"Basecalls performed using Casava versions 1.6 or 1.7."	"data_processing.1"
"Sequenced reads were trimmed for adaptor sequence."	"data_processing.2"
"Trimmed reads were sequentially aligned using Bowtie v0.12.7 to E. coli rRNA and noncoding RNA allowing one mismatch. Reads aligning to any of these indices were discarded."	"data_processing.3"
"The remaining reads were aligned using Bowtie v0.12.7 against E. coli MG1655 genome using parameters -v1 -m2 -k1."	"data_processing.4"
"Bowtie alignments against the E. coli genome were converted to wiggle files. For ribosome footprints and mRNA-seq, the position of each alignment is distributed into several nucleotides in the center of each read. For each read, the center residues that are at least 10 nucleotides away from either ends were given the same score, which is weighted by the length of the fragment [Oh et al,. Cell 147, 1295 (2011)]. Scores therefore represent the number of read alignments attributed to each genomic position under each scoring scheme. For DMS-seq, the position of each alignment was the position immediately 5' of the 5' end of the read."	"data_processing.5"
"Genome_build: NC000913.2"	"data_processing.6"
"Supplementary_files_format_and_content: Wiggle files with two columns: first column containing chromosome positions and second column containing the number of reads mapped to the position (see publication for details)."	"data_processing.7"
"Extraction was performed as described previously (Li et al., 2012; Oh et al., 2011). For ribosome profiling, 200 mL of cell culture were filtered rapidly and the resulting cell pellet was flash-frozen in liquid nitrogen and combined with 650 µL of frozen lysis buffer (10 mM MgCl2, 100mM NH4Cl, 20mM Tris-HCl pH 8.0, 0.1% Nonidet P40, 0.4% Triton X-100, 100 U/mL DNase I (Roche), 1mM chloramphenicol). Cells were pulverized in 10mL canisters pre-chilled in liquid nitrogen. Lysate containing 0.5 mg of RNA was digested for 1 h with 750 U of micrococcal nuclease (Roche) at 25°C. The ribosome-protected RNA fragments were isolated using a sucrose gradient followed by hot acid phenol extraction. For mRNA-seq and DMS-seq, cells were pelleted by centrifuging for 2 min at 8000rpm. Total RNA was then hot acid phenol extracted. Ribosomal RNA and small RNA were removed with MICROBExpress (Ambion) or Ribozero (Epicenter) and MEGAclear (Ambion), respectively."	"extract_protocol_ch1.1"
"The ribosome footprints and fragmented mRNA were ligated to miRNA cloning linker-1 (IDT) using truncated T4 RNA ligase 2 K227Q. The ligated RNA fragments were reverse transribed using the primer 5Phos/GATCGTCGGACTGTAGAACTCTGAACCTGTCGGTGGTCGCC GTATCATT/iSp18/CACTCA/iSp18/CAAGCAGAAGACGGCATACGAATTGATG GTGCCTACAG. The resulting cDNA was circularized with CircLigase (Epicentre) and PCR amplification was done as described previously (Ingolia et al., 2009)."	"extract_protocol_ch1.2"
"All cultures were based on MOPS media with 0.2% glucose (Teknova), with full supplement (Neidhardt et al., 1974) minus methionine. An overnight liquid culture was diluted 400-fold into 200 ml fresh media. The culture was kept in a 1 liter flask at 37°C with aeration until OD420 reached 0.4."	"growth_protocol_ch1.1"
"Escherichia coli"	"organism_ch1.1"
"bacteria"	"source_name_ch1.1"
"mRNA-seq 37°C in WT with plasmid expressing mini-ORF CUA"	"title.1"
"For in vivo DMS modification, 15 mL of exponentially growing E. coli were incubated with 750 µL DMS for 2 min at 37°C. For kasugamycin (ksg) experiments, ksg was added to a final concentration of 10 mg/mL to ΔgcvB cells for 2 min at 37°C prior to DMS modification. DMS was quenched by adding 30 mL 0°C stop solution (30% β-mercaptoethanol, 25% isoamyl alcohol). For in vitro DMS modifications, mRNA was denatured at 95 °C for 2 min, cooled on ice and refolded in 90 µL RNA folding buffer (10 mM Tris pH 8.0, 100 mM NaCl, 6 mM MgCl2) at 37°C for 30 min then incubated in either .2% DMS for 1 min (95°C) or 4% DMS for 5 min (37°C)."	"treatment_protocol_ch1.1"
"RNA-Seq"	"library_strategy.1"
"strain: MG1655 [p-CUA]"	"characteristics_ch1.1"
"treatment: 1mM IPTG"	"characteristics_ch1.2"
"All cultures were based on MOPS media with 0.2% glucose (Teknova), with full supplement (Neidhardt et al., 1974) minus methionine. An overnight liquid culture was diluted 400-fold into 200 ml fresh media. The culture was kept in a 1 liter flask at 37°C with aeration until OD420 reached 0.4."	"growth_protocol_ch1.1"
"Escherichia coli"	"organism_ch1.1"
"bacteria"	"source_name_ch1.1"
"For in vivo DMS modification, 15 mL of exponentially growing E. coli were incubated with 750 µL DMS for 2 min at 37°C. For kasugamycin (ksg) experiments, ksg was added to a final concentration of 10 mg/mL to ΔgcvB cells for 2 min at 37°C prior to DMS modification. DMS was quenched by adding 30 mL 0°C stop solution (30% β-mercaptoethanol, 25% isoamyl alcohol). For in vitro DMS modifications, mRNA was denatured at 95 °C for 2 min, cooled on ice and refolded in 90 µL RNA folding buffer (10 mM Tris pH 8.0, 100 mM NaCl, 6 mM MgCl2) at 37°C for 30 min then incubated in either .2% DMS for 1 min (95°C) or 4% DMS for 5 min (37°C)."	"treatment_protocol_ch1.1"