anaerobic culture_CO gas_biol rep 3_Cy3 5 Cy5 0
Slide 56_Anaerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 10
Slide 56_Anaerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 20
Slide 56_Anaerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 2.5
Slide 56_Anaerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 40
Slide 56_Anaerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 5
Slide 56_Anaerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 80
Slide 56_Anaerobic culture_CO gas_biol rep 1_Cy3 2.5 Cy5 0
Slide 56_Anaerobic culture_CO gas_biol rep 1_Cy3 5 Cy5 0
Slide 58_Anaerobic culture_CORM-401_biol rep 1_Cy3 10 Cy5 0
Slide 58_Anaerobic culture_CORM-401_biol rep 1_Cy3 20 Cy5 0
Slide 58_Anaerobic culture_CORM-401_biol rep 1_Cy3 40 Cy5 0
Slide 58_Anaerobic culture_CORM-401_biol rep 1_Cy3 80 Cy5 0
Slide 58_Anaerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 10
Slide 58_Anaerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 20
Slide 58_Anaerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 2.5
Slide 58_Anaerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 5
Slide 59_Anaerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 40
Slide 59_Anaerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 80
Slide 59_Anaerobic culture_CORM-401_biol rep 2_Cy3 10 Cy5 0
Slide 59_Anaerobic culture_CORM-401_biol rep 2_Cy3 20 Cy5 0
Slide 59_Anaerobic culture_CORM-401_biol rep 2_Cy3 2.5 Cy5 0
Slide 59_Anaerobic culture_CORM-401_biol rep 2_Cy3 40 Cy5 0
Slide 59_Anaerobic culture_CORM-401_biol rep 2_Cy3 5 Cy5 0
Slide 59_Anaerobic culture_CORM-401_biol rep 2_Cy3 80 Cy5 0
Slide 70_Anaerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 10
Slide 70_Anaerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 20
Slide 70_Anaerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 2.5
Slide 70_Anaerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 40
Slide 70_Anaerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 5
Slide 70_Anaerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 80
Slide 70_Anaerobic culture_CORM-401_biol rep 1_Cy3 2.5 Cy5 0
Slide 70_Anaerobic culture_CORM-401_biol rep 1_Cy3 5 Cy5 0
Sodium phosphate (1/100 vol. of 1M, pH 7.6; 10 mM final) was added to the mid-log cultures followed by formaldehyde to 1% final, and aerobic or anaerobic sparging was continued for 10 min. Cold 2.5 M glycine was added to 100mM and the mixture was incubated at 4 °C with aerobic or anaerobic sparging for 30 minutes to stop the crosslinking. Cells were spun at 3500 x g, and washed repeatedly with phosphate buffered saline before being frozen at -80 °C.
Sodium phosphate (1/100 vol. of 1M, pH 7.6; 10 mM final) was added to the mid-log cultures followed by formaldehyde to 1% final and anaerobic sparging was continued for 10 min. Cold 2.5 M glycine was added to 100mM and the mixture was incubated at 4 °C with anaerobic sparging for 30 minutes to stop the crosslinking. Cells were spun at 3500 x g, and washed repeatedly with phosphate buffered saline before being frozen at -80 °C. Cell pellets (from initial 250 mL of culture) were thawed and resuspended in 250 μL of IP buffer (100 mM Tris pH 8, 300 mM NaCl, 1% TritonX-100) and sonicated using a microtip sonicator set at 10% output for 20 second intervals with periods of cooling in between. Cells were then treated for one hour at 4 °C with RNase A (2 ng/ml), micrococcal nuclease (50 units), 20 μM CaCl2,1.2 mM KCl, 0.3 mM NaCl, 6 mM sucrose, and 10 μM DTT. EDTA was added to 10 mM to stop the micrococcal nuclease and the samples were spun down to remove cell debris. The lysate was then precleared through incubation with a 50/50 slurry of sepharose protein A beads in IP buffer for 2-3 hours at 4 °C. The beads were removed by centrifugation and antibody was added to the pre-cleared lysate for an overnight incubation. The next day, 30 μl of a 50/50 slurry of sepharose protein A beads in IP buffer was added to the lysate to capture antibody-protein-DNA complex for one hour at 4 °C. Beads were then washed once with 1 ml of LiCl wash buffer (100 mM Tris pH 8, 250 mM LiCl, 2% TritonX-100), twice with 600 mM NaCl wash buffer (100 mM Tris pH 8, 600 mM NaCl, 2% TritonX-100), twice with 300 mM NaCl wash buffer (100 mM Tris pH 8, 300 mM NaCl, 2% TritonX-100), and twice with TE. Elution buffer (50 mM Tris pH 8, 10 mM EDTA, 1% SDS) was added after the final wash step, and beads were incubated at 65 °C for 30 minutes to remove the crosslinked protein-DNA complexes from the beads. After centrifugation to remove the beads, the samples were incubated overnight at 65 °C to reverse the protein-DNA formaldehyde crosslinks. DNA was purified using Qiagen’s PCR Purification kit and eluted to a final volume of 50 μl with EB.
Soil DNA was extracted from a 0.5g soil sub-sample using the MoBio DNA Power Soil kit (MoBio Laboratories, Carlsbad, CA).
Solvent control, biological rep1
Solvent control, biological rep2
Solvent control, biological rep3
sorted E. coli cells from culture 1
sorted E. coli cells from culture 2
sorted E. coli cells from dual-species biofilms 1
sorted E. coli cells from dual-species biofilms 2
sorted E. coli cells from dual-species planktonic culture 1
sorted E. coli cells from dual-species planktonic culture 2
sorted E. coli cells from mono-species biofilms 1
sorted E. coli cells from mono-species biofilms 2
sorted E. coli cells from mono-species pure planktonic culture 1
sorted E. coli cells from mono-species pure planktonic culture 2
sorted vs. non-sorted cells bioreplicate 1 technical replicate 1
sorted vs. non-sorted cells bioreplicate 1 technical replicate 2
sorted vs. non-sorted cells bioreplicate 2 technical replicate 1
sorted vs. non-sorted cells bioreplicate 2 technical replicate 2
source: Bustamante et al., 2011
source: Peripheral blood
soxR-8myc-tagged_PQ treated
SoxR PQ 1
SoxR PQ 2
soxS-8myc-tagged_PQ treated
SoxS PQ 1
SoxS PQ 2
sp1
sp2
Specifically, data were treated as two experiments constituting either two (\
specific growth rate 0.11 1/h
specific growth rate 0.21 1/h
specific growth rate 0.26 1/h
specific growth rate 0.31 1/h
specific growth rate 0.36 1/h
specific growth rate: 0.3 h-1
Specific growth rate 0.3 h-1
specific growth rate 0.40 1/h
specific growth rate: 0.47 h-1
Specific growth rate 0.47 h-1
specific growth rate 0.48 1/h
specific growth rate: 0.5h-1
SPET-seq (Ribo- RNA)
SPET-seq (Ribo- RNA), Replicate #1
SPET-seq (Ribo- RNA), Replicate #2
SPET-seq (Total RNA)
Sphingomonas sp. NM05
S. pneumoniae reads were mapped to the D39 whole genome with Rockhopper version 1.21, using default parameters. E. coli reads were mapped to the K-12, substr. MG1655 whole genome with Bowtie 2, using parameters --mixed --discordant -D 10 -R 2 -N 0 -L 22 -i S,0,2.50.
Spot intensities and corresponding background signals were quantified with Genepix Pro (version 6; Axon Instruments [http://www.moleculardevices.com/pages/software/gn_genepix_pro.html]). Spots which had signal-to-noise ratio less than three were filtered. Further analysis was carried out in R environment (version 2.6.1; [http://www.r-project.org/]) using KTH package (KTH Microarray Center; [http://www.biotech.kth.se/molbio/microarray/dataanalysis/index.html]). Flagged spots and background were extracted before “printTipLoess” normalization.
Spot intensities and locations were determined using TIGR Spotfinder, Version 3.1.1.  All subsequent analyses were performed using the ma-anova package in the open-source statistical software package, R (www.r-project.org), Version 2.4.1.  The data were normalized using the regional lowess method.
Spot intensities and locations were determined using TIGR Spotfinder, Version 3.1.1. All subsequent analyses were performed using the ma-anova package in the open-source statistical software package, R (www.r-project.org), Version 2.4.1. The data were normalized using the regional lowess method.
Spot intensities were extracted using the Feature Extraction software 10.5.1.1 from Applied Biosystems with a linear dye normalization correction method. The gProcessedSignal and rProcessedSignal was used for further analysis with the statistics software R. Ratios of g (sample) to r (control) were calculated after background substraction and normalized to the array wide average. Data points with a value below 0 after background subtraction were set 'null'. Data points form non-unique regions on the chromosome were excluded from analysis.
Spot intensities were extracted using the Feature Extraction software 10.5.1.1 from Applied Biosystems with a linear dye normalization correction method. The gProcessedSignal and rProcessedSignal was used for further analysis with the statistics software R. Ratios of g (sample) to r (control) were calculated after background substraction. Data points with a value below 0 after background subtraction were set 'null'. Data points form non-unique regions on the chromosome were excluded from analysis.
Spots automatically flagged as bad, negative or poor in the Imagene software were removed before the statistical analysis was carried out in GeneSight.  The mean values from each channel were log2 transformed and normalised using the Lowess method to remove intensity-dependent effects in the log2(ratios) values.  The Cy3/Cy5 fluorescent ratios were calculated from the normalized values.
Spots automatically flagged as bad, negative or poor in the Imagene software were removed before the statistical analysis was carried out in GeneSight.  The mean values from each channel were log2 transformed and normalised using the Lowess method to remove intensity-dependent effects in the log2(ratios) values.  The Cy3/Cy5 or Cy5/Cy3 (test/reference) fluorescent ratios were calculated from the normalized values.
Spots with reference signal intensities lower than the local background (LBG)  plus 5 standard deviations or with some spotting abnormalities were removed from analysis. Signal intensities of other spots were corrected by subtracting the LBG.
srain: K12 MG1655
srain: K12 MG1656
srain: K12 MG1657
srain: K12 MG1658
srain: K12 MG1659
srain: K12 MG1660
srain: K12 MG1661
srain: K12 MG1662
srain: K12 MG1663
srain: K12 MG1664
srain: K12 MG1665
srain: K12 MG1666
srain: K12 MG1667
srain: K12 MG1668
srain: K12 MG1669
srain: K12 MG1670
srain: K12 MG1671
srain: K12 MG1672
srain: K12 MG1673
srain: K12 MG1674
ß - Aerobic - A
ß - Aerobic - B
ß - Anaerobic - A
ß - Anaerobic - B
ß ChIP DNA from WT Escherichia coli MG1655 K-12
ssRNA-seq
ssrS_1_input
ssrS_1_IP
ssrS_EE_1
ssrS_EE_2
ssrS_LS_1
ssrS_LS_2
ssrS_ME_1
ssrS_ME_2
ssrS_S_1
ssrS_S_2
ssrS_TS_1
ssrS_TS_2
Stage: logarithm phase
Standard Affymetrix procedure
Standard hot-phenol method
Standard illumina library construction protocol for ChIP
standard in vitro (Mg2+)
standard in vitro MgCl2
Standard library construction for Illumina Hiseq2500 sequencing platform
Standard Paired-End Illumina Library Construction Protocol was used with modified adapters containing optimized 20 bp barcode sequences (see original paper).  Samples with barcoded adapters were sequenced on an Illumina HiSeq 2000 with a 2x101 (for the first sequencing run) and 2x51 (for the second) base paired-end reads in one lane.
Starter was cultivated at 32°C with shaking (180 rpm), then was inoculated into 100 ml of 2YT without antibiotics and cultivation was proceeded under the same conditions until culture reaching mid-logphase (OD600=0.6-0.8).
Starting from single colonies, the following cultures were set up in triplicate for overnight incubation: GJ13507, GJ13531, and GJ13533 in glucose-minimal A; and GJ13519 also in 0.2% glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG, with the exception of the cultures of GJ13507 whose supplementation with IPTG was at 3 μM. The overnight-grown cultures were each subcultured into 20 ml of fresh medium of the same composition, with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder, and grown to an A600 of 0.4 to 0.45, before the cells were harvested for making the RNA preparations
stationary culture
stationary phase
Stationary phase culture of EDL933 rpoS mutants in LB at OD600 of 1.5
Stationary phase culture of EDL933 wild type in LB at OD600 of 1.5
Stationary phase growth (24hr) ~8 log CFU/ml was centrifuged at 8000xg 4C and resuspended in Luria-Bertaini broth with 0.5% sodium benozate for 15 minutes
Stationary phase growth (24hr) ~8 log CFU/ml was centrifuged at 8000xg 4C and resuspended in Luria-Bertaini broth with 0.5% sodium benozate for 30 minutes
Stationary phase growth (24hr) ~8 log CFU/ml was centrifuged at 8000xg 4C and resuspended in Luria-Bertaini broth with 0.5% sodium benozate for 5 minutes
Stationary phase growth (24hr) ~8 log CFU/ml was centrifuged at 8000xg 4C and resuspended in Luria-Bertaini broth with 0.5% sodium benozate for 60 minutes
Stationary phase growth (24hr) ~8 log CFU/ml was centrifuged at 8000xg 4C and resuspended in Luria-Bertaini broth with 0.5% (w/v) sodium benozate
Stationary phase growth (24hr) ~8 log CFU/ml was centrifuged at 8000xg 4C and resuspended in Luria-Bertaini broth with 0% sodium benozate for 15 minutes
Stationary phase growth (24hr) ~8 log CFU/ml was centrifuged at 8000xg 4C and resuspended in Luria-Bertaini broth with 0% sodium benozate for 30 minutes
Stationary phase growth (24hr) ~8 log CFU/ml was centrifuged at 8000xg 4C and resuspended in Luria-Bertaini broth with 0% sodium benozate for 5 minutes
Stationary phase growth (24hr) ~8 log CFU/ml was centrifuged at 8000xg 4C and resuspended in Luria-Bertaini broth with 0% sodium benozate for 60 minutes
Stationary phase growth (24hr) ~8 log CFU/ml was centrifuged at 8000xg 4C and resuspended in Luria-Bertaini broth with no sodium benozate
Stationary phase  t=0
Statistical analysis was performed using R Limma package (Linear Models for Microarrays Data)  (Smyth 2004), where the two microarrays per sample were normalized using lowess normalization method. Multiple-gene probes results were merged and normalized using the MA table conversion tool available on the MOLGEN Bioinformatics Server (http://server.molgenrug.nl/ - Molecular genetics, university of Groningen, the Netherlands).
Statistical comparisons were performed using multiple testing procedures to evaluate statistical significance for differentially expressed genes. A modified t-test (p-value) was computed to measure the significance associated with each differential expression value. A gene expression value was decided to be significantly different in the mutant and over-expression strains when the p-value was less than 0.05 (except otherwise mentioned) and the expression ratio was ≥ 2.0or ≤ 0.5. Gene functions were assigned using data from EcoCyc (http://ecocyc.org/).
Statistical preprocessing steps were conducted with ArrayPipe (version 1.7), a web-based software designed for processing of microarray data (www.pathogenomics.ca/arraypipe, Hokamp et al. 2004). The following pre-processing steps were applied: 1) flagging of markers and control spots, 2) subgrid-wise background correction, using the median of the lower 10% foreground intensity as an estimate for the background noise, 3) data-shifting, 4) limma’s LOESS normalization by print tip, 5) merging of duplicate spots.
Stat-rpoS-rep1
Stat-rpoS-Rep1
Stat-rpoS-rep2
Stat-rpoS-Rep2
Stat-rpoS-rep3
Stat-rpoS-Rep3
Stat-WT-rep1
Stat-WT-Rep1
Stat-WT-rep2
Stat-WT-Rep2
Stat-WT-rep3
Stat-WT-Rep3
Steady-state continuously-cultured control samples in the presence of adequate Zn
Steady-state continuously-cultured experiment samples in the total absence of Zn
Steady-state continuously-cultured experiment samples in total absence of Zn
Steady-state continuously-cultured MG1655 in the presence of adequate Zn
Steady-state continuously-cultured MG1655 in the total absence of Zn
STEC EC472/01, conditioned medium
STEC EC472/01, fresh medium
STEC EC472 after 3 hrs incubation in conditioned medium, replicate 1 [COND]
STEC EC472 after 3 hrs incubation in conditioned medium, replicate 2 [COND]
STEC EC472 after 3 hrs incubation in conditioned medium, replicate 3 [COND]
STEC EC472 after 3 hrs incubation in conditioned medium, replicate 4 [COND]
STEC EC472 after 3 hrs incubation in fresh medium, replicate 1 [FRESH]
STEC EC472 after 3 hrs incubation in fresh medium, replicate 2 [FRESH]
STEC EC472 after 3 hrs incubation in fresh medium, replicate 3 [FRESH]
STEC EC472 after 3 hrs incubation in fresh medium, replicate 4 [FRESH]
STEC EH41 after 3 hrs incubation in conditioned medium, replicate 1 [COND]
STEC EH41 after 3 hrs incubation in conditioned medium, replicate 2 [COND]
STEC EH41 after 3 hrs incubation in conditioned medium, replicate 3 [COND]
STEC EH41 after 3 hrs incubation in conditioned medium, replicate 4 [COND]
STEC EH41 after 3 hrs incubation in fresh medium, replicate 1 [FRESH]
STEC EH41 after 3 hrs incubation in fresh medium, replicate 2 [FRESH]
STEC EH41 after 3 hrs incubation in fresh medium, replicate 3 [FRESH]
STEC EH41 after 3 hrs incubation in fresh medium, replicate 4 [FRESH]
STEC EH41, conditioned medium
STEC EH41, fresh medium
STEC strains were lysate using lysozyme (1 mg/mL) and proteinase K (2 mg/mL) and incubated for 10 min at 20°C. Total RNA was obtained using the RNeasy Mini Kit (Qiagen cat no. 74104, Valencia, CA) according to the manufacturer's instructions. The purity and quantification for all RNA samples were done using the NanoVue spectrophotometer and the RNA quality was assessed on the Agilent BioAnalyzer 2100 (Agilent, Santa Clara, CA). All samples that present RIN > 7.0 were stored at -80°C until used in hybridization experiments.
stimulus: 1 MPa for 15 min
stimulus: Control
S, TP1
S, TP2
S, TP3
S, TP4
strain: 173150
strain: 174750
strain: 174900
strain: 178200
strain: 178850
strain: 178900
strain: 179100
strain: 179550
strain: 180050
strain: 180200
strain: 180600
strain: 2-1
strain: 214-4
strain: 2230
strain: 229-1
strain: 2429
strain: 278485-1
strain: 292-1
strain: 350C1A
strain: 3780
strain: 42-1 C1
strain 520
strain 521
strain: 86-24
strain: AH28
Strain A of experimental evolution under ethanol stress in 1224 hours.
Strain A of experimental evolution under ethanol stress in 1824 hours.
Strain A of experimental evolution under ethanol stress in 2496 hours.
Strain A of experimental evolution under ethanol stress in 384 hours.
Strain A of experimental evolution under ethanol stress in 744 hours.
strain: APEC SCI-07 (O nontypeable:H31) isolated from lesions (gelatinous edema) on the skin of the head and periorbital tissues from a laying hen showing clinical signs of swollen head syndrome
strain: ArcA8myc
strain: ARG-2
strain: ARG-3
strain: ATCC 4157
strain: AW1.7
strain: B
strain B02
strain B05
strain: B2C
strain: B7A
strain background: B
strain background: BW25113
strain/background: BW25113
strain background: EDL933
strain background: K-12
strain background: MG1655
strain/background: MG1655
strain: BCE001, MS16
strain: BCE002, MS12
strain: BCE003, DS5
strain: BCE005, MS23
strain: BCE007
strain: BCE007, MS11
strain: BCE008_MS1
strain: BCE008, MS13
strain: BCE011, DS3
strain: BCE013, DS1
strain: BCE018, DS6
strain: BCE019, MS16
strain: BCE021, DS7
strain: BCE022DS6
strain: BCE035, DS6
strain: BCE035, MS8
strain: BCE039, DS2
strain: BCE039, MS13
strain: BCE041, MS11
strain: BCE046, DS2
strain: BCE046, DS7
strain: BCE046, MS16
strain: BCE049, DS3
strain: BCE049, MS9
strain: BCE054, DS4
strain: BCE054, MS24
strain: BCE055, DS1
strain: BCE058, MS13
strain: BCE061, DS1
strain: BCE062, DS2
strain: BCE062, MS24
strain: BCE063, DS4
strain: BCE063, MS14
strain: BCE066, DS5
strain: BCE068, MS10
strain: BCE068, MS23
strain: BCE069, DS2
strain: BCE069, MS15
strain: BCE069, MS9
strain: BCE129, DS2
strain: Bear feces isolate B1
strain: Bear feces isolate B3
strain: Bear feces isolate B5
strain: beta-lactamase (ESBL)-producing UPEC (ESBL019)
strain: BJW9 w/ recoded ompF
strain: BL21(DE3)
strain: BL21 (DE3) rne131 DrhlB
strain B of experimental evolution under ethanol stress in 1224 hours.
strain B of experimental evolution under ethanol stress in 1824 hours.
strain B of experimental evolution under ethanol stress in 2496 hours.
strain B of experimental evolution under ethanol stress in 384 hours.
strain B of experimental evolution under ethanol stress in 744 hours.
strain BW25113
strain: BW25113
Strain BW25113
Strain BW25113 
Strain:BW25113
Strain: BW25113
Strain: BW25113/arcA-
Strain:BW25113/arcA-
Strain: BW25113/fur-
Strain:BW25113/fur-
strain: BW25113 hha hns / pCA24N-hns
strain: BW25113 hha hns / pCA24N-hnsK57N
Strain: BW25113/ihfA-
Strain:BW25113/ihfA-
Strain: BW25113/phoB-
Strain:BW25113/phoB-
strain BW25113 ppsA deletion
strain: BW25113/ubiE-
strain: BW27786 (K-12 derivative)
strain: BW38028
strain C01
strain C02
strain: C-34666
strain: C-35134
strain: C-35209
strain: C-35213
strain: C-35605
strain: C-35662
strain: C-35776
strain: C-35959
strain: C-36255
strain: CAR005
strain: Cattle feces isolate C1A
strain: Cattle feces isolate C4A
strain: Cattle feces isolate C6D
strain: CFT073
strain CFT073; GenBank accession AE014075.1
strain: CFT073 nsrR::3X-Flag tag
strain: clinical isolate LB226692
strain: CMA540(MG1693 delta_hfq::cat)
strain: CMCC(B) 44102
strain: cocar 07-043
strain: cocar 07-40
strain C of experimental evolution under ethanol stress in 1224 hours.
strain C of experimental evolution under ethanol stress in 1824 hours.
strain C of experimental evolution under ethanol stress in 2496 hours.
strain C of experimental evolution under ethanol stress in 384 hours.
strain C of experimental evolution under ethanol stress in 744 hours.
strain: cosin 07-14
strain: cosin 07-36
strain: cosin 07-61
strain: cosin 07-88
strain: cosin 07-92
strain: Crooks
strain: Crp_delAr1
strain: Crp_delAr1delAr2
strain: Crp_delAr2
strain: CSH50
strain: CVCC2943
strain: D02-2
strain: Deer feces isolate D1
strain: Deer feces isolate D3
strain: Deer feces isolate W6A
strain: delta Crp
strain description: E. coli BW25113 with an integrated F tra operon at the trp locus, plus additional F oriT sequences integrated at mbhA and hyfC
strain description: E. coli BW25113 with F oriTs integrated at mbhA and hyfC
strain details: lacIq lacZχ- cynX::GmR lacZY::χχχ  mhpA::χχχ rph+
strain details: lacIq lacZχ- lacZ::246pal cynX::GmR lacZY::χ  mhpA::χχχ codBχ- prpEχ- mhpCχ- cynXχ- rph+
strain details: lacIq lacZχ- lacZ::246pal cynX::GmR lacZY::χχ  mhpA::χχχ codBχ- prpEχ- mhpCχ- cynXχ- rph+
strain details: lacIq lacZχ- lacZ::246pal cynX::GmR lacZY::χχχ  mhpA::χχχ codBχ- prpEχ- mhpCχ- cynXχ- rph+
strain details: lacIq lacZχ- lacZ::246pal cynX::GmR lacZY::χχχ  mhpA::χχχ rph+
strain details: lacIq lacZχ- lacZ::246pal cynX::GmR lacZY::χχχχ mhpA::χχχ codBχ- prpEχ- mhpCχ- cynXχ- rph+
strain details: lacIq lacZχ- lacZ::246pal cynX::GmR lacZY::χχχχχ  mhpA::χχχ codBχ- prpEχ- mhpCχ- cynXχ- rph+
strain details: lacIq lacZχ- lacZ::246pal cynX::GmR lacZY::χχχχχχ  mhpA::χχχ codBχ- prpEχ- mhpCχ- cynXχ- rph+
strain: DH10BGFP
strain: DH1 ΔhisA::cat ΔintC::Ptrc-dsred.t4-tetR-PEM7-zeo ΔgalK::PtetA-gfpuv5
strain: DH1 ΔhisB::cat ΔintC::Ptrc-dsred.t4-tetR-PEM7-zeo ΔgalK::PtetA-gfpuv5
strain: DH1 ΔhisC::cat ΔintC::Ptrc-dsred.t4-tetR-PEM7-zeo ΔgalK::PtetA-gfpuv5
strain: DH1 ΔhisD::cat ΔintC::Ptrc-dsred.t4-tetR-PEM7-zeo ΔgalK::PtetA-gfpuv5
strain: DH1 ΔhisF::cat ΔintC::Ptrc-dsred.t4-tetR-PEM7-zeo ΔgalK::PtetA-gfpuv5
strain: DH1 ΔhisG::cat ΔintC::Ptrc-dsred.t4-tetR-PEM7-zeo ΔgalK::PtetA-gfpuv5
strain: DH1 ΔhisI::cat ΔintC::Ptrc-dsred.t4-tetR-PEM7-zeo ΔgalK::PtetA-gfpuv5
strain: DH1 ΔintC::Ptrc-dsred.t4-tetR-PEM7-zeo ΔgalK::PtetA-gfpuv5
strain: DH1ΔleuB::gfpuv5-kmr
strain: DH5a
strain: DH5α
strain: DH5α(pAR060302)
strain: DL4184
strain: DL4201
strain: DL5966
strain: DL6204
strain: DMS2545 (K-12 derivative)
strain: DMS2564 (K-12 derivative)
strain D of experimental evolution under ethanol stress in 1224 hours.
strain D of experimental evolution under ethanol stress in 1824 hours.
strain D of experimental evolution under ethanol stress in 2496 hours.
strain D of experimental evolution under ethanol stress in 384 hours.
strain D of experimental evolution under ethanol stress in 744 hours.
strain: DS168-1
strain: DS26-1
strain: DY330
strain: DY330 (W3110)
strain: E058
strain: E1392/75
strain: E1777
strain: E1785
strain: E1786
strain: E1787
strain: E1788
strain: E1789
strain: E1790
strain: E1791
strain: E1792
strain: E20738A
strain: E24377A
strain: E2528C1
strain: E7473/0
strain: E7476A
strain: E8775
strain: E9034A
strain: EC472/01 (isolated from cattle)
strain: E. coli ATCC 25922
strain: E. coli DH1
strain: E. coli imp 4231(G93V)
strain: E. coli imp 4231(G93V), substitution of the 93th codon of fabI
strain: E. coli imp 4231(G93V), substitution of the 94th codon of fabI
strain: E. coli K12 MG1655
Strain:E.coli K-12 MG1655
Strain:E.coli K-12 MG1655, Genetic background: fnr-, Growth conditions: aerobic
Strain:E.coli K-12 MG1655, Genetic background: fnr-, Growth conditions: anaerobic
Strain:E.coli K-12 MG1655, Genetic background: fnr-, Growth conditions: anaerobic plus NO2
Strain:E.coli K-12 MG1655, Genetic background: fnr-, Growth conditions: anaerobic plus NO3
Strain:E.coli K-12 MG1655, Genetic background: narXL, Growth conditions: anaerobic plus NO2
Strain:E.coli K-12 MG1655, Genetic background: narXLP, Growth conditions: anaerobic plus NO2
Strain:E.coli K-12 MG1655, Genetic background: wt, Growth conditions: aerobic
Strain:E.coli K-12 MG1655, Genetic background: wt, Growth conditions: anaerobic
Strain:E.coli K-12 MG1655, Genetic background: wt, Growth conditions: anaerobic plus NO2
Strain:E.coli K-12 MG1655, Genetic background: wt, Growth conditions: anaerobic plus NO3
strain: E.coli O157:H7 EDL 932
strain: e. coli o157 H7 strain TW10915
strain: e. coli o157 H7 strain TW10916
strain: e. coli o157 H7 strain TW10917
strain: e. coli o157 H7 strain TW10938
strain: e. coli o157 H7 strain TW10948
strain: e. coli o157 H7 strain TW10950
strain: e. coli o157 H7 strain TW10957
strain: e. coli o157 H7 strain TW10967
strain: E. coli RP437
strain: ECOM4
strain: EDL933
strain: EDL 933
strain: EH41 (isolated from patient with HUS)
strain: EHEC strain
Strain EM1453 wild-type pBAD-ryhB#1 + arabinose
strain E of experimental evolution under ethanol stress in 1224 hours.
strain E of experimental evolution under ethanol stress in 1824 hours.
strain E of experimental evolution under ethanol stress in 2496 hours.
strain E of experimental evolution under ethanol stress in 384 hours.
strain E of experimental evolution under ethanol stress in 744 hours.
strain: EP61
strain: EPEC
strain: Escherichia coli
strain: Escherichia coli 8624
strain: Escherichia coli K12 MG1655
strain: Escherichia coli strain 8624
strain: Escherichia coli strain 8624 kdpE mutant
strain: Escherichia coli strain 8624 qseB mutant
strain: Escherichia coli strain 8624 qseC
strain: Escherichia coli strain 8624 qseC mutant
Strain: Escherichia coli W3110 [F– IN(rrnD-rrnE)1]
strain: ETEC 10/1
strain: ETEC 18/2
strain: ETEC 20/10
strain: ETEC 8/11
strain: ETEC Jurua
strain: ETP05-002
strain: ETP05-003
strain: ETP05-007
strain: ETP05-008
strain: ETP05-009
strain: ETP05-010
strain: ETP05-011
strain: ETP05-012
strain: ETP05-015
strain: ETP05-016
strain: ETP05-017
strain: ETP05-019
strain: ETP05-020
strain: ETP05-026
strain: ETP05-035
strain: ETP05-038
strain: ETP05-039
strain: ETP05-044
strain: ETP05-046
strain: ETP05-047
strain: ETP05-050
strain: ETP98004
strain: ETP98015
strain: ETP98028
strain: ETP98038
strain: ETP98042
strain: ETP98053
strain: ETP98056
strain: ETP98061
strain: ETP98062
strain: ETP98066
strain: ETP98068
strain: ETP98073
strain: ETP98097
strain: ETP98103
strain: ETP98105
strain: ETP98109
strain: ETP98111
strain: ETP98112
strain: ETP98114
strain: ETP98115
strain F01
strain F02
strain: F5656-C1
strain: F595C
strain: FHI12
strain: FHI24
strain: FHI25
strain: FHI27
strain: FHI36
strain: FHI4
strain: FHI43
strain: FHI48
strain: FHI6
strain: FHI63
strain: FHI66
strain: FHI7
strain: FHI79
strain: FHI8
strain: FHI83
strain: FHI9
strain: FHI95
strain: Fnr8myc
strain F of experimental evolution under ethanol stress in 1224 hours.
strain F of experimental evolution under ethanol stress in 1824 hours.
strain F of experimental evolution under ethanol stress in 2496 hours.
strain F of experimental evolution under ethanol stress in 384 hours.
strain F of experimental evolution under ethanol stress in 744 hours.
strain: FRIK2000
strain: FRIK966
strain: G4H14
strain: GGG10
strain: GLBRCE1
strain: GLBRCE1_pBBR
strain: GM11
strain H01
strain H02
strain H03
strain H04
strain H05
strain H12
strain H23
strain H27
strain: HB101
strain: hemA strain MG1655
strain: ∆hns/∆stpA
strain: HS
strain: HT873
strain: HT874
strain: HT875
strain: Human sewage isolate H1
strain: Human sewage isolate H2
strain: Human sewage isolate H3
strain: IAI1
strain: ICDDR,B_p1
strain: ICDDR,B_p10
strain: ICDDR,B_p11
strain: ICDDR,B_p12
strain: ICDDR,B_p13
strain: ICDDR,B_p2
strain: ICDDR,B_p4
strain: ICDDR,B_p5
strain: ICDDR,B_p6
strain: ICDDR,B_p7
strain: ICDDR,B_p8
strain: ICDDR,B_p9
strain information: E. coli harboring empty vector (pRADgro), used as a control strain
strain information: E. coli harboring pRADgro::dr1558
strain: IspG1
strain: JM109
strain: JM83
strain: JPEP22
strain: JW3367
strain: K12
strain: K-12
Strain: K-12
strain: K-12 MG1655
strain: K12 MG1655
strain: K12 (MG1655)
strain: K12 MG1655 deltaprfC
strain: K12 MG1655 prfB-Bstrain allele
strain: K12 MG1655 prfB-Bstrain allele deltaprfC
strain: k-12 MG1655 wild-type
strain: K12-MG1693
strain: K-12 PHL644/pMP4655
Strain: K-12 reduced genome
strain: K-12 substrain MG1655
strain: K-12 substr. DH10B
strain: K-12 substr. MG1655
strain: K-12 W3110
strain: K12 W3110
strain: KCTC 2571
strain: KMD
strain: L-form
strain: LSN02-012560/A
strain: LSN03-016011/A
strain: M408C1
strain: M424C1
strain: MC1000
strain: MC1061
strain: MC4100
strain: MC4100 derivative
strain: MC4100 derivative, dcd::kan
strain: MC4100 derivative, ndk::cam
strain: MC4100 derivative, recA730
strain: MC4100 derivative, recA730, dcd::kan
strain: MC4100 derivative, recA730, ndk::cam
strain: MC4101
strain: MC4102
strain: MC4103
strain: MC4104
strain: MC4105
strain: MC4106
strain: MC4107
strain: MDS42
strain: MDS42 (genome reduced)
strain: MDS42 (RL1961)
strain: MG1655
strain: MG 1655
Strain MG1655
Strain MG1655 cells were grown in MOPS minimal medium supplemented with 0.2% glucose (www.genome.wisc.edu/resources/protocols/mopsminimal.htm).
strain: MG1655 delta lac
strain: MG1655 delta lac delta dksA
strain: MG1655 delta lac + MG1655 delta lac delta dksA
strain: MG1655 delta_mazF
strain: MG1655dnaC2
strain: MG1655GFP
strain: MG1655 K-12 WT
Strain MG1655 or isogenic strain MG1655 HA3::nusG cells were grown in MOPS minimal medium supplemented with 0.2% glucose (www.genome.wisc.edu/resources/protocols/mopsminimal.htm).
strain: MG1655 (parent)
strain: MG1655 [p-CTRL]
strain: MG1655 [p-CUA]
strain: MG1655 [p-CUG]
Strain: MG1655 pGIT1 (carries the ytfE promoter in multicopy, titrates out NsrR to phenocopy an NsrR- mutation)
Strain: MG1655 pGIT1 (carries the ytfE promoter in multicopy, titrates out NsrR to phenocopy an NsrR- mutation) Growth: Anaerobic to early exponential growth Media:Minimal salts + 20 mM trimethylamine-N-oxide
Strain: MG1655 pGIT1 (carries the ytfE promoter in multicopy, titrates out NsrR to phenocopy an NsrR- mutation) Growth: Anaerobic to early exponential growth Media:Minimal salts + 20 mM trimethylamine-N-oxide 
Strain: MG1655 pGIT1 (carries the ytfE promoter in multicopy, titrates out NsrR to phenocopy an NsrR- mutation) Growth: Anaerobic to early exponential growth Media:Minimal salts + 20 mM trimethylamine-N-oxide +2.5 mM sodium nitrite
Strain: MG1655 pGIT8 (carries 1 base pair deletion in the NsrR-binding site of the ytfE promoter)
Strain: MG1655 pGIT8 (carries 1 base pair deletion in the NsrR-binding site of the ytfE promoter) Growth: Anaerobic to early exponential growth Media:Minimal salts + 20 mM trimethylamine-N-oxide + 2.5 mM sodium nitrite
Strain: MG1655 pGIT8 (carries 1 base pair deletion in the NsrR-binding site of the ytfE promoter) Growth: Anaerobic to early exponential growth Media:Minimal salts + 20 mM trimethylamine-N-oxide +2.5 mM sodium nitrite
Strain: MG1655 pGIT8 (carries 1 base pair deletion in the NsrR-binding site of the ytfE promoter) Growth: Anaerobic to early exponential growth Media:Minimal salts + 20 mM trimethylamine-N-oxide + .5 mM sodium nitrite
Strain: MG1655 pGIT8 (carries 1 base pair deletion in the NsrR-binding site of the ytfE promoter) Growth: Anaerobic to early exponential growth Media:Minimal salts + 20 mM trimethylamine-N-oxide Pool of eight independent cultures
strain: MG1655 (RL1655)
strain: MG1655 thyA-
strain: MG1655 ΔseqA
strain: MG1693
strain: N3431
strain: N3433
strain: NEB 10-beta
strain: NN-34-1-3
strain: no tag
strain: NR-12
strain: NZ-502 (RpoB mutant)
strain: O08 (O38:H10) obtained from the yolk of the abdomen of a diseased 1-day-old chick
strain: O157: h7
strain: O157: H7
Strain: O157:H7
strain: O157:H7 EHEC TUV93-0
strain: O157:H7 NCTC 12900
strain: o157: H7 (Sakai) wild-type
strain: O2
strain: O63:nm
strain: O78: h11
strainorline: K-12 substr. MG1655
Strain P4X, grown on minimal medium, reference sample
strain: PC1012
strain: PE360
strain: PK4854
strain: PK8263
strain: PK9416
strain: PKH5000
strain: Porcine EPEC strain O45
strain: Poultry E. coli Virulent and multidrug resistant
strain: PUTI O26 UMN O26
strain: Rabbit EPEC strain O103
strain: REL4536
strain: REL606
strain: RL2325
strain: RL2673
strain: RSW421 (RL1962)
strain: RSW421 (RL1967)
strain: RSW422 (RL1963)
strain: RSW472 (RL1966)
strain S04
strain S05
strain S13
strain: SE15
strain: SH0003
strain: SH0012
strains: K-12 BW25113
strain: SK4455
strain: sPRH-20
strain: sPRH-21
strain: sPRH-25
strain: sPRH-372
strain: sPRH-403
strain: sPRH-414
strain: sPRH-418
strain: sPRH-420
strain: sPRH-421
strain: sPRH-443
strain: sPRH-445
strain: sPRH-450
strain: sPRH-604
strain: sPRH-605
strain: sPRH-606
strain: sPRH-609
strain: sPRH-610
strain: sPRH-612
strain: sPRH-613
strain: St. Olav104
strain: St. Olav157
strain: St. Olav164 
strain: St. Olav17
strain: St. Olav172
strain: St. Olav173
strain: St. Olav174
strain: St. Olav176
strain: St. Olav178
strain: St. Olav179
strain: St. Olav39
strain: St. Olav40
strain: St. Olav63
strain: strain K12 substrain MG1655
strain: strain O157:H7
strains TW014359 vs TW04863 epithelial exposure
strains TW014359 vs TW11037 epithelial exposure
strains TW02883 vs TW11028 epithelial exposure
strains TW04863 vs TW14279 epithelial exposure
strains TW07591 vs TW09098 epithelial exposure
strains TW07937 vs TW11185 epithelial exposure
strains TW07961 vs TW08610 epithelial exposure
strains TW07961 vs TW11029 epithelial exposure
strains TW08030 vs TW10045 epithelial exposure
strains TW08609 vs TW08030 epithelial exposure
strains TW08609 vs TW08623 epithelial exposure
strains TW08609 vs TW11110 epithelial exposure
strains TW08610 vs TW11110 epithelial exposure
strains TW08623 vs TW02883 epithelial exposure
strains TW08623 vs TW08030 epithelial exposure
strains TW08635 vs TW09098 epithelial exposure
strains TW09098 vs TW11308 epithelial exposure
strains TW09189 vs TW11032 epithelial exposure
strains TW09189 vs TW14279 epithelial exposure
strains TW10012 vs TW11037 epithelial exposure
strains TW10012 vs TW14313 epithelial exposure
strains TW10045 vs TW07937 epithelial exposure
strains TW11028 vs TW07937 epithelial exposure
strains TW11028 vs TW11308 epithelial exposure
strains TW11029 vs TW02883 epithelial exposure
strains TW11029 vs TW08610 epithelial exposure
strains TW11032 vs TW04863 epithelial exposure
strains TW11032 vs TW09189 epithelial exposure
strains TW11037 vs TW08635 epithelial exposure
strains TW11110 vs TW10012 epithelial exposure
strains TW11185 vs TW014313 epithelial exposure
strains TW11185 vs TW08635 epithelial exposure
strains TW11308 vs TW07591 epithelial exposure
strains TW14279 vs TW10045 epithelial exposure
strains TW14313 vs TW07591 epithelial exposure
strains TW14359 vs TW07961 epithelial exposure
strain: Suc-T110 (parental strain)
Strains were grown in LB at 37°C with shaking at 250 rpm.  16 h overnight cultures were diluted to OD600 = 0.05 in HEPES-glucose (0.4%), grown to OD600 ~ 0.6, and exposed to 4.5% deoxycholate for 30 min.
Strains were grown in LBCm30 at 37°C with shaking at 250 rpm.  16 h overnight cultures were diluted at 1:1000 into fresh LBCm30, grown to OD600 ~ 1.0, and induced with 1 mM IPTG for 90 min.
Strains were grown in LBCm30 at 37°C with shaking at 250 rpm.  Overnight cultures were diluted into fresh LBCm30, grown for 2.5 h, and induced with 1 mM IPTG for 90 min (final OD600 = 1.6).
Strains were grown in LB medium (Difco) supplemented with thymine (50 µg/ml) at 37ºC, unless otherwise stated. Overnight cultures of single fresh grown colonies were diluted to an initial OD600 appr. 0.03. Cultures were collected at exponential phase (OD600 appr. 0.5).
Strains were grown overnight in LB broth and then equalised to 0.15 optical density (OD600nm) units. Cells were collected and washed in EG minimal medium (pH 7.2). This wash step was repeated twice more with centrifugation to collect the cells. The final pellet was resuspended in 1 ml of 1X EG minimal (pH 7.2). Cells were grown to OD600 ~0.5-0.6 in a 40 ml volume in a 250 ml flask at 37°C and 200 rpm.
Strains were harvested in MH broth at log phase
strain: T175
strain: T177
strain: T3 5H5
strain: T3 5H5 M
strain: T75
strain: TB1
strain: TB16
strain: TG-1
strain: TG-2
strain TW02883
strain TW02883 
strain: TW03439
strain: TW03452
strain: TW03574
strain: TW03576
strain: TW03585
strain: TW03741
strain TW04863
strain TW07591
strain TW07937
strain TW07961
strain TW07961 
strain TW08030
strain TW08609
strain TW08609 
strain TW08610
strain TW08623
strain TW08635
strain TW08635 
strain TW09098
strain TW09098 
strain TW09189
strain: TW09308
strain TW10012
strain TW10045
strain TW10045 
strain TW11028
strain TW11029
strain TW11029 
strain TW11032
strain TW11032 
strain TW11037
strain TW11110
strain TW11110 
strain TW11185
strain TW11185 
strain TW11308
strain TW11308 
strain: TW11588
strain TW14279
strain TW14279 
strain TW14313
strain TW14359
strain: TWx30
strain: TWx31
strain: TWx34
strain: TWx48
strain: unevolved parent strain
strain: W3110
Strain W3110
Strain :W3110
Strain : W3110
Strain: W3110
strain: W3110hns∆93-1
strain: wildtype
strain: Wild Type K-12
strain: Wild type strain MG1655
strain: WS 0115A
strain: WS1896A
strain: WS1896 A-1
strain: WS 1933D
strain: WS2068A
strain: WS 2173A
strain: WS2741 A-1
strain: WS3080A
strain: WS 3294A
strain: WS 3572 A-1
strain: WS 3596 A-4
strain: WS4087 A-1
strain: WS4264 A-1
strain: WS5874 A-1
strain: WS6582 A-1
strain: WS 6866B-1
strain: WS 7162 A-1
strain: WS7179 A-2
strain: wt
strain: wt 3xflag strain
strain: Xuzhou21
strain: Xuzhou21m
strain: ZD1
strain: ZD26
strain: ZD51
strain: ZD56
strain: ZD59
strain: ZD60
strain: ZD8
Strand specific base read counts were determined for each of 4091 ORFs for the 15 samples
Strand-specific cDNA libraries were prepared from 50 ng of rRNA-depleted samples following the TruSeq RNA protocol (Illumina, San Diego, CA, USA, without purification) with modification of the 2nd strand cDNA synthesis as previously described (Parkhomchuk et al. 2009). The libraries were prepared using multiplex primers to allow simultaneous sequencing in a single lane. Sequencing was performed on a HiSeq1500 using SBS v3 kits (Illumina) to generate paired-end reads of 2 x 50 nucleotides.
Strand-specific RNA-Seq data were generated, following rRNA depletion with a Ribo-Zero kit, with the aid of the di-tagged cDNA strategy (ScriptSeq) on an Illumina NextSeq platform
Strand specific RNAtag-seq libraries were created by the Broad Technology Labs specialized service facility (SSF) using the standard protocol described in Shishkin et al. Nature Methods 2016.
streptomycin treatment
Streptomycin_treatment_plasmidmappedreads_statistical_output.txt: NC_012692.1
Strep_treatment_genomemappedreads_statistical_output.txt: NC_000913.2
stress: acidic
stress: Adenosine addition
stress: Alanine addition
stress: Arginine addition
stress: Aspartate addition
stress: control
stress: control (before perturbation)
stress: Cysteine addition
stress: Cytidine addition
stress: Glutamate addition
stress: Glutamine addition
stress: Glycine addition
stress: Guanosine addition
stress: heptanoic acid
stress: Histidine addition
stress: Isoleucine addition
stress: Lysine addition
stress: Methionine addition
stress: Minimal medium
stress: n-butanol
stress: osmotic
stress: oxidative
stress: Phenylalanine addition
stress: Proline addition
stress: Serine addition
stress: Threonine addition
stress: Thymidine addition
stress: Tryptophan addition
stress: Uridine addition
stress: Valine addition
Strian :W3110
S. Typhimurium cells were grown in LB (supplemented with 10mM glucose) to mid-exponential phase (OD600 = ~0.6) at 37C and shaking 250rpm
Subsequent data visualizations were performed in R (version 3.1.2) using the cummeRbund package (version 3.0)
substrain: ATCC 25922
sub strain: BW38028
sub strain: BW39452
substrain: DH1
substrain: EC14
substrain: EC19
substrain: EC24
substrain: GJ13507
substrain: GJ13519
substrain: GJ13531
substrain: GJ13533
substrain: MG1655
substr: MG1655
sucrose status: no sucrose
sucrose status: with 15% sucrose
SucT110_12%Glu
SucT110_5%Glu
sulA___U_N0025_r1
sulA___U_N0025_r2
sulA___U_N0025_r3
sulA upregulation, amp 50ug/ml, 0.0125% arabinose, 0.025ug/ml norfloxacin OD ~0.3
Summarize the read count to each annotated gene
Supplementary files contain the following: Raw Signal Values: The term “raw” signal values refer to the linear data after thresholding and summarization Summarization is performed by computing the geometric mean. Raw data filtered on Expression (20.0 - 343943.344)• Normalized Signal Values: ``Normalized'' value is the value generated after log transformation and normalization (Shift to 75 percentile) and baseline transformation.
Supplementary_files_format_and_content: 5m_ribozero_counts_cleavage_ratio.csv.gz is a log-transformed list of sequencing depth-normalized counts for every genomic position at both strands for each ribozero treated sample as well as the average cleavage ratio calculated from all samples. total_RNA_rpm.csv.gz is a list of sequencing depth-normalized counts for every genomic position at both strans for all total RNA samples.
Supplementary_files_format_and_content: All in tab-delimited ASCII format. raw_count.txt (pre-normalized read count), normalized_count.txt,  panGeneMap.txt (geneID map between the strains and pangene ID), Gene_annotations.txt (annotation of genes)
Supplementary_files_format_and_content: A tab deliminited file with counts for each gene.
Supplementary_files_format_and_content: bed format peak file generated from MACS2
Supplementary_files_format_and_content: bedgraph: Data presented in a 4 column BED format, of which the first column is the chromosome, the second column is the start position of the chromosome, the third column is the end position, and the fourth column is the fragments per kilobase mapped (FPKM) for that sample. Chromosome positions are specified as 0-relative. The first chromosome position is 0. The last position in a chromosome of length N would be N - 1. Only positions specified have data. Positions not specified do not have data and will not be graphed. All positions specified in the input data are in numerical order.
Supplementary_files_format_and_content: Bedgraphs files representing the extracted peak data
Supplementary_files_format_and_content: BedGraphs of the reads before and after TAP treatment for each of the samples. Separate files are provided for the forward and reverse strands.
Supplementary_files_format_and_content: Bedgraph wiggle files were created for each sample and replicate for all reads aligned to the genome after computational rRNA and tRNA subtraction
Supplementary_files_format_and_content: BIGWIG file containing coverage tracks from 3' RACE data
Supplementary_files_format_and_content: BigWIG files are provided showing uniquely mapped sequence reads.
Supplementary_files_format_and_content: BigWig files for whole-genome reads coverage (including number of mapped reads) for each sample. Each sample has two files, one for plus strand, and the other for minus strand. Therefore, there are 14 BigWig files for 7 samples.
Supplementary_files_format_and_content: chromosome chromosomeStartPosition chromosomeStopPosition readCoverage(positive values on + strand, negative on - strand)
Supplementary_files_format_and_content: CoK12_LB.xlsx: Average expression values of reads related with MG1655 strain in samples Co-culture_LB1 and LB2
Supplementary_files_format_and_content: Column 1 names the nucleotide in the genome, column 2 gives counts for the forward strand, column 3 for the reverse strand, columns are tab separated
Supplementary_files_format_and_content: Comma-delimited text file includes RPKM values for each Sample.
Supplementary_files_format_and_content: comma-delimited text files include FPKM values for each Sample.
Supplementary_files_format_and_content: comma-delimited text files include RPKM values for each Sample
Supplementary_files_format_and_content: Comma separated value files include log-fold changes and associated p-values for each comparison made
Supplementary_files_format_and_content: contents : reference seq,co-ordinate start position,co-ordinate end position,counts for the position, mapping quality, strand position
Supplementary_files_format_and_content: CoT1E_LB.xlsx: Average expression values of reads related with DOT-T1E strain in samples Co-culture_LB1 and LB2
Supplementary_files_format_and_content: counts
Supplementary_files_format_and_content: CSV file contains counts generated using RSEM software.  Ribosomal RNA transcripts excluded.
Supplementary_files_format_and_content: csv files, FPKM values from pairwise comparisons
Supplementary_files_format_and_content: CSV files of raw read counts and normalized gene expression in FPKM units.
Supplementary_files_format_and_content: CSV files providing the number of reads mapping to each genomic gene
Supplementary_files_format_and_content: DMS-seq data (pooled Total and Ribo- RNA) is provided in the form of RNA Framework's (http://www.rnaframework.com) RNA Count (RC) files. For a detailed description of the RC format, please refer to: http://rnaframework.readthedocs.io/en/latest/rf-count/#rc-rna-count-format
Supplementary_files_format_and_content: Each wig file contains the alignd reads of each ChIP-exo sample.
Supplementary_files_format_and_content: ecoli_heatshock_normalizedcounts.txt: Tab-delimited text file has EdgeR-normalized counts per kilobase million for each E. coli gene (EcoCyc gene names).
Supplementary_files_format_and_content: ecoli_heatshock_rawcounts.txt: Tab-delimited text file has raw read counts per kilobase million for each E. coli gene (EcoCyc gene names).
Supplementary_files_format_and_content: Enrichement (IP/input) wig files were generated using homemade matlab code
Supplementary_files_format_and_content: Excel file include FPKM values of different genes for each sample
Supplementary_files_format_and_content: excel file include RPKM values for each Sample
Supplementary_files_format_and_content: Excel files include FPKM values for each sample.
Supplementary_files_format_and_content: excel file with coverage and FPKM measurements
Supplementary_files_format_and_content: Excel formatted matrix table containing transcript coordinates, normalized abundance estimates across the biological replicates and fold-changes in gene expression between cells expressing Vector and DicF.
Supplementary_files_format_and_content: expression level files are tab-delimited text with columns as follows: index, hits, RPKM, RPM, start_position, end_position, strand, feature_type, reference_replicon (type), locus_tag, gene_name, product
Supplementary_files_format_and_content: expression of genes in time, rows = genes, cols = time points
Supplementary_files_format_and_content: Files ending with _coverage.txt: tab-delimited text file of nucleotide-resolution coverage from RNA-seq data (column 1: genome ID, column 2: nucleotide position, column 3: coverage)
Supplementary_files_format_and_content: format:bed format
Supplementary_files_format_and_content: Gene_lists_GEO.xls; The supplementary file contains gene lists used in data analysis.
Supplementary_files_format_and_content: GFF file containing 3' end annotations
Supplementary_files_format_and_content: gff file is generated by in-house script
Supplementary_files_format_and_content: htcount : expression count for each gene and its name.
Supplementary_files_format_and_content: In the .txt files the first column is the coordinate of the base corresponding to NC_000913.3 and the second column is the number of normalized reads at that position. All 0 values were given a pseudocount of 0.01. Counts are normalized so that the averages of ssrA, ssrS, and rnpB are stable throughout the decay from 0 to 20 minutes
Supplementary_files_format_and_content: K12_LB.xlsx: Average of expression values of samples MG1655_LB1 and LB2
Supplementary_files_format_and_content: MACS v2.0.10.20131216 peaks file
Supplementary_files_format_and_content: Mapped reads were rescaled to a size of 10 bp, and BEDGraph files were generated using the genomeCoverageBed utility of the BEDTools suite.
Supplementary_files_format_and_content: Microsoft Excel File with normalized sequencing coverage of all annotated genes and statistical comparison of expression in antibiotic treated to untreated cells .
Supplementary_files_format_and_content: Microsoft excel spreadsheet files include RPKM values for each gene of sample
Supplementary_files_format_and_content: .narrowPeak files output by macs2, giving peak start and end positions, as well as fold-change, -log10pvalue, -log10qvalue, and relative summit position to peak start
Supplementary_files_format_and_content: .narrowPeak files output by MACS, giving peak start and end positions, as well as fold-change, -log10pvalue, -log10qvalue, and relative summit position to peak start
Supplementary_files_format_and_content: peaks.bed
Supplementary_files_format_and_content: Processed data files are WIG files normalized to reads per million per position.  Those designated \
Supplementary_files_format_and_content: Processed data files are WIG files with non-coding RNAs removed, normalized to reads per million per position.  Those with a \
Supplementary_files_format_and_content: Processed data files contain raw counts for CDS genomic features, locations of genomic features are provided in associated .gtf files
Supplementary_files_format_and_content: Processed data files contain the number of reads mapped to each base pair after the total number of reads were scaled to 20 million reads per experiment
Supplementary_files_format_and_content: Processed data include read pileups obtained in two ChIP-seq experiments by two different approaches (files 1-4), the set of regions bound by Dps in both experiments (file 5) and the set of regions unbound by Dps in both experiments (file 6). All processed data are provided as tab-delimited .txt files.
Supplementary_files_format_and_content: Processed data is presented in a cuff diff analysis format
Supplementary_files_format_and_content: Processed data is presented in gff files containing a pileup of 5' tags. GFF column headers \
Supplementary_files_format_and_content: Processed files are in tab delimited format. Separate files are provided for the forward and reverse strands. The start and end coordinates should be the same. Each line in the data set represents the position of the first nucleotide at the 5' end of a sequence that could be mapped to the E. coli genome.
Supplementary_files_format_and_content: Processed-VectorvsDicF-operon.txt: .txt tab delimited file with operons expressed differently between vector and DicF
Supplementary_files_format_and_content: Processed-VectorvsDicF-transcripts.txt: .txt raw output file from Rockhopper
Supplementary_files_format_and_content: Processed-VectorvsDicF-transcripts.xlsx: Excel file with transcription start and stop, expression values of all genes in the E. coli genome in vector and DicF
Supplementary_files_format_and_content: raw read counts as determined by HTseq-Count, provided in .csv format
Supplementary_files_format_and_content: Read counts aligned to genes and noncoding Rfam features in CSV format
Supplementary_files_format_and_content: Read counts were normalized by the length of the unique CDS per kilobase (RPKM) and the total mapped reads per million (RPM)
Supplementary_files_format_and_content: Reads, RPKM, and RCV mapped to NC_002655 (RCV = Ribosomal Coverage Value = RPKM-footprint over RPKM-transcription)
Supplementary_files_format_and_content: rna-seq: genomic position (middle of the 5kb-bin) to each count. 3C seq: contact maps (2D array of 928 5kb-bins x 928 5kb-bins).
Supplementary_files_format_and_content: RPG (reads per gene) files were created using HTSeq, mapping raw reads (fastq format) against the E. coli K12 genome and using a GFF file derived from the annotation of NC_000913.3 available from NCBI.
Supplementary_files_format_and_content: RPKM
Supplementary_files_format_and_content: RPKM is generated by in-house script
Supplementary_files_format_and_content: sam containing aligned sequences
Supplementary_files_format_and_content: SPET-seq data is provided in the form of RNA Framework's (http://www.rnaframework.com) RNA Count (RC) files. A file corresponding to each transcription intermediate is provided. For a detailed description of the RC format, please refer to: http://rnaframework.readthedocs.io/en/latest/rf-count/#rc-rna-count-format
Supplementary_files_format_and_content: SPET-seq data is provided in the form of RNA Framework's (http://www.rnaframework.com) RNA Count (RC) files. A file corresponding to each transcription intermediate is provided. For a detailed description of the RC format, please refer to: http://rnaframework.readthedocs.io/en/latest/rf-count/#rc-rna-count-format. For rRNA 23S (rrlB gene), SPET-seq data is provided in the form of RC files, each one corresponding to individual transcription intermediates.
Supplementary_files_format_and_content: SPET-seq data (pooled Total and Ribo- RNA from both replicates) is provided in the form of RNA Framework's (http://www.rnaframework.com) RNA Count (RC) files. For each analyzed transcript, 10 files corresponding to SPET-seq data for the 10 transcription deciles are provided. For a detailed description of the RC format, please refer to: http://rnaframework.readthedocs.io/en/latest/rf-count/#rc-rna-count-format
Supplementary_files_format_and_content: Strain-expression.xlsx archive contains expression values in RPKM (Reads Per Kb exon (contig) per Million mapped  reads ( see Mortazavi et al. 2008, Nat Methods. 5(7):621-8 ) and can be directly compared to each other)  tab-delimited text files include RPKM values for each Sample.
Supplementary_files_format_and_content: T1E_LB.xlsx: Average of expression values of samples DOT-T1E_LB1 and LB2
Supplementary_files_format_and_content: Tab-delimited text file; genes in rows and samples in columns; each entry corresponds to the number of reads mapping to the given gene in the given sample.
Supplementary_files_format_and_content: Tab delimited text file; includes: gene differential expression levels relative to the G500 strain with corresponding p-values and processed counts for each biological replicate (each normolized and averaged between 2 technical replicates).  Linked as supplementary file on Series record.
Supplementary_files_format_and_content: Tab-delimited text file includes Rockhopper (McClure et al., 2013) normalized transcript abundance measurements (Expression), transcript abundance ratios (Expression Ratio), and qValues (qValue) for raw data that were treated as two experiments constituting either two (\
Supplementary_files_format_and_content: tab-delimited text file of transition error rate per position. The position is corresponding to the position of \
Supplementary_files_format_and_content: Tab delimited text files containing transcription coordinates and abundance estimates.
Supplementary_files_format_and_content: tab-delimited text files include count values for each Sample.
Supplementary_files_format_and_content: tab-delimited text files include CPM values for each Sample
Supplementary_files_format_and_content: tab-delimited text files include gene expresion values for each Sample
Supplementary_files_format_and_content: tab-delimited text files include normalized FPKM values and raw fragment counts for each Sample
Supplementary_files_format_and_content: tab-delimited text files include RPKM values for each Sample
Supplementary_files_format_and_content: tab-delimited text files include RPKM values for each Sample .
Supplementary_files_format_and_content: tab-delimited text files include RPKM values for each Sample …
Supplementary_files_format_and_content: tab-delimited text files include RPKM values for each Sample.
Supplementary_files_format_and_content: Tab-delimited text files include RPKM values for each sample
Supplementary_files_format_and_content: Tab-delimited text files include RPKM values for each sample.
Supplementary_files_format_and_content: tab-delimited text files include the average of the expression values obtained in Rockhopper for the replicates of each condition
Supplementary_files_format_and_content: tab-delimited text files include TPM values for each Sample; column1: transcript id; column2: TPM value
Supplementary_files_format_and_content: Tab-delimited text files in gff format which has 8 columns: sequence id, source(empty), feature (+/- strand), start position, end position, intensity score, strand(+/-), frame(.), attribute(.).
Supplementary_files_format_and_content: tab delimited text files, with feature annotation, REC_seq score, gene name and description
Supplementary_files_format_and_content: tab-delimitted text files contain TPM (transcripts per million) values for each sample
Supplementary_files_format_and_content: Table of read counts with genes as  rows and samples as columns.
Supplementary_files_format_and_content: tabular: Tabular data that informs the excel spreadsheet. The data are averaged across the three samples per strain. Both averaged strain data are presented for each gene on the same line. Data contain gene ID, gene number, locus, fragments per kilobase mapped (FPKM) for WT and mutant strains, log2(fold-change) relative epxression of WT over mutant strains, test-statistic, p-value, q-value, and significance analyzed via the cummeRbund package in R whereby a q-value of <0.05 is considered significant.
Supplementary_files_format_and_content: tar archives contain the following:
Supplementary_files_format_and_content: text files containing gene counts output by htseq-count
Supplementary_files_format_and_content: The columns in the processed files are the following in order:  GeneID, Length, ORF1_1_mapped_reads(7655775), ORF1_1_IPTG_mapped_reads(7178582), ORF1_2_mapped_reads(7706927), ORF1_2_IPTG_mapped_reads(7070827), Svi3_3_1_mapped_reads(8018710), Svi3_3_1_IPTG_mapped_reads(8299205), Svi3_3_2_mapped_reads(7313736), Svi3_3_2_IPTG_mapped_reads(8344539), WT1_IPTG_mapped_reads(8074159), WT2_IPTG_mapped_reads(8103887), ORF1_1_coverage, ORF1_1_IPTG_coverage, ORF1_2_coverage, ORF1_2_IPTG_coverage, Svi3_3_1_coverage, Svi3_3_1_IPTG_coverage, Svi3_3_2_coverage, Svi3_3_2_IPTG_coverage, WT1_IPTG_coverage, WT2_IPTG_coverage, ORF1_1_rpkm, ORF1_1_IPTG_rpkm, ORF1_2_rpkm, ORF1_2_IPTG_rpkm, Svi3_3_1_rpkm, Svi3_3_1_IPTG_rpkm, Svi3_3_2_rpkm, Svi3_3_2_IPTG_rpkm, WT1_IPTG_rpkm, WT2_IPTG_rpkm, Symbol (gene name), Description, KEGG Orthology, GO Component, GO Function, and GO Process
Supplementary_files_format_and_content: The file format is .xlsx. The file contains the raw gene counts of all samples.
Supplementary_files_format_and_content: The tab-delimited text files include raw read values for each time-point for both biol. replicates of control and Carolacton-treated samples as obtained from Rockhopper. A FASTA file on the series record contains the transcript sequences.
Supplementary_files_format_and_content: The text file contains sense and antisense raw base read counts for each of the 4091 ORFs for all the 15 samples, and the explanation key is included in the file.
Supplementary_files_format_and_content: The txt file includes the gene expression profiles of all the samples. The xlsx file contains the PC1 and PC2 values of all the samples.
Supplementary_files_format_and_content: .txt file file with raw and normalized counts of coverage
Supplementary_files_format_and_content: Txt files are processed data for DMS-MaPseq with two columns: first column containing chromosome positions (relative to transcription start site (1) of cspA) and second column containing the mutation rate.
Supplementary_files_format_and_content: txt files including count data for the whole genome
Supplementary_files_format_and_content: txt files including count numbers of RNA's and quality control were generated
Supplementary_files_format_and_content: txt files of a matrix containing genome position in column 1 and number of depth of mapped reads in column 2. Also, in a CSV file of a matrix containing genome position in column 1 and subsequent coloumns with normalised number of depth of mapped reads (column names have the strain number). CSV file is on the series record.
Supplementary_files_format_and_content: .txt (log2 fold change values, p-values)
Supplementary_files_format_and_content: [.txt] tab-delimited text file includes RPKM values
Supplementary_files_format_and_content: txt: tab-delimited text files include RPKM values for each Sample
Supplementary_files_format_and_content: *txt, *xml: These files contain the raw counts, normalized counts, RPKM values, expression values, P-values and Q-values. Each file contains the values for both samples at the indicated timepoint.
Supplementary_files_format_and_content: WIG files are provided showing uniquely mapped sequence reads (normalized).
Supplementary_files_format_and_content: wig files representing the normalized number of pAA-associated mapped reads per nucleotide. Files contain wiggle-formatted files data for accessions  NC_018658.1, NC_018659.1, NC_018660.1, and NC_018666.1.
Supplementary_files_format_and_content: wiggle
Supplementary_files_format_and_content: wiggle files with two columns: first column containing chromosome positions and second column containing the number of reads mapped to the position (see publication for details).
Supplementary_files_format_and_content: Wiggle files with two columns: first column containing chromosome positions and second column containing the number of reads mapped to the position (see publication for details).
Supplementary_files_format_and_content: .xls,  spreadsheet of normalized read counts for each gene for each sample, differential expression data, and annotation
Supplementary_files_format_and_content: xls: The data are averaged across the three samples per strain. Both averaged strain data are presented for each gene on the same line. Excel spreadsheet containing gene ID, gene number, locus, fragments per kilobase mapped (FPKM) for WT and mutant strains, log2(fold-change) relative epxression of WT over mutant strains, test-statistic, p-value, q-value, and significance analyzed via the cummeRbund package in R whereby a q-value of <0.05 is considered significant.
Supplementary_files_format_and_content: xlsx file format includes raw gene counts for each sample before and after filtering for low coverage genes
Supplementary_files_format_and_content: .xlsx files contain peak region locations and gene expression value for ChIP-Seq and RNA-Seq respectively
Supplementary_files_format_and_content: xlsx: logFC and p-value
supplementation: adenine (10 mM)
supplementation: L-tryptophan (20 mg/L)
supplementation: None
Suspended cells were then removed and biofilms were washed 3 times with 1 ml 10% LB broth. Biofilms from each petri dish were then scraped into a vial containing 1 ml 10% LB. Scraped biofilms in each vial were concentrated from 1 ml into 50 ul by centrifugation. 500 ul RNAlater was added and mixed well. Samples in RNAlater were kept in 4C fridge overnight.  Each vial was homogenized with OMNI TH homogenizer for 2 min on ice and further aliquoted into small vials. Cells in each vial were then re-suspended in nuclease-free phosphate buffered saline, incubated with anti-E. coli antibody (ViroStat) and microbeads (Miltenyi), followed by separation on a MACS separator (Miltenyi, Auburn, CA) at 4 degree C. Sorted cells were re-suspended into RNAlater until RNA extractions.
Svi3_3_1
Svi3_3_1_IPTG
Svi3_3_2
Svi3_3_2_IPTG
symbioflor status: without Symbioflor
symbioflor status: with Symbioflor
Synchronization was achieved by passaging cells through one or two rounds of stationary phase according to Cutler and Evans 1966. Briefly: Individual colonies (LB plate, 37°C, 24 h) were inoculated into M9 media and grown O/N (37°C, 200 rpm). M9 media was inoculated to a final OD600 = 0.25 (early-logarithmic phase). Cultures were grown (37°C, 200 rpm) and maintained in stationary phase (OD600 1.8) for approximately 2 hours. An appropriate amount of each culture was used to inoculate pre-warmed (37°C) M9 media to a final OD600 = 0.25 (approximate 7-fold dilution). Released cultures were grown (37°C, 200 rpm) and harvested (time = 0, 1 hr, or 2 hr) for GCC and RNA isolation. Samples (1 mL) were also taken for FACS analysis and fluorescence microscopy (t=0, 1 hr, and 2 hr).
SynH_Exp_BXHU
SynH_Exp_CBYS
SynH_LT_Exp_BXNX
SynH_LT_Exp_CBYU
SynH_LT_Exp_CCOG
SynH_LT_Stat1_BXNB
SynH_LT_Stat1_BXNZ
SynH_LT_Stat1_CHBW
SynH_LT_Trans_BXNC
SynH_LT_Trans_BXXC
SynH_LT_Trans_CBYW
SynH_Stat1_CBYN
SynH_Stat1_CUOC
SynH_Trans_CUNZ
SynH_Trans_CUOB
synthetic circuit: H3
synthetic circuit: LACZ
synthetic circuit: Lux
synthetic circuit: M1
synthetic circuit: None
T0_N0025_r1
T0_N0025_r2
T0_N0025_r3
T12_N0025_r1
T12_N0025_r2
T12_N0025_r3
T170V 0 min
T170V 10 min
T18-ParB (G101S) were produced by addition of 0.5mM IPTG for an hour before formadehyde to 1% (final concentration ) was added to fix cells for ChIP-seq
T18-ParB (WT) were produced by addition of 0.5mM IPTG for an hour before formadehyde to 1% (final concentration ) was added to fix cells for ChIP-seq
T24_N0000_r1
T24_N0000_r2
T24_N0000_r3
T24_N0025_r1
T24_N0025_r2
T24_N0025_r3
T24 THP-1 infection, Microarray #1 first replicate
T24 THP-1 infection, Microarray #1 second replicate
T24 THP-1 infection, Microarray #2 first replicate
T24 THP-1 infection, Microarray #2 second replicate
T2 THP-1 infection, Microarray #1 first replicate
T2 THP-1 infection, Microarray #1 second replicate
T2 THP-1 infection, Microarray #2 first replicate
T2 THP-1 infection, Microarray #2 second replicate
T36_N0025_r1
T36_N0025_r2
T36_N0025_r3
T48_N0025_r1
T48_N0025_r2
T48_N0025_r3
T5_1x_4
T5_27x_1
T60_N0000_r1
T60_N0000_r2
T60_N0000_r3
T60_N0025_r1
T60_N0025_r2
T60_N0025_r3
t7 genotype: evolved, codon-deoptimized gene 10
t7 genotype: wild-type gene 10
t7 strain: evolved
t7 strain: wild type
T8 THP-1 infection, Microarray #1 first replicate
T8 THP-1 infection, Microarray #1 second replicate
T8 THP-1 infection, Microarray #2 first replicate
T8 THP-1 infection, Microarray #2 second replicate
tab-delimited text files with GCSs coordinates, N3E values (\
tagged gyrase subunit: GyrA-SPA
tag: MG1655 K-12 WT
Tagwise dispersion was estimated using the weighted likelihood empirical Bayes method
technical replicate: 1
technical replicate: 2
technical replicates: 2
temp: 37ºC
temperature: 10°C
temperature: 37°C
temperature_down_0min
temperature_down_12min
temperature_down_20min
temperature_down_28min
temperature_down_44min
temperature_down_4min
temperature_down_8min
temperature down shift, 0min
temperature down shift, 12min
temperature down shift, 20min
temperature down shift, 28min
temperature down shift, 44min
temperature down shift, 4min
temperature down shift, 8min
temperature_Up_0min
temperature_Up_12min
temperature_Up_20min
temperature_Up_28min
temperature_Up_44min
temperature_Up_4min
temperature_Up_8min
temperature up shift, 0min
temperature up shift, 12min
temperature up shift, 20min
temperature up shift, 28min
temperature up shift, 44min
temperature up shift, 4min
temperature up shift, 8min
test: ChIP DNA
test: E. coli TOP10 containing pBAD18 vector exposed to arabinose inducer
TEX-_E. coli O104:H4
TEX+_E. coli O104:H4
text wig files contain coverage depth data
text wig files contain N3E values (number of DNA fragments 3' ends for each position of the genome)
TG1/pBS(Kan)/pMMB277 2nd
TG1/pBS(Kan)/pMMB277, cis-DCE
TG1/pBS(Kan)-TOM-Green/pMMB277-IsoILR1-GSHI 2nd
TG1/pBS(Kan)-TOM-Green/pMMB277-IsoILR1-GSHI, cis-DCE
TG1/ pMMB206-TOM-Green/pBS(Kan), cis-DCE
TG1/pMMB206-TOM-Green/pBS(Kan)-EchA F108L/I219L/C248I, cis-DCE
than or equal to the intensity of the foreground, the resulting log ratios became complex or
The 200 ml eluate from the Ni-NTA agarose was mixed with equal volume of pre-warmed PCI and incubated for 2 min at 70˚C. The mixture was centrifuged, and RNA and DNA were precipitated with isopropanol from the supernatant. The pellet was dissolved in 30 ml DNase I buffer with 5 U DNaseI (Takara Bio) and 20 U SUPERase, incubated for 10 min at RT. RNA was separated from the digested DNA by the PCI extraction and RNA was precipitated with isopropanol. The pellet was dissolved in diethylpyrocarbonate-treated water and used for cDNA synthesis.
The aligned reads were converted to BAM files and sorted and indexed using SAMtools
The .align files have been processed using tagalign. Reads were aligned to the reference genome (Bowtie v.0.12.0) by the first 25 nt and extended to account for the linker.
The alignment Bam files were compared against the gene annotation general feature format (GFF) file, and raw counts for each gene were  generated using the featureCounts tool from Subread. The raw counts data of the expressed genes was normalized for RNA composition using the trimmed mean of M values (TMM) method (http://www.ncbi.nlm.nih.gov/pubmed/20196867) from the Empirical analysis of Digital Gene Expression Data in R (EdgeR) package   (https://bioconductor.org/packages/release/bioc/html/edgeR.html), then transformed to log2CPM (counts per million) values using the voom method   (http://www.ncbi.nlm.nih.gov/pubmed/24485249) from the R LIMMA package  (https://bioconductor.org/packages/release/bioc/html/limma.html).
The amplified cDNA libraries from two biological replicates for each E. coli were sequenced on an Illumina Genome Analyzer. Sequence reads for cDNA libraries were aligned onto E. coli K12 MG1655 genome, using Mosaik with following arguments: hash size=10, mismatch=0. Only reads that aligned to the unique genomic location were retained. Two biological replicates were processed seperatedly, and only sequence reads presented in both biological replciates were considered for further process. The genomic coordinates of the 5'-end of these uniquely aligned reads were defined as potential TSSs. Among potential TSSs, only TSSs with the strongest signal within 10 bp window were kept to remove possible noise signals, and TSSs with greater than or equal to 40% of the strongest signal upstream of an annotated gene were considered as multiple TSSs.
The analysis of the data is based on cross validation with datasets generated by Monte-Carlo simulation. The null hypothesis was that the gene expression changes monotonously as a function of NaCl concentration. The existence of a deviation from monotony was tested by F-tests for each gene probe. By comparing the number of probes with the lowest p(F) values for each NaCl concentrations with analogous results generated from Monte-Carlo sampling of the null hypothesis, we show that it is very unlikely that a switch between 4.5 and 5% NaCl could have happened by chance (in fact p<<0.01).
The analyzed data were imported to ArrayTrack (NCTR Center for Toxicoinformatics;http://www.fda.gov/nctr/science/centers/toxicoinformatics/ArrayTrack/arraytrack_webaccess.htm). The raw data were normalized by using median channel (intensity) scaling with no background subtraction.
The analyzed data were imported to ArrayTrack (NCTR Center for Toxicoinformatics.  The raw data were normalized by using median channel (intensity) scaling with no background subtraction.
The appropriate protocols were performed using standard Illumina procedures
The average fluorescence intensity for each spot was calculated and local background was subtracted. All data normalization and selection of fold-changed genes were performed using GeneSpringGX 7.3.1 (Agilent Technology, USA).  Normalization for Agilent one-color method was performed, which is Data transformation : Set measurements less than 5.0 to 5.0 and Per Chip :Normalize to 50th percentage.
The average fluorescent signal intensity and local background correction for each spot were obtained using commercially available software from Biodiscovery Inc (Imagene, version 4.0 and Genesight, version 3.5).  Spots with a signal intensity lower than the background signal or those with blemishes were omitted from subsequent analysis.  The mean values from each channel were then log2 transformed and normalised using the LOWESS method to remove intensity-dependent effects in the log2 (ratios) values.  The Cy3/Cy5  (or, for replicates 3 and 4, Cy3/Cy3 ratio) fluorescent ratios were calculated form the normalised values.  Data from independent experiments were combined.  Significance analysis of the data used the Student’s t test to determine the probability that the average of the experimental replicates was significantly different from the average of the control replicates. p-values for the data were calculated by treating each slide as a repeat using Genesight.
The average signal intensity and local background correction were obtained using a commercially available software package from Biodiscovery, Inc (Imagene, version 4.0 and GeneSight, version 3.5).
The bacterial cells from 5L fermentation were collected at 20h, 30h, 40h and centrifuged for 5min to pellet the cells. The cells then mixed with 500mL of RNA protectant bacterial reagents to stabilize RNA and stored at -80°C until use. Total RNAs were isolated using RNeasy mini kit and were treated with DNase to remove DNA.
The bacterial cells were grown at 37℃ for 17 hours on Luria-Bertani (LB) agar plate. An isolated colony was picked and inoculated into 100ml of sterilized LB broth (10g of tryptone, 5g of yeast extract and 10g of sodium chloride per liter) and incubated overnight for 17 hours at 37℃ with shaking at 250 rpm. A 1:100 dilution of the culture was performed using pre-warmed LB broth. The diluted culture was incubated at 37℃ with shaking at 250rpm until a final optical density (OD600) of 0.8 (early logarithmic phase) was attained. A further 1:10 dilution was performed using LB broth and incubated at 37℃ with shaking at 250 rpm.
The bacterial culture pellets were grown according to the instructions from ATCC.
The bacteria were centrifuged at 4000×g at 4°C for 5 min and then washed with PBS.
The bacteria were routinely grown in Luria-Bertani (LB) broth or on LB agar plates (pH 7.2).
The bcl2fastq Conversion Software v. 1.8.4 from Illumina (http://support.illumina.com/downloads.html) was used to translate cluster intensity values into fastq files.
The binding regions were considered by taking into account base position with z-score greater than threshold and merging adjacent binding regions seperated by a distance of less than 200bo into the single binding regions
The CEL files generated for each array were analyzed using Affymetrix Expression Console software.
The cell cultures were interrupted by placing them directly into a cold phenol-ethanol solution (0.1g-phenol/mL-ethanol). The cells were collected using centrifugation at 12,000g for 5 min at 4C, and the pelleted cells were once stored at -80C prior to use.
The cell culture was put into cold phenol-ethanol solution (1 g of phenol in 10 mL of ethanol) prepared in advance. The cells were collected by centrifugation at 16,000 × g for 5 min at 4°C, and the pelleted cells were stored at –80°C prior to use.
The cell culture was put into cold phenol-ethanol solution (1 g of phenol in 10 mL of ethanol) prepared in advance. The cells were collected by centrifugation at 7,000 × g for 3 min at 4°C, and the pelleted cells were stored at –80°C prior to use.
The cell culture was treated with the RNAprotect reagent (Qiagen).
The cell samples were collected directly into RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) to avoid RNA degradation. The samples were centrifuged according to the manufacturer’s protocol and frozen at - 80 °C until RNA isolation.
The cells culture were harvested and resuspended with a  solution containing 0.5% SDS, 20 mM sodium acetate (pH 5.5), and 10 mM  EDTA. The suspended cells were mixed with an equal volume of pre-warmed  saturated phenol (20 mM sodium acetate, 10 mM EDTA pH 5.5) and incubated  for 5 min at 60˚C.
The cells for RNA extraction were immediately mixed with RNA Protect Bacterial reagent® (Qiagen) and processed by the RNAeasy Mini Kit (Qiagen) according to the manufacturers instructions. The cells for whole cell proteomics were chilled in ice-slush, pelleted at 14000 rpm, 4°C and the media was aspirated.  The cells were washed with 3×1.5 mL PBS with pelleting at as above in between. The final pellet was stored at -80°C until being shipped to the Proteomics Core Facility at University of Gothenburg for processing. The RNA was shipped to BGI for total RNA sequencing.
The cells were centrifuged at 8000 rpm for 5min at 4°C. The cell pellets were snap-frozen in liquid nitrogen and kept at -80°C
The cells were centrifuged when they reached the log phase, and then rapidly chilled and stored in liquid nitrogen until used for the DNA microarray assay
The cells were collected by centrifugation at 8,000 × g for 5 min at 25°C, and the pelleted cells were stored at –80°C prior to use.
The cells were cultivated in 100 ml LB broth containing 2 mg/L Cm with  50 mg/L triclosan and harvested in mid-logarithmic growth phase (OD600=1.1).
The cells were cultivated in 100 ml LB broth containing 2 mg/L Cm without triclosan and harvested in mid-logarithmic growth phase (OD600=1.0).
The cells were grown in ~300 ml LB broth +25 mg/ml kanamycin with shaking at 37˚C until OD600 of ~0.5. The cells of 150 mg (wet weight) were harvested by centrifugation at 6,500 × g for 4 min at 4˚C, aliquoted in three 1.5 ml tubes, flash frozen in liquid nitrogen, and stored at -80˚C.
The cells were grown in ~300 ml LB broth +25 mg/ml kanamycin with shaking at 37˚C until OD600 of ~0.5.The cells of 150 mg (wet weight) were harvested by centrifugation at 6,500 × g for 4 min at 4˚C, aliquoted in three 1.5 ml tubes, flash frozen in liquid nitrogen, and stored at -80˚C.
The cells were untreated, or treated with  (100µg/mL Erythromycin or 50 µg/mL Clindamycin in 70% Ethanol). After 10 minutes at 37°C, 1 mL samples were subjected to hot phenol-chloroform extraction. Ref: Chuang SE, Daniels DL, and Blattner FR (1993) Global regulation of gene expression in Escherichia coli. J. Bacteriol. 175:2026-2036.
The ChIP-exo experiments were generated by following the steps presented by Rhee and Pugh, 2011.
The ChIP experiment was performed essentially as described previously (Herring, Raffaelle et al. 2005). Briefly, the cell cultures were fixed by a 1% formaldehyde and 10 mM sodium phosphate (pH 7.6) solution for 20 min at room temperature. After cell lysis, RNase A treatment and sonication, the chromosome was fragmented to 100-1200 bp. RNAP binding DNA (IP DNA) was immunoprecipitated with RNAP using an antibody against the RNAP β’ subunit and pan mouse magnetic beads. The same sample without the β’ antibody was used as mock immunoprecipitation DNA (mock IP DNA). After washing and de-crosslinking, DNA was purified using the PCR purification kit (Qiagen).
The clean reads obtained were aligned to the genome sequence of E. coli O157:H7 EDL933 using SOAP2
The conditioned medium (C) was the DMEM medium containing 10% FBS without antibiotics recovered after 24 hrs incubation with differentiated Caco-2 cells. 400 µL of STEC culture were inoculated in 4 mL of C medium and incubated for 3 hrs at 37°C. After this period the bacteria were recovered by centrifugation for 10 min at 5000 xg and the pellet was ressuspended in 600 µL of RNAprotect Bacteria Reagent (Qiagen cat. no. 76506, Valencia, CA) for RNA extraction.
The counts of reads 150 aligning to genomic features were obtained using the 'feaureCounts' function from the R package 'Rsubread'
The cross-linked DNA-ArgR complexes in the supernatant were then immunoprecipitated by adding 10 µL of Anti-myc (9E10) (Santa Cruz, Dallas, TX). For mock-IP control, 2 µg of normal mouse IgG (Santa Cruz) was added into the supernatant in parallel. They were then incubated overnight at 4oC with constant rotation. The cross-linked DNA-protein and antibody complexes were selectively captured by adding 50 µL of Dynabeads Pan Mouse IgG magnetic beads (Invitrogen, Grand Island, NY). Then, DNAs were end-polished using T4 DNA polymerase (NEB, Ipswich, MA), ligated with the annealed adaptor 1 (5’- Phospho-AACTGCCCCGGGTTGCTCTTCCGATCT and 5’- OH-AGATCGGAAGAGC-OH), nick-repaired using phi29 polymerase (NEB), and digested with λ exonuclease (NEB) as reported previously. Then, protein-DNA complexes were reverse-cross-linked by heating at 65°C overnight and proteins were degraded by 8 µg of protease K (Invitrogen). The purified DNAs were denatured at 95°C and extended by P1 primer (5’-OH-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT), further ligated with the annealed adaptor 2 (5’-OH-ACACTCTTTCCCTACACGACGCTCTTCCGATCT and 5’-OH-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAG). The ligated DNA products were purified using Qiagen PCR purification kit and were PCR-amplified by P2 primer (5’-OH-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and P3 primer (5’-OH-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGT). The degenerative sequence (the underlined 6Ns) in the P3 primer indicates the index sequence for the Illumina next-generation sequencing (Illumina, San Diego, CA). The PCR-amplified DNA products were then loaded onto 2% agarose gel and extracted using QIAquick gel purification columns.
The cultivations were performed in a Biostat C 15 L bioreactor with the DCU-3 controlling unit and MFCS-win supervisory system (Sartorius) with an initial working volume of 8 L. The mineral salt medium contained per liter: 14.6 g K2HPO4, 3.6 g NaH2PO4 × 2 H2O, 2.0 g Na2SO4, 2.47 g (NH4)2SO4, 0.5 g NH4Cl, 1.0 g (NH4)2-H-citrate, 2 mM MgSO4, 0.1 g thiamine hydrochloride, 0.1 mL antifoam 204 (Sigma) and 2 mL trace element solution (1). The initial glucose concentration was 40 g L-1. The feed solution contained 650 g L-1 glucose. 2 mL L-1 of sterile filtered 1M MgSO4 were added regularly per OD600=10 increase.
The cultured cells were inoculated with 1:100 dilution into 50 mL of the fresh M9 medium containing 2 g/L glucose in either the presence or absence of 1 g/L arginine and continued to culture at 37°C until reaching an appropriate cell density (OD600 ≈ 0.5).
The culture medium samples were withdrawn with a capillary sampling probe as developed by Theobald et al. (1997), however, without using membrane-covered glass tubes.
The cultures were balanced and grown in CAMHB media at 37 degrees Celsius.
The cultures were centrifuged at 8000 rpm for 10 minutes and the pellet was dissolved in 15 mL of 10 mM NaCl, 20 mM Tris-HCl (pH 8.0), 1 mM EDTA, 100 μg/mL proteinase K and 0.5% SDS. This suspension was incubated at 50oC for 2 h and DNA extracted with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1). Following centrifugation for 10 min at 8000 rpm, the upper phase was removed and precipitated by adding 0.1 volume of 3 M NaOAc (pH 5.2) and 2 volumes of 99% ethanol. The DNA precipitate was then spooled out of the solution using a sterile glass rod, washed with 70% ethanol, and dissolved in 5 mL of TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) buffer.
The cultures were prepared by inoculating one colony from tryptone soya agar (TSA) (Oxoid) (overnight growth at 37°C) to 5 ml TSB and incubating overnight at 37°C, with shaking (200 rpm). This culture was initially diluted 1:10 in medium and used to inoculate room-temperature TSB for each of the different stress factors (40 ml total volume) to a final concentration of approx. 1´107 CFU/ml (1:100 dilution of overnight culture). For cold stress experiment the medium was chilled to 15°C prior to inoculation. The cultures were incubated at 37°C (except fpr 15°C and 46°C conditions), shaking at 200 rpm and samples were collected during exponential growth at a cell density of approx. 1´108 CFU/ml. All the stress conditions, including the control, were inoculated with the same overnight culture and started at the same time point. The experiment was performed 3 times at different days and with freshly prepared solutions, resulting in 3 biological replicates.
The culture was divided into two 20-ml volumes and the cells collected by centrifugation. The supernatant was removed and the two pellets were subjected to different treatments. One was resuspended in 1 ml of pre-warmed 1X EG-minimal medium pH 7.2. The second was resuspended in 1 ml of pre-warmed 1X EG-minimal medium pH 4.5. Each suspension was added to a final volume of 20 ml 1X EG minimal medium of the same pH in a 250 ml flask. Cells were grown at 37°C and 200 rpm shaking for 90 min before harvesting for analysis.
The culture was incubated with 100 µg/ml of chloramphenicol for 2 min, and harvested by centrifugation. The pellet with washed and resuspended in 100 mM NH4Cl, 10 mM MgCl2, 20 mM Tris Cl, 0.4% Triton X100, 0.1% NP-40, and 100 µl/ml chloramphenicol, and flash frozen over liquid nitrogen. The frozen cell pellets were pulverized by mixer milling and thawed in 2.5 mM DSP. The crosslinking reaction was quenched with 100 mM Tris Cl 8.3.
The data did not undergo normalization across samples.
The data output from the Illumina Hiseq System was obtained directly from Vertis
The data provided are the original data generated with the Jaguar software from the microarray images. The VALUEs reported represent log10 (Cy5/Cy3) ratios for this experiment/sample. They were not normalized across all samples in the study.
The data provided are the original data generated with the Jaguar software from the microarray images. The VALUEs reported represent normalized log10 (Cy5/Cy3) ratios for this experiment/sample. They were not normalized across all samples in the study.
The data were analyzed using Robust Multi-Array average as implemented in Bioconductor
The data were analyzed with ArrayStar 3 (DNASTAR) using RMA normalization method. Genes with at least two-fold expression level change and FDR-adjusted P-value (T-test) of less than 0.05 were considered significant.
The data were analyzed with FlexArray 1.4.1 software program (http://genomequebec.mcgill.ca/FlexArray/). The data were normalized using the Robust Multi-Array Average algorithm (RMA). Comparison between the two data sets was done using the Randomized Variance Model (RVM) with a cut-off of a fold change of 2 (or -2) and a P-value of 0.05.
The data were analyzed with GCOS 1.4 software.  All probe sets scaling was performed with a target signal value of 500.  No normalization was performed.
The data were analyzed with Microarray Suite version 5.0 (MAS 5.0) using Affymetrix default analysis settings and global scaling as normalization method.
The data were analyzed with Microarray Suite version 5.0 (MAS 5.0) using Affymetrix default analysis settings and global scaling as normalization method.  Data from this sample were collected using Affy Ecoli anti-sense chip (2001; platform ID GPL4940), but because the analysis software failed to recognize the correct platform, we reformatted the data to match the newer (and mostly equivalent) platform GPL199 (Affy Ecoli anti-sense chip version 2, 2002).  Because, however, not all of the probes on the new platform were present on the old platform, data for some probes were unavailable and labeled in the 'remapped' dataset as 'NULL' to indicate they were missing.  While the following data are therefore formatted using ID_REFs that match GPL199, the CEL file contains the raw data (not 'remapped') and thus corresponds to the actual array used (GPL4940, Ecoli antisense chip, 2001).
The data were analyzed with Microarray Suite version 5.0 (MAS 5.0) using Affymetrix default analysis settings and global scaling as normalization method. The trimmed mean target intensity of each array was arbitrarily set to 100.
The data were analyzed with Partek Genomics Suite using Affymetrix default analysis settings and global scaling as normalization method.
The data were imported into FlexArray using gc-RMA preprocessing for analysis.
The data were normalised manually in Excel. For each spot, the median of the spot intensity minus the background were considered. Because we wanted to compare different environmental conditions, the cDNA signal in each condition was normalised to that of gDNA with M=ln(cDNA/gDNA). To ensure that the fluorescence measurements were independent of the overall signal intensity of the spot, the values of M were made independent of A=(lncDNA+lngDNA)/2 with a linear shift. Spots where the A values were less than 5.5 were not considered. Finally the experiments were aligned so that the median of M=0 and their deviation was normalised.
The data were normalized by RMA method and then analyzed by limma package to identify differentially expressed genes (bioconductor).
The distribution of reads was plotted by its location in the reference genome, and then divided into gene region and intergenic region. Genome and gene coverage was calculated by counting the number of reads mapped to the genome and individual genes respectively.
The early-exponential phase cells were collected without NaCl treatment.
The E. coli isolate ESBL019 was originally isolated from a patient at Örebro University hospital, Sweden and was maintained on tryptic soy agar (TSA) (Becton Dickinson, Le Pont Claix, France). ESBL019 was grown in Luria broth (Difco Laboratories, Detroit, MI, USA) overnight on shake at 200 rpm 37 °C prior to experiments. The bacteria were resuspended in sterile phosphate buffered saline prior to inoculation of CnT-21 cell culture medium (CCM) with or without ceftibuten (480 ng/mL).
The E. coli K12 strain MG1655 and its isogenic ptsN mutant were grown in M9 minimal medium containing 0.5% glucose as carbon source. Cells from duplicate experiments were harvested in exponential growth phase when cultures reached an A600 of 0.4.
The E. coli strain BW25113 (2 x 10^9) suspended with insect saline (0.13 M NaCl, 4.7 mM KCl, 1.9 mM CaCl2), was incubated with GST or GST-fused Drosophila immune proteins for 10 min at room temperature.
The E. coli strains were grown for six hours under anaerobic growth condition in glucose-containing complex medium.
The equivalent of 5 OD600 was saved for RNA extraction with TriZOL before adding antibodies (lysate RNA sample). For coIP samples, beads were resuspended in the lysis buffer, mixed with an equal volume of phenol:chloroform:isopropanol (25:24:1, pH4.5, Roth) for 20 s and incubated at room temperature for 3 min. After centrifugation, the aqueous phase was precipitated with isopropanol (coIP RNA sample). The purified RNA coIP sample was treated with DNase I (Thermo Scientific) to remove the residual DNA and reisolated with phenol:chloroform:isopropanol. The spike-in RNA (5’P-CUCGUCCGACGUCACCUAGA, IBA) had been added to 40 pg/µl for coIP samples and to 1.6 ng/µl for lysate samples.
The exponential phase culture was split in two, and one part was induced with mitomycin C at a final concentration of 0.25 μg/ml. Both cultures were subsequently incubated at 37 °C with agitation for 1.5 hours. Bacterial cells were then spun down and resuspended in 5-10 volumes of RNA later (QIAGEN) before being frozen at -20 °C.
The expression levels were based upon the RPKM metric obtained from strand-specific manner.
The fastq files of 36-bp sequenced reads were generated with the CASAVA v1.8 (Illumina). For the bulk RNET-seq analysis, the specific adapter sequences were trimmed with the Trimmomatic v0.25 to obtain reads ≥ 21-nt from the 5’ end. The reads ≥ 21-nt were mapped to the reference genome of E. coli K-12 strain W3110 (NC_007779.1) using the Bowtie2 v2.1.0 with the default parameter. A gene annotation file of E. coli W3110 was downloaded from the ftp server of Ensembl.
The fed-batch cultivations were carried out with the bacterial strain E. coli K-12 W3110 (DSM 5911, German Collection of Microorganisms and Cell Cultures) in a 30-l bioreactor (Bioengineering AG, Wald, Switzerland). Minimal medium supplemented with glucose as the carbon source was used. The batch medium (batch volume VR,0 =17 l) consisted of 8.8 g l−1 glucose•H2O, 2.0 g l−1 Na2SO4•10H2O, 2.68 g l−1 (NH4)2SO4, 1.0 g l−1 NH4Cl, 14.6 g l−1 K2HPO4, 4.02 g l−1 NaH2PO4•2H2O, 0.01 g l−1 thiamine HCl; 0.3mM CaCl2•2H2O, 2mM MgSO4•7H2O; 3ml l−1 of trace element solution (TES: 16.7 g l−1 FeCl3•6H2O, 20.1 g l−1
the first ten base pairs of each read were trimmed using FASTX­Toolkit 0.0.13.
The five bacterial strains (JO2057, JO2081, JO2083, JO3020 and MW30) were grown in 100ml LB 0.5% NaCl, M9 minimal glucose or M9 minimal glycerol at 200 rpm in New Brunswick laboratory shaker in 2liter flasks. The typical doubling time, observed in exponential phase in LB, was 40min for JO2057, JO2081, JO2083, MW30 and 75 min for JO3020. After growth curve calibration, the various growth phase sample were collected at the following cell densities: exponential phase: OD600 0.6-0.7; transition: 2.2-2.5 and stationary: 4.6-4.8 (3.0 for hupAB).
The fluorescent spot intensities were quantified using ImaGeneÔ 5.6.1 (BioDiscovery Inc.) software. Background subtraction and normalization (LOWESS) was performed in GeneSpringä 7 (Silicon Genetics). (A lowess curve was fit to the log-intensity versus log-ratio plot. 20% of the data was used to calculate the lowess fit at each point. The curve was used to adjust the control value for each measurement. If the control channel was lower than 10 then the value was set to 10). Only data from spots representing E. coli K-12 MG1655 genes were analyzed in our studies. All analyses were based on 3 biological replicates with the exception of the second biological replicate from conditions HCl and NaOH. These two observations were removed due to bad hybridization giving a total of 34 array hybridizations (observations). Genes not present in any of the 34 observations were filtered out, resulting in the analysis of 4279 out of 4289 MG1655 genes on the array. Missing values (data points) were replaced by using the KNNimpute procedure (k=10) on log2 transformed data.
The fresh medium (F) was the DMEM medium containing 10% FBS without antibiotics. 400 µL of STEC culture were inoculated in 4 mL of F medium and incubated for 3 hrs at 37°C. After this period the bacteria were recovered by centrifugation for 10 min at 5000 xg and the pellet was ressuspended in 600 µL of RNAprotect Bacteria Reagent (Qiagen cat. no. 76506, Valencia, CA) for RNA extraction.
The full library construction protocol was described in detail previously (Churchman et al., Nature 2011). Purified total RNA was fragmented and dephosphorylated with T4 PNK, and then ligated to a 5' adenylated DNA oligo to generate RNA ranging from 30-100 nt. The RNA was reverse transcribed, and the single-stranded DNA circularized and PCR amplified.
The gene expression values were calculated as RPKM (reads per kilobase transcriptome per million mapped reads) by the inhouse BGI pipeline.
The gene expression was calculated using the RPKM method
The genes were considered differentially expressed when the logarithmic gene expression ratios had a 2-fold difference in the expression level. The significance of the data was determined using Student’s t test. P-values of less than 0.01 were considered significant.
The genes were filtered by removing the flag-out genes in each experiment. The gene expression was normalized through LOWESS regression for 3 datasets obtained from 3 biological replicates.
The genomic DNA from pure and mixed bacterial cultures was isolated using the Wizard genomic DNA isolation kit (Promega corporation, Madison, USA) as per manufacturer's instructions. The concentration of DNA was analyzed by Nanodrop spectrophotometer (Nanodrop Technologies Inc, Rockland, USA), and quality was determined by analysis on DNA 12000 kit (Caliper Sciences, USA) using the Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA).
The hot-phenol method was used to extract total RNA from two independent cultures of cells grown aerobically
The hot-phenol method was used to extract total RNA from two independent cultures of cells grown aerobically and treated with 250 μM CORM-2 during 15 min.
The hot-phenol method was used to extract total RNA from two independent cultures of cells grown anaerobically
The hot-phenol method was used to extract total RNA from two independent cultures of cells grown anaerobically and treated with 250 μM CORM-2 during 15 min.
The hybridization intensity data signals were analyzed, normalized, and corrected for batch effect using Affymetrix GeneChip® Command Console® Software (AGCC v.3.0). Signal average, noise average, scaling factor, % present, and % absent were calculated for each probe, from which the signal intensity of >39 was calculated as reliable expression. Using this cutoff, 5531 probes were classified as present out of total 10208 probes on the array (full_expressed_data.txt).
The image analysis performed using GenePix Pro 6.0 Software (Molecular Devices), normalized with MIDAS (LOWESS method), with clustering analysis in MeV (CAST)
The image analysis was performed using GenePix Pro 6.0 Software (Molecular Devices). Data were normalized with MIDAS (LOWESS method), with clustering analysis in MeV (CAST).
The  intensity cell files were then imported, normalized for background correction (used RMA for normalization)and data analysed using Gene Spring 11.5 software.
The intensity cell files were then imported, normalized for background correction using PLIER and data analysed using Gene Spring 11.5 software.
The intensity of each spot was measured with ScanArray Express using the histogram quantitation method; the percentile ranges for histograms were 80% for low signal range, 95% for high signal range, 5% for low background range and 20% for high background range. The median intensity minus the median background intensity was used for further calculations performed in Microsoft Excel. The background measurement refers to the local spot background intensity. Prior to normalization, all spots with a Signal-to-Noise ratio (SNR) lower than 3 were removed. The SNR was calculated using the following formula: (Median Signal – Median Background)/Standard Deviation of Background. Normalization between each array was performed using an internal labeling control (IC) consisting of a 290 bp luxA fragment. This fragment was added to each labeling reaction at a ratio of 0.05% of the DNA to be labeled. The intensity of each Cy5-sample gene spot  was corrected using the average intensity of all Cy3-lambda signals. Corrected intensity values were averaged over triplicate spots to give a single value per gene. The intensity of the genes for which hybridization of the probes could not be visually detected in image analysis was set to zero. Relative intensity values were then calculated by dividing the intensity of a gene by the sum of the intensity for all genes (excluding controls). This “relative abundance” represents the fraction of the total intensity that is due to a particular gene and this value was subsequently used in statistical analyses.
The in vitro bacterial samples were harvested by centrifugation (5000 × g, 10 min, 4 °C) and the pellet was frozen at −70 °C until RNA extraction. The in vivo bacterial samples were harvested with two-step centrifugation. We first centrifuged the collected anticoagulated blood samples at low speed to remove the abundant red and white blood cells and collected the upper serum layer. We then used high-speed centrifugation to precipitate the bacteria from the serum.
The in vivo bacterial samples were harvested with two-step centrifugation. We first centrifuged the collected anticoagulated blood samples at low speed to remove the abundant red and white blood cells and collected the upper serum layer. We then used high-speed centrifugation to precipitate the bacteria from the serum.
The isolated persisters were incubated in 0.85% NaCl solution for 1 h (200 rpm, 37oC) with or without 5 µg/mL BF8.
The laboratory strain E. coli K12 MG1655 was grown for 24 h at 37 °C under continuous shaking (120 rpm), in 200 mL M9 medium (Merck Prolabo) complemented with 2.5 g/L of anhydrous glucose, and inoculated at 108 CFU/mL (corresponding to an optical density at 595 nm [OD595 nm] of 0.12). The inoculum for this culture was prepared in 40 mL M9 broth inoculated with approximately 1.5x107 CFU/mL (corresponding to an OD595 nm of 0.12) and incubated overnight under the same conditions (37 °C, 120 rpm). This inoculum was obtained by adding 1 mL of stock culture of the bacterial cells in 5 mL of Luria Bertani broth (Biokar Diagnotics, PRS Panreac) in a 15-mL half-opened BD FalconTM tube, followed by 8 h of incubation at 37 °C and 120 rpm.
The libraries were generated by Vertis Biotechnologie AG (Munich, Germany). The samples were poly(A)-tailed by using poly(A) polymerase. The 5'-PPP were removed using tobacco acid pyrophosphatase (TAP) followed by the ligation of the RNA adapter to the 5'-monophosphate of the RNA. First-strand cDNA synthesis was performed with an oligo(dT)-adapter primer and the M-MLV reverse transcriptase. The resulting cDNA was PCR-amplified to reach a concentration of 20-30 ng/μl using a high fidelity DNA polymerase. The cDNA was purified using the Agencourt AMPure XP kit (Beckman Coulter Genomics) and was analyzed by capillary electrophoresis. The primers used for PCR amplification were designed for TruSeq sequencing according to the instructions of Illumina
The log10 mRNA concentration (pM) data are provided as a supplementary file on the SERIES record.
The log2-ratio is computed and scaled to center the ratio data around zero. Scaling is performed by subtracting the bi-weight mean for the log2-ratio values for all features on the array from each log2-ratio value.
The ‘LogRatio’ value was used in subsequent analyses.  All values for the same ORF were averaged as were the values from the two biological replicates performed for each comparison.
The low-quality of raw reads were trimmed using Trimmomatic (v0.30) with default settings.
The lysates were applied to gDNA removal columns and rRNA was removed from total RNA using a Ribo-Zero rRNA removal kit (Illumina, UK) following the manufacture’s instruction for Gram-positive bacteria. The sequencing libraries were prepared from the enriched mRNA using the NEBNext Ultra RNA library prep kit (NEB, UK), and independently indexed using NEBNext multi-plex oligos for Illumina (NEB, UK). The libraries were pooled at equimolar ratios before they were sequenced using MiSeq Reagent Kit v3 600 cycles (Illumina,UK).
The MACS 2.1.0 software was used to call peaks.
The MACS2 software was used to call peaks.
The mean signal intensity values of the duplicate spots were averaged and then normalized by the global normalization method. The genes showing the p-values lower than 0.05 were considered to be significant.
The measured lifetime of mRNA is available as a supplementary file (real_rna_life.txt) on the Series record.
The medium for batch culture was consisted of 11.3 g M9 medium, 0.2 g MgSO4•7H2O, 0.1 g CaCl2, 1 mg thiamine, 10 g NaHCO3 and 9 g glucose, 50 mg ampicillin and 0.1 mmole IPTG per liter.
The medium for continuous culture contained 20 g LB, 9 g glucose, 10 g NaHCO3, 50 mg ampicillin per liter and isopropyl--D-thiogalactopyranoside (IPTG) was supplemented to be 0.1 mM. The initial pH of the medium was set to be pH 7.3 by adding 1 N HCl solution. The inoculation culture was transferred into a 250 mL-fermentor containing 100 mL medium (Small scale multi-chemostat fermentor; Biotron Inc., Bucheon, Korea). The culture was performed at 37 C, 350 rpm with flushing CO2 gas at 20 mL/min. After 8 h inoculation, the feeding and outlet pumps were started at flow rate of 0.166 mL/h (dilution rate = 0.1 h-1).
The medium for continuous culture contained 20 g LB, 9 g glucose, 10 g NaHCO3, 50 mg ampicillin per liter and isopropyl--D-thiogalactopyranoside (IPTG) was supplemented to be 0.1 mM. The initial pH of the medium was set to be pH 7.3 by adding 1 N HCl solution. The inoculation culture was transferred into a 250 mL-fermentor containing 100 mL medium (Small scale multi-chemostat fermentor; Biotron Inc., Bucheon, Korea). The culture was performed at 37 C, 350 rpm with flushing CO2 gas at 20 mL/min. After 8 h inoculation, the feeding and outlet pumps were started at flow rate of 0.166 mL/h (dilution rate = 0.1 h-1). 
The medium for continuous culture contained 3 g glucose medium consisted with 0.8 g NH4Cl, 0.5 g NaCl, 7.5 g Na2HPO4•2H2O, 3 g KH2PO4 with separately added trace element of 0.2 g MgSO4•7H2O, 0.1 g CaCl2, 1 mg thiamine per liter and the concentraiton of added succinate gradually was raised from 30 g/L to 160 g/L during 9 months.  The initial pH of the medium was set to be pH 8. The fermentor was maintained at 37℃, 350 rpm with air gas flushing and the feeding and outlet pumps were maintained at flow rate of 0.1 h-1.
The medium for continuous culture contained 3 g glucose medium consisted with 0.8 g NH4Cl, 0.5 g NaCl, 7.5 g Na2HPO4•2H2O, 3 g KH2PO4 with separately added trace element of 0.2 g MgSO4•7H2O, 0.1 g CaCl2, 1 mg thiamine per liter and the concentraiton of added succinate gradually was raised from 30 g/L to 160 g/L during 9 months.  The initial pH of the medium was set to be pH 8. The fermentor was maintained at 37℃, 350 rpm with air gas flushing and the feeding and outlet pumps were maintained at flow rate of 0.1 h-1. 
The medium for continuous culture contained 3 g glucose medium consisted with 0.8 g NH4Cl, 0.5 g NaCl, 7.5 g Na2HPO4•2H2O, 3 g KH2PO4 with separately added trace element of 0.2 g MgSO4•7H2O, 0.1 g CaCl2, 1 mg thiamine per liter.  The fermentor was maintained at 37℃, 350 rpm with air gas flushing and the feeding and outlet pumps were maintained at flow rate of 0.1 h-1.
The medium for continuous culture contained 3 g glucose medium consisted with 0.8 g NH4Cl, 0.5 g NaCl, 7.5 g Na2HPO4•2H2O, 3 g KH2PO4 with separately added trace element of 0.2 g MgSO4•7H2O, 0.1 g CaCl2, 1 mg thiamine per liter.  The fermentor was maintained at 37℃, 350 rpm with air gas flushing and the feeding and outlet pumps were maintained at flow rate of 0.1 h-1. 
The microarray data files were processed using statistical software R version 3.0.1 and Bioconductor packages. The Single-Channel Array Normalization (SCAN.UPC) package was used to normalize the microarray data. Batch effects were adjusted by using the Empirical Bayes method implemented in COMBAT software.
The microarray data were analyzed using R (v. 2.2.1) and the MAANOVA (v. 0.98.8) package. Raw intensity values from replicate probes were averaged and log2 transformed after normalization with the pin-tip LOWESS method. The normalized intensity values were fitted to a mixed model ANOVA considering array and biological replicates as random factors and dye, strain and growth phase as fixed factors. The linear model tested was Y (intensity) = array + dye + strain (wild type or mutant) + growth phase (exponential or stationary) + strain*growth phase + sample (biological replicate) + error. Significant differences in expression due to strain, growth phase and strain*growth phase were determined using the Fs test in MAANOVA which uses a shrinkage estimator for gene-specific variance components that makes no assumption about the variances across genes with 500 random permutations to estimate the p-values. The q-value package in R was used for determining the false discovery rate (FDR).
The microarray data were analyzed using R (v. 2.2.1) and the MAANOVA (v. 0.98.8) package. Raw intensity values from replicate probes were averaged and log2 transformed after normalization with the pin-tip LOWESS method. The normalized intensity values were fitted to a mixed model ANOVA considering array and biological replicates as random factors and dye, strain as fixed factors. The linear model tested was Y (intensity) = array + dye + strain (clinical or bovine-biased)+ sample (biological replicate) + error. Significant differences in expression due to strain were determined using the Fs test in MAANOVA which uses a shrinkage estimator for gene-specific variance components that makes no assumption about the variances across genes with 500 random permutations to estimate the p-values. The q-value package in R was used for determining the false discovery rate (FDR). SAM provided by TMEV was also used for data analysis.
The microarray data were analyzed using R (v. 2.2.1) and the MAANOVA (v. 0.98.8) package. Raw intensity values from replicate probes were averaged and log2 transformed after normalization with the pin-tip LOWESS method. The normalized intensity values were fitted to a mixed model ANOVA considering array and biological replicates as random factors and dye, strain as fixed factor. The linear model tested was Y (intensity) = array + dye + strain (clinical or bovine-biased)+ sample (biological replicate) + error. Significant differences in expression due to strain were determined using the Fs test in MAANOVA which uses a shrinkage estimator for gene-specific variance components that makes no assumption about the variances across genes with 500 random permutations to estimate the p-values. The q-value package in R was used for determining the false discovery rate (FDR). SAM provided by TMEV was also used for data analysis.
The microarray experiment was performed with two serotypes of wild type E. coli and their adhE mutants: (1) K-12 strain, wild type; (2) B strain, wild type; (3) BW25113, adhE mutants; (4) BL21(DE3), adhE mutants.
The MiSeq Reporter MiSeq Reporter 2.4.60.8 was used for basecalling and demultiplexing
The normalized data can be found on the series record in the file \
The number of R1 reads mapping to each gene were counted using HTSeq 0.6.0
The number of reads at each position in the genome was counted using in-house Python scripts.
The number of reads mapping to each gene was counted and normalized using EdgeR.
The number of reads overlapping each gene was recorded and normalized based on reads per kilobase per million (RPKM) uniquely mapped reads.
The number of sequence reads that aligned to features in annotation file (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf from http://bacteria.ensembl.org) were tabulated from the resulting SAM alignment files using the HTSeq-count program (Anders et al., 2015, Bioinformatics) with intersection non-empty mode.
The number read pairs mapped to each gene was counted with HTSeq 0.6.1
The numbers of 4 bases A, T, G, C, and N were counted in each position of the mapped reads by using the program  SAMtools 0.1.18 with supplemental use of a Perl script.
Theobald, U., Mailinger,W., Baltes, M., Rizzi, M., Reuss, M., 1997. In vivo analysis of metabolic dynamics in Saccharomyces cerevisiae. 1. Experimental observations. Biotechnol. Bioeng. 55, 305–316.
The obtained reads were aligned  and mapped to the pPR9 plasmid DNA sequences using   Bowtie 0.12.7.
The optical density was measured every 30 min and expression of the heterologous sigma factor was induced with 1mM IPTG at an optical density of 0.1. Samples for RNA extractions (1ml) were taken after 4.5, 6 and 9 hours after induction. Cell pellets were stored at -80°C until total RNA extraction was performed.
The overnight culture (0.25 ml) was used to inoculate 25 ml of fresh LB medium. After incubation at 30°C with shaking (250 rpm) to OD600 0.5, 100 uM AI-2 was added in. after further 3-h incubation, 2.0 ml of cell culture was removed and cells were pelleted and frozen in -80C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
The overnight culture (0.25 ml) was used to inoculate 25 ml of fresh LB medium. After incubation at 30°C with shaking (250 rpm) to OD600 0.5, no AI-2 was added in. after further 3-h incubation, 2.0 ml of cell culture was removed and cells were pelleted and frozen in -80C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
The overnight culture (0.25 ml) was used to inoculate 25 ml of fresh LB medium. After incubation at 30°C with shaking (250 rpm) to OD600 4.0, 2.0 ml of cell culture was removed and cells were pelleted and frozen in -80C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
The overnight culture (0.25 ml) was used to inoculate 25 ml of fresh LB medium. After incubation at 37°C with shaking (250 rpm) to OD600 0.5, 100 uM AI-2 was added in. after further 3-h incubation, 2.0 ml of cell culture was removed and cells were pelleted and frozen in -80C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
The overnight culture (0.25 ml) was used to inoculate 25 ml of fresh LB medium. After incubation at 37°C with shaking (250 rpm) to OD600 0.5, no AI-2 was added in. after further 3-h incubation, 2.0 ml of cell culture was removed and cells were pelleted and frozen in -80C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
The overnight culture (0.25 ml) was used to inoculate 25 ml of fresh LB medium. Planktonic cells were grown to a turbidity of 0.5 at 600 nm in LB medium with 1 mM IPTG at 37 °C, adjusted the turbidity to 1, and exposed to 20 μg/mL ampicillin with 1 mM IPTG for 1 h.  Cells were isolated by centrifuging at 0°C, and RNALater buffer (Ambion, Cat# AM7021) was added to stabilize RNA during the RNA preparation steps.  After breaking the cells with a bead beater, the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
The overnight culture (0.25 mL) was used to inoculate 25 mL of fresh LB medium. Planktonic cells were grown to a turbidity of 0.5 at 600 nm in LB medium with 1 mM IPTG at 37 °C, adjusted the turbidity to 1, and exposed to 20 μg/mL ampicillin with 1 mM IPTG for 1 h.  Cells were isolated by centrifuging at 0°C, and RNALater buffer (Ambion, Cat# AM7021) was added to stabilize RNA during the RNA preparation steps.  After breaking the cells with a bead beater, the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104).
The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB glu medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) for forming biofilm. After incubation for 15 h at 37°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB glu medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) for forming biofilm. After incubation for 15 h at 37°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104).
The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium. After incubation at 30°C with shaking (250 rpm) for 7 hours, 2.0 ml of cell culture was removed from suspension part and cells were pelleted and frozen in -80C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) and 1 mM indole for forming biofilm. After incubation for 7 h at 30°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104).
The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) and DMF for forming biofilm. After incubation for 7 h at 30°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) and DMF for forming biofilm. After incubation for 7 h at 30°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104).
The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) and DMF for forming biofilm. After incubation for 7 h at 37°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) and with 100 uM indole for forming biofilm. After incubation for 7 h at 30°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) and with 100 uM indole for forming biofilm. After incubation for 7 h at 37°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
“The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) for forming biofilm. After incubation for 15 h at 37°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104).
The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) for forming biofilm. After incubation for 15 h at 37°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) for forming biofilm. After incubation for 24 h at 37oC with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0oC. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0oC. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104).
The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) for forming biofilm. After incubation for 7 h at 30°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) for forming biofilm. After incubation for 7 h at 37°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104).
The overnight cultures of bacteria in LB broth were refreshed with the ratio of 1:100 into fresh LB broth, and incubated at 30℃ with continuous shaking until the absorbance at 590 nm reached 0.5 to 0.6.
The overnight culture was used to inoculate 25 ml of fresh LB medium. After incubation for OD600=0.5 at 37oC under 2 mM IPTG with shaking (250 rpm), the planktonic cells were quickly removed and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104).
The overnight culture was used to inoculate 25 ml of fresh LB medium. After incubation for OD600=0.5 at 37oC with shaking (250 rpm), the planktonic cells were quickly removed and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104).
The overnight culture was used to inoculate 25 ml of fresh LB medium. After incubation for OD600=0.8 at 37oC with shaking (250 rpm), adding 0.5% L-arabinose and incubated for 24 h
The parent strain, AG102, was previously derived from AG100 (K-12).  AG102 is drug hyper-resistant due to a mutation in marR (marR1) which increases expression of MarA, a global regulator, which in turn results in overexpression of the AcrAB-TolC multidrug efflux system.
The pCA24N,-gfp/DA4201 cultures and two cultures each of Svi3-3 comp. (recoded Svi3-3)/DA4201 and pORF1/DA4201 were supplemented by 50 μM IPTG. The cells were grown to OD 0.15-0.2 and cells were withdrawn for RNA extraction and whole cell proteomics.
The pre-culture was the overnight propagated cells in 5 ml of LB medium at 37ºC and 180 rpm. The main bacterial culture was prepared by 1% inoculation from pre-culture when optical densities at 600 nm (i.e., OD600) reached 0.7. Growth was achieved in 50 ml of LB medium.
The probe intensity data  was analyzed using Genetraffic software (Iobion Informatics LLC, La Jolla, CA, USA). The probe intensity data was normalized using GC-RMA algorithm.
The processed data file (csv) includes information about genomic position, reference/non-reference bases, read count, the fraction of 3’ RNA end, DNA strand (+/-), gene name, and mapping/base qualities in transcriptional pause sites that are defined by the parameters P(0.9,100).
The processed data file (csv) includes information about genomic position, reference/non-reference bases, read count, the fraction of 3’ RNA end, DNA strand (+/-), gene name, and mapping/base qualities in transcriptional pause sites that are defined by the parameters P(0.9, 160).
The processed gene expression data in log10 scale are provided in the supplementary file \
The program Rockhopper (described in Mc Clure, et al. Nucleic Acids Research. 2013, 41(14)) was used for alignment, normalization, and quantification. Genome_builg: K-12 subst. MG1655 genome (NC_000913.3)/ASM584v1
The program used to generate the bed/bar files is “Affymetrix Tiling Analysis Software.” Standardized signals, for each probe in the arrays, were generated using the MAT software (Johnson WE et al. 2006), which provides a model-based, sequence-specific, background correction for each sample. A gene-specific score was then calculated for each gene by averaging all MAT scores (natural log) for all probes under the annotated gene coordinates. Gene annotation was from the ASAP database (Glasner JD et al. 2003) at the University of Wisconsin-Madison, for E. coli K-12 MG1655 version m56. Differences of two log scale values in the absence or presence of D-galactose were calculated in galT mutant cells.  Finally, the transcriptome results (log scale values) with or without D-galactose were compared graphically [References: Johnson WE, et al. (2006) Model-based analysis of tiling-arrays for ChIP-chip. Proc Natl Acad Sci USA 103:12457–12462; Glasner JD, et al. (2003) ASAP, a systematic annotation package for community analysis of genomes. Nucleic Acids Res 31:147–151]
The quality and quantity of rRNA-depleted RNA was assessed on a 2100 Bioanalyzer RNA pico chip (Agilent Technologies) using manufacturer’s recommendations. Next generation sequencing (NGS) libraries were prepared using the Kapa biosystems NGS stranded library prep kit for RNA-Seq with dual indexed Illumina adapters. The mode library insert size was ~150 bp, as determined by high sensitivity NGS fragment analysis kit for Fragment Analyzer™ (Advanced Analytical Technologies) using manufacturer’s instructions. Quantification of each library was done by qPCR and all 30 libraries were pooled in equal concentrations.
The quality of reads was assessed by using FastQC (Andrews S, 2010) and any reads with a quality score ≤  Q28 were trimmed using Trim Galore! (Krueger F, 2013 ).
The quality of sequencing data was assessed using FastQC, (V11.2) before the reads were trimmed using Trimmomatic (V0.33).
The raw data output (XSEQ files) from the SOLiD 4 Genetic Analyzer System are passed through the ABI Sequence Accuracy Enhancement Tool (SAET)
The raw data (.pair file) was subjected to per channel quantile normalization (Bolstad et al. Bioinformatics 19(2):185), IP/mock-IP ratio computation and enriched region identification as implemented in the NimbleScan software package, version 2.4.27 (www.nimblegen.com).
The raw data (.pair file) was subjected to RMA (Robust Multi-Array Analysis; Irizarry et al. Biostatistics 4(2):249), quantile normalization (Bolstad et al. Bioinformatics 19(2):185), and background correction as implemented in the NimbleGen Deva software, version 1.2 (Roche NimbleGen, Inc.).
The raw data (.pair file) was subjected to RMA (Robust Multi-Array Analysis; Irizarry et al. Biostatistics 4(2):249), quantile normalization (Bolstad et al. Bioinformatics 19(2):185), and background correction as implemented in the NimbleScan software package, version 2.4.27 (Roche NimbleGen, Inc.).
The raw data were normalized using a space and intensity-dependant LOWESS program. Data from faint spots were removed, in which the intensity was lower than the average intensity plus 2 standard deviations of the negative controls on the array. For each experimental and control sample, amplification and hybridization were performed by a dye-swap strategy in two independent experiments. Differentially expressed genes were identified with at least 2 fold changes and q<0.001 criteria using SAM software .
The raw pair data (.txt file) was subjected to per channel quantile normalization (Bolstad et al. Bioinformatics 19(2):185), IP/mock-IP ratio computation and enriched region identification as implemented in the NimbleScan software package, version 2.4.27 (www.nimblegen.com).
The raw reads were filtered for removing dirty raw reads which contain adapters, unknown or low quality bases.
The reads were processed using BWA software.
The remaining reads were aligned to genome using Bowtie v.0.12.0 allowing for one mismatch and reads aligning in more than one position in the genome were discarded
The remaining reads were aligned using Bowtie v0.12.7 against E. coli MG1655 genome using parameters -v1 -m2 -k1.
The resulting reads were mapped to the reference genome of Escherichia coli str. K-12 substr. MG1655 using Tophat2 using the following parameters, --GTF --library type fr-secondstrand
The ribosome footprints and fragmented mRNA were ligated to miRNA cloning linker-1 (IDT) using truncated T4 RNA ligase 2 K227Q. The ligated RNA fragments were reverse transribed using the primer 5Phos/GATCGTCGGACTGTAGAACTCTGAACCTGTCGGTGGTCGCC GTATCATT/iSp18/CACTCA/iSp18/CAAGCAGAAGACGGCATACGAATTGATG GTGCCTACAG. The resulting cDNA was circularized with CircLigase (Epicentre) and PCR amplification was done as described previously (Ingolia et al., 2009).
The RNA extraction from the samples was performed by Qiagen RNeasy Mini Kit with DNAse treatment (Cat.No. 74004) as per manufacturer’s protocol.
The RNA-Seq library was constructed with TruSeq RNA Preparation Kit.
The RNAs were chemically fragmented using RNA Fragmentation Reagents (Ambion) to the size range of 200-250 bp using 1x fragmentation solution for 5 minutes at 70°C (Ambion).  Double stranded cDNA was generated using the SuperScript Double-Stranded cDNA Synthesis Kit (Invitrogen) following the manufacturer’s protocol.  The Illumina Paired End Sample Prep kit was used for Illumina RNA-seq library creation using the manufacturer’s instructions.  Briefly, the fragmented cDNA was end repaired, ligated to Illumina specific adapters and amplified with 10 cycles of PCR using the TruSeq SR Cluster Kit (v2).  Single-end 36 bp reads were generated by sequencing on the Illumina Genome Analyzer IIx, using the TruSeq SBS Kit (v5) following the manufacturer’s protocol.
The RNA was fragmented using Ambion’s Fragmentation Reagent at 70°C for 5 min, and collected by Zymo’s RNA columns. RNA seq libraries were prepared according to Illumna’s protocol, using NEB enzymes and barcoded adapters (Integrated DNA Technologies). The libraries were pooled and sequenced with an Illumina GA II machine (Center for Systems Biology, Harvard University).
The RNeasy Mini Kit (QIAGEN) was used to extract RNA. Quantity and quality of the samples were determined by NanoDrop (Thermo) and Bioanalyzer (Agilent Technologies), respectively
The RNeasy mini kit, with on column RNase-Free DNase I treatment, (both Qiagen, Hilden, Germany) was used for total RNA isolation (RNA ≥ 200 bases), according to the manufacturer’s protocol. RNA quality was determined by a Lab-on-a-Chip-System Bioanalyzer 2100 (Agilent, Boeblingen, Germany).
The RNeasy Mini Purification Kit (Qiagen; Valencia, CA) was used to extract total RNA from E. coli O157:H7 cultures.  RNAlater Stabilization Reagent (1.2 ml) (Qiagen; Valencia, CA) was combined with 0.6 ml E. coli O157:H7.  After 10 min at room temperature, the mixture was centrifuged at 8000 x g for 10 min under refrigeration.  The supernatant was decanted and the bacterial pellet was stored at -70°C until further processed (2-10 h).
The R package 'DESeq2' (Version 1.12.4) was used to calculate differential gene expression between the LP group and the HP group.
The R package, Ringo, was used to read the pair files and the limma package for within- and between-array normalization. ChIP-chip data were bi-weighted scaled within each array and aquantile normalized between arrays.
The sample sources of individual reads were determined by the barcoding. The barcodes for the minus and plus TAP treatments were ACTTGA and CGATGT, respectively, for the E. coli RNA, and CAGATC and ATCACG, respectively, for the S. coelicolor RNA.
The samples were sonicated for a total of 16 minutes and 50 uL protein A/G sepharose. All reactions are performed in an Eppendorf ThermalMixerR while being mixed at 1.4k x rpm. After each reaction, the sepharose was washed with 1 mL of each of the following buffers, leaving 50-100 uL buffer above the sepharose in-between each wash : 1x TE : 10mM Tris-HCl, pH 8.0 + 1 mM EDTA ; 1 x High Salt - 1M NaCl (1% Triton X-100, 50 mM HEPES, pH 8.0, 2 mM EDTA, 0.1% sodium deoxycholate and 1M NaCl) ; 1x Wash Buffer 2 (1% Triton X-100, 50 mM HEPES, pH 8.0, 2 mM EDTA, 0.1% sodium deoxycholate and 0.5M NaCl) ;1x Wash Buffer 3 (1% Triton X-100, 50 mM HEPES, pH 8.0, 2 mM EDTA, 1.0% sodium deoxycholate, 0.25 M LiCl, 1% NP-40, and 10 mM Tris-HCl, pH 8.0) ; 1x TE : 10mM Tris-HCl, pH 8.0 + 1mM EDTA.
The scanned images were analyzed using the Feature Extraction Software (Agilent) with default parameters to obtain background subtracted and spatially detrended Processed Signal intensities.
The scanned images were analyzed with Feature Extraction Software 10.5 (Agilent) using default parameters (protocol GE1_105_Dec08).
The scanned images were analyzed with Feature Extraction Software version 9.5.3.1 (Agilent) using default parameters (protocol GE1-v5_95 and Grid: 020097_D_F_20080627) to obtain background subtracted and spatially detrended Processed Signal intensities but not included the normalization process.  Features flagged in Feature Extraction as Feature Non-uniform outliers were excluded.
The scanning process of the hybridized chips included a fourteen-fold scan of each chip at different settings, altering both PMT and laser power settings. The following primary analysis served as a quantification method and is performed with the Gene Pix Pro 6.0™ (Molecular Devices, Sunnyvale, USA) software tool. 
The secondary analysis is subsequently conducted using the data from the primary analysis. Therefore, data from different scans is first searched for saturation effects, which are eliminated. A locally weighted linear regression (Lowess) has been employed as a normalization method in order to account for intensity-dependent effects. Due to the lacking gene replicates on the commercial whole genome array, a t-test could not be applied. Instead, the quotients of respectively two states have been calculated for the assessment of the regulation. A absolute value of log-ratio (to base2) higher than 1 is used as criteria for a regulated gene.
These  counts were fed into the DESeq package in Bioconductor to estimate differential expression between the mutants and the wildtype.
The sequence data were mapped against the genome sequence of E. coli K12 substr. MG1655 (NCBI accession number NC_000913.3) using Bowtie2 (Langmead and Salzberg, 2012, doi:10.1038/nmeth.1923).
The sequencing libraries were constructed using the TruSeq RNA Sample Preparation kit (Illumina Inc., USA). Each library was prepared with RNA isolated from seven E. coli cultures grown in triplicate to an exponential phase under aerobic and anaerobic conditions. RT-PCR was performed with SuperScript® II One-step RT-PCR reagents (Invitrogen, USA). The libraries were sequenced using the Illumina HiSeq2000 platform with a paired-end protocol and read lengths of 50 nt.  The final concentration of DNA and RNA was measured using a Qubit 2.0 Fluorometer (Invitrogen, USA). The integrity of total RNA, DNA contamination, removal of rRNAs and cDNA library validation were assessed with Agilent 2100 Bioanalyzer (Agilent Technologies, USA).
The signal/noise ratio for each array was calculated, for each spot and each channel, as (foreground intensity minus background intensity)/(standard deviation of the background). The raw data were normalized  using a space and intensity-dependant LOWESS program. Faint spots were removed from the data if the intensities were lower than the average intensity plus 2 standard deviations of the negative controls. The significant genes differentiating wild-type and deleting dnaK were selected based on q<0.05 and greater than twofold as criteria.
The sigPep.csv file contains the counts for each specific signal peptide fusion to each specific test gene. Entries with SP_spkA/D/G/K represent spike in control molecules used for normalization.
The Sphingomonas sp. strain NM-05 used in the study is a known degrader of γ-hexachlorocyclohexane (γ-HCH) and has been isolated from the vicinity of an industry India Pesticide Limited, Chinhat industrial area, Lucknow which is involved in manufacturing chlorinated pesticides for last 25 years. The strain was harvested in mineral salt medium with 0.34mM γ-HCH as sole source of carbon and energy. The strain Bordetella sp. strain IITR-02 used in this study has been isolated from the vicinity of the industry India Pesticide Limited, Chinhat, Lucknow and is found to be a degrader of 1,2-, 1,4-dichloro and 1,2,3- and 1,2,4-trichlorobenzene. The strain was harvested in mineral salt medium with 3.2mM of 1,2,4-trichlorobenzene as sole source of carbon and energy. The bacterium Rhodococcus sp. strain RHA1 which is a known degrader of polychlorinated biphenyls, substituted phenols, benzoates and phthalates was grown on 0.2% biphenyl and 20mM of benzoate as carbon sources. The strain Escherichia coli DH5α and Escherichia coli BL21 were grown in Luria-Bertani medium and strain Escherichia coli K12  was grown in nutrient broth to an OD560nm of 0.4 at 37 degree centigrade with continuous shaking.
The Sphingomonas sp. strain NM-05 used in the study is a known degrader of γ-hexachlorocyclohexane (γ-HCH) and has been isolated from the vicinity of an industry India Pesticide Limited, Chinhat industrial area, Lucknow which is involved in manufacturing chlorinated pesticides for last 25 years. The strain was harvested in mineral salt medium with 0.34mM γ-HCH as sole source of carbon and energy. The strain Escherichia coli DH-5α was grown in Luria-Bertani medium to an O.D. of 0.4 at 37 degree centigrade with continuous shaking. The soil/sludge samples were collected in air tight vessels,transported on ice (4○C) to the laboratory and processed immediately for DNA isolation. At each sampling location multiple samples were collected from close (100m) to far (500m) from the industry, along the effluent channel and at the place where effluent channel from the industrial area falls into the river.
The strain E. coli CMCC(B) 44102, was provided by Institute of Microbiology, Chinese Academy of Sciences and preserved at the Department of Food Science and Nutrition, Zhejiang University. The strain was maintained in nutrient agar medium (NA, Hangzhou Microbiological Agents Co., Ltd., China) at 37 °C, and cultured in tryptic soy broth (TSB, Qingdao Hope Biotechnology Co., Ltd., China) at pH 7.0 and transferred every 20-24 h with incubation at 37 °C.
The strain Escherichia coli MG1655 [pPROEx-CAT] was cultured in a fed-batch fermenter in LB media w/ glucose and a glucose/MgS04 feed at 37 degrees.  Cultures were synchronized to the late log phase, approximately 4.5 hours of fermentation time.  Serine hydrxamate (100mg/L final concentration) was added to the cultures. Samples were taken 1 hour after the beginning the serine hydrxamate addition.
The strain MG1655 [pPROEx-CAT] was cultured in a fed-batch fermenter in LB media w/ glucose and a glucose/MgS04 feed at 37 degrees.  Cultures were synchronized to the late log phase, approximately 4.5 hours of fermentation time. One set of fermentations were exposed to IPTG and one set was not exposed to IPTG.  Samples were taken 0, 1, and 4 hours post-synchronization (Time S0, S1, and S4).
The strains were grown exponentially (after initiation by a 1,000-fold dilution from overnight cultures) for ~5 generations at 37°C in Vogel-Bonner (VB) minimal medium supplemented with glucose (0.4%), pantothenic acid (5 µg/ml), casamino acids (Becton-Dickenson) (1%), and hypoxanthine (50 µg/ml).
The strain was cultivated in 5L defined medium with glycerol as carbon source in a 7L (total) MBR-bioreactor. When the OD at 600 nm reached a value of around 5, the BAD – promoter was induced by adding 1g per litre and OD arabinose to the medium. Samples were taken at –10, 0, 2, 5, 10, 20, 30, 45 and 60 minutes related to point of induction.
The strain was stocked in tryptic soy broth (TSB) with 25% glycerol at -80℃, and was activated by streaking onto TSA plate and incubating at 37℃ for 24 h. And then, a single colony was picked and used to inoculate TSB and incubated at 37℃ for 12 h with shaking at 200 rpm. This overnight culture was transferred to TSB at a dilution of 1:100 and grew to the exponential phase (OD550=0.93).
The subculture was split into two 10 ml portions, one of which was treated with 6ug/ml triclosan and the other retained as an untreated control. Treated and untreated samples were incubated at 37c for 30 min.
The TAS software provides analysis capabilities specifically for the GeneChip® Tiling Arrays. TAS analyzes feature intensity data stored in GCOS output .CEL files and produces:
The total DNA to be used as target for microarray hybridization was isolated from soil/ sediment samples using the Mo Bio Power soil DNA kit (Mo Bio Inc., Carlsbad, CA, USA) as per manufacturer’s instructions. Before processing for DNA isolation, the soil/ sediments were mixed thoroughly using a mortar-pestle. One gm of soil/sediment was taken for DNA isolation, and during processing with the kit, lysozyme was added to facilitate the lysis of bacteria. The genomic DNA from pure bacterial cultures was isolated using the Wizard genomic DNA isolation kit (Promega corporation, Madison, USA) as per manufacturer's instructions. The concentration of DNA was analyzed by Nanodrop spectrophotometer (Nanodrop Technologies Inc, Rockland, USA), and quality was determined by analysis on DNA 12000 kit (Caliper Sciences, USA) using the Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA).
The total RNA extracted from Xuzhou21 and Xuzhou21m were first treated with Ribo-Zero™ rRNA Removal kit to remove rRNA. The mRNA was fragmented and produced cDNA libraries primed with random hexamers. cDNA was selected by size, amplificated using PCR and and then sent to sequencing using Illumina HiseqTM 2000 commercially.
The total RNA was extracted using an RNeasy kit, Qiagen, in accordance with the manufacturer's instructions.
The total RNA was isolated using an RNeasy mini kit (Qiagen).
The total sequencing base pair coverage for all annotated genes was summed for each sample and normalized to total coverage using bedtools and custom R scripts as described in Wu et al. 2015 PLoS Genetics Nov 6;11(11):e1005655.
The treatment condition includes adding 10 mM octanoic acid during logarithmic growth.
The trimmed reads were aligned against E. 149 coli MG1655 (GenBank: U00096.3) using bowtie2 (Version 2.2.4)
The VALUE data are normalized log2(test/ref) ratios which were normalized 'print-tip-loess' using the software R (R, 2005) and the Limma package included (Smyth, 2005). Additionally, spots, which were classified as not found by the image analysis software, were down weighted to 10%.
The value is the simple linear ratio of the processed Cy3 and Cy5 signals.
The value is the simple linear ratio of the processed Cy5 and Cy3 signals.
The values below 0.01 were set to 0.01. The log2 ratio of the intensity of signal channel to that of control channel was calculated and was then normalized to each slide’s median intensity ratio. The default interpretation mode was set to‘log of ratio’. Each time point was then tested separately for statistical differences using ANOVA at 5% confidence level, in conjunction with Benjamini-Hochberg multiple testing correction.
The web-based tool, DAVID (the Database for Annotation, Visualization, and Integrated Discovery) was used to perform the biological interpretation of differentially expressed genes. Then, these genes were classified based on the information of gene function in Gene ontology database. 
The wildtype and mutant E. coli O157:H19 strains were grown on LB agar incubated at 37c x 24h. A single isolated colony for each strain was selected and inoculated into 20 ml LB broth and incubated at 37c until growth reached an optical density of 0.6 at 600nm.
The Zymo Fungal/Bacterial RNA extraction kit was used to extract RNA from all samples. In-column DNaseI treatment was used to eliminate genomic DNA carryover as described by the manufacturer.
The ΔbolA and wt 3xflag strains were used to perform ChIP-seq experiments. Overnight cultures were diluted 1/100 in fresh LB medium and grown until OD600 0.6
Third biological repeat 37°C
Third biological repeat 50°C
Thirty-six dye-swap hybridizations were performed between four groups with six strains per group, according to a balanced double loop design.  Strains were grouped based on cladestx profiles and each strain was considered an independent biological replicate of its group (n=6).  The six strains from each group were randomly hybridized with six strains from every other group; each hybridization compared a pair of strains that differed in either clade or stx profile, or both.  Subsequent to local Lowess normalization, averaging of replicate probes and log2 transformation,  the microarray data were fitted to a 2-factor mixed ANOVA model (intensity = Array + Dye + Clade + Stx + Clade:Stx + Sample; where the biological replicate (Sample) and array effects were considered random effects, while all other effects were considered fixed effects), using the MAANOVA package (version 0.98-8) in R software (version 2.2.1).  This model allows independent consideration of the effect of ‘Clade’ (clade divergence) and ‘Stx’ (stx type variation) parameters on differences in gene expression among O157:H7 strains, as well as their interaction (combined) effect (Clade:Stx).  Overall differences in gene expression between groups were determined using the Fs test, followed by pair-wise contrasts to determine significant differential expression between each pair of groups.  Subsequently, the Fs statistic was estimated for the ‘Clade’ effect to determine significant differences in gene expression between clades 8 (n=12) and 2 (n=12), regardless of stx profile.  Similarly, the Fs statistic was estimated for the ‘Stx’ effect as well as the ‘Clade:Stx’ interaction effect to examine the combined effect of clade and stx type on differences in gene expression among O157:H7 strains.  In other words, this analysis will determine whether the expression of any given gene among groups with different stx types is also dependent on clade.  An interaction effect would be observed if expression estimates between strain groups clade8stx2 and clade2stx2 are different from expression estimates between strain groups clade8stx2,2c and clade2stx1,2.  For every analysis, 1000 permutations of the data were performed to generate P values; estimates were considered significant if the P value was < 0.05 after adjusting for multiple comparisons. 
three different concentrations, without H2O2, 10% (v/v) or 30% H2O2 were added directly to the cell cultures of wild type or luxS mutants, OD of which is 1.0. Treated samples were continuously incubated at 30 degree Celcius for 30min
Threonine addition
Thymidine addition
time: 0-15h
time: 0-16h
time: 0-2h
time: 0.5 min
time: 0 min
time: 0 mins
time: 10min
time: 10 min
time: 10 mins
time 10 (OD600=4.7)
time 11 (OD600=4.8)
time: 120min
time: 120 minutes
time: 12 h
time: 180 minutes
time: 195 min
time: 1 h with 20 μg/mL ampicillin
time: 1 min
time: 1 min post-infection
time 1 (OD600=0.1)
time: 20min
time: 20 min
time: 20 minutes (t2) after treatment
time: 210min
time: 24 h
time: 25h
time: 25min
time: 2.5min
time: 2.5 min
time: 2.5 mins
time: 26h
time: 28h
time: 2 min
time 2 (OD600=0.3)
time: 300 minutes
time: 30 min
time: 30 mins
time: 330min
time 3 (OD600=0.4)
time: 40min
time: 40 min
time: 40 minutes (t3) after treatment
time: 420 minutes
time: 45min
time 4 (OD600=0.6)
time: 5min
time: 5 min
time: 5 min post-infection
time 5 (OD600=1.0)
time: 60 min
time: 60 minutes
time: 6 h
time 6 (OD600=1.3)
time: 75min
time: 7 hours
time: 7 mins
time 7 (OD=1.7)
time 7 (OD600=1.7)
time: 80min
time: 80 min
time 8 (OD=2.7)
time 8 (OD600=2.7)
time: 9 min post-infection
time 9 (OD600=4.5)
time: at time of treatment (t1)
time course sample harvested after 15 min of glucose to acetate shift
time course sample harvested after 1 hour of glucose to acetate shift
time course sample harvested after 2 hour of glucose to acetate shift
time course sample harvested after 30 min of glucose to acetate shift
time course sample harvested after 3 hour of glucose to acetate shift
time course sample harvested after 4 hour of glucose to acetate shift
time course sample harvested after 5 hour of glucose to acetate shift
time course sample harvested after 5 min of glucose to acetate shift
time course sample harvested after 6 hour of glucose to acetate shift
time induction: 30 minutes
time induction: 5 minutes
time induction: 60 minutes
time point 0
time point: 0
time point: 0min
time point: 0 min
time point: 0 minutes related to point of BRP induction
time point: 10 min
time point: -10 minutes related to point of BRP induction
time point: 10 minutes related to point of BRP induction
time point: 135 min
time point: 15 min
time point: 168 hours
time point: 180 min
time point: 1 min
time point 2
time point: 20 min
time point: 20 minutes related to point of BRP induction
time point: 24 hours
time point: 2 min
time point: 2 minutes related to point of BRP induction
time point: 30min
time point: 30 minutes related to point of BRP induction
time point: 336 hours
time point: 3 hours
time point 4
time point: 4.5 hrs after induction
time point: 45 min
time point: 45 minutes related to point of BRP induction
time point: 48 hours
time point: 4 hours
time point: 4 min
time point: 5 hours
time point: 5 minutes related to point of BRP induction
time point 6
time point: 60 minutes related to point of BRP induction
time point: 6 hours
time point: 6 hrs after induction
time point: 6 min
time point 8
time point: 8 hours
time point: 8 min
time point: 90min
time point: 90 min
time point: 9 hrs after induction
time point (minutes): 0
time point (minutes): 15
time point (minutes): 30
time point (minutes): 5
Time-point samples were taken every 15-30 minutes from 15 minutes to 2 hours post treatment.
time point: time0
time point: time10
time point: time20
time point: time2.5
time point: time5
time point: time7.5
time post-induction: 0h
time post-induction: 10h
time post-induction: 16h
time post-induction: 20h
time post-induction: 5h
time post-induction: 6h
time post-induction: 8h
time post release: E. coli cells 1 hour following release from Stationary phase  (t=1)
time post release: E. coli cells 2 hour2 following release from Stationary phase  (t=2)
time post release: E. coli cells immediately following release from Stationary phase  t=0
time: Sample was taken after mouse was on the diet for 14 days.
time: Sample was taken after mouse was on the diet for 1 days.
time: Sample was taken after mouse was on the diet for 2 days.
time: Sample was taken after mouse was on the diet for 4 days.
time: Sample was taken after mouse was on the diet for 6 days.
time: Sample was taken after mouse was on the diet for 7 days.
tissue: bacterial cells
tissue: entire bacterial cell
tissue source: kidney from CD-1 mice
TLD-15-rep1
TLD-15-rep2
TLD-30-rep1
TLD-30-rep2
TLD-45-rep1
TLD-45-rep2
TLD-60-rep1
TLD-60-rep2
TLD-90-rep1
TLD-90-rep2
TLM-15
TLM-30
TLM-45
TLM-60
TLM-90
tnaA2trpA46PR9 vs. tnaA2, W3110 min
tnaA2trpA46PR9, W3110 min , 30 ug total
tnaA2trpR2 vs. tnaA2, W3110 min +Trp 50ug/ml
tnaA2trpR2, W3110 min +Trp 50ug/ml, 30 ug total
tnaA2,W3110 min,30 ug total
tnaA2,W3110 minimal +Trp 50ug/ml, 25 ug total RNA
tnaA2,W3110 minimal +Trp 50ug/ml vs. dnaC genomic DNA
tnaA2,W3110 min +Trp 50ug/ml, 30 ug total
To analyze RNAP pausing on the E. coli chromosome, we counted the number of reads at every genomic nucleotide position using the mpileup command of SAM tools v0.1.18 with –A –B parameters. Pausing sites were defined P(φ, δ), where φ is the minimal fraction of having 3’ RNA ends in the mapped reads and δ is the minimal read depth for any genomic position. We chose δ to be 100 for WT and 160 for ΔgreAB, which normalized these respective numbers for each strain since there were 1.6-fold more total reads in the ΔgreAB strain. The high φ parameter allowed us to define a reliable pause-inducing element for WT or ΔgreAB cells.
To apply the second approach variable in length reads from Illumina MiSeq were first trimmed from both sides to obtain a set of standard 50 nt sequences taken from the middle of longer reads. Reads shorter than 50 nt were discarded. Then, all four sets from both experiments were aligned to the genome using the Matcher program (available at: http://www.mathcell.ru/DnaRnaTools/Matcher.zip). This software maps only 5’-ends if the reads correspond to the top strand of genomic DNA, or only 3’-ends, if they are aligned to the bottom strand. As such, the signals from fully complementary reads will match the same (left) position. Reporting the distribution of matching reads across the genome the program also evaluates reads with multiple occurrence and their positions.
To capture target protein binding sites corresponding genomic position of mapped reads start position (MRSP) was counted and stored for visual inspection using in-house scripts.
To enrich mRNAs and other transcripts, majority of rRNAs were removed from the DNase-treated total RNA using a MICROBExpress kit (Ambion) following the manufacturer’s instructions.
To generate Illumina-compatible sequencing libraries for each sample, molecular indexes were added to each library, allowing samples to be pooled and sequenced on the Illumina HiSeq 2500 with a 1 x 50 bp single-end configuration. More than 250 million reads were generated per sample, and at least 80% bases had quality scores above Q30.
To harvest total RNA samples, overnight cultures of wild type MG1655 grown in LB at 37˚C were diluted back 1:500 in either fresh LB or M63 minimal glucose medium and allowed to grow until the cultures reached an OD600 of ~ 0.4 and 2.0 for cultures grown in LB and an OD600 of ~0.4 for cultures grown in M63. For samples grown to OD600 of ~0.4 a total volume of 25 ml of cells were harvested and combined with 5 ml of stop solution (95% Ethanol, 5% acid phenol). For samples grown to OD600 of 2.0 a total volume of 5 ml of cells were harvested and combined with 1 ml of stop solution.
To infer the tag copy numbers in each Tag-Seq library, all sequence reads were examined, regardless of their quality scores. If the first ten nucleotides of a read perfectly matched one of the 13,000 or 27,000 designed tags and the remaining nucleotides matched the expected upstream MPRA construct sequence, this was counted as one occurrence of that tag. All reads that did not meet this criterion were discarded.
To lyse the cells, 1.0 mL RLT buffer (Qiagen, Inc., Valencia, CA) and 0.2 mL 0.1 mm zirconia/silica beads (Biospec) were added to the frozen bead beater tubes containing the cell pellets. The tubes were closed tightly and beat for 50 seconds at the maximum speed in a mini bead beater (cat. no. 3110BX, Biospec). The total RNA was isolated by following the protocol of the RNeasy Mini Kit (Qiagen) including an on-column DNase digestion with RNase-free DNase I (Qiagen). 
To obtain the absolute expression levels of genes from microarray raw data, we used the Finite Hybridization model (Furusawa et al, 2009; Ono et al, 2008).
To prepare the in vitro samples, APEC strain E058 was grown statically at 37 °C in 10 mL of LB broth until the absorbance at 600 nm (A600) reached 0.4. To prepare the in vivo samples, the bacteria was harvested from cardiac blood  in 1-day-old chickens at 5 hours post infection.
To prepare the in vivo samples, the bacteria was harvested from cardiac blood  in 1-day-old chickens at 5 hours post infection.
To remove contaminating sequences, the reads were split according to the HinfI consensus motif (5’-  G^ANTC-3’) considered as a barcode sequence using fastx_toolkit  (http://hannonlab.cshl.edu/fastx_toolkit/) (fastx_barcode_splitter.pl --bcfile barcodelist.txt --bol --  exact). Most of the reads (more than 90%) were rejected, and the reads kept were remapped to the  reference genomes with bwa mem and samtools to generate a sorted bam file.  The bam file was further filtered to remove low mapping quality reads (keeping AS >= 45) and split  by orientation (alignmentFlag 0 or 16) with bamtools. The reads were counted at 5' positions  using Bedtools (bedtools genomecov -d -5). Both orientation count files were combined into a  bed file at each identified 5’-GANTC-3’ motif (where reverse counts >=1 at position N+1 and forward  counts >=1 at position N-1) using a home-made PERL script. The HinfI positions in the bed file were  associated with the closest gene using Bedtools closest and the gff3 file of the reference genomes  . The final bed file was converted to an MS Excel sheet (S1 and S2 Tables) with a homemade  script. For the MboI-based REC-Seq, the strategy was identical except that a different adaptor was  used for ligation after cleavage and the MboI consensus motif (5’-^GATC-3’) was used as barcode for  filtering of V. cholerae O1 biovar El Tor and E. coli K12 Ec100D gDNA mapped onto the  MG1655 genome.
To study gene expression,  28 days old E.coli cells were grown in the presence of LB broth and LB broth supplemented with 10% v/v glycerol.
To study gene expression in the presence and absence of glycerol, LB was supplemented with 10% (v/v) glycerol. Medium without glycerol served as a control.
Total cellular RNAs were extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturers protocol. Residual DNA in the fractions was digested by addition of 27 Kunitz units Dnase I (Qiagen), and absence of DNA verified by Polymerase chain reaction (PCR). mRNA enrichment was conducted using the Ribo-Zero kit for Gram-negative bacteria (epicentre). RNA quality control of the RNA extracts, as well as the successful mRNA enrichment, was conducted by using an Agilent 2100 Bioanalyzer.
total DNaseI treated RNA was depleted of ribosomal RNA using the Ribo-Zero™ RNA removal kit for Gram-negative bacteria (Epicentre). A 3' RNA adapter, based on the Illumina multiplexing adapter sequence (Oligonucleotide sequences © 2007-2014 Illumina, Inc. All rights reserved) blocked at the 3' end with an inverted dT (5'-GAUCGGAAGAGCACACGUCU[idT]-3'), was phosphorylated at the 5' end using T4 PNK (New England Biolabs) per the manufacturer’s protocol. The 3' RNA adapter was ligated to the 3' ends of the rRNA depleted RNA using T4 RNA ligase I (New England Biolabs). 1.5 mg of RNA was incubated at 20°C for 6 hours in 1X T4 RNA ligase reaction buffer with 1 mM ATP, 30 µM 3' RNA adapter, 10 % DMSO, 10 U of T4 RNA ligase I, and 40 U of RNasin (Promega) in a 20 ml reaction. RNA was then fragmented in equivalents of 100 ng using the RNA fragmentation reagents (Ambion®) per the manufacturer’s protocol at 70°C for 3 min and subsequently phosphorylated at the 5' ends using T4 PNK (New England Biolabs) per the manufacturer’s protocol to allow for ligation of the 5' adapter. RNA was size-selected (≈ 150-300 nt) and purified over a denaturing 8 % polyacrylamide/8 M urea/TBE gel. Gel slices were incubated in RNA elution buffer (10 mM Tris-HCl, pH 7.5, 2 mM EDTA, 0.1 % SDS, 0.3 M NaOAc) with vigorous shaking at 4°C overnight. The supernatant was subsequently ethanol precipitated using glycogen as a carrier molecule. The Illumina small RNA 5' adapter (5'-GUUCAGAGUUCUACAGUCCGACGAUC-3') was ligated to the RNA as described before except the concentration of the adapter was 52 mM and 20 U of T4 RNA ligase I was used in total volume of 25 µl. The ligated RNAs were size-selected (≈ 200-300 nt) and gel-purified over a denaturing 8 % polyacrylamide/8 M urea/TBE gel (as described above). The di-tagged RNA libraries were reverse-transcribed with SuperScript®II reverse transcriptase (Invitrogen) using random nonamers per the manufacturer’s protocol. RNA was removed using RNase H (Promega) per the manufacturer’s protocol and cDNA was amplified in PCR carried out using Phusion® High-Fidelity Polymerase (New England Biolabs). cDNA was amplified with modified designed Illumina-compatible PCR primers (3’ library Forward 5’-CAAGCAGAAGACGGCATACGACAGGTTCAGAGTTCTACAGTCCGA-3’; Reverse 5’-AATGATACGGCGACCACCGAGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3’) by 18 cycles of PCR. The products were purified using Agencourt AMPure XP beads (Beckman) and analyzed on an Agilent 2100 Bioanalyzer. 3’ end enriched cDNA libraries were sequenced on individual Genome Analyzer IIx lanes (36 bp, single-end) or on HiSeq 2000 lanes (50 bp, single-end) using primer based on Illumina Multiplexing Read 2 Sequencing Primer (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3’) at the CSF NGS unit http://csf.ac.at/.
Total DNA was extracted from three human faecal samples using  Qiagen’s DNA Stool Kit (Qiagen, West Sussex, UK). Total genomic DNA was extracted from pure bacterial cultures using DNeasy Blood and Tissue Kit (Qiagen, West Sussex, UK). 10ng of sample was then used for PCR amplification. 16S rRNA genes were amplified using universal primers 27F (AGAGTTTGATCMTGGCTCAG) and 1492R (TACGGYTACCTTGTTACGACT). PCR reactions were performed in a 50µl volume, using DreamTaq DNA polymerase (Fermentas, St. Leon-Rot, Germany). The PCR reaction consisted of an initial denaturation step at 95°C for 5min followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 40 s and elongation at 72°C for 2 min. A final extension step was performed at 72°C for 5 min. PCR product size was verified by electrophoresis with 1% (w/v) agarose gel and were purified using the MinElute PCR Purification Kit (Qiagen Ltd., UK) following manufacturer’s instructions and stored at -20°C.
Total mRNA isolated from each cell culture was treated with Terminator 5' Phosphate Dependent Exonuclease (Epicentre) to enrich 5' tri-phosphorylated mRNAs. Intact tri-phosphorylated RNAs were then treated with RNA 5'-Polyphosphatase (Epicentre) to generate 5'-end monophosphorylated RNA for ligation to RNA adaptors. cDNAs were synthesized using the adaptor-ligated mRNAs as template using a modified small RNA RT primer from Illumina and Superscript II Reverse Transcriptase (Invitrogen). The cDNA samples were amplified, and size fractionated from 100 to 300 bp.
Total RNA (2ug) was subjected to rRNA depletion using Ribozero rRNA removal kit – Bacteria (Epicenter, illumina). rRNA-depleted RNA was purified using Ampure XP beads. Purified RNA was then fragmented using RNA Fragmentation Reagents (Ambion) at 70C for 2mins, targeting fragments ranging from 200-300bp. Fragmented RNA was then purified using Ampure XP beads (Agencourt). Reverse transcription was performed using SuperScript II Reverse Transcription (Invitrogen) with an initial annealing of random hexamers (Fermentas) at 65C for 5mins, follow by an incubation of 42C for 50mins and an inactivation step at 70C for 10mins. cDNA was then purified with Ampure XP beads. This was followed by second strand synthesis using dNTP mix where dTTP is replaced by dUTP. Reaction was performed at 16C for 1h. Double stranded cDNA fragments were purified and selected for targeted fragments (200-300bp) using Ampure XP beads. The dscDNA were then blunt-ended, the 3' ends were adenylated with a single A, and ligated with library adapters using Kapa Library Amplification Kit (Kapa Biosystems). Adapter-ligated DNA was purified using Ampure XP beads. Digestion of dUTP was then performed using AmpErase UNG (Applied Biosystems) to remove second strand cDNA. Digested cDNA was again cleaned up with Ampure SPRI beads. This was followed by amplification by 10 cycles of PCR using Kapa Library Amplification Kit (Kapa Biosystems). The final library was cleaned up with Ampure SPRI beads. Sequencing was done on the Illumina HiSeq platform generating paired end reads of 100bp each. Note: Target fragments here refers to the insert only, that is the cDNA.  The actual size we use in selection will be larger, typically the target fragment size + 125bp adaptors (~300-450bp).
Total RNA extracted from Rho prion-containing cells
Total RNA extracted from Rho prion-lacking cells
Total RNA extracted using Qiagen RNEASY kit according to directions
Total RNA extracted using QIAGEN RNeasy kit according to manufacturer's instructions
Total RNA extracted using RiboEX reagent (GeneAll, Korea), treated with Dnase, and purified using the Rneasy Mini kit (Qiagen, Germany) according to the manufacturer's instructions.
Total RNA extracted using RNAprotect Bacterial Reagent (Qiagen) and an RNeasy Mini kit (Qiagen).
total RNA extracted using Trizol Extraction Protocol
Total RNA extracted using Trizol following manufacturer's instructions
Total RNA extraction using Vantage™ RNA Purification Kit (Origene, Rockville, MD, USA) was performed according with the manufacter instructions.  Purity and concentration of isolated RNA were assessed in a NanoDrop One spectrophotometer (Thermo Scientific Incorporated, WI, USA). Quality was evaluated by microfluidic capillary electrophoresis on an Agilent 2100 Bioanalyzer (Agilent Technologies, Inc, USA).
Total RNA extraction was carried out based on the protocols given in the manual of QIAGEN - RNAprotect Bacteria Reagent Handbook, QIAGEN - RNeasy Mini Kit and QIAGEN - RNase-free DNase set. The concentration of each RNA sample was measured by Qubit® RNA BR Assay Kit (Invitrogen).
Total RNA extraction was done using TRIzol reagent and DNAse digested. RNA purfication was carried out using Rneasy spin columns
Total RNA from 8.1*10exp9 cells was isolated using the RNeasy Kit (Qiagen) according to the manufacturer’s protocol. On-column DNase digestion was performed (RNase free DNase set, Qiagen). RNA concentration and quality were assessed photometrically (Nanodrop ND 1000, NanoDrop Technologies, Inc., Delaware, USA), by formaldehyde gel electrophoresis and bioanalyzer analysis (RNA 6000 Nano LabChip Kit, Agilent Bioanalyzer 2100, Agilent Technologies, California, USA). Only RNA with 260 nm / 280 nm ratio of 1.8 - 2 as well as 260 nm / 230 nm ratio > 1.8 was used for precipitation. The RNA was precipitated and resolved at the final concentration of 6 µg / µl required for reverse transcription and labeling with fluorescent dyes. Total RNA isolate was mixed with 1/10 volume of NaCl solution (3 M) and 2 volumes of ethanol (100 %) and stored at -20 °C overnight. The samples were subsequently centrifuged (14000 rpm; 20800 g) and the supernatant was discarded. The RNA was washed with ethanol (70 %) and vacuum dried. 100 µg of RNA were used for reverse transcription.
Total RNA from bacterial culture
Total RNA from both the in vitro and in vivo samples of APEC E058 was extracted with the RNAiso Plus kit (Takara, Dalian, China) and further purified with NucleoSpin RNA Clean-up (Macherey-Nagel, Germany), according to the manufacturers’ instructions.
Total RNA from cells of the microemulsion-treated E. coli was extracted in duplicate using an RNAiso Plus (Cat. # 908, Takara, Japan) according to the manufacturer’s instructions,
Total RNA from in vivo samples of APEC E058 and E058ΔrstAB was extracted and purified using RNeasy mini kit (Cat#74106, QIAGEN, GmBH, Germany) following the manufacturer’s instructions.
Total RNA is extracted from 10^9 cells by phenol-chloroform extraction according to Sambrook et al. and ethanol precipitation with 5M NaCl. Subsequently a DNAse I digest at 37°C for 30 minutes and an additional phenol-chloroform extraction step is performed. Integrity of the total RNA is electrophoretically confirmed using the Agilent 2100 Bioanalyzer. 
Total RNA is extracted from 10^9 cells by phenol-chloroform extraction and ethanol precipitation with 5M NaCl. Subsequently a DNAse I digest at 37°C for 30 minutes and an additional phenol-chloroform extraction step is performed. Integrity of the total RNA is electrophoretically confirmed using the Agilent 2100 Bioanalyzer. 
Total RNA isolated from E. coli
Total RNA isolation was performed using the RNeasy Protect Bacteria system from Qiagen.
Total RNA samples were isolated using RNAzol RT (Molecular Research Center) by following manufature's instructions. Contaminating DNA was   removed from RNA samples by DNase I digestion using the TURBO DNA-free kit (Ambion).
Total RNA samples were purified using the Qiagen RNeasy kit (Chatsworth, CA) according to the manufacturer’s protocol.
Total RNA-seq 20 min after shift to 10°C in ∆rnr cells
Total RNA-seq 20 min after shift to 10°C in WT cells
Total RNA-seq 4 hr after shift to 10°C in ∆rnr cells
Total RNA-seq 4 hr after shift to 10°C in WT cells
Total RNA-seq 8 hr after shift to 10°C in ∆rnr cells
Total RNA-seq 8 hr after shift to 10°C in WT cells
Total RNA-seq after rifampicin treatment -- 4 hr after shift to 10°C in ∆rnr cells
Total RNA-seq after rifampicin treatment -- 4 hr after shift to 10°C in WT cells
Total RNA-seq before rifampicin treatment -- 2 hr after shift to 10°C in ∆rnr cells
Total RNA-seq before rifampicin treatment -- 2 hr after shift to 10°C in WT cells
Total RNAs from two biological replicate, each with two technical replicates were extracted using the Total RNA Purification Kit (Norgen Biotek, UK) according to the manufacturer’s protocol with the addition of 1 mg/ml lysozyme for cell lysis.
Total RNAs were extracted from the bacterial isolates using TRIzol
Total RNAs were extracted using an RNeasy mini kit (Qiagen) in accordance with the manufacturer’s instructions.
Total RNAs were extracted using RNeasy mini kit (Qiagen, #74104) following manufacture's instruction
Total RNAs were isolated using TRIzol reagent, followed by clean-up and DNase I treatment with QIAGEN RNeasy mini kit. Illumina TruSeq RNA Sample Prep Kit (Cat#FC-122-1001) was used for the construction of sequencing libraries.
Total RNA using Qiagen RNeasy kit
Total RNA was depleted of ribosomal RNAs using Epicentre’s RiboZero rRNA removal kit.
Total RNA was extracted and DNase-treated according to published protocols (Khodurksy A, Bernstein J, Peter B, Rhodius V, Wendisch V, Zimmer D. Escherichia coli Spotted Double-Strand DNA Microarrays)
Total RNA was extracted by the hot phenol–chloroform method.
Total RNA was extracted from 1 ml cells using the RNeasy Protect Bacteria Mini Prep kit (Qiagen) as recommended by the manufacturer including the “on-column” DNase treatment.
Total RNA was extracted from 5ml cell culture after 30min incubation with or without H2O2 treatment using RNeasy Mini kit (Qiagen, Inc., Valencia, CA) according to the manufacturer’s protocol
Total RNA was extracted from 5ml cell culture at 0, 10, 30 and 60 min incubation after addition of 5% isooctane using RNeasy mini kit (Qiagen, Inc., Valencia, CA) according to the manufacturer’s protocol
Total RNA was extracted from 5ml cell culture at 10min incubation with or without 1% Hydrogen peroxide using RNeasy Mini kit (Qiagen, Inc., Valencia, CA) according to the manufacturer’s protocol
Total RNA was extracted from cell pellets by hot phenol extraction. The integrity of total RNA was determined from agarose gel or microchannel electrophoretograms.
Total RNA was extracted from cell pellets by hot phenol extraction. The integrity of total RNA was determined from agarose gel or microchannel electrophoretograms. 16S and 23S Ribosomal RNA was depleted prior to construction of RNAseq libraries using MICROBExpress reagents.
Total RNA was extracted from cell pellets with TRI Reagent (MRC).  RNA was precipitated, resuspended in DNase Reaction Buffer (Invitrogen) for 30 min at room temperature.  DNase-treated samples were subsequently purified with an Rneasy Plus Mini Kit (Qiagen).
Total RNA was extracted from cells with the UltraClean Microbial RNA isolation kit (MO BIO, CA, USA). After extraction, contaminating DNA was digested with DNAse I (Sigma Aldrich) and total RNA was purified by phenol/chloroform extraction and ethanol precipitation. RNA purity and quantity was assess by optical density measurements (OD 260/280 and OD 260/230) and RNA integrity was checked with the Bioanalyseur 2100 (Agilent, CA, USA).
Total Rna was extracted from cultures using Qiagen RNeasy Protect Bacteria Mini Kit. For rRNA depletion, samples were treated with the MICROBExpressTM Bacterial mRNA Enrichment Kit (Life Technologies) according to the manufacturer’s instructions.  Samples were cleaned with the Zymo RNA Clean and ConcentratorTM (Zymo Research) and then subjected to a second cycle of rRNA depletion.  RNA was recovered by ethanol precipitation.
Total RNA was extracted using a hot phenol method (Khodursky et al, Methods in Molecular Biology 2003).
Total RNA was extracted using a Thermo Scientific GeneJET RNA isolation kit.
Total RNA was extracted using MasterPure RNA purification kits (Epicentre, Madison, WI, USA) according to the manufacturer’s protocol
Total RNA was extracted using Qiagen RNeasy kit.
Total RNA was extracted using Qiagen RNeasy kit (Hilden, Germany) following manufacturer’s instructions and checked for a RIN number to inspect RNA integration by an Agilent Bioanalyzer 2100 (Agilent technologies, Santa Clara, CA, US). Qualified total RNA was further purified by RNeasy mini kit (QIAGEN, GmBH, Germany) and RNase‐Free DNase Set (QIAGEN, GmBH, Germany).
Total RNA was extracted using Qiagen RNeasy Mini Kit. DNA was removed using Ambion DNA-free kit. RNA quality was assessed using 2% agarose gels and OD260/OD280 ratio. Amino-allyl dUTP was used to label 5µg of RNA during reverse transcription. The reverse transcription was performed at 42°C during 50 min using 600 units of superscript RT II (Invitrogen), 3 µg of random hexamers, 0.6mM dATP, dCTP and dGTP, 0.2mM dTTP, and 0.4mM amino-allyl dUTP (Ambion). RNA was then degraded by incubation at 65°C, for 15 min, after adding 10µL of 0.5M EDTA and 10µL of 1M NaOH.
Total RNA was extracted using RNeasy Mini Kit (Qiagen) according to instructions in the kit.
Total RNA was extracted using RNeasy Mini Kit (Qiagen) according to the manufacturer's protocol.
Total RNA was extracted using RNeasy Mini Kit (QIAGEN, Valencia, CA) and the genomic DNA was removed using RNase-Free DNase Set (QIAGEN).
Total RNA was extracted using the commercial product TRIzol Reagent (Invitrogen, Carlsbad, CA).Disrupt about 107cells with a homogenizer with 1ml TRIzol Reafent on ice. Store the homogenate for 5 minutes at room temperature to permit the complete dissociation of nucleoprotein complexes. Next, supplement the homogenate with 0.2 ml chloroform per 1 ml of TRI Reagent, cover the samples tightly and shake vigorously for 15 seconds. Store the resulting mixture at room temperature for 2-15 minutes and centrifuge at 12,000 g for 15 minutes at 4 C. Following centrifugation, the mixture separates into a lower red phenol-chloroform phase, interphase and the colorless upper aqueous phase. Transfer the aqueous phase to a fresh tube. Precipitate RNA from the aqueous phase by mixing with isopropanol. Use 0.5 ml of isopropanol per 1 ml of TRI Reagent used for the initial homogenization. Store samples at room temperature for 5-10 minutes and centrifuge at 12,000 g for 8 minutes at 4 - 25 C. Remove the supernatant and wash the RNA pellet ( by vortexing) with 75% ethanol and subsequent centrifugation at 7,500 g for 5 minutes at 4 - 25 C. Add at least 1 ml of 75% ethanol per 1 ml TRI Reagent used for the initial homogenization. Remove the ethanol wash and briefly air-dry the RNA pellet for 3 - 5 min. Dissolve RNA in DEPC-treated water by passing solution a few times through a pipette tip. Using an on-column DNase digestion with RNase-free DNase I (Qiagen) to purify the total RNA.
Total RNA was extracted using the frozen acid-phenol method described by Maes and Messens (Maes and Messens, 1992) and then treated with RNase-free DNaseI according to the manufacturer’s recommendations (Ambion, USA).
Total RNA was extracted using the RNeasy Mini kit (Qiagen) and DNA was removed by on-column DNase digestion with the RNase-Free DNase set (Qiagen). RNA  concentration was measured by SpectorPhotometer(NonoDrop).
Total RNA was extracted using the RNeasy Mini kit (Qiagen, Hilden, Germany) according to the manufactures recommendations.
Total RNA was extracted using the RNeasy Mini kit (Qiagen Inc., Valencia, CA, USA) and the RNAprotect reagent (Qiagen) and DNA was removed by on-column DNase digestion with the RNase-Free DNase set (Qiagen). RNA concentration was determined on a Nanodrop ND-1000 (Thermo Scientific) and RNA quality was determined by analysis with an Agilent 2100 bioanalyzer.
Total RNA was extracted using the RNeasy Plus Mini kit (Qiagen Inc., Valencia, CA, USA) and genomic DNA was removed by gDNA Eliminator spin column in the RNeasy Plus Mini Kit. RNA quality and concentration was determined by analysis with a NanoDrop 1000 (Thermo Scientific Inc., Wilmington, DE, USA).
Total RNA was extracted using the Trizol reagent (Thermo Fisher Scientific) and the concentration and purity of the samples were determined using Nano Drop. RNA integrity was monitored using the R6K ScreenTape system on the Agilent 2200 TapeStation. gDNA was removed by Turbo DNase (Thermo Fisher Scientific) in the presence of 1U/L RiboLock RNase Inhibitor (Thermo Fisher Scientific) for 60 min at 37°C. Following organic extraction (1x 25:24:1 v/v phenol/chloroform/ isoamyalcohol, 1x chloroform), RNA was recovered by overnight precipitation with 3 volumes of 30:1 100 % ethanol/3 M sodium acetate (pH 5.2). Next, the sample (TEX+) was depleted of processed RNAs using 1U per 1μg of RNA Terminator 5´-Phosphate-Dependent Exonuclease (TEX, Epicentre) in the presence of 1U/μL RNase Inhibitor for 60 min at 30° C. A control reaction without TEX (TEX-) was run in parallel. Following organic extraction, RNA was recovered by overnight precipitation and resuspended in RNase-free water.
Total RNA was extracted using TRI Reagent (Sigma Aldrich), enriched by depleting small RNAs with GeneJET Purification Kit (Fermentas) and rRNA with MICROBExpres Bacterial mRNA Enrichment Kit (Ambion) and fragmented in alkaline solution (2 mM EDTA and 100 mM Na2CO3 pH 9.2 for 40 min at 95°C) to fragments with size of 24-35 nts. For RPFS, cells were lysed by freeze-rupturing (Retch Mill) and 100 A260 units of ribosome-bound mRNA fraction were directly used for polysomal analysis or subjected to nucleolytic digestion with 10 units/µl micrococcal nuclease (Fermentas) for 10 min at room temperature in buffer with pH 9.2 (10 mM Tris pH 11 containing 50 mM NH4Cl, 10 mM MgCl2, 0.2% triton X-100, 100 µg/ml chloramphenicol and 20 mM CaCl2) to obtain the monosomal fraction. Separation was obtained by sucrose density gradient (15-50% w/v). Subsequently, 20-35-nt RNA fragments from the monosomal fraction were size selected on a denaturing 15% polyacrylamide gel.
Total RNA was extracted using TRIzol (Invitrogen)
Total RNA was extracted using TRIzol reagent (Invitrogen) and the sample was enriched in mRNA, depleting small RNAs with GeneJET™ RNA Purification Kit (Fermentas) and ribosomal RNA with two cycle of MICROBExpress™Bacterial mRNA Enrichment Kit (Ambion). To probe the RNA structure two µg of enriched mRNA were resuspended in 45 µl of DEPC water and denatured for 3 min at 95°C,refolded at 37 °C, after addition of 10x RNA-structure buffer with pH 7.0 (100 mM Tris, 1 M KCl, 100 mM MgCl2) and digested for 1 min at 37 °C with either 0.05 U RNase V1 (Life Technologies) or a combination of 2 µg RNase A and 5 U RNase T1 (Thermo Scientific). The reaction was stopped by extracting the RNA with phenol-chlorophorm. The RNase A/T1-digested sample was phosphorylated with T4 PNK (NEB) and purified with RNA Clean & Concentrator™ kit (Zymo Research). Both the V1 and A/T1 digested samples were randomly fragmented in buffer with pH 9.2 (100 mM Na2CO3, 2 mM EDTA) for 12 min at 95°C.
Total RNA was extracted with phenol chloroform and alkaline fragmented, then fragments (20-40 nt) were gel-purified.
Total RNA was extracted with Qiagen's Rneasy Mini Kit
total RNA was extreacted using Quagen RNA mini kit. DNA was removed by DNase digestion. RNA quality and concentration was determined by analysis with an Thermo NanoDrop 1000.
Total RNA was harvested from C. glutamicum cells using TRIzol® reagent (Invitrogen, Carlsbad, CA, USA) and NucleoSpin® (Macherey-Nagel, Düren, Germany) according to the manufacturer’s instructions with the following modifications. Cells were harvested by centrifugation, resuspended in TRIzol® reagent, and transferred to a vial containing Lysing Matrix B® (MP Biomedicals, Solon, OH, USA) for lysis. The suspension was centrifuged, and the supernatant was applied to a NucleoSpin® RNA II kit for purification.
Total RNA was isolated according to the RNeasy Mini Kit (QIAGEN) manufacturer's protocol.
Total RNA was isolated and purified from cells using an RNeasy mini kit with on-column DNA digestion.
Total RNA was isolated as described (Sambrook et al., 1989). The extracted RNA was checked for purity by gel electrophoresis and was quantified by measuring extinction spectrophotometrically at 260 nm.
Total RNA was isolated as desribed in Kime et al., 2008
Total RNA was isolated by the Trizol-Phenol-Chloroform method. An additional clean-up including the on-column DNase I treatment was performed by using the RNeasy mini kit (Qiagen).
Total RNA was isolated from cell lysates using RNeasy kits (Qiagen). mRNA was extracted from total RNA using MicroPoly(A)Purist™ kits (Ambion) and treated with DNase I using the Turbo DNA-free™ kit (Ambion). First-strand cDNA was synthesized from 400-700 ng mRNA using High Capacity RNA-to-cDNA kits (Applied Biosystems).  Tag-Seq sequencing libraries were generated directly from 12% of a cDNA reaction or 50 ng plasmid DNA by 26 cycle PCR using Pfu Ultra HS DNA polymerase 2x master mix (Agilent) and primers AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGAGGTGCCTAAAGG (where XXXXXXXX is a library-specific index sequence). The resultant PCR products were size-selected using 2% agarose E-Gel EX (Invitrogen).
Total RNA was isolated from cell pellets using Aurum total RNA mini kit (Bio-Rad) according to the manufacturer’s instructions, and RNA quality was controlled using the RNA 6000 nano kit and 2100 Bioanalyzer (Agilent). Ribosomal RNA was removed using Ribo-Zero rRNA Removal Kit for Gram-Negative Bacteria (Epicentre).
Total RNA was isolated from cells grown in LB medium using the Qiagen RNeasy column.
Total RNA was isolated from E.coli cells using NucleoSpin® RNA II kit according to the manufacturers’ instructions (Macherey Nagel, Duren, Germany). RNA samples were examined in a 1.5% denaturing agarose gel, quantitated by absorbance at 260 nm and stored until further use for microarray and RT-PCR verification
Total RNA was isolated from E.coli cells using NucleoSpin® RNA II kit according to the manufacturers’ instructions (Macherey Nagel, Duren, Germany). RNA samples were examined in a 1.5% denaturing agarose gel, quantitated by absorbance at 260 nm and stored until further use for microarray and RT-PCR verification.
Total RNA was isolated from strains using NucleoSpin RNAII kit (Macherey-Nagel Corporation) following the instruction. RNA samples were examined in a 1.5% denaturing agarose gel, quantitated by absorbance at 260 nm and stored until further use for microarray.
Total RNA was isolated from the cell pellets using a bead mill and the mirVana RNA isolation kit (Ambion) including DNase treatment. From the total RNA samples, ribosomal RNA molecules were depleted using the Ribo-Zero rRNA Removal Kit for bacteria (Illumina).
Total RNA was isolated from the cells stored in liquid nitrogen using TRIzol Reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) and RNeasy MinElute Cleanup Kits (Qiagen, Valencia, CA, USA)
Total RNA was isolated from the VBNC cells and the exponential-phase cells using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. The RNA samples were treated with DNase Ⅰ (Invitrogen) to remove residual genomic DNA.
Total RNA was isolated using a RiboPureTM -Bacteria Kit (Ambion) following the manufacturer’s instructions. Once isolated, ~10μg total RNA was treated with 8 units DNase (Invitrogen) twice to remove genomic DNA.
Total RNA was isolated using a RNeasy® RNA isolation kit, according to the manufacturer’s specifications (QIAGEN, Germany) and stored in RNase-free water at –80°C. RNA concentration was determined by UV-spectrometry and its quality controlled by agarose gel electrophoresis.
Total RNA was isolated using Qiagen RNeasy Mini Kit and treated with DNase I
Total RNA was isolated using Ribopure Bacteria Kit as described by the manufacturer (Ambion, Huntingdon, UK). RNA quality was assessed by Agilent 2100 bioanalyser using the RNA 6000 Nano Chip (Agilent Technologies, Amstelveen, The Netherlands), and quantity was determined by ND-1000 Spectrophotometer (NanoDrop Technologies, Inc., DE, USA).
Total RNA was isolated using the hot phenol method as described in (Lybecker et al., 2014).
Total RNA was isolated using the Rneasy Mini Kit procedure with on column Dnase treatment (Qiagen).
Total RNA was isolated using the RNeasy Mini-Kit (Qiagen) according to the manufacturer`s instruction and DNA was removed by using RNAse-Free DNAse Set (Qiagen).
Total RNA was isolated with the MasterPure RNA Isolation Kit (Epicentre), enriched for mRNA using the mRNA Prokaryotic mRNA Isolation Kit (Epicentre), and polyadenylated with kit all based on the manufacturer's instructions
Total RNA was isolated with the RNeasy Protect Bacteria Mini Kit from Qiagen (Hilden, Germany). The isolated RNA was further purified from genomic DNA contaminations using Ambion DNase I treatment following the manufacturer's instructions (DNA-free, Ambion by Life Technologies, Darmstadt, Germany). RNA samples were further subjected to an mRNA enrichment step using the MICROBExpress Kit from Ambion according to the manufacturer`s instructions (Life Technologies, Darmstadt, Germany).
Total RNA was purified on a RNeasy columns (Qiagen); ribosomal RNAs were removed with the MicroExpress kit (Ambion). The resulting RNA was reverse transcribed with SuperScript II reverse transcriptase (Invitrogen) + random hexamers + dNTP mix containing aminoallyl-dUTP.
Total RNA was purified using the RNAeasy kit (Qiagen).
Total RNA was purified with an RNeasy micro kit (Qiagen K.K., Tokyo, Japan).
Total RNA was stabilised and subsequently purified from a 500 ul portion of each bacterial culture using a RNAprotect Bacterial Reagent Mini Kit (Qiagen, Crawley, UK)
Total RNA were then isolated according to the standard protocol using an RNeasy mini kit (Qiagen). Genomic DNA were extracted from both Xuzhou21 and Xuzhou21m using Wizard Genomic DNA purification kit (Promega, Madison, WI, USA) according to the manufacturer’s protocols.
toxin: deoxynivalenol
toxin: nivalenol
TPM (transcripts per million) was calculated by RSEM(version 1.2.19)
Transcript Abundance in LB at 30 degrees OD600=0.8 Trial A
Transcript Abundance in LB at 30 degrees OD600=0.8 Trial B
Transcript Abundance in M9 at 30 degrees OD600=0.8 Trial A
Transcript Abundance in M9 at 30 degrees OD600=0.8 Trial B
transcript abundance was quantified using rockhopper
Transcript assembly an quantification was performed using a protocols from Trapnell et al., and Li et al. Fragments Per Kilobases of exon per million (FPKM) were calculated.
Transcriptional profiling of Escherichia coli cultured under severe zinc limitation Chemostat 1A
Transcriptional profiling of Escherichia coli cultured under severe zinc limitation Chemostat 1B
Transcriptional profiling of Escherichia coli cultured under severe zinc limitation Chemostat 2A
Transcriptional profiling of Escherichia coli cultured under severe zinc limitation Chemostat 2B
Transcriptional profiling of Escherichia coli cultured under severe zinc limitation Chemostat 3A
Transcriptional profiling of Escherichia coli cultured under severe zinc limitation Chemostat 3B
Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (0A1)
Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 0A2)
Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 0B1)
Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 0B2)
Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 10A1)
Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 10A2)
Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 10A3)
Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 10B1)
Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 10B2)
Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 2.5A1)
Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 2.5A2)
Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 2.5B1)
Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 2.5B2)
Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 30A1)
Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 30A2)
Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 30B1)
Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 30B2)
Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 7A1)
Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 7A2)
Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 7B1)
Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 7B2)
Transcriptional response of E. coli to TPEN (m1)
Transcriptional response of E. coli to TPEN (m2)
Transcriptional response of E. coli to TPEN (m3)
Transcriptional response of E. coli to TPEN (t1)
Transcriptional response of E. coli to TPEN (t2)
Transcriptional response of E. coli to TPEN (t3)
transcription factor: CsiR
transcription factor: Nac
transcription factor: NtrC
transcription factor: OmpR
Transcription profiles of NTG-treated E. coli imp fabI(G93V) and its control strain in the absence of triclosan
Transcription profiles of NTG-treated E. coli imp fabI(G93V) and its control strain in the presence of triclosan
Transcriptome of cells was prepared using a RNA extraction kit (RNeasy mini kit;Qiagen, Hilden, Germany)
Transcriptomic analyses were carried out after growing bacteria in minimal media supplemented with glucose. Several Ni concentrations and exposure times were assayed. rcnA gene expression was taken as an internal control to arbitrate between the different conditions. rcnA is induced by Ni when cells are overloaded with this ion and must detoxify the cytoplasm by extruding excess metal via the RcnAB efflux system. rcnA induction was maximised after culture incubation for 10 min, and longer periods of incubation lead to a decline in rcnA expression (Fig. S1). For the RNA-Seq experiments, bacteria were grown until O.D600nm = 0.3, were treated with 50 µM NiCl2 for 10 min and were frozen prior to RNA extraction.
Transcripts evaluation of differential expression were accomplished using MARS (MA-plot-based method with Random sampling model) in DEGseq package.(Bioinformatics 2010, 26: 136-138)
Transfer 700 μl lysate into RNeasy Mini column place in a 2 ml collection tube and centrifuge for 30 s at highest speed. Add 350 μl Buffer RW1 to the column and centrifuge for 30 s. Discard flow-through and reuse the collection tube. Add 10 μl DNase stock solution to 70 μ l RDD Buffer. Add the DNase I solution into the column and incubate at RT for 15 min. Add 350 μl Buffer RW1 to the column and wait for 5 min, centrifuge for 30 s. Discard the flow-through and collection tubes. Place the RNeasy Mini spin column in a new 2 ml collection tube. Add 500 μl Buffer RPE to the column. Centrifuge for 30 s. Place the column in a new 1.5 ml tube, and centrifuge for 1 min to eliminate any residue ethanol. Place the column in a new collection tube. Add 50 μl RNase free water, centrifuge for 1 min. Store RNA samples at -20°C.
transformation: empty vector
transformation: pSigma70-LB
transformation: pSigma70-LP
Transform the mapped file format from sam to sorted bam which are later tranfered to bigWig, and separated by the strand (plus and minus).
transition phase
Transition phase sample 1
Transition phase sample 2
Transition phase sample 3
Transition phase sample 4
Treated experimental sets transformed with plasmids containing BCM/WT rho. Rho treated cells subjected to P1 transduction to delete the genomic counterparts of the gene.
Treated experimental sets transformed with plasmids containing Rho (WT/N340S/G324D).Cells subjected to P1 transduction to delete the genomic counterparts of the gene.
Treated experimental sets transformed with plasmids containing WT/G181D/R258C NusA. Cells subjected to P1 transduction to delete the genomic counterparts of the respective gene.
treated sample at 30 min, biological rep1
treated sample at 30 min, biological rep2
treated sample at 60 min, biological rep1
treated sample at 60 min, biological rep2
treated with: 0.5 μg/ml trimethoprim
treated with: 100 µg/ml BSA for 30min (control)
treated with: 100 µg/ml PGRP for 30min
Treated with 100 uM KCN for 5 minutes before harvesting
treated with: 172mM NaCl
treated with: 172mM short chain fatty acid mix
Treated with 1% vol/vol butanol 10 minutes prior to harvest
Treated with 1% vol/vol isobutanol 10 minutes prior to harvest
treated with: 20 ug/ml bicyclomycin
treated with: 250 uM of paraquat at mid-log pahse for 20 min
treated with: 250 uM of paraquat at mid-log phase for 20 min
treated with: 30mM NaCl
treated with: 30mM short chain fatty acid mix
Treated with 3% vol/vol ethanol 10 minutes prior to harvest
treated with: 5 µg/ml gentamicin for 30 min
treated with: 800 µM CCCP for 15min
treated with: none
treated with: none (untreated control)
treated with: Rifampicin for 20 minutes
treatment: 0.025mM CspA protein
treatment: 0.05mM CspA protein
treatment: 0.1mM CspA protein
treatment: 0.3% glucose
treatment: 0.4% glucose
treatment: 0.5 µg/ml Carolacton
treatment: 0.5 mg/ml menadione
treatment: 0.5mg/ml serine hydroxamate for 20min
treatment: 0.5mg/ml SHX for 40min
treatment: 0.8% n-butanol was added at time 0
treatment: 0 μg/ml nalidixic acid
treatment: 100 μg/ml nalidixic acid
treatment: 10% H202
treatment: 10 μg/ml nalidixic acid
treatment: 15 min
treatment: 15 min after induction with arabinose
treatment: 15 min after induction with rhamnose
treatment: 1% H202, anaerobic
treatment: 1% H2O2, anaerobic
treatment: 1mM IPTG
Treatment 1: UA30 (EHEC 86-24 exposed to pH 3 for 30 min)
treatment: 200 mM glyphosate shock for 1 h
Treatment 2: AA30 (EHEC 86-24 pH 5.0, followed by 30 min pH 3.0)
treatment: 2 mM NaN3 for 10 minutes
treatment: 2ug/ml of ciprofloxacin
treatment: 30 C
treatment: 30% H202
treatment: 37°C
Treatment 3: UA15 (EHEC 86-24 exposed to pH 3 for 15 min)
treatment: 42 C
treatment: 4ug/ml of ciprofloxacin
treatment: 50°C heatshock
treatment: 5 percent isooctane
treatment: 60 min after induction with arabinose
treatment: 60 min after induction with rhamnose
treatment: After 10 mg/mL kasugamycin treatment for 40 min
treatment: After 250 µg/mL rifampicin treatment for 2 hr
treatment: ampicillin (50 µg/mL final concentration)
Treatment A Population 1 Colony a replica 1
Treatment A Population 1 Colony a replica 2
Treatment A Population 1 Colony b replica 1
Treatment A Population 1 Colony b replica 2
Treatment A Population 1 Colony c replica 1
Treatment A Population 1 Colony c replica 2
Treatment A Population 2 Colony a replica 1
Treatment A Population 2 Colony a replica 2
Treatment A Population 2 Colony b replica 1
Treatment A Population 2 Colony b replica 2
Treatment A Population 2 Colony c replica 1
Treatment A Population 2 Colony c replica 2
treatment: Bacillus volatile organic compounds (VOCs)
treatment: batch growth
treatment: BCM
treatment: Before rifampicin treatment
treatment: bicontinious microemulsion
Treatment B Population 3 Colony a replica 1
Treatment B Population 3 Colony a replica 2
Treatment B Population 3 Colony b replica 1
Treatment B Population 3 Colony b replica 2
Treatment B Population 3 Colony c replica 1
Treatment B Population 3 Colony c replica 2
Treatment B Population 4 Colony a replica 1
Treatment B Population 4 Colony a replica 2
Treatment B Population 4 Colony b replica 1
Treatment B Population 4 Colony b replica 2
Treatment B Population 4 Colony c replica 1
Treatment B Population 4 Colony c replica 2
Treatment B Population 5 Colony a replica 1
Treatment B Population 5 Colony a replica 2
Treatment B Population 5 Colony b replica 1
Treatment B Population 5 Colony b replica 2
Treatment B Population 5 Colony c replica 1
Treatment B Population 5 Colony c replica 2
treatment: Carbon starvation
treatment: chemostat growth
treatment: ciprofloxacin
treatment: clindamycin
treatment: Cold Shock
treatment: Con1
treatment: Con2
treatment: Con3
treatment: Continuous aerobically grown cultures in Evans medium, exposed to 0.1L/min CO gas
treatment: Continuous aerobically grown cultures in Evans medium, exposed to 40uM CORM-3
treatment: Continuous aerobically grown cultures in Evans medium, exposed to 40uM iCORM-3
treatment: Continuous anaerobically grown cultures in Evans medium, exposed to 40uM CORM-3
treatment: Continuous anaerobically grown cultures in Evans medium, exposed to CO gas at 0.1L/min
treatment: control
treatment: control, anaerobic
Treatment C Population 6 Colony b replica 1
Treatment C Population 6 Colony b replica 2
Treatment C Population 6 Colony c replica 1
Treatment C Population 6 Colony c replica 2
Treatment C Population 7 Colony b replica 1
Treatment C Population 7 Colony b replica 2
Treatment C Population 7 Colony c replica 1
Treatment C Population 7 Colony c replica 2
treatment: DpnI digested DNA
treatment duration: 10 min
treatment duration: 15 h
treatment duration: 2.5 h
treatment duration: 8 min
treatment duration: none
treatment: erythromycin
treatment: exposed to 100uM CORM-3 for 10min
treatment: exposed to 100uM CORM-3 for 120min
treatment: exposed to 100uM CORM-3 for 20min
treatment: exposed to 100uM CORM-3 for 40min
treatment: exposed to 100uM CORM-3 for 60min
treatment: exposed to 100uM iCORM-3 for 10min
treatment: exposed to 100uM iCORM-3 for 120min
treatment: exposed to 100uM iCORM-3 for 20min
treatment: exposed to 100uM iCORM-3 for 40min
treatment: exposed to 100uM iCORM-3 for 60min
treatment: exposed to the lettuce rhizosphere for 3 days
treatment: florfenicol (30 µg/mL final concentration)
treatment: glucose (2 g/L) minimal M9 medium supplemented with 10 mM leucine.
treatment: glucose (2 g/L) minimal M9 medium supplemented with 20 mg/L tryptophan.
treatment: glucose (2 g/L) minimal M9 medium supplemented without 10 mM leucine.
treatment: glucose (2 g/L) minimal M9 medium supplemented without 20 mg/L tryptophan.
treatment: glucose (2 g/L) minimal W2 medium supplemented with 1g/L arginine.
treatment: glucose (2 g/L) minimal W2 medium supplemented with 2g/L glutamine.
treatment: glutamine
treatment group: cold stress
treatment group: control
treatment group: heat stress
treatment group: indole treated
treatment group: lactose shift
treatment group: oxidative stress
treatment group: rifampicin time point 0
treatment group: rifampicin time point 2
treatment group: rifampicin time point 4
treatment group: rifampicin time point 6
treatment group: rifampicin time point 8
treatment: grown in lettuce rhizosphere
treatment: grown without lettuce rhizosphere
treatment: heat shock
treatment: Heat Shock
treatment: induced DNA double strand break
treatment: log phase sample
treatment: Low pH
treatment: MG1655 + 3µM HgCl2 at t10
treatment: MG1655 + 3µM HgCl2 at t30
treatment: MG1655 + 3µM HgCl2 at t60
treatment: MG1655 + 3µM PMA at t10
treatment: MG1655 + 3µM PMA at t30
treatment: MG1655 + 3µM PMA at t60
treatment: MG1655 - unexposed at t0
treatment: MG1655 - unexposed at t10
treatment: MG1655 - unexposed at t30
treatment: MG1655 - unexposed at t60
treatment: minimal C&N source
treatment: minimal C source
treatment: minimal N source
treatment: NA
treatment: N/A
treatment: Nitrogen starvation
treatment: none
treatment: None
treatment: non-sorted
treatment: No treatment
Treatment of sub-lethal triclosan; 50 mg/L triclosan
treatment: oil in water
treatment: Osmotic stress
treatment: Oxidative stress
treatment: PA1
treatment: PA2
treatment: PA3
treatment: Pooled RNA from mixture of the same amount of wt, wt+SHX, dksA, dksA+SHX RNA samples
treatment: prior to CORM-3 addition (t=0)
treatment: prior to iCORM-3 addition (t=0)
Treatment protocol- E.coli cells grown in LB media with  at 37C until early log phase (0.4), then were treated with 200 mM glyphosate for 1 h,after that the cells were harvested to extract RNA.
treatment: PS-60min
treatment: Ribosome-protected mRNA, Ribosome footprint sample digested with 60 units of micrococcal nuclease per A260 absorbance
treatment: rifampicin
treatment: saline
treatment: sham-treated power line intermittent (2 min on, 4 min off) magnetic field
treatment: sham-treated sinusoidal continous magnetic field
treatment: sham-treated sinusoidal intermittent (2 min on, 4 min off) magnetic field
treatment: sorted
treatment: Standard
treatment: starvation growth
treatment: stationary phase
treatment: streptomycin (50 µg/mL final concentration)
treatment: Supernatant
treatment temperature: 30C
treatment temperature: 42C
treatment time: T10: 210 min after stress
treatment time: T11: 235 min after stress
treatment time: T12: 260 min after stress
treatment time: T1: OD 0.3
treatment time: T1: OD 0.5
treatment time: T2: OD 0.5
treatment time: T2: OD 0.6
treatment time: T3: 10 min after reaching OD 0.6
treatment time: T3: 10 min after stress
treatment time: T3: OD 0.6
treatment time: T3: OD 0.7
treatment time: T4: 10 min after growth lag
treatment time: T4: 10 min after stress
treatment time: T4: 20 min after reaching OD 0.6
treatment time: T4: 20 min after stress
treatment time: T5: 20 min after growth lag
treatment time: T5: 20 min after stress
treatment time: T5: 30 min after reaching OD 0.6
treatment time: T5: 30 min after stress
treatment time: T6: 30 min after growth lag
treatment time: T6: 30 min after stress
treatment time: T6: 40 min after reaching OD 0.6
treatment time: T6: 40 min after stress
treatment time: T7: 40 min after growth lag
treatment time: T7: 40 min after stress
treatment time: T7: 50 min after reaching OD 0.6
treatment time: T7: 50 min after stress
treatment time: T8: 90 min after reaching OD 0.6
treatment time: T8: 90 min after stress
treatment time: T9: 150 min after stress
treatment: tobacco acid pyrophosphatase (TAP)
treatment: Treated by HPCD at 5 MPa and 25℃ for 40 min
treatment: treated culture
treatment: treated power line intermittent (2 min on, 4 min off) magnetic field
treatment: treated sinusoidal continous magnetic field
treatment: treated sinusoidal intermittent (2 min on, 4 min off) magnetic field
treatment: triclosan
treatment: unexposed, left chamber/bioreacator
treatment: unexposed, right chamber/bioreacator
treatment: unexposed, treated with 1mM H2O2
treatment: unexposed, treated with water
treatment: untreated
treatment: untreated culture
treatment: UV
treatment: vector control
treatment: water in oil
treatment: with homogenization and separation
treatment: without salt shock
treatment: WT Rho plasmid
Triclosan tolerant mutant triclosan treated biological rep 1
Triclosan tolerant mutant triclosan treated biological rep 2
Triclosan tolerant mutant triclosan treated biological rep 3
Triclosan tolerant mutant untreated biological rep 1
Triclosan tolerant mutant untreated biological rep 2
Triclosan tolerant mutant untreated biological rep 3
trim adaptors on raw reads and moved trimmed reads to trimmed_reads with flexbar
Trimethoprim-treated E. coli cells
Trimmed adaptor sequences from reads using Flexbar 2.31
Trimmed reads were aligned on most recent reference genome of Escherichia coli (GenBank U00096.3) by using TopHat (v2.0.10) coupled with bowtie (v1.0.0).
Trimmed reads were aligned using Bowtie v0.12.7 against the reference genome using parameters -a -v 3 -m 1
Trimmed reads were sequentially aligned using Bowtie v0.12.7 to E coli genome using parameters -v 1 -m 1 --best. This allows one mismatch and reports only reads that align 1 or fewer times to the genome
Trimmed reads were sequentially aligned using Bowtie v0.12.7 to E coli rRNA and noncoding RNA allowing one mismatch. Reads aligning to any of these indices were discarded.
Trimmed reads were sequentially aligned using Bowtie v0.12.7 to E. coli rRNA and noncoding RNA allowing one mismatch. Reads aligning to any of these indices were discarded.
triplicate samples were prepared by combining cells from 5 tubes each.  Each pellet was
TRI Reagent (Sigma) or Rneasy (QIAGEN) according to manufacturer's protocol. No Rnase treatment.
Trizol extraction of total RNA was performed according to the manufacturer's instructions
Trizol extraction of total RNA was performed according to the manufacturer's instructions.
Trizol for RNAseq, gradient centrifugation => RNase digestions => Trizol => gel extraction for RIBOseq
TRIzol reagent (Gibco BRL) was used according to the manufacturer instruction. RNA was treated with DNase (Ambion). RNA sample was converted to cDNA in 5 independent reverse-transcription reactions as described previously (Graham, J. 1999. PNAS 96:11554-559). Bacterial transcript were purified from host transcript by using 3 round of the SCOTS procedure (Daigle, F. 2002. Methods Enzymol. 358:108-122).
trpD KO rep1
trpD KO rep2
trpD KO rep3
trpEA2trpR2 vs. trpEA2, W3110 min +Trp 50ug/ml
trpEA2trpR2, W3110 min +Trp 50ug/ml, 30 ug total
trpEA2,W3110 min +Trp 50ug/ml, 30 ug total
trpR2+50ug/ml Trp, 30 ug total RNA
trpR2+50ug/ml Trp vs. wt+50ug/ml Trp
trpR2tnaA2,W3110 minimal +Trp 50ug/ml vs. dnaC genomic DNA
trpR2tnaA2,W3110 min +Trp 50ug/ml, 25 ug total RNA
trpR2 +trp vs. -trp, min+.2%glucose, W3110
trpR2 vs. wt, min+.2%glucose, W3110
TrpR_glucose
TrpR_Trp
TruSeq
Truseq ChIP kit was used for the library preparation. DNA was end repaired and adapters were ligated. After ligation, purify ligation products and then amplify.
Truseq Small RNA
Tryptophan addition
TTAGGC-D3
Tube state 1 (IPTG-/aTc-/Ara-)
Tube state 2 (IPTG+/aTc-/Ara-)
Tube state 3 (IPTG-/aTc+/Ara-)
Tube state 4 (IPTG+/aTc+/Ara-)
Tube state 5 (IPTG-/aTc-/Ara+)
Tube state 6 (IPTG+/aTc-/Ara+)
Tube state 7 (IPTG-/aTc+/Ara+)
Tube state 8 (IPTG+/aTc+/Ara+)
TW09308 batch
TW09308 chemostat
TW09308 starvation
TW09308 transcriptome from batch growth_1
TW09308 transcriptome from batch growth_2
TW09308 transcriptome from chemostat growth_1
TW09308 transcriptome from chemostat growth_2
TW09308 transcriptome from starvation growth_1
TW09308 transcriptome from starvation growth_2
TW10915 cells were grown in DMEM medium upto exponential phase (OD600~0.5, 2.5 h after inoclulation) at 37C.
TW10916 cells were grown in DMEM medium upto exponential phase (OD600~0.5, 2.5 h after inoclulation) at 37C.
TW10917 cells were grown in DMEM medium upto exponential phase (OD600~0.5, 2.5 h after inoclulation) at 37C.
TW10938 cells were grown in DMEM medium upto exponential phase (OD600~0.5, 2.5 h after inoclulation) at 37C.
TW10948 cells were grown in DMEM medium upto exponential phase (OD600~0.5, 2.5 h after inoclulation) at 37C.
TW10950 cells were grown in DMEM medium upto exponential phase (OD600~0.5, 2.5 h after inoclulation) at 37C.
TW10957 cells were grown in DMEM medium upto exponential phase (OD600~0.5, 2.5 h after inoclulation) at 37C.
TW10967 cells were grown in DMEM medium upto exponential phase (OD600~0.5, 2.5 h after inoclulation) at 37C.
TW11588 batch
TW11588 chemostat
TW11588 starvation
TW11588 transcriptome from batch growth_1
TW11588 transcriptome from batch growth_2
TW11588 transcriptome from chemostat growth_1
TW11588 transcriptome from chemostat growth_2
TW11588 transcriptome from starvation growth_1
TW11588 transcriptome from starvation growth_2
Two Avian Pathogenic Escherichia coli strains (APEC) were grown at 37°C in Dulbecco´s Modified Eagle´s Media (DMEM) media until reach O.D 600 = 0.8.
Two biological replicates were performed for samples with and without treatment with bicyclomycin. For samples without BCM treatment, cells were grown OD600 ≈ 0.8 at 370 with shaking at 200 rpm.  For samples with BCM treatment, cells were grown to early log phase (O.D. 600=0.1) ≈ 1h at 370 with shaking at 200 rpm. BCM was added to a final concentration of 25ug mL-1
Two biological replicates were processed seperatedly, and only sequence reads presented in both biological replciates were considered for further process. The genomic coordinates of the 5'-end of these uniquely aligned reads were defined as potential TSSs.
Two color cDNA microarray data are never devoid of spurious technical contributions that
Two color cDNA microarray data are never devoid of spurious technical contributions that originate during array printing, as well as during the collection and processing of samples, fluorescent labeling and hybridization and scanning of the microarray images (Balazsi et al. 2003, PNAS).  To minimize the effect of such contributions, microarray data were normalized as described before (Tong et al. 2004 BBRC). Briefly, spots were excluded from further analysis if the foreground intensity of less than 50% of the pixels within the spot were above 2 standard deviations of the background. We generated expression data tables in Microsoft Excel, containing the following information for each of the 14,352 entries: block (B), column (X), and row (Y) number, red foreground (f_r) and background (b_r), green foreground (f_g) and background (b_g) intensity. The position of each probe within a block, P is defined by the pair of integers (X,Y). Log ratios were defined as the base 10 logarithm of (F_r-B_r)/(F_g-B_g), where F_r, B_r, F_g and B_g represent the median Cy5 (red) foreground and background, and the median Cy3 (green) foreground and background intensities, respectively.  In some cases, when the intensity of the background was higher than or equal to the intensity of the foreground, the resulting log ratios became complex or infinity. These values were eliminated using the find, imag, and isfinite functions in Matlab. Next, data were normalized, by averaging the log ratios resulting from all spots printed by a print tip, and subtracting the resulting average from all the individual log ratios corresponding to the same tip. Finally, all the log ratios of the same gene from each slide were averaged and listed in a new file.
Two different approaches were used to align sequence reads to the genome of E. coli K-12 MG1655 (U00096.3). First, quality controlled reads were mapped using the CLC Genomics Workbench version 7.5.1 (CLC GW, Bio-Qiagen, Aarhus, Denmark) with either default settings for the length and similarity fractions (0.5 and 0.8, respectively, see supplemental Table 2 of the paper) or with the most stringent criteria (1.0 and 1.0, respectively, deposited). Reads with sequences aligned to multiple genomic regions were ignored.
Two precultures were performed in LB medium and mineral salt medium with 10 g L 1 of glucose without antifoam agent consecutively at 37 °C at a rotary shaker at 180 rpm. Main cultivations were started as batch cultures at a temperature of 37 °C. The pH was kept at 7.0 by controlled addition of 25% ammonia solution. At the end of the exponential growth phase (cell dry weight about 16 g L-1) the stirrer rate was lowered from 1000 rpm to 500 rpm, to provoke oxygen limitation by decreased oxygen transfer. Constant glucose feed of 100 g L-1 h-1 was started 15 min after the oxygen drop which was enough to ensure glucose excess during the whole cultivation.
tynA- at T0
tynA- at T1h
tynA- at T4h
ug/ml smx / ug/ml tm: 20/4 (1x)
ug/ml smx / ug/ml tm: 540/108 (27x)
ugpC KO rep1
ugpC KO rep2
ugpC KO rep3
umuD___U_N0025_r1
umuD___U_N0025_r2
umuD___U_N0025_r3
umuD upregulation, amp 50ug/ml, 0.0125% arabinose, 0.025ug/ml norfloxacin OD ~0.3
Un_IN_3
Un_IN_Mu_1
Un_IN_Mu_2
Un_IP_3
Un_IP_Mu_1
Un_IP_Mu_2
untreated
Untreated
untreated cells, 25 ug total RNA
untreated cells after 24 min
untreated cells after 60 min
untreated control
Untreated E. coli cells
Untreated Rep 1 -A-IP
Untreated Rep 1 -A+IP
Untreated Rep 2 -A-IP
Untreated Rep 2 -A+IP
Untreated Rep 3 -A-IP
Untreated Rep 3 -A+IP
Untreated_replicate_1
Untreated_replicate_2
Untreated_replicate_3
Untreated wild type versus untreated yajL mutant.
Uridine addition
uropathogenic Escherichia coli (UPEC)
uropathogenic Escherichia coli (UPEC) grown with nitrosative stress
uropathogenic Escherichia coli (UPEC) grown without nitrosative stress
Used SAMTOOLS (Li, et al., PMID 1950593) to sort and index the SAM files obtained from Bowtie2 and convert them to BAM format.
Used SAMTOOLS (Li, et al., PMID 1950593) to sort and index the SAM files obtained from Bowtie and convert them to BAM format.
Using a combination of python (3.2.1) and bowtie(0.12.7), from the raw sequencing data, we isolated reads which contained barcode sequences that corresponded to our original list of single molecule barcodes in both forward and reverse reads for each sequence pair that had at most one mismatch. We then aligned the first 28 bases (26 bases for the second sequencing run) of the targeted sequence of both the forward and reverse reads of each cluster to the E. coli genome and kept the sequences that uniquely align fewer than three mismatches and where the two reads did not map to the same sense or antisense strand of the genome.  We used a detailed filtering process to determine the identity of closely-mapped reads. Mapped sequence fragments with a length of at least 1,000 bases were discarded.  All sequences within the same transcription unit that had the same unique tag were analyzed further. We determined that more than one sequence with the same unique tag were identical if the distance between their center positions was less than four base-pairs and if the difference in length was less than 9 base-pairs. Then for each unique sequence, we counted the number of unique barcode tags that appeared to determine the copy number of each sequence and mapped each of them to genes. We include indexed genome viewer files (.sam and .sai) for both experiments using both the conventional method and the digital method.
Using blind and fit-only parameter in DE-Seq pakage, expressions of genes in all samples were changed to count per gene, using RNA-Seq protocol on Illumina HiSeq2500 platform
Using Bowtie2 (version 2.0.2), sequenced reads were mapped to an EPEC O127:H6 reference genome (EMBL/GenBank accession codes FM180568, FM180569, and FM180570).
using RNeasy Mini Kit
uspA__U_N0075_r1
uspA__U_N0075_r2
uspA__U_N0075_r3
uspA upregulation, 0.075 mg/mL norfloxacin
UVA irradiated chemostat for 1 h, run 1
UVA irradiated chemostat for 1 h, run 2
UVA irradiated chemostat for 1 h, run 2 dye swap
UVA irradiated chemostat for 1 h, run 3
UVA irradiated chemostat for 50 h, run 1
UVA irradiated chemostat for 50 h, run 2
UVA irradiated chemostat for 50 h, run 3
uvrA___U_N0025_r1
uvrA___U_N0025_r2
uvrA___U_N0025_r3
uvrA upregulation, amp 50ug/ml, 0.0125% arabinose, 0.025ug/ml norfloxacin OD ~0.3
UvrY - ChIP-exo
UvrY (Response regulator of the BarA/UvrY two-component system)
V1
V1 biological replicate
Valine addition
VALUE is Log (base 2) of the ratio of the mean of Channel 2 (usually 635 nm) to Channel 1 (usually 532 nm)
VALUE is Log (base 2) of the ratio of the median of Channel 2 (usually 635 nm) to Channel 1 (usually 532 nm)
VALUE=log2(Cy3_signal/Cy5_signal)=log2(SIGNAL_GREEN/SIGNAL_RED)
VALUE=log2(Cy5_signal/Cy3_signal)=log2(SIGNAL_RED/SIGNAL_GREEN)
VALUEs are calculated as log2-transformed (test/ref) ratios after background correction and limma's LOESS normalization
vector: pET-28a
vector: pET-28a-BnTR1
Vector rep1
Vector rep2
Vector rep3
Veg
verified with in-house pipeline
Vertis Biotechnologie AG bioinformatics department did a preliminary analysis of the high-throughput sequencing results which included the mapping of the reads against E. coli genome (NC_000913 downloaded from NCBI genome database).
Viable clones of the UvsW-expressing strains GJ13531 (Δrho) and GJ13507 (ΔnusG) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531/pHYD2411 and GJ13507 /pHYD2412 on glucose-minimal A plates supplemented with Xgal and IPTG at 200 μM (for Δrho) or 3 μM (for ΔnusG), as previously described
Visualizations for assessing the quality of the array data
W3110 (KCTC 2223)
W3110 (lacI-deleted) strain harboring pKK223-3
W3110  lsrK mutants
W3110 lsrK mutants
W3110 lsrK mutants, biological rep1
W3110 lsrK mutants, biological rep2
W3110 lsrR  mutants
W3110 lsrR mutants, biological rep1
W3110 lsrR mutants, biological rep2
W3110 overexpressing pck
W3110 rpoC-6xHis::kan gal490
W3110 rpoC-6xHis::kan greA::tet, greB::amp
W3110 trpR2,min+.2%glucose, 30 ug RNA
W3110 trpR2 -trp, 30 ug total RNA
W3110 trpR2+trp, 30 ug total RNA
W3110 wild type
W3110 wild type, biological rep1
W3110 wild type, biological rep2
W3110 wt, min+.2%glucose, 30 ug RNA
W3110 wt-trp, 30 ug total RNA
W3110 wt+trp, 30 ug total RNA
Washed pellets were resuspended in 1 ml of TESS buffer (10 mM Tris-Cl pH7.5, 1 mM EDTA, 250 mM NaCl, 0.02% SDS, 0.2% Tween-20) with addition of proteases inhibitors cocktail (cOmplete ultra EDTA free, Roche) and RNAse A (Thermo Scientific). Resulting suspensions were sonicated with parameters optimized to obtain DNA fragments between 200 and 700 bp (SONOPULS HD 3100). Lysates were diluted with 1 ml of TES buffer and 100 μl of ANTI-FLAG® M2 affinity gel (Sigma-Aldrich) was added. Immunoprecipitation was performed for 1.5-2 hours at room temperature with moderate mixing, then affinity gel was washed 4 times by repeating steps of centrifugation (1.5 minute, 1000xg at room temperature) and resuspention (x2 with 1 ml of TESS buffer, x1 with 1 ml of TES buffer, x1 with 1 ml of TE buffer).
was washed with 70 percent ethanol, resuspended in 30 ul water, and held at 4 deg. C for
We compared the microarray-determined mRNA profiles (Affymetrix E. coli Genome 2.0 Array) of Δfur and WT genotypes in response to ciprofloxacin treatment (100 ng/ml) with those of untreated cultures. We used two biological replicates per genotype.
We developed in-house computational and statistical analysis tools for use with the E. coli tiling array.  We used a previous study (Choe et al., 2005) as a model for perfect match adjustment on single arrays.  Analysis scripts were written in Perl, MatLab, and R to standardize the statistical manipulations across all data sets. The output file from the scanning process is a CEL file. The raw CEL data were used as the basis for the manuscript; no processed data are available.
We established a method for preparing five different cDNA  libraries each with its own barcode for Illumina sequencing. Each 6-nt barcode allows multiplexing all five in vitro and  in vivo preparations in a single sequencing analysis. our method introduces internal control sequences to the library  that are subjected to the artifact errors, but are not for RNAP  errors. The 5’ fragment of the 5.7 kb RNA  transcripts was reverse transcribed to make the cDNA.  The cDNA was subjected to PCR reactions that generated  six  200 bp segments. The primers contained a specific barcode  for each of the five starting preparations and the inner Illuminasequencing  adapters. The 2nd-step of PCR generated  the final cDNA libraries for the Illumina sequencing by using  the 1st-step PCR product as a template and primers containing  the outer sequencing adapters in the 5’ tails.
We extracted RNA using RNAprotect Bacteria reagent (Qiagen) and RNeasy Mini Kit (Qiagen) combined with RNase-Free DNase Set (Qiagen) according to the manufacturer’s instructions.
We grew cells in 10 ml M9 minimal medium to OD600=0.5-0.6. Then, we divided each culture into 500µl aliquots to which we added the appropriate concentration of NA.
We incubated each aliquot at 37ºC for 4 hours with NA
were above 2 standard deviations of the background. We generated expression data tables
were averaged and listed in a new file.
were immediately frozen in liquid nitrogen and stored at -80 deg. C.  For RNA isolation,
We then used the mapped files to run Cufflinks (estimates the relative abundance of the transcripts) and after Cuffdiff to find significant changes in transcript expression when comparing two samples (Trapnell, Williams et al. 2010).
We used an Illumina NextSeq 500 system and a MID 150 Kit with 1x75 bp read length. Base-calling was perform online during the sequencing procedure with the Real-Time Analysis (RTA) software version 2.4.11 and System Suite Version 2.1.2.1.
We use Rockhopper for alignment and the complete analysis of data
When cultures reached OD595 ≈ 0.470 (~ 200 min), two cultures were made 3 µM mercuric chloride (HgCl2) or 3 µM phenylmercuric-acetate (PMA) and the third was left as an unexposed control. Duplicate 1 ml aliquots of each culture were collected at 0 (unexposed control only), 10, 30, 60 min after mercurial exposure and immediately centrifuged at 21 krpm, for 3 min at 4°C. Spent medium was aspirated and cell pellets were frozen at -70°C within 5 min after collection.
When E. coli cells were cultivated to the exponential growth phase (OD600 = 0.5) in Riesenberg medium, 3 or 10 mM heptanoic acid was treated to BL21(DE3) and K-12 MG1655, respectively. After 3 h incubation, the E. coli cells were harvested for transcriptome analysis
When OD600 of the culture reached 0.54±0.06, cells were treated with 100 µg/ml of (-)-Roemerine. Since the alkaloid was dissolved in DMSO, control cells were also treated with the same amount of DMSO.
When reaching  the optical density indicated (OD600=0.6-0.8) the culture was bisected and DNA gyrase poison (ciprofloxacin, oxolinic acid or microcin B17) was added to the first half (+A samples), while second served as a control (-A samples).
When the cultures reached an OD600 0.6 they were split into two flasks, each containing 20 ml of the culture. One was treated with a subinhibitory concentration of purified colicin M, while the untreated served as a control. 2-ml culture aliquotes were harvested from each flask after 30 min and 60 min incubation at 37°C  and were mixed with 4 ml RNAProtect Bacteria Reagent (Qiagen).
When the cultures reached the desired density, 2 ml of culture was added to 4 ml of RNAprotect Bacteria Reagent (Qiagen).  The mixture was incubated at room temperature for 5 min and then centrifuged at 5000 g for 10 min.  The supernatant was removed and the pellets were stored at -80C.  RNA was isolated using the Norgen Total RNA Purification Kit (Product #17200) according to the manufacturer’s directions except in the last step the RNA was eluted in 35 uL.
When the samples had reached an OD600 of 0.4-0.5, 25 ml of each culture was added to a 2.5 ml mixture of cold 95% ethanol and 5% phenol to preserve the mRNA. The cells were cooled rapidly on ice and immediately harvested by centrifugation at 4°C, and the pellet was frozen on dry ice.
Whole bacterial cell RNA transcriptome
Whole cell, aspC KO, M9 and 0.4% glucose
Whole cell, cysA KO, M9 and 0.4% glucose
Whole cell, cysG KO, LB and 0.3% glucose
Whole cell, cysH KO, LB and 0.3% glucose
Whole cell, dcd KO, LB and 0.3% glucose
Whole cell, dcd KO, M9 and 0.3% glucose
Whole cell, entF KO, M9 and 0.4% glucose
Whole cell, fadR KO, LB and 0.3% glucose
Whole cell, fadR KO, M9 and 0.3% glucose
Whole cell, fepA KO, LB and 0.3% glucose
Whole cell, fepA KO, M9 and 0.3% glucose
Whole cell, fliY KO, M9 and 0.4% glucose
Whole cell, gabT KO, M9 and 0.4% glucose
Whole cell, galE KO, M9 and 0.4% glucose
Whole cell, kefB KO, M9 and 0.4% glucose
Whole cell, khc KO, M9 and 0.4% glucose
Whole cell, lacA KO, LB and 0.3% glucose
Whole cell, lacA KO, M9 and 0.3% glucose
Whole cell, lplA KO, M9 and 0.4% glucose
whole cell lysate
Whole cell lysates were clarified by brief centrifugation. Ribosome footprints were created using Mnase digestion (45 enzyme units per absorbance unit of lysate at 260nm). Using sucrose gradients the monosome fraction of lysate was isolated and footprints were size selected and converted to a cDNA library. Total RNA was extracted from purified lysate for a simultaneous RNA-seq library production for total RNA samples. Small RNA and ribosomal RNA subtraction was performed in total RNA samples using MEGAClear (ThermoFisher) and MicrobExpress (ThermoFisher) kits. Subtracted total RNA was then subjected to alkaline fragmentation prior to library preparation.
Whole cell, mgtA KO, M9 and 0.4% glucose
Whole cell, mhpD KO, M9 and 0.4% glucose
Whole cell, ppk KO, LB and 0.3% glucose
Whole cell, ppk KO, M9 and 0.3% glucose
Whole cell, putP KO, M9 and 0.4% glucose
Whole cell, rfbA KO, M9 and 0.4% glucose
Whole cell, sdhC KO, M9 and 0.4% glucose
Whole cell, trpD KO, M9 and 0.4% glucose
Whole cell, ugpC KO, M9 and 0.4% glucose
Whole cell, WT, LB and 0.3% glucose
Whole cell, WT, M9 and 0.3% glucose
Whole cell, WT, M9 and 0.4% glucose
Whole cell, wzc KO, LB and 0.3% glucose
Whole cell, wzc KO, M9 and 0.3% glucose
Whole cell, yghD KO, LB and 0.3% glucose
Whole cell, yghD KO, M9 and 0.3% glucose
WIG files were normalized by using an in-house script that reads in the raw WIG files while excluding counts from all 22 rRNA genes. A simple global normalization approach was utilized that multiplied the count at each base location by 1 billion and divides that value by the sum of base counts at all base locations in the file. This normalization strategy is anlogous to the Total Count approach used for normalizing gene-specific read alignments. In this way, the base counts are expressed as parts per billion.
WIG files were viewed and annotated using Jbrowse and Integrated Genome Viewer.
Wiggle files were created by center mapping the reads between 20-40bps. Using a 10bp trim on either side of the read then mapping the read across the remaining location using Plastid.
wild type
wild-type
wild type, 10% H2O2
wild-type 1.0 ug/ml norfloxacin
wild-type 15 min (1) slide 1
wild-type 15 min (1) slide 2
wild-type 15 min (2) slide 1
wild-type 15 min (2) slide 2
wild-type 1 hour (1) slide 1
wild-type 1 hour (1) slide 2
wild-type 1 hour (2) slide 2
wild-type 1 hour (3) slide 1
wild-type 1 hour (3) slide 2
wild-type 2 hour (1) slide 1
wild-type 2 hour (1) slide 2
wild-type 2 hour (2) slide 1
wild-type 2 hour (2) slide 2
wild-type 2 hour (3) slide 1
wild-type 2 hour (3) slide 2
wild type, 30% H2O2
wild-type 30 min (1) slide 1
wild-type 30 min (1) slide 2
wild-type 30 min (2) slide 1
wild-type 30 min (2) slide 2
wild-type 3 hour (1) slide 1
wild-type 3 hour (1) slide 2
wild-type 3 hour (2) slide 1
wild-type 3 hour (2) slide 2
wild-type 3 hour (3) slide 1
wild-type 3 hour (3) slide 2
wild-type 4 hour (1) slide 1
wild-type 4 hour (1) slide 2
wild-type 4 hour (2) slide 1
wild-type 4 hour (2) slide 2
wild-type 4 hour (3) slide 1
wild-type 4 hour (3) slide 2
wild-type 5 hour (1) slide 1
wild-type 5 hour (1) slide 2
wild-type 5 hour (2) slide 1
wild-type 5 hour (2) slide 2
wild-type 5min (1) slide 1
wild-type 5min (1) slide 2
wild-type 5min (2) slide 1
wild-type 5min (2) slide 2
wild-type 6 hour (1) slide 1
wild-type 6 hour (1) slide 2
wild-type 6 hour (2) slide 1
wild-type 6 hour (2) slide 2
Wild-type Aerobic A
Wild-type Aerobic B
Wild-type Anaerobic A
Wild-type Anaerobic B
Wild type and the mutant were grown on minimal M9 media with 4 g/L glucose as a sole carbon source at 37C with aeration (+O2) or nitrogen sparging (-O2)
wild type_anoxic (NO3)_glycerol
wild type_anoxic (NO3)_glycerol + propionate
wildtype, brain heart infusion agar, rep 1
wildtype, brain heart infusion agar, rep 2
wildtype, brain heart infusion agar, rep 3
wildtype, brain heart infusion agar +Sucrose+MgSO4, rep 1
wildtype, brain heart infusion agar +Sucrose+MgSO4, rep 2
wildtype, brain heart infusion agar +Sucrose+MgSO4, rep 3
Wild-type_cDNA_Aerobic
Wild-type_cDNA_Anaerobic
Wild-type Cells
Wild-type Cells Replicate 1
Wild-type Cells Replicate 2
Wild-type Cells Replicate 3
wild-type cells with 0.025 ug/ml norfloxacin
wild-type cells with 0.050 ug/ml norfloxacin
wild-type cells with 0.075 ug/ml norfloxacin
wild-type cells without norfloxacin
wildtype colony morphology
Wild type control
Wild type control (0 min)
Wild type control (10 min)
Wild type control (15 min)
Wild type control (20 min)
Wild type control (2.5 min)
Wild type control (30 min)
Wild type control (5 min)
Wild type control (60 min)
wild type E0, biological rep1
wild type E0, biological rep2
wild type E0, biological rep3
Wild-type E. coli ATCC 25922 replicate 1
Wild-type E. coli ATCC 25922 replicate 2
Wild type E. coli K-12 (strain BW38038) and BW39452(ΔrpoS) cultures were grown on MOPS glucose minimal medium with 0.2% glucose as sole carbon source at 37°C, pH was initially 7.4,  and the agitation speed was 500 rpm. Culture samples were harvested during logarithmic growth and  following entry into stationary phase for the WT and rpoS mutant. OD600 measurements were made on a Beckman Coulter DU 800 spectrophotometer. Samples were harvested directly into ice-cold RNAlater at a 1:1 dilution to protect RNA from degradation and cells then were pelleted by centrifugation at 8000rpm for 10 minutes. Cell pellets were stored at -80°C in an equal volume of RNAlater prior to RNA extraction.
Wild type E. coli K-12 (strain BW38038) and BW39452(ΔrpoS) cultures were grown on MOPS glucose minimal medium with 0.2% glucose as sole carbon source in a 2L B. Braun Biostat® B fermenter with working volume of 1 L MOPS minimal medium with 0.2% glucose, at 37°C, pH was kept constant at 7.4 by the addition of 1 M NaOH, and dissolved oxygen was maintained above 40% of saturation by adjusting the agitation speeds in the range of 270–500 rpm with fixed 1.5 liter/min air flow. Culture samples were harvested by using a homemade sampling device seven times during logarithmic growth and three times following entry into stationary phase for the WT and two times during logarithmic phase and three times during stationary phase for the rpoS mutant. OD600 measurements were made on a Beckman Coulter DU 800 spectrophotometer. Samples were harvested directly into ice-cold RNAlater at a 1:1 dilution to protect RNA from degradation and cells then were pelleted by centrifugation at 8000rpm for 10 minutes. Cell pellets were stored at -80°C in an equal volume of RNAlater prior to RNA extraction.
Wildtype E. coli O157 treated with 6 ug/ml triclosan for 30 min, biological rep 1
Wildtype E. coli O157 treated with 6 ug/ml triclosan for 30 min, biological rep 2
Wildtype E. coli O157 treated with 6 ug/ml triclosan for 30 min, biological rep 3
Wildtype E. coli O157 untreated, biological rep 1
Wildtype E. coli O157 untreated, biological rep 2
Wildtype E. coli O157 untreated, biological rep 3
Wild type E.coli SE15 vs. LuxS mutant E.coli SE15
wildtype Escherichia coli
wild type grown to logarithmic phase
wild type grown to transition phase
wild-type in ala media_1
wild-type in ala media_2
wild-type in gln media_1
wild-type in gln media_2
Wild-type IrrE, biological rep1
Wild-type IrrE, biological rep2
Wild-type IrrE, biological rep3
Wild Type (K10)  M9 + 0.2% Glycerol, 0.2% Tryptone, 40 mM Suc. at 30 C Mid Log
Wild Type (K10)  M9 + 0.2% Glycerol, 0.2% Tryptone, 40 mM Suc. at 30 CMid Log
Wild Type (K10)  M9 0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log
wild type MG1655
wild-type MG1655
wild-type MG1655 + glycolaldehyde 10 mM
Wild-type (MG1655) RNA-seq
Wild-type (MG1655) T0 RNA rep 2
Wild-type (MG1655) T0 RP rep 1
Wild-type (MG1655) T0 RP rep 2
Wild-type (MG1655) T1 RNA rep 1
Wild-type (MG1655) T1 RNA rep 2
Wild-type (MG1655) T1 RP rep 1
Wild-type (MG1655) T1 RP rep 2
Wild-type (MG1655) T2 RNA rep 1
Wild-type (MG1655) T2 RNA rep 2
Wild-type (MG1655) T2 RP rep 1
Wild-type (MG1655) T2 RP rep 2
Wild Type (N3433)  in M9  0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
Wild Type (N3433)  M9  0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
Wild Type (N3433)  M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
wild type_oxic_glycerol
wild type_oxic_glycerol + propionate
wild-type pBAD-ryhB#1 + arabinose
wild-type pBAD-ryhB#1 +FeSO4 + arabinose
wild-type pBAD-ryhB #2 + arabinose
wild-type pBAD-ryhB#2 +FeSO4 + arabinose
wild-type pNM12#1 +arabinose
wild-type pNM12#1 +FeSO4 + arabinose
wild-type pNM12#2 + arabinose
wild-type pNM12#2 +FeSO4 + arabinose
wild type rep 1
wild type rep 2
Wild-types cells were grown in MOPS medium with 0.2% glucose, leucine, isoleucine, valine, glycine, phenylalanine, threonine (40 mg/ml) and uracil (50 mg/ml) until mid-log phase and treated with 0.5mg/ml serine hydroxamate (SHX) for 20min at 37°C with vigorous shaking.
Wild-types cells were grown in MOPS medium with 0.2% glucose, leucine, isoleucine, valine, glycine, phenylalanine, threonine (40 mg/ml) and uracil (50 mg/ml) until mid-log phase at 37°C with vigorous shaking.
Wild-types cells were grown in MOPS medium with 0.2% glucose, leucine, isoleucine, valine, glycine, phenylalanine, threonine (40 mg/ml) and uracil (50 mg/ml) until mid-log phase (OD600~0.4) at 37°C with vigorous shaking.
wild type SdiA
wildtype strain; minimal medium
Wildtype strain, rep1
wildtype strain, rep2
Wildtype triclosan treated biological rep 1
Wildtype triclosan treated biological rep 2
Wildtype triclosan treated biological rep 3
Wildtype untreated biological rep 1
Wildtype untreated biological rep 2
Wildtype untreated biological rep 3
wild type, without H2O2
with D-galactose
without D-galactose
without Symbioflor
with/without 2.5 mM Fumaric acid
write.table(norm.temp, file=\
wt
WT
WT_01_rep1
WT_02_rep1
WT_03_rep1
WT_04_rep1
WT_04_rep2
WT_04-R_rep1
WT_04_TEX
WT_08_rep1
WT_0_Hx Rep1
WT_0_Hx Rep2
WT_0_Hx Rep3
WT 0 μg/ml NA rep1
WT 0 μg/ml NA rep2
wt_1
WT_1
WT-1
WT 100 μg/ml NA rep1
WT 100 μg/ml NA rep2
WT 100 μg/ml NA rep3
WT1088 in LB at 37 Mid Log Phase
WT1088 vs. dpiA 2x Overexpression pHI1429 in LB at 37 Mid Log Phase Trial A
WT1088 vs. dpiA 2x Overexpression pHI1429 in LB at 37 Mid Log Phase Trial B
WT 10 μg/ml NA rep1
WT 10 μg/ml NA rep2
WT_120 (Low Dilution) Rep1
WT_120 (Low Dilution) Rep2
WT_120 (Low Dilution) Rep3
Wt – 120 min
WT_12h_rep1
WT_12h_rep2
WT_14_rep1
wt 150 minutes growth rep1
wt 150 minutes growth rep2
wt 150 minutes growth rep3
WT_15 (Low Dilution) Rep1
WT_15 (Low Dilution) Rep2
WT_15 (Low Dilution) Rep3
WT_15min_rep1
WT_16_rep1
WT_16-R_rep1
Wt – 180 min
WT_180min_rep1
wt_1_input
wt_1_IP
WT1_IPTG
WT 1min rep7
wt_2
WT_2
WT-2
WT 22°C
wt 240 minutes growth rep1
wt 240 minutes growth rep2
wt 240 minutes growth rep3
WT_24h_rep1
WT_24h_rep2
wt_2_input
wt_2_IP
WT2_IPTG
WT_3
WT-3
Wt – 300 min
WT_30 (Low Dilution) Rep1
WT_30 (Low Dilution) Rep2
WT_30 (Low Dilution) Rep3
WT_30min_rep1
WT_30min_rep2
WT_30min-R_rep1
WT_30min_TEX
WT3110_1
WT3110_2
WT3110_3
wt 360 minutes growth rep1
wt 360 minutes growth rep2
wt 360 minutes growth rep3
WT 37°C
WT_37C
Wt – 420 min
WT_45 (Low Dilution) Rep1
WT_45 (Low Dilution) Rep2
WT_45 (Low Dilution) Rep3
WT_48h_rep1
WT_48h_rep2
wt+50ug/ml Trp, 30 ug total RNA
WT_60 (Low Dilution) Rep1
WT_60 (Low Dilution) Rep2
WT_60 (Low Dilution) Rep3
Wt – 60 min
WT_6h_rep1
WT_6h_rep2
wt 90 minutes growth rep1
wt 90 minutes growth rep2
wt 90 minutes growth rep3
WT 9min rep7
WT 9min rep8
WTA1
WT_acetate
WT acetate 1
WT acetate 2
WT + ade
wt aerobic
wt aerobic  AN rep 1
wt aerobic  AN rep 2
wt aerobic  AN rep 3
wt aerobic rep 1
wt aerobic rep 2
wt aerobic rep 3
wt anaerobic
wt anaerobic 
wt anaerobic  AN rep 1
wt anaerobic  AN rep 2
wt anaerobic  AN rep 3
wt anaerobic plus NO2
wt anaerobic plus NO2  AN rep 1
wt anaerobic plus NO2  AN rep 2
wt anaerobic plus NO2  AN rep 3
wt anaerobic plus NO2 rep 1
wt anaerobic plus NO2 rep 2
wt anaerobic plus NO2 rep 3
wt anaerobic plus NO3
wt anaerobic plus NO3  AN rep 1
wt anaerobic plus NO3  AN rep 2
wt anaerobic plus NO3  AN rep 3
wt anaerobic plus NO3 rep 1
wt anaerobic plus NO3 rep 2
wt anaerobic plus NO3 rep 3
wt anaerobic rep 1
wt anaerobic rep 2
wt anaerobic rep 3
WT_Anaerobic_RNAseq_A_Tag_Count.txt: U00096.2
WT_Anaerobic_RNAseq_A_WIG.wig: U00096.2
WT_Anaerobic_RNAseq_B_Tag_Count.txt: U00096.2
WT_Anaerobic_RNAseq_B_WIG.wig: U00096.2
WTA_time0
WTA_time10
WTA_time20
WTA_time2.5
WTA_time5
WTA_time7.5
wt at T0
wt at T1h
wt at T4h
WTB1
WTB_time0
WTB_time2.5
WTB_time7.5
WTC3
WT cells were treated with 10 mM Glycolaldehyde for 30 min whenever the culture OD600nm reached ~1.
WT_CPR_1
WT_CPR_2
WT_D_N1000_r1
WT_D_N1000_r2
wt E. coli, after butanol treatment
wt E. coli, before butanol treatment
wt_EE_1
wt_EE_2
WT_exp1_mRNA
WT_exp1_ribosome
WT_exp2_mRNA
WT_exp2_ribosome
WT_exp3_mRNA
WT_exp3_ribosome
WT_exp4_mRNA
WT_exp4_ribosome
WT exp mRNA
WT exp RPF
WT_fructose
WT fructose 1
WT fructose 2
WT_glucose
WT glucose 1
WT glucose 2
WT_glucose_log
WT_glucose_log_TEX
WT-glucose-Rep1
WT-glucose-Rep2
WT glucose_replicate1
WT glucose_replicate2
WT glucose_replicate3
WT_glucose_stat
WT_glucose_stat_TEX
WT_glycerol_replicate1
WT_glycerol_replicate2
WT_glycerol_replicate3
WT (K10) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 0C Mid Log 6.0' post rif
WT (K10) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log 1.5' post rif
WT (K10) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log 3' post rif
WT (K10) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log 4.5' post rif
WT (K10) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log 6.0' post rif
WT (K10)  M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log
WT (K10)  M9  0.2% Glycerol 0.2% Tryptone 40 mM Succinate at 30 C Mid Log
WT (K10) vs Eno- (DF261) in M9 + 0.2% Glycerol, 0.2% Tryptone, 40 mM Suc. at 30 C Mid Log Trial A
WT (K10) vs Eno- (DF261) in M9  0.2% Glycerol, 0.2% Tryptone, 40 mM Suc. at 30 C Mid Log Trial B
WT (K10) vs Eno- (DF261)  M9 + 0.2% Glycerol,  0.2% Tryptone, 40 mM Suc. at 30 C Mid Log Trial A1
WT (K10) vs Eno- (DF261)  M9 + 0.2% Glycerol, 0.2% Tryptone, 40 mM Suc. at 30 C Mid Log Trial B1
WTKasRep1_0min
WTKasRep1_15min
WTKasRep1_20min
WTKasRep1_2min
WTKasRep1_4min
WTKasRep1_6min
WTKasRep1_8min
WTKasRep2_0min
WTKasRep2_10min
WTKasRep2_15min
WTKasRep2_20min
WTKasRep2_2min
WTKasRep2_4min
WTKasRep2_6min
WTKasRep2_8min
WT- Keio Sample 1
WT- Keio Sample 20
WT- Keio Sample 39
wt + Leu vs. wt - Leu
wt_LS_1
wt_LS_2
WT + L-trp
WT-mannose
wt_ME_1
wt_ME_2
WT_minimal_mRNA
WT_minimal_ribosome
WT_minus_2DG_1
WT_minus_2DG_2
WT_minus_2DG_3
WT-mucus-P1
WT-mucus-P2
WT_N0000_r1
WT_N0000_r2
WT_N0025_r1
WT_N0025_r2
WT_N0050_r1
WT_N0050_r2
WT_N0075_r1
WT_N0075_r2
WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 1.5' post rif
WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 3.0' post rif
WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 3' post rif
WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 4.5' post rif
WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 6' post rif
WT (N3433)  M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
WT (N3433) M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 6' post rif
WT (N3433) vs Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial A2
WT (N3433) vs Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial B2
WT (N3433) vs Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial C2
WT (N3433) vs RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial A
WT (N3433) vs RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial A1
WT (N3433) vs RhlB- (SU02) in M9 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial B
WT (N3433) vs RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial B1
WT (N3433) vs RhlB- (SU02) in M9  0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial C
WT (N3433) vs RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial C1
WT NaCl 1
WT NaCl 2
WT NO3 1
WT NO3 2
WT NO3 w/propionate 1
WT NO3 w/propionate 2
WT_noCPR_1
WT_noCPR_2
WT_N_strv
WT_N_strv_TEX
WT -O2
WT -O2 1
WT +O2 1
WT O2 1
WT -O2 2
WT +O2 2
WT O2 2
WT -O2 3
WT +O2 3
WT O2 w/propionate 1
WT O2 w/propionate 2
wt or mutant: P2-08
wt or mutant: P2-51
wt or mutant: P2-58
wt or mutant: P2-66
wt or mutant: P2-77
wt or mutant: PF2-04
wt or mutant: PF2-08
wt or mutant: PF2-12
wt or mutant: WT @ 0.8%But
WT pH5.5
WT pH5.5 1
WT pH5.5 2
WT pH 5.6 A
WT pH 5.6 B
WT pH 5.6 C
WT pH 7.2+15% sucrose A
WT pH 7.2+15% sucrose B
WT pH 7.2+15% sucrose C
WT_plus_2DG_1
WT_plus_2DG_2
WT_plus_2DG_3
WT PQ
WT PQ 1
WT PQ 2
WT rep1
WT rep 1
WTRep1_0min
WTRep1_10min
WTRep1_15min
WTRep1_20min
WTRep1_2min
WTRep1_4min
WTRep1_6min
WTRep1_8min
wt.rep1.ee
wt.rep1.me
WT rep2
WT rep 2
WTRep2_0min
WTRep2_10min
WTRep2_15min
WTRep2_20min
WTRep2_2min
WTRep2_4min
WTRep2_6min
WTRep2_8min
wt.rep2.ee
wt.rep2.me
WT rep3
WT rep 3
WT_RNA-Seq
wt_S_1
wt_S_2
WT (SH3208) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
WT (SH3208) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 1.5' post rif
WT (SH3208) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 3' post rif
WT (SH3208) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 4.5' post rif
WT (SH3208) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 6' post rif
WT (SH3208)  M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
WT (SH3208) vs N-RNaseE (BZ453)  in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
WT (SH3208) vs N-RNaseE (BZ453)  in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial A
WT (SH3208) vs N-RNaseE (BZ453)  in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial B
WT (SH3208) vs N-RNaseE (BZ453)  in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial C
WT strain treated with glycolaldehyde first repetition
WT strain treated with glycolaldehyde second repetition
WT strain treated with glycolaldehyde third repetition
WT strain without glycolaldehyde first repetition
WT strain without glycolaldehyde second repetition
WT strain without glycolaldehyde third repetition
wt_T_1
wt_T_2
wt_T_3
wt +trp vs. -trp, min+.2%glucose, W3110
wt_TS_1
wt_TS_2
wt_un_1
wt_un_2
wt_un_3
WT UvsW_replicate1
WT UvsW_replicate2
WT UvsW_replicate3
WT_vs_dcd
WT_vs_ndk
WT_vs_recA730
WT with DPD 1 (RNA-seq)
WT with DPD 2 (RNA-seq)
WT with Fe 1 (RNA-seq)
WT with Fe 2 (RNA-seq)
wzc KO LB rep1
wzc KO LB rep2
wzc KO M9 rep1
wzc KO M9 rep2
X515_V1_T4_424287A03
X515_V1_T4_475655A02
X515_V1_T6_475649A04s
X515_V1_T7_475654A02
X515_V1_T8_475585A04
X515_V2_T4_424219A04
X515_V2_T4_475655A03
X515_V2_T6_475644A04
X515_V2_T7_475649A01
X515_V2_T8_424219A01s
X515_V3_T4_475585A02s
X515_V3_T6_424221A04
X515_V3_T7_475649A02
X515_V3_T8_475641A04
X515_V4_T4_475585A03
X515_V4_T4_475644A01
X515_V4_T6_424221A03
X515_V4_T7_424287A04
X515_V4_T8_475655A04
X520_V1_T4_424221A01
X520_V1_T6_475649A03
X520_V1_T7_475655A01
X520_V1_T8_475641A01
X520_V2_T3_424221A02
X520_V2_T4_475641A03
X520_V2_T6_424287A02
X520_V2_T7_475654A01
X520_V2_T8_424219A02
X520_V3_T4_475654A04
X520_V3_T6_475641A02
X520_V3_T7_475644A02s
X520_V3_T8_424219A03
X520_V4_T4_475654A03
X520_V4_T6_424287A01
X520_V4_T7_475644A03
X520_V4_T8_475585A01
Xpression (https://depts.washington.edu/cshlab/html/rnaseq.html) was used for RNA-Seq data processing.
Xpression was used for filtering and trimming reads.
Xuzhou21 cured of the pO157_Sal plasmid
yajL mutant (genetic background MG1655)
year: 2000
year: 2001
year: 2003
year: 2004
year: 2005
year: 2006
year: 2007
year: 2008
yebF__U_N0075_r1
yebF__U_N0075_r2
yebF__U_N0075_r3
yebF upregulation, 0.075ug/ml norfloxacin
yghD KO LB rep1
yghD KO LB rep2
yghD KO M9 rep1
yghD KO M9 rep2
yoeB__U_N0075_r1
yoeB__U_N0075_r2
yoeB__U_N0075_r3
yoeB upregulation, 0.075 mg/mL norfloxacin
yPileup was used to generate count data for the whole genome - Example:  pyPileup.py --file_type=novo -f DL4184.novo --tab=NC000913.3.tab --chr=Wholechom.txt -- ignorestrand
yPileup was used to generate count data for the whole genome - Example:  pyPileup.py --file_type=novo -f DL4900.novo --tab=NC000913.3.tab --chr=Wholechom.txt.gz -- ignorestrand
zipA__U_N0075_r1
zipA__U_N0075_r2
zipA__U_N0075_r3
zipA upregulation, 0.075ug/ml norfloxacin
zi = (Ri – mean(R)) / sd(R), where zi is the z-score for each element, Ri is the log-ratio for each element, and sd(R) is the standard deviation of the log-ratio. With this criterion, the elements with a z-score > 2 standard deviations would be the significantly differentially expressed genes.
Zn-depleted custom-built chemostats were grown for 50 h.  At this point, ZnSO4.7H2O in water was added to a final concentration of 0.2 M in the chemostat.  A 10 ml sample of culture was taken using a polypropylene pipette tip immediately prior to Zn addition and 2.5, 7, 10 and 30 min after addition.  The culture was pipetted directly into RNAprotect (Qiagen) to stabilize RNA.  Total RNA was purified using Qiagen’s RNeasy Mini kit as recommended by the suppliers.  RNA was quantified using a BioPhotometer (Eppendorf).  A control experiment was carried out in which water was added.  
∆zwf parent Sample 2
∆zwf parent Sample 21
∆zwf parent Sample 40
zwf suppressor 1-1 Sample 22
zwf suppressor 1-1 Sample 3
zwf suppressor 1-1 Sample 41
zwf suppressor 1-2 Sample 23
zwf suppressor 1-2 Sample 4
zwf suppressor 1-2 Sample 42
ΔbolA
Δcra_acetate
Δcra acetate 1
Δcra acetate 2
Δcra_fructose
Δcra fructose 1
Δcra fructose 2
Δcra_glucose
Δcra glucose 1
Δcra glucose 2
Δfur with DPD 1 (RNA-seq)
Δfur with DPD 2 (RNA-seq)
Δfur with Fe 1 (RNA-seq)
Δfur with Fe 2 (RNA-seq)
ΔgadE pH5.5
ΔgadE pH5.5 1
ΔgadE pH5.5 2
ΔgadW pH5.5
ΔgadW pH5.5 1
ΔgadW pH5.5 2
ΔgadX pH5.5
ΔgadX pH5.5 1
ΔgadX pH5.5 2
ΔompR NaCl 1
ΔompR NaCl 2
ΔoxyR PQ
ΔoxyR PQ 1
ΔoxyR PQ 2
Δrac
Δrac 1
Δrac 2
Δrac + 20 ug/ml bicyclomycin
Δrac + 20 ug/ml bicyclomycin 1
Δrac + 20 ug/ml bicyclomycin 2
Δrac ΔnusG
Δrac ΔnusG 1
Δrac ΔnusG 2
ΔsoxR PQ
ΔsoxR PQ 1
ΔsoxR PQ 2
ΔsoxS PQ
ΔsoxS PQ 1
ΔsoxS PQ 2
σ32 30°C rep1
σ32 30°C rep2
σ32 30°C short RNase
σ32 43°C rep1
σ32 43°C rep2
σ32 43°C short RNase
σ32 ChIP DNA, control
σ32 ChIP DNA, heat
σ32 ChIP DNA, short RNase digestion
σ70 IP ChIP-seq Aerobic A
σ70 IP ChIP-seq Aerobic B
σ70 IP ChIP-seq Anaerobic A
σ70 IP ChIP-seq Anaerobic B