GSE100233	antibody: Flag
GSE100233	ChIP-Seq
GSE100233	Cultures of Caulobacter (TLS1631-TLS1633) were grown at 30oC in PYE and supplemented with antibiotics, as necessary, at appropriate concentrations. To deplete wild-type non-tagged ParB, exponential-phase cells were washed off xylose and re-introduced to PYE+0.2% glucose for an additional 5 hours. After 4 hours, vanillate was added to induce the expression of flag-parB (WT) or flag-parB (G101S
GSE100233	developmental stage: mixed population, exponential phase
GSE100233	DNA was isolated using the Qiagen Cell Lysis and Protein Precipitation solutions. Detailed protocols are listed in the Supplementary Materials
GSE100233	Escherichia coli
GSE100233	Escherichia coli AB1157
GSE100233	For analysis of ChIP-seq data, Hiseq 2500 Illumina short reads (50 bp) were mapped back to the Caulobacter NA1000 reference genome (NCBI Reference Sequence: NC-011916.1) using Bowtie 1 (Langmead et al., 2009) and the following command:bowtie -m 1 -n 1 --best --strata -p 4 --chunkmbs 512 NA1000-bowtie --sam *.fastq > output.sam. Subsequently, the sequencing coverage at each nucleotide position was computed using BEDTools (Quinlan and Hall, 2010) using the following command: bedtools genomecov -d -ibam output.sorted.bam -g NA1000.fna > coverage_output.txt. For analysis of E. coli ChIP-seq data, reference genomes were first reconstructed in silico by inserting the nucleotide sequence of parS and apramycin antibiotic resistance cassette to the ybbD locus of E. coli MG1655 genome. Afterwards, Hiseq 2500 Illumina short reads were mapped back to these reconstructed reference genomes using Bowtie 1. Sequence coverage at each nucleotide position was also computed using BEDTools. Finally, ChIP-seq profiles were plotted with the x-axis representing genomic positions and the y-axis is the number of reads per base pair per million mapped reads (RPBPM) using custom R scripts.
GSE100233	For analysis of IDAP-seq data, Hiseq 2500 Illumina short reads (50 bp) were mapped back to the Caulobacter NA1000 reference genome (NCBI Reference Sequence: NC-011916.1) using Bowtie 1 (Langmead et al., 2009) and the following command:bowtie -m 1 -n 1 --best --strata -p 4 --chunkmbs 512 NA1000-bowtie --sam *.fastq > output.sam. Subsequently, sequencing reads were sorted to either being mapped to the upper DNA strand or to the lower strand of the reference genome, as suggested in the original IDAP-seq publication (Belitsky and Sonenshein, 2013). The number of 5’ end of reads that were mapped to the upper strand was counted for each nucleotide position along the Caulobacter genome using BEDTools (Quinlan & Hall, 2010) and the following command: bedtools genomecov -d -5 -strand + -ibam output.sorted.bam -g NA1000.fna > upper_strand_output.txt. To count the number of 5’ end of reads that were mapped to the lower strand, the following command was used instead: bedtools genomecov -d -5 -strand - -ibam output.sorted.bam -g NA1000.fna > lower_strand_output.txt. The IDAP-seq profile was then plotted using R. The sequence in between the summit of upper strand profile and that of the lower strand profile defines the minimal parS sequence required for binding to ParB.
GSE100233	Genome_build: NC_000913.3
GSE100233	Genome_build: NC_011916.1
GSE100233	genotype: AB1157 ybbD::parS scrambled site 3 pUTC18::parB (G101S)
GSE100233	genotype: AB1157 ybbD::parS scrambled site 3 pUTC18::parB (WT)
GSE100233	genotype: AB1157 ybbD::parS site 1 pUTC18::parB (WT)
GSE100233	genotype: AB1157 ybbD::parS site 2 pUTC18::parB (G101S)
GSE100233	genotype: AB1157 ybbD::parS site 2 pUTC18::parB (WT)
GSE100233	genotype: AB1157 ybbD::parS site 3 pUTC18::parB (G101S)
GSE100233	genotype: AB1157 ybbD::parS site 3 pUTC18::parB (WT)
GSE100233	genotype: AB1157 ybbD::parS site 4 pUTC18::parB (G101S)
GSE100233	genotype: AB1157 ybbD::parS site 4 pUTC18::parB (WT)
GSE100233	genotype: AB1157 ybbD::parS site 5 pUTC18::parB (G101S)
GSE100233	genotype: AB1157 ybbD::parS site 5 pUTC18::parB (WT)
GSE100233	genotype: AB1157 ybbD::parS site 6 pUTC18::parB (WT)
GSE100233	genotype: AB1157 ybbD::parS site 7 pUTC18::parB (G101S)
GSE100233	genotype: AB1157 ybbD::parS site 7 pUTC18::parB (WT)
GSE100233	Hiseq 2500 Illumina short reads (50 bp) were mapped back to the Caulobacter NA1000 reference genome (NCBI Reference Sequence: NC-011916.1) using Bowtie 1 (Langmead et al., 2009) and the following command: bowtie -m 1 -n 1 --best --strata -p 4 --chunkmbs 512 NA1000-bowtie --sam *.fastq > output.sam. Subsequently, the sequencing coverage for each nucleotide position was computed using BEDTools (Quinlan & Hall, 2010) and the following command: bedtools genomecov -d -ibam output.sorted.bam -g NA1000.fna > coverage_output.txt. Finally, the ratio between the number of reads of libraries generated from pMCS1-Tn5-ME-R6Kγ-kanR-ME or pMCS1-Tn5-ME-R6Kγ-kanR-parS456-ME were calculated. Results were binned over 1 kb and represented as a log10 scale.
GSE100233	LELab_ChIP_seq_TLS1637_anti_FLAG
GSE100233	LELab_ChIP_seq_TLS1638_anti_FLAG
GSE100233	LELab_ChIP_seq_TLS1639_anti_FLAG
GSE100233	LELab_ChIP_seq_TLS1640_anti_FLAG
GSE100233	LELab_ChIP_seq_TLS1641_anti_FLAG
GSE100233	LELab_ChIP_seq_TLS1642_anti_FLAG
GSE100233	LELAb_ChIP_seq_TLS1643_anti_FLAG
GSE100233	LELab_ChIP_seq_TLS1644_anti_FLAG
GSE100233	LELab_ChIP_seq_TLS1645_anti_FLAG
GSE100233	LELab_ChIP_seq_TLS1646_anti_FLAG
GSE100233	LELab_ChIP_seq_TLS1647_anti_FLAG
GSE100233	LELab_ChIP_seq_TLS1648_anti_FLAG
GSE100233	LELab_ChIP_seq_TLS1649_anti_FLAG
GSE100233	LELab_ChIP_seq_TLS1650_anti_FLAG
GSE100233	None
GSE100233	Standard library construction for Illumina Hiseq2500 sequencing platform
GSE100233	Supplementary_files_format_and_content: Files ending with _coverage.txt: tab-delimited text file of nucleotide-resolution coverage from RNA-seq data (column 1: genome ID, column 2: nucleotide position, column 3: coverage)
GSE100233	T18-ParB (G101S) were produced by addition of 0.5mM IPTG for an hour before formadehyde to 1% (final concentration ) was added to fix cells for ChIP-seq
GSE100233	T18-ParB (WT) were produced by addition of 0.5mM IPTG for an hour before formadehyde to 1% (final concentration ) was added to fix cells for ChIP-seq
GSE100373	Adapter cutting using cutadapt, version 1.8.3, parameters -e 0.1 -O 1 -m 12
GSE100373	E. coli CMA540(MG1693 ∆hfq::cat)
GSE100373	E. coli MG1693
GSE100373	Escherichia coli
GSE100373	Genome_build: U00096.3
GSE100373	Genome mapping using Bowtie, version 1.1.2, parameters for samples 1-2: -v 2 --best --strata -m 1
GSE100373	growth phase: Exponential
GSE100373	Hfq mut exp mRNA
GSE100373	Hfq mut exp RPF
GSE100373	Quality trimming using FASTX-toolkit, version 0.0.13.2, parameters -v -t 20 -l 10
GSE100373	Read counting using bedtools, version 2.17.0, parameter: -s, the middle nucleotide of each read was taken
GSE100373	RNA-Seq
GSE100373	RNA-size selection and generation of the cDNA libraries was performed as described {Ingolia, 2009}
GSE100373	strain: CMA540(MG1693 delta_hfq::cat)
GSE100373	strain: MG1693
GSE100373	Strains were grown in LB medium (Difco) supplemented with thymine (50 µg
GSE100373	Supplementary_files_format_and_content: Read counts were normalized by the length of the unique CDS per kilobase (RPKM) and the total mapped reads per million (RPM)
GSE100373	Total RNA was extracted using TRI Reagent (Sigma Aldrich), enriched by depleting small RNAs with GeneJET Purification Kit (Fermentas) and rRNA with MICROBExpres Bacterial mRNA Enrichment Kit (Ambion) and fragmented in alkaline solution (2 mM EDTA and 100 mM Na2CO3 pH 9.2 for 40 min at 95°C) to fragments with size of 24-35 nts. For RPFS, cells were lysed by freeze-rupturing (Retch Mill) and 100 A260 units of ribosome-bound mRNA fraction were directly used for polysomal analysis or subjected to nucleolytic digestion with 10 units
GSE100373	WT exp mRNA
GSE100373	WT exp RPF
GSE101471	All cultures were grown at 37C in well-mixed minimal media modified with M63 (mM63: pH 7.0, 62 mM K2HPO4, 39 mM KH2PO4, 15 mM ammonium sulfate, 1.8 µM FeSO4-7H2O, 15 µM thiamine hydrochloride, 0.2 mM MgSO4-7H2O and 22 mM glucose). One amino acid, Ile or Leu, was added to the monoculture medium when appropriate. Prior to coculturing, at both the initial inoculation and transfer, we washed the E. coli cells with fresh mM63 without amino acids to exclude the carry-over of supplements from the pre-culture. For coculture samples, we used cell culture inserts with a pore size of 0.45 µm at a density of 10^8
GSE101471	Ancestral I- cells at amino acid starvation in monoculture
GSE101471	Ancestral I- cells at log phase in monoculture
GSE101471	Ancestral I- cells in coculture
GSE101471	Ancestral I- cells in coculture, a biological replicate
GSE101471	Ancestral L- cells at amino acid starvation in monoculture
GSE101471	Ancestral L- cells at log phase in monoculture
GSE101471	Ancestral L- cells at log phase in monoculture, a technical replicate
GSE101471	Ancestral L- cells in coculture
GSE101471	Ancestral L- cells in coculture, a biological replicate
GSE101471	cell type: Ancestral I- cells
GSE101471	cell type: Ancestral L- cells
GSE101471	cell type: Evolved I- cells
GSE101471	cell type: Evolved L- cells
GSE101471	cell type: Original prototroph DH1 cells
GSE101471	culture type: coculture
GSE101471	culture type: monoculture
GSE101471	DH1-log
GSE101471	DH1-log-tr
GSE101471	Escherichia coli K-12
GSE101471	Evolved I- cells at amino acid starvation in monoculture
GSE101471	Evolved I- cells at log phase in monoculture
GSE101471	Evolved I- cells in coculture
GSE101471	Evolved I- cells in coculture, a biological replicate
GSE101471	Evolved L- cells at amino acid starvation in monoculture
GSE101471	Evolved L- cells at log phase in monoculture
GSE101471	Evolved L- cells at log phase in monoculture, a technical replicate
GSE101471	Evolved L- cells in coculture
GSE101471	Evolved L- cells in coculture, a biological replicate
GSE101471	genotype
GSE101471	growth type: amino acid starvation
GSE101471	growth type: log phase
GSE101471	IA-co1
GSE101471	IA-co2
GSE101471	IA-log
GSE101471	IA-starve
GSE101471	IE-co1
GSE101471	IE-co2
GSE101471	IE-log
GSE101471	IE-starve
GSE101471	LA-co1
GSE101471	LA-co2
GSE101471	LA-log
GSE101471	LA-log-tr
GSE101471	LA-starve
GSE101471	LE-co1
GSE101471	LE-co2
GSE101471	LE-log
GSE101471	LE-log-tr
GSE101471	LE-starve
GSE101471	Metabolome data for these cultures are also provided in the supplementary file \Ecoli_co_results.xlsx\, just for information.
GSE101471	Microarray data were processed using a custom R software for the finite hybridisation (FH) model (Ono et al., 2008, Bioinformatics 24, p1278).
GSE101471	Original prototroph DH1 cells at log phase in monoculture
GSE101471	Original prototroph DH1 cells at log phase in monoculture, a technical replicate
GSE101471	strain: K-12
GSE101471	substrain: DH1
GSE101471	The cell cultures were interrupted by placing them directly into a cold phenol-ethanol solution (0.1g-phenol
GSE101471	The processed gene expression data in log10 scale are provided in the supplementary file \Ecoli_co_results.xlsx\.
GSE101471	The total RNA was extracted using an RNeasy kit, Qiagen, in accordance with the manufacturer's instructions.
GSE102091	After normalization, the read counts were estimated in the running windows of 35 bp, and the ratios R between values obtained for experimental and control libraries were calculated. Peaks were localized requiring R≥1.5 for at least 50% positions of at least 60 bp genomic region in length.
GSE102091	antibody: Anti-Dps antibodies
GSE102091	antibody: rabbit pre-immune IgG
GSE102091	Bacterial cells
GSE102091	Bacterial cells were grown aerobically in M9 medium supplemented with 0.2% glucose and 5% LB at 37°C under constant shaking (~120 rpm) in a water bath and harvested at OD ~0.6.
GSE102091	ChIP-Seq
GSE102091	ChIP-seq experiments were performed in duplicate using similar growth condition and protocols for chromatin immunoprecipitation. The first experiment was done in the Centre for Genomic Regulation (CRG, Barcelona, Spain), while the second one in the Immanuel Kant Baltic Federal University (Kaliningrad, Russia). In both cases, bacterial cells were grown aerobically at 37°C until OD600~0.6 were treated with formaldehyde (final concentration of 1%, 20 min incubation). Cross-linking was stopped with glycine (final concentration of 450 mM). After 5 minutes of incubation the cells were pelleted by centrifugation at 14,000 rpm for 15 minutes (+4°C), washed twice with 5 ml of PBS and resuspended in 1.3 ml of ice-cold immunoprecipitation buffer prepared from 50 ml of buffer containing 100 mM NaCl, 50 mM Tris-HCl (pH 8.1), 5 mM EDTA, 0.2% NaN3, 0.5% SDS, and 25 ml of buffer containing 100 mM Tris-HCl (pH 8.6); 100 mM NaCl; 5 mM EDTA; 0,2% NaN3, 5% Triton-X-100. Then phenylmethylsulfonyl fluoride (final concentration of 1 mM) or 20 μl of Protease Inhibitor Cocktail (PIC, Sigma) for the first and the second experiment, respectively, were added followed by incubation for 30 min at +4°C.
GSE102091	ChIP-seq libraries were prepared from 5-10 ng of the DNA samples with the NebNext® Ultra™ DNA Library Prep Kit for Illumina (New England Biolabs, MA, USA) following the manufacturer’s instructions. For the final amplification of the library 15 PCR cycles were used. Size distribution and concentration of the amplicons was checked on the Bioanalyzer 2100 (Agilent, USA). In the first experiment, the maximum was at about 300 bp, and ChIP libraries were sequenced using 50 nt single-end read protocol on the Illumina HiSeq system (Illumina, USA) of the Genomics Facility in the Centre for Genomic Regulation (Barcelona). In the second experiment, the maximum was at about 450 bp, and samples were sequenced using standard paired-end 2*150 nt protocol on the MiSeq system (Illumina, USA) in the Immanuel Kant Baltic Federal University (Kaliningrad).
GSE102091	Escherichia coli str. K-12 substr. MG1655
GSE102091	Exp 1_control
GSE102091	Exp 1_IP sample
GSE102091	Exp 2_control
GSE102091	Exp 2_IP sample
GSE102091	For immunoprecipitation, 800 μl of collected chromatin (~1000 μg of protein) were incubated on a rotating wheel over night at 4°C with 10 μg of either rabbit anti-Dps antibodies (experimental sample) or rabbit pre-immune IgG (negative control). Next day 30 μl of Ultra Link Protein A
GSE102091	Genome_build: E. coli K-12 MG1655 (U00096.3)
GSE102091	growth stage: log-phase
GSE102091	medium: M9 medium supplemented with 0.2% glucose and 5% LB
GSE102091	ngs platform: Illumina HiSeq
GSE102091	ngs platform: Illumina MiSeq
GSE102091	Only ideal correspondence of sequence reads to the genome in both cases was permitted. The profiles obtained for experimental and control samples were normalized by the scaling method initially offered by Affymetrix for microarray data analysis and later implemented in several other approaches. This method assumes unaffected protein occupancy at most genomic positions and quantifies the scaling factor on the basis of corrected mean values obtained after removal of 2% signals with highest and lowest intensities from both control and experimental sets.
GSE102091	Raw data were quality filtered on the Galaxy server (Filter by Quality tool, Q≥20) providing 99% probability of correct sequencing for all nucleotides in each read. As a result, the sets contain 31,656,551 and 45,396,252 sequences in the control and immunoprecipitated samples of the first experiment, and, respectively, 7,493,528 and 8,214,737 reads for the second experiment.
GSE102091	sequencing mode: 50 nt single-end read protocol
GSE102091	sequencing mode: paired-end 2*150 nt protocol
GSE102091	Supplementary_files_format_and_content: Processed data include read pileups obtained in two ChIP-seq experiments by two different approaches (files 1-4), the set of regions bound by Dps in both experiments (file 5) and the set of regions unbound by Dps in both experiments (file 6). All processed data are provided as tab-delimited .txt files.
GSE102091	To apply the second approach variable in length reads from Illumina MiSeq were first trimmed from both sides to obtain a set of standard 50 nt sequences taken from the middle of longer reads. Reads shorter than 50 nt were discarded. Then, all four sets from both experiments were aligned to the genome using the Matcher program (available at: http:
GSE102091	Two different approaches were used to align sequence reads to the genome of E. coli K-12 MG1655 (U00096.3). First, quality controlled reads were mapped using the CLC Genomics Workbench version 7.5.1 (CLC GW, Bio-Qiagen, Aarhus, Denmark) with either default settings for the length and similarity fractions (0.5 and 0.8, respectively, see supplemental Table 2 of the paper) or with the most stringent criteria (1.0 and 1.0, respectively, deposited). Reads with sequences aligned to multiple genomic regions were ignored.
GSE102322	Agilent Scan Control Software V.8.5 at a resolution of 3μm. The data was extracted using Agilent Feature extraction software V 10.10
GSE102322	azide treated
GSE102322	Cells were subcultured from overnight cultures into 20 ml of LB media
GSE102322	cultures were split into two 10 ml cultures. One half was treated with 2 mM NaN3 for 10 minutes and the other half was left untreated
GSE102322	Escherichia coli K-12
GSE102322	growth media: LB
GSE102322	od: 0.8
GSE102322	Sample 1
GSE102322	Sample 2
GSE102322	strain: BW25113
GSE102322	Total RNA using Qiagen RNeasy kit
GSE102322	treatment: 2 mM NaN3 for 10 minutes
GSE102322	treatment: none
GSE102322	untreated
GSE10307	Adaptive threshold (quantitation method) uses the parameters of the spot diameter and background inner and outer dimensions to create a spot mask and background mask, then refines the mask on a pixel-by-pixel basis. Total (normalization method), uses the intensity of each spot in relation to all spots.
GSE10307	E. coli, glucose limitation, 110 min after depletion of extracellular acetate
GSE10307	E. coli, glucose limitation, 170 min after depletion of extracellular acetate
GSE10307	E. coli, glucose limitation, 230 min after depletion of extracellular acetate
GSE10307	E. coli, glucose limitation, 30 min after depletion of extracellular acetate
GSE10307	E. coli, glucose limitation, 350 min after depletion of extracellular acetate
GSE10307	E. coli, glucose limitation, 50 min after depletion of extracellular acetate
GSE10307	E. coli, glucose limitation, acetate concentration ≤ 0.35 gL-1
GSE10307	E. coli, glucose limitation (glucose concentration < 0.05 gL-1)
GSE10307	E. coli, glucose limitation (glucose concentration < 0.05 gL-1), fed-batch
GSE10307	E. coli K12 (W3110), fed-batch
GSE10307	E.coli_RviaT1_SR1
GSE10307	E.coli_RviaT1_SR2
GSE10307	E.coli_RviaT1_SR3
GSE10307	E.coli_RviaT2_SR1
GSE10307	E.coli_RviaT2_SR2
GSE10307	E.coli_RviaT2_SR3
GSE10307	E.coli_RviaT3_SR1
GSE10307	E.coli_RviaT3_SR2
GSE10307	E.coli_RviaT3_SR3
GSE10307	E.coli_RviaT4_SR1
GSE10307	E.coli_RviaT4_SR2
GSE10307	E.coli_RviaT4_SR3
GSE10307	E.coli_RviaT5_SR2
GSE10307	E.coli_RviaT5_SR3
GSE10307	E.coli_RviaT6_SR2
GSE10307	E.coli_RviaT6_SR3
GSE10307	E.coli_RviaT7_SR2
GSE10307	E.coli_RviaT7_SR3
GSE10307	E.coli_RviaT8_SR2
GSE10307	E.coli_RviaT8_SR3
GSE10307	E.coli_T1viaR_SR1
GSE10307	E.coli_T1viaR_SR2
GSE10307	E.coli_T1viaR_SR3
GSE10307	E.coli_T2viaR_SR1
GSE10307	E.coli_T2viaR_SR2
GSE10307	E.coli_T2viaR_SR3
GSE10307	E.coli_T3viaR_SR1
GSE10307	E.coli_T3viaR_SR2
GSE10307	E.coli_T3viaR_SR3
GSE10307	E.coli_T4viaR_SR1
GSE10307	E.coli_T4viaR_SR2
GSE10307	E.coli_T4viaR_SR3
GSE10307	E.coli_T5viaR_SR2
GSE10307	E.coli_T5viaR_SR3
GSE10307	E.coli_T6viaR_SR2
GSE10307	E.coli_T6viaR_SR3
GSE10307	E.coli_T7viaR_SR2
GSE10307	E.coli_T7viaR_SR3
GSE10307	E.coli_T8viaR_SR2
GSE10307	E.coli_T8viaR_SR3
GSE10307	E. coli, unlimited growth (batch)
GSE10307	E. coli, unlimited growth (batch) 
GSE10307	Escherichia coli str. K-12 substr. W3110
GSE10307	Raw data were created by analyzing 16-bit tiff files with the Scan Array Express imaging software (microarray analysis system, version 3.0.0.0016, PerkinElmer, Massachusetts, USA; adaptive treshold method, total normalization method).
GSE10307	The cell samples were collected directly into RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) to avoid RNA degradation. The samples were centrifuged according to the manufacturer’s protocol and frozen at - 80 °C until RNA isolation.
GSE10307	The culture medium samples were withdrawn with a capillary sampling probe as developed by Theobald et al. (1997), however, without using membrane-covered glass tubes.
GSE10307	The fed-batch cultivations were carried out with the bacterial strain E. coli K-12 W3110 (DSM 5911, German Collection of Microorganisms and Cell Cultures) in a 30-l bioreactor (Bioengineering AG, Wald, Switzerland). Minimal medium supplemented with glucose as the carbon source was used. The batch medium (batch volume VR,0 =17 l) consisted of 8.8 g l−1 glucose•H2O, 2.0 g l−1 Na2SO4•10H2O, 2.68 g l−1 (NH4)2SO4, 1.0 g l−1 NH4Cl, 14.6 g l−1 K2HPO4, 4.02 g l−1 NaH2PO4•2H2O, 0.01 g l−1 thiamine HCl; 0.3mM CaCl2•2H2O, 2mM MgSO4•7H2O; 3ml l−1 of trace element solution (TES: 16.7 g l−1 FeCl3•6H2O, 20.1 g l−1
GSE10307	Theobald, U., Mailinger,W., Baltes, M., Rizzi, M., Reuss, M., 1997. In vivo analysis of metabolic dynamics in Saccharomyces cerevisiae. 1. Experimental observations. Biotechnol. Bioeng. 55, 305–316.
GSE10307	The VALUE data are normalized log2(test
GSE10307	Total RNA from 8.1*10exp9 cells was isolated using the RNeasy Kit (Qiagen) according to the manufacturer’s protocol. On-column DNase digestion was performed (RNase free DNase set, Qiagen). RNA concentration and quality were assessed photometrically (Nanodrop ND 1000, NanoDrop Technologies, Inc., Delaware, USA), by formaldehyde gel electrophoresis and bioanalyzer analysis (RNA 6000 Nano LabChip Kit, Agilent Bioanalyzer 2100, Agilent Technologies, California, USA). Only RNA with 260 nm 
GSE10319	An RNeasy minikit was used to prepare total RNA according to the manufacturer’s instructions (QIAGEN Ltd.). Any contaminating DNA was removed using a DNAase column kit (QIAGEN Ltd).
GSE10319	Escherichia coli
GSE10319	Escherichia coli O157 TUV93-0 MEM-HEPES + 20uM ME0052 (in DMSO)
GSE10319	Escherichia coli O157 TUV93-0 MEM-HEPES + 20uM ME0053 (in DMSO)
GSE10319	Escherichia coli O157 TUV93-0 MEM-HEPES + 20uM ME0054 (in DMSO)
GSE10319	Escherichia coli O157 TUV93-0 MEM-HEPES + 20uM ME0055 (in DMSO)
GSE10319	Escherichia coli O157 TUV93-0 MEM-HEPES + DMSO
GSE10319	Escherichia coli O157 TUV93-0 was grown at 37 degrees C to OD 0.7 in MEM-HEPES supplemented with 0.1% Glucose and 250nM Fe(NO3)2.
GSE10319	Escherichia coli O157 TUV93-0 was grown at 37 degrees C to OD 0.7 in MEM-HEPES supplemented with 0.1% Glucose and 250nM Fe(NO3)2 and and equivalent volume of DMSO.
GSE10319	Escherichia coli O157 TUV93-0 was grown in the presence of 20uM ME0052
GSE10319	Escherichia coli O157 TUV93-0 was grown in the presence of 20uM ME0053
GSE10319	Escherichia coli O157 TUV93-0 was grown in the presence of 20uM ME0054
GSE10319	Escherichia coli O157 TUV93-0 was grown in the presence of 20uM ME0055
GSE10319	Escherichia coli O157 TUV93-0 was grown in the presence of DMSO
GSE10319	inhibitor: 20uM ME0052
GSE10319	inhibitor: 20uM ME0053
GSE10319	inhibitor: 20uM ME0054
GSE10319	inhibitor: 20uM ME0055
GSE10319	LOWESS normalised data that represents the average of the three replicate experiments
GSE10319	ME0052
GSE10319	ME0053
GSE10319	ME0054
GSE10319	ME0055
GSE10319	media: MEM-HEPES supplemented with 0.1% Glucose and 250nM Fe(NO3)2
GSE10319	no inhibitor: equivalent volume of DMSO added
GSE10319	od: 0.7
GSE10319	strain: O157:H7 EHEC TUV93-0
GSE103421	All culture experiments were performed in MOPS medium supplemented with 0.2% glucose, 19 amino acids (without methionine), vitamins, bases and micronutrients (MOPS rich defined medium minus methionine, Teknova). Cells were grown in an overnight liquid culture at 37°C, diluted to an OD420 = .001 in fresh medium and grown until OD420 reached 0.4 where samples were collected.  For 10°C samples, cultures were grown to OD420 = 1.1 at 37°C and cold shock was performed by mixing 70mL of 37°C culture with 130mL of 0°C media pre-chilled in ice-water slurry, with continued growth of the culture in a 10°C shaker.
GSE103421	Basecalls performed using Casava versions 1.6 or 1.7.
GSE103421	Bowtie alignments against the E. coli genome were converted to wiggle files. For ribosome footprints and mRNA-seq, the position of each alignment is distributed into several nucleotides in the center of each read. For each read, the center residues that are at least 10 nucleotides away from either ends were given the same score, which is weighted by the length of the fragment [Oh et al,. Cell 147, 1295 (2011)]. Scores therefore represent the number of read alignments attributed to each genomic position under each scoring scheme. For DMS-seq, the position of each alignment was the position immediately 5' of the 5' end of the read.
GSE103421	DMS-MaPSeq of purified cspA mRNA at 10°C
GSE103421	DMS-MaPSeq of purified cspA mRNA at 10°C, rep1
GSE103421	DMS-MaPSeq of purified cspA mRNA at 10°C, rep2
GSE103421	DMS-MaPSeq of purified cspA mRNA at 10°C, rep 3
GSE103421	DMS-MaPSeq of purified cspA mRNA at 10°C, rep 4
GSE103421	DMS-MaPSeq of purified cspA mRNA at 10°C with 0.025mM CspA protein
GSE103421	DMS-MaPSeq of purified cspA mRNA at 10°C with 0.05mM CspA protein
GSE103421	DMS-MaPSeq of purified cspA mRNA at 10°C with 0.1mM CspA protein
GSE103421	DMS-MaPSeq of purified cspA mRNA at 10°C with 0.1mM CspA protein, rep1
GSE103421	DMS-MaPSeq of purified cspA mRNA at 10°C with 0.1mM CspA protein, rep 2
GSE103421	DMS-MaPSeq of purified cspA mRNA at 10°C with 0.1mM CspA protein, rep 3
GSE103421	DMS-MaPSeq of purified cspA mRNA at 10°C with 0.1mM CspA protein, rep 4
GSE103421	DMS-MaPSeq of purified cspA mRNA at 37°C
GSE103421	DMS-MaPSeq of purified cspA mRNA at 37°C, rep1
GSE103421	DMS-MaPSeq of purified cspA mRNA at 37°C, rep 2
GSE103421	DMS-seq 30 min after shift to 10°C in WT cells
GSE103421	DMS-seq 6 hr after shift to 10°C in WT cells
GSE103421	DMS-seq 8 hr after shift to 10°C in ∆cspABEG cells
GSE103421	DMS-seq 8 hr after shift to 10°C in ∆cspBG cells
GSE103421	DMS-seq 8 hr after shift to 10°C in WT cells
GSE103421	DMS-seq of purified mRNA in vitro at 10°C, rep1
GSE103421	DMS-seq of purified mRNA in vitro at 10°C, rep2
GSE103421	DMS-seq of WT cells after kasugamycin treatment at 10°C
GSE103421	Escherichia coli
GSE103421	Escherichia coli str. K-12 substr. MG1655
GSE103421	Extraction was performed as described in detail previously (Li et al., 2012; Oh et al., 2011; Rouskin et al., 2014). For ribosome profiling, 200 ml of cell culture was rapidly filtered by passing through a nitrocellulose filter. Cell pellets was were rapidly collected using a pre-warmed metal table crumber, flash frozen in liquid nitrogen, and combined with frozen droplets of lysis buffer. Cells and lysis buffer were pulverized in 10 ml canisters (Retsch) pre-chilled in liquid nitrogen using Qiagen TissueLyser II. Pulverized lysate was thawed on ice and clarified by centrifugation at 4°C. Lysate containing 0.5 mg of RNA was digested for 1 h with 750 U of micrococcal nuclease (Roche) at 25°C. The ribosome-protected RNA fragments were isolated using a sucrose gradient followed by hot acid phenol extraction.
GSE103421	For DMS-MaPSeq, reads were aligned to the 5’UTR of cspA using bowtie2 and an alignment seed of 12nt.  Low sequence quality bases (Q score < 20%) and missing bases due to truncated reads were set to question marks. Reads that consisted of more than 20% question marks were filtered out. Only mutations that agreed between the forward and the reverse read were considered true mutations. Mutation rate per base was calculated as number of reads with a mutation at the base divided by total number of reads covering the base.
GSE103421	For in vivo DMS modification, 15 mL of E. coli culture was incubated with 750 µL DMS. Incubation was performed for 2 min at 37°C or for 45 min at 10°C. DMS was quenched by adding 30 mL 0°C stop solution (30% β-mercaptoethanol, 25% isoamyl alcohol), after which cells were quickly put on ice, collected by centrifugation at 8000 x g, 4 °C for 2 min, and washed with 8 mL 30% BME solution. Cells were then resuspended in 450 µL total RNA lysis buffer (10 mM EDTA, 50 mM sodium acetate pH 5.5), and total RNA was purified with hot acid phenol (Ambion).
GSE103421	Genome_build: NC000913.2
GSE103421	genotype
GSE103421	MG1655
GSE103421	MG1655 ∆cspABCEG
GSE103421	MG1655 ∆cspABEG
GSE103421	MG1655 ∆cspBG
GSE103421	MG1655 ∆rnr
GSE103421	molecule subtype: DMS-modified mRNA
GSE103421	molecule subtype: mRNA
GSE103421	molecule subtype: Ribosome protected mRNA
GSE103421	molecule subtype: Total RNA
GSE103421	mRNA fragments were size selected via gel purification, and ligated to 5' adenylated DNA oligo. After reverse transcription, the single stranded DNA was circularized, and PCR amplified (Oh et al., 2011; Li et al., 2014; Rouskin et al., 2014).
GSE103421	mRNA-seq 10 min after shift to 10°C in WT cells
GSE103421	mRNA-seq 2 hr after shift to 10°C in WT cells
GSE103421	mRNA-seq 30 min after shift to 10°C in WT cells
GSE103421	mRNA-seq 3 hr after shift to 10°C in WT cells
GSE103421	mRNA-seq 4 hr after shift to 10°C in WT cells
GSE103421	mRNA-seq 6 hr after shift to 10°C in WT cells
GSE103421	mRNA-seq 8 hr after shift to 10°C in ∆cspABEG cells
GSE103421	mRNA-seq 8 hr after shift to 10°C in WT cells
GSE103421	mRNA-seq at 37°C in ∆cspABCEG cells
GSE103421	mRNA-seq at 37°C in WT cells_1
GSE103421	mRNA-seq at 37°C in WT cells_2
GSE103421	OTHER
GSE103421	Ribosome profiling 10 min after shift to 10°C in WT cells_1
GSE103421	Ribosome profiling 10 min after shift to 10°C in WT cells_2
GSE103421	Ribosome profiling 15 min after shift to 10°C in WT cells
GSE103421	Ribosome profiling 2 hr after shift to 10°C in WT cells
GSE103421	Ribosome profiling 30 min after shift to 10°C in WT cells
GSE103421	Ribosome profiling 3 hr after shift to 10°C in WT cells
GSE103421	Ribosome profiling 4 hr after shift to 10°C in WT cells
GSE103421	Ribosome profiling 5 min after shift to 10°C in WT cells
GSE103421	Ribosome profiling 6 hr after shift to 10°C in WT cells
GSE103421	Ribosome profiling 8 hr after shift to 10°C in ∆cspABEG cells
GSE103421	Ribosome profiling 8 hr after shift to 10°C in WT cells
GSE103421	Ribosome profiling at 37°C in ∆cspABCEG cells
GSE103421	Ribosome profiling at 37°C in WT cells_1
GSE103421	Ribosome profiling at 37°C in WT cells_2
GSE103421	RNA-Seq
GSE103421	Sequenced reads were trimmed for adaptor sequence.
GSE103421	strain background: MG1655
GSE103421	strain: MG1655
GSE103421	Supplementary_files_format_and_content: Txt files are processed data for DMS-MaPseq with two columns: first column containing chromosome positions (relative to transcription start site (1) of cspA) and second column containing the mutation rate.
GSE103421	Supplementary_files_format_and_content: Wiggle files with two columns: first column containing chromosome positions and second column containing the number of reads mapped to the position (see publication for details).
GSE103421	temperature: 10°C
GSE103421	temperature: 37°C
GSE103421	The remaining reads were aligned using Bowtie v0.12.7 against E. coli MG1655 genome using parameters -v1 -m2 -k1.
GSE103421	Total RNA-seq 20 min after shift to 10°C in ∆rnr cells
GSE103421	Total RNA-seq 20 min after shift to 10°C in WT cells
GSE103421	Total RNA-seq 4 hr after shift to 10°C in ∆rnr cells
GSE103421	Total RNA-seq 4 hr after shift to 10°C in WT cells
GSE103421	Total RNA-seq 8 hr after shift to 10°C in ∆rnr cells
GSE103421	Total RNA-seq 8 hr after shift to 10°C in WT cells
GSE103421	Total RNA-seq after rifampicin treatment -- 4 hr after shift to 10°C in ∆rnr cells
GSE103421	Total RNA-seq after rifampicin treatment -- 4 hr after shift to 10°C in WT cells
GSE103421	Total RNA-seq before rifampicin treatment -- 2 hr after shift to 10°C in ∆rnr cells
GSE103421	Total RNA-seq before rifampicin treatment -- 2 hr after shift to 10°C in WT cells
GSE103421	treatment: 0.025mM CspA protein
GSE103421	treatment: 0.05mM CspA protein
GSE103421	treatment: 0.1mM CspA protein
GSE103421	treatment: After 10 mg
GSE103421	treatment: After 250 µg
GSE103421	treatment: Before rifampicin treatment
GSE103421	treatment: NA
GSE103421	Trimmed reads were sequentially aligned using Bowtie v0.12.7 to E. coli rRNA and noncoding RNA allowing one mismatch. Reads aligning to any of these indices were discarded.
GSE10345	Bicyclomycin (BCM, gift of Schering-Plough Animal Health) was added to the culture at the indicated dose for 20 minutes. Culture was added to 2 volumes of RNAprotect Bacterial Reagent (QIAGEN).
GSE10345	Coli-MDS42_bcm-100mcg
GSE10345	Coli-MDS42_del-nusA_rep1
GSE10345	Coli-MDS42_del-nusA_rep2
GSE10345	Coli-MDS42_del-nusG_rep1
GSE10345	Coli-MDS42_del-nusG_rep2
GSE10345	Coli-MDS42_no-drug_rep1
GSE10345	Coli-MDS42_no-drug_rep2
GSE10345	Coli-MG1655_bcm-100mcg
GSE10345	Coli-MG1655_bcm-10mcg
GSE10345	Coli-MG1655_bcm-25mcg
GSE10345	Coli-MG1655_no-drug_rep1
GSE10345	Coli-MG1655_no-drug_rep2
GSE10345	Coli-O157H7_bcm-100mcg
GSE10345	Coli-O157H7_no-drug_rep1
GSE10345	Coli-O157H7_no-drug_rep2
GSE10345	Culture conditions: 37 C with shaking at 220 RPM
GSE10345	Drug: bicyclomycin
GSE10345	Drug: none
GSE10345	Escherichia coli
GSE10345	Extraction: Rneasy
GSE10345	Extraction: TRI Reagent
GSE10345	Feature intensity was extracted by GeneChip Operating System as CEL files. The probe-level analysis of the CEL files was done by the PLIER algorithm in the Affymetrix Expression Console. No further adjustments were made to the data in the table.
GSE10345	Growth medium: MOPS minimal, 0.4% glucose, 0.5% casamino acids
GSE10345	Growth phase: exponential
GSE10345	Growth phase: OD600=0.3
GSE10345	Isolate: EDL933
GSE10345	Isolate: MDS42
GSE10345	Isolate: MG1655
GSE10345	K12 strain MG1655, 100 mcg
GSE10345	K12 strain MG1655, 10 mcg
GSE10345	K12 strain MG1655, 25 mcg
GSE10345	K12 strain MG1655, control sample, exponential phase
GSE10345	O157:H7 strain EDL933, 100 mcg
GSE10345	O157:H7 strain EDL933, control sample, exponential phase
GSE10345	Overnight culture in LB medium was innoculated from a single colony. The overnight culture was diluted 1
GSE10345	Reduced genome strain MDS42, 100 mcg
GSE10345	Reduced genome strain MDS42, control sample, exponential phase
GSE10345	Reduced genome strain MDS42, deletion of nusA gene, OD600=0.3
GSE10345	Reduced genome strain MDS42, deletion of nusG gene, OD600=0.3, overnight culture
GSE10345	Strain: K-12
GSE10345	Strain: K-12 reduced genome
GSE10345	Strain: O157:H7
GSE10345	TRI Reagent (Sigma) or Rneasy (QIAGEN) according to manufacturer's protocol. No Rnase treatment.
GSE103937	Aligned reads were designated to top and bottom strands using Samtools
GSE103937	At the appropriate optical density, culture growth was instantaneously arrested by addition of an equal volume of chilled 100% ethanol, and the cells were stored at –80°C until they were processed for RNA extraction. The cells were lysed and total RNA was prepared by the hot phenol method essentially as described, after chromosomal DNA has been digested with RNase-free DNase.
GSE103937	Bacterial cells
GSE103937	bcl2fastq2 v2.15.0 (Demultiplexing), Fastqc 0.11.5 (read quality), Cutadapt-1.9.1 (adaptor trimming)
GSE103937	Escherichia coli K-12
GSE103937	Genome_build: NC000913.2 MG1655
GSE103937	genotype: {delta}nusG
GSE103937	genotype: {delta}rho
GSE103937	genotype: wild type
GSE103937	∆nusG UvsW_replicate1
GSE103937	∆nusG UvsW_replicate2
GSE103937	∆nusG UvsW_replicate3
GSE103937	Reads were aligned using MG15655 as reference genome (NC000913.2) using Bowtie2 tool.
GSE103937	∆rho UvsW_replicate1
GSE103937	∆rho UvsW_replicate2
GSE103937	∆rho UvsW_replicate3
GSE103937	ssRNA-seq
GSE103937	Starting from single colonies, the following cultures were set up in triplicate for overnight incubation: GJ13507, GJ13531, and GJ13533 in glucose-minimal A; and GJ13519 also in 0.2% glycerol-minimal A. All the cultures were supplemented with 200 μM IPTG, with the exception of the cultures of GJ13507 whose supplementation with IPTG was at 3 μM. The overnight-grown cultures were each subcultured into 20 ml of fresh medium of the same composition, with an inoculum of 1:50 for GJ13507 and GJ13531 and of 1:100 for the remainder, and grown to an A600 of 0.4 to 0.45, before the cells were harvested for making the RNA preparations
GSE103937	Strand specific base read counts were determined for each of 4091 ORFs for the 15 samples
GSE103937	Strand-specific RNA-Seq data were generated, following rRNA depletion with a Ribo-Zero kit, with the aid of the di-tagged cDNA strategy (ScriptSeq) on an Illumina NextSeq platform
GSE103937	substrain: GJ13507
GSE103937	substrain: GJ13519
GSE103937	substrain: GJ13531
GSE103937	substrain: GJ13533
GSE103937	Supplementary_files_format_and_content: The text file contains sense and antisense raw base read counts for each of the 4091 ORFs for all the 15 samples, and the explanation key is included in the file.
GSE103937	Viable clones of the UvsW-expressing strains GJ13531 (Δrho) and GJ13507 (ΔnusG) were obtained as white colonies from their respective shelter plasmid-carrying derivatives GJ13531
GSE103937	WT glucose_replicate1
GSE103937	WT glucose_replicate2
GSE103937	WT glucose_replicate3
GSE103937	WT_glycerol_replicate1
GSE103937	WT_glycerol_replicate2
GSE103937	WT_glycerol_replicate3
GSE103937	WT UvsW_replicate1
GSE103937	WT UvsW_replicate2
GSE103937	WT UvsW_replicate3
GSE104504	cells
GSE104504	Cells were inoculated from overnight grown culture in Lysogeny Broth (LB) and then harvested in the early exponential growth phase and mid exponential growth phase.
GSE104504	crpfis.rep1.ee
GSE104504	crpfis.rep1.me
GSE104504	crpfis.rep2.ee
GSE104504	crpfis.rep2.me
GSE104504	crp.rep1.ee
GSE104504	crp.rep1.me
GSE104504	crp.rep2.ee
GSE104504	crp.rep2.me
GSE104504	cya.rep1.ee
GSE104504	cya.rep1.me
GSE104504	cya.rep2.ee
GSE104504	cya.rep2.me
GSE104504	Escherichia coli
GSE104504	fis.rep1.ee
GSE104504	fis.rep1.me
GSE104504	fis.rep2.ee
GSE104504	fis.rep2.me
GSE104504	Genome_build: Escherichia coli (NC000913.2)
GSE104504	genotype: crpfis mutant background
GSE104504	genotype: crp mutant background
GSE104504	genotype: cya mutant background
GSE104504	genotype: fis mutant background
GSE104504	genotype: wildtype
GSE104504	growth phase: Early exponential
GSE104504	growth phase: Mid exponential
GSE104504	NEXTflexRapid Directional RNA-Seq library kit
GSE104504	Raw .fastq files were mapped to the reference genome (NC000913.2) using BWA (version 0.7). Mapped reads were then converted to read count per gene using bedtools (version 2).  In the case of Ion torrent data .bam files were converted using BWA.
GSE104504	Resulting read count matrix was used as input for the differntial expression analysis in edgeR (version 3.12.1).
GSE104504	RNA-Seq
GSE104504	RNA was extracted from the harvested cells using Trizol reagent. Depending upon the concentration of total RNA, sample were treated with Dnase and ribocleanup was given according to the instruction manual.
GSE104504	srain: K12 MG1655
GSE104504	srain: K12 MG1656
GSE104504	srain: K12 MG1657
GSE104504	srain: K12 MG1658
GSE104504	srain: K12 MG1659
GSE104504	srain: K12 MG1660
GSE104504	srain: K12 MG1661
GSE104504	srain: K12 MG1662
GSE104504	srain: K12 MG1663
GSE104504	srain: K12 MG1664
GSE104504	srain: K12 MG1665
GSE104504	srain: K12 MG1666
GSE104504	srain: K12 MG1667
GSE104504	srain: K12 MG1668
GSE104504	srain: K12 MG1669
GSE104504	srain: K12 MG1670
GSE104504	srain: K12 MG1671
GSE104504	srain: K12 MG1672
GSE104504	srain: K12 MG1673
GSE104504	srain: K12 MG1674
GSE104504	Supplementary_files_format_and_content: .txt (log2 fold change values, p-values)
GSE104504	wt.rep1.ee
GSE104504	wt.rep1.me
GSE104504	wt.rep2.ee
GSE104504	wt.rep2.me
GSE105133	cell pellets
GSE105133	E. coli 042 WT
GSE105133	E. coli hhahha2
GSE105133	E. coli hns
GSE105133	E. coli hns2
GSE105133	E. coli hnshns2
GSE105133	Escherichia coli 042
GSE105133	For quantification of gene expression (read counting), the alignments generated with the Genomics Workbench were exported in BAM format. Read counting was then performed with the FeatureCounts v. 1.5.0-p1 program using the following parameters; Level : meta-feature leve. Paired-end : no. Strand specific : yes. Multimapping reads : counted (as fractions). Multi-overlapping reads : not counted. Overlapping bases : 30. Read orientations : fr
GSE105133	From the rRNA depleted RNA samples, first-strand cDNA was synthesized using a N6 randomized primer. After fragmentation, the Illumina TruSeq sequencing adapters were ligated in a strand specific manner to the 5' and 3' ends of the cDNA fragments. The cDNA was finally amplified with PCR (15 PCR cycles) using a proof reading enzyme. For Illumina sequencing, cDNA libraries were pooled in a 25:1 ratio. The library pool was fractionated in the size range of 250-500 bp using a differential clean- up with the Agencourt AMPure kit. The cDNA pool was sequenced on an Illumina NextSeq 500 system using 75 bp read length.
GSE105133	Genome_build: NCBI reference sequence (NC_017626.1)
GSE105133	genotype: mutant hhahha2
GSE105133	genotype: mutant hhs
GSE105133	genotype: mutant hns2
GSE105133	genotype: mutant hnshns2
GSE105133	genotype: wild type
GSE105133	Illumina sequencing instruments generate per-cycle BCL base call files as primary sequencing output in bcl2 format. Conversion of the bcl2 file to gzipped fastq files was performed using the bcl2fastq script v. 2.18.0.12 provided by Illumina.
GSE105133	LB medium at 37ºC with 200rpm agitation.
GSE105133	Mapping of the trimmed reads to the reference sequences was also performed with the CLC Genomics Workbench 9.0 using the 'Map Reads to Reference' tool with standard parameters.
GSE105133	Quality and adapter trimming was performed with the CLC Genomics Workbench 9.0 software package using the 'Trim Sequences' tool with standard parameters.
GSE105133	RNA-Seq
GSE105133	Supplementary_files_format_and_content: Strain-expression.xlsx archive contains expression values in RPKM (Reads Per Kb exon (contig) per Million mapped  reads ( see Mortazavi et al. 2008, Nat Methods. 5(7):621-8 ) and can be directly compared to each other)  tab-delimited text files include RPKM values for each Sample.
GSE105133	Total RNA was isolated from the cell pellets using a bead mill and the mirVana RNA isolation kit (Ambion) including DNase treatment. From the total RNA samples, ribosomal RNA molecules were depleted using the Ribo-Zero rRNA Removal Kit for bacteria (Illumina).
GSE105133	We used an Illumina NextSeq 500 system and a MID 150 Kit with 1x75 bp read length. Base-calling was perform online during the sequencing procedure with the Real-Time Analysis (RTA) software version 2.4.11 and System Suite Version 2.1.2.1.
GSE106628	E.coli_∆ompR pH 5.6 A
GSE106628	E.coli_∆ompR pH 5.6 B
GSE106628	E.coli_∆ompR pH 5.6 C
GSE106628	E.coli_∆ompR pH 7.2+15% sucrose A
GSE106628	E.coli_∆ompR pH 7.2+15% sucrose B
GSE106628	E. coli strains was grown in MgM media at pH 5.6, 7.2 and 7.2 with 15% (w
GSE106628	E.coli_WT pH 5.6 A
GSE106628	E.coli_WT pH 5.6 B
GSE106628	E.coli_WT pH 5.6 C
GSE106628	E.coli_WT pH 7.2+15% sucrose A
GSE106628	E.coli_WT pH 7.2+15% sucrose B
GSE106628	E.coli_WT pH 7.2+15% sucrose C
GSE106628	Escherichia coli str. K-12 substr. MG1655
GSE106628	genotype: delta_ompR
GSE106628	genotype: Wildtype
GSE106628	∆ompR pH 5.6 A
GSE106628	∆ompR pH 5.6 B
GSE106628	∆ompR pH 5.6 C
GSE106628	∆ompR pH 7.2+15% sucrose A
GSE106628	∆ompR pH 7.2+15% sucrose B
GSE106628	ph: 5.6
GSE106628	ph: 7.2
GSE106628	Raw signal data were extracted from the TIFF image with Agilent Feature Extraction Software (V10.7.1.1). The data analysis is done using a microarray specialized analysis software, Genespring GX. In this experiment, the microarray type used is a slide having 8 arrays with 60 thousand features per array. The exact number of features in the each array, inclusive of control probes, is 10,751 features. The microarray has a specific Agilent identifier called an AMADID which is used to identify what kind of array is being used; in this experiment the AMADID used is the design ID 020097.
GSE106628	strain: MG1655
GSE106628	sucrose status: no sucrose
GSE106628	sucrose status: with 15% sucrose
GSE106628	Supplementary files contain the following: Raw Signal Values: The term “raw” signal values refer to the linear data after thresholding and summarization Summarization is performed by computing the geometric mean. Raw data filtered on Expression (20.0 - 343943.344)• Normalized Signal Values: ``Normalized'' value is the value generated after log transformation and normalization (Shift to 75 percentile) and baseline transformation.
GSE106628	The total RNA was isolated using an RNeasy mini kit (Qiagen).
GSE106628	WT pH 5.6 A
GSE106628	WT pH 5.6 B
GSE106628	WT pH 5.6 C
GSE106628	WT pH 7.2+15% sucrose A
GSE106628	WT pH 7.2+15% sucrose B
GSE106628	WT pH 7.2+15% sucrose C
GSE107093	170 μl were taken from each of four wells per time point and collected into a fresh tube were 1.360 ml of RNA protection buffer had previously been added. Samples were left for 5 minutes at RT and then centrifuged at 4°C at maximum speed. Supernatant was discarded and pellets frozen at -20°C. RNA extraction was performed using RNeasy Mini Kit from Qiagen [Cat No 74104]. To remove possible traces of genomic DNA contamination, 2 μg of each sample were treated for a second time with DNAseI from Qiagen [Cat No 79254]. Total RNA quality and integrity was assessed using Agilent 2100 Bioanalyzer and Agilent RNA 6000 Nano kit [Cat No 5067-1511]. Samples had an average RIN of 9.5. Enrichment of mRNA was performed using MicrobExpress rRNA removal kit from Thermo Scientific [Cat No AM1905].  Successful rRNA depletion was assessed with analysis on Bioanalyzer. Retrotranscription was then performed starting from 50 ng total enriched mRNA using Tetro cDNA synthesis kit from Bioline [Cat No BIO-65043] and 6 μl of Random Hexamers [Cat No BIO-38028] per reaction. Second cDNA synthesis was performed adding to the first strand synthesis mix 5 μl of Second strand synthesis buffer [Cat No B6117S], 3 μl of dNTPs [Cat No N0446S], 2μl of RNAseH [Cat No M0297L] all from NEB, 2 μl of Polymerase I from Thermo Scientific [Cat No 18010025] and 18 μl of water, per reaction. Samples were incubated at 16°C for 2.5 h. Purification of cDNA was performed using MiniElute PCR purification kit [Cat No 28004] with final elution in 10 μl of DEPC-treated free water. cDNA was quantified using a Qubit fluorometer (Invitrogen).
GSE107093	After 60 minutes into the incubation, the plate was briefly removed so inducer could be added to wells, and this time point was set as time 0. Samples were instead removed from wells at 15 and 60 minutes after induction for processing.
GSE107093	B10 DH10BGFP_pSB1C3_2
GSE107093	B17 MG1655GFP_pSB1C3_2
GSE107093	B22 MG1655GFP_pSB1C3_H3_2
GSE107093	B26 MG1655GFP_Lux_2
GSE107093	B3 DH10BGFP_pSB1C3_2
GSE107093	B4 DH10BGFP_pLys_2
GSE107093	B7 DH10BGFP_pD864_2
GSE107093	B9 DH10BGFP_pLys_M1_2
GSE107093	Bacterial cells
GSE107093	E. coli cells with construct and control plasmids were grown at 37°C overnight with aeration in a shaking incubator in 5 ml of defined supplemented M9 medium with the appropriate antibiotic. In the morning, 60 μl of each sample were diluted into 3 ml of fresh medium and grown at 37°C with shaking for another hour (outgrowth). 200 μl of each sample were then transferred in 8 wells of a 96-well plate (Costar) at approximately 0.1 OD (600 nm). The samples were placed in a Synergy HT Microplate Reader (BioTek) and incubated at 37°C with orbital shaking at 1,000 rpm for 1 h, performing measurements of GFP (excitation (ex.), 485 nm; emission (em.), 528 nm) and OD (600 nm) every 15 minutes.
GSE107093	Escherichia coli
GSE107093	G21 MG1655GFP_pD864_3
GSE107093	G23 MG1655GFP_pLys_M1_3
GSE107093	G28 MG1655GFP_pD864_3
GSE107093	G29 DH10BGFP_None_3
GSE107093	G5 DH10BGFP_Lux_3
GSE107093	G6 DH10BGFP_pD864_LacZ_3
GSE107093	Genome_build: Samples from strain DH10BGFP were mapped to the reference geneome Escherichia coli str. K-12 substr. DH10B, assembly ASM1942v1.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit.
GSE107093	Genome_build: Samples from strain MG1655GFP were mapped to the reference geneome Escherichia coli str. K-12 substr. MG1655, assembly ASM584v2.31 complemented with the GFP sequence, and the sequence of corresponding synthetic circuit.
GSE107093	Library preparation was performed using the Nextera XT kit from Illumina [Cat No FC-131-1096] starting from 1 ng of total cDNA. The original protocol was modified where 3 min tagmentation and 13 cycles of step-limited PCR were used. Ampure beads from Beckman Coulter [Cat No A63880] were used for library purification. Library quality assessment and quantification was performed with Agilent 2100 Bioanalyzer and Agilent high sensitivity DNA analysis kit [Cat No 5067-4626]. Finally all 90 samples were pooled together in the same reaction tube at a final concentration of 1 nM.
GSE107093	Numer of reads per gene were counted using Bioconductor Rsubread package v1.12.6
GSE107093	paired end sequencing with Illumina HiSeq 2500 Sequencer
GSE107093	plasmid: None
GSE107093	plasmid: PD864
GSE107093	plasmid: PLYS
GSE107093	plasmid: PSB1C3
GSE107093	R11 DH10BGFP_pLys_1
GSE107093	R16 MG1655GFP_pLys_M1_1
GSE107093	R19 MG1655GFP_Lux_1
GSE107093	R26 MG1655GFP_Lux_1
GSE107093	R27 MG1655GFP_pD864_LacZ_1
GSE107093	R29 DH10BGFP_None_1
GSE107093	R2 DH10BGFP_pLys_M1_1
GSE107093	R3 DH10BGFP_pSB1C3_1
GSE107093	R6 DH10BGFP_pD864_LacZ_1
GSE107093	RNA-Seq
GSE107093	Sequenced reads were trimmed for adaptor sequence and low-quality sequence using TrimGalore version 0.4.1, then mapped to mm8 whole genome using bwa mem version 0.7.12 with default parameters
GSE107093	strain: DH10BGFP
GSE107093	strain: MG1655GFP
GSE107093	Supplementary_files_format_and_content: CSV files providing the number of reads mapping to each genomic gene
GSE107093	synthetic circuit: H3
GSE107093	synthetic circuit: LACZ
GSE107093	synthetic circuit: Lux
GSE107093	synthetic circuit: M1
GSE107093	synthetic circuit: None
GSE107093	treatment: 15 min
GSE107093	treatment: 15 min after induction with arabinose
GSE107093	treatment: 15 min after induction with rhamnose
GSE107093	treatment: 60 min after induction with arabinose
GSE107093	treatment: 60 min after induction with rhamnose
GSE107301	3C-seq: 5 µg of a 3C library was suspended in water (final volume 130 µL) and sheared using a Covaris S220 instrument (Duty cycle 5, Intensity 5, cycles
GSE107301	3C-seq libraries were proccessed using the 3C-seq pipeline available at (https:
GSE107301	3C-seq of E. coli fis cells in exponential phase 30°C
GSE107301	3C-seq of E. coli fis cells in exponential phase 30°C -Replicate 1
GSE107301	3C-seq of E. coli hns cells in exponential phase 30°C
GSE107301	3C-seq of E. coli hns cells in exponential phase 30°C -Replicate 1
GSE107301	3C-seq of E. coli hupAB cells in exponential phase 37°C
GSE107301	3C-seq of E. coli hupAB cells in exponential phase 37°C -Replicate 1
GSE107301	3C-seq of E. coli matP cells in exponential phase 22°C
GSE107301	3C-seq of E. coli matP cells in exponential phase 30°C
GSE107301	3C-seq of E. coli matP cells in exponential phase 30°C -Replicate 1
GSE107301	3C-seq of E. coli matPDC20 cells harbouring plasmid pGBM2-5xmatS in exponential phase 30°C
GSE107301	3C-seq of E. coli matPDC20 cells harbouring plasmid pGBM2 in exponential phase 30°C
GSE107301	3C-seq of E. coli matPDC20 cells in exponential phase 30°C
GSE107301	3C-seq of E. coli mukB cells in exponential phase 22°C
GSE107301	3C-seq of E. coli mukB cells in exponential phase 22°C -Replicate 1
GSE107301	3C-seq of E. coli mukBmatP cells in exponential phase 22°C
GSE107301	3C-seq of E. coli wt cells harbouring plasmid pGBM2-5xmatS in exponential phase 30°C
GSE107301	3C-seq of E. coli wt cells harbouring plasmid pGBM2-5xmatS in exponential phase 30°C -Replicate 1
GSE107301	3C-seq of E. coli wt cells harbouring plasmid pGBM2 in exponential phase 30°C
GSE107301	3C-seq of E. coli wt cells harbouring plasmid pGBM2 in exponential phase 30°C -Replicate 1
GSE107301	3C-seq of E. coli wt cells in exponential phase 22°C
GSE107301	3C-seq of E. coli wt cells in exponential phase 22°C -Replicate 1
GSE107301	3C-seq of E. coli wt cells in exponential phase 30°C
GSE107301	3C-seq of E. coli wt cells in exponential phase 30°C -Replicate 1
GSE107301	3C-seq of E. coli wt cells in exponential phase 30°C -Replicate 2
GSE107301	3C-seq of E. coli wt cells in exponential phase 37°C
GSE107301	3C-seq of E. coli wt cells in exponential phase 37°C -Replicate 1
GSE107301	3C-seq of E. coli wt cells in exponential phase LB 30°C
GSE107301	3C-seq of E. coli wt cells in exponential phase LB 30°C -Replicate 1
GSE107301	3C-seq of E. coli wt cells in stationary phase 30°C (30h)
GSE107301	3C-seq of E. coli wt cells in stationary phase 30°C (30h) -Replicate 1
GSE107301	3C-seq of E. coli zapB cells harbouring plasmid pGBM2-5xmatS in exponential phase 30°C
GSE107301	3C-seq of E. coli zapB cells harbouring plasmid pGBM2 in exponential phase 30°C
GSE107301	3C-seq of E. coli zapB cells in exponential phase 30°C
GSE107301	Assignment to restriction fragment
GSE107301	Binning at 5kb.
GSE107301	E coli cells
GSE107301	E. coli cells were grown at 22°C, 30°C and 37°C in either Lennox Broth (LB) or liquid minimal medium A supplemented with 0.12% casamino acids and 0.4% glucose. The cultures were grown to OD600 = 0.2 (early exponential) or 2 (stationary phase).
GSE107301	Escherichia coli str. K-12 substr. MG1655
GSE107301	Filtering, Mapping quality=30, no ambiguous reads
GSE107301	For 3C-seq: ≈ 1-2 x 109 crosslinked cells (7% formaldehyde, unless otherwise stated ) are suspended in 600 μl Tris 10 mM EDTA 0.5 mM (TE) (pH 8) with 4 μl of lysozyme (35 U
GSE107301	For RNA-seq: total RNA was extracted using RNeasy Protect Bacteria according to manufacturer instructions (QIAGEN - # 74524)
GSE107301	Genome_build: E. coli MG1655 GenBank: U00096.2,total length : 4639675 bp
GSE107301	genotype: F- lambda- ilvG- rfb-50 rph-1
GSE107301	genotype: F- lambda- ilvG- rfb-50 rph-1 [delta]fis::frt-kan-frt
GSE107301	genotype: F- lambda- ilvG- rfb-50 rph-1 [delta]hns::frt- kan -frt
GSE107301	genotype: F- lambda- ilvG- rfb-50 rph-1 [delta]matP::frt-cam-frt
GSE107301	genotype: F- lambda- ilvG- rfb-50 rph-1 [delta]mukB::frt- kan
GSE107301	genotype: F- lambda- ilvG- rfb-50 rph-1 [delta]zapB::frt-kan-frt
GSE107301	genotype: F- lambda- ilvG- rfb-50 rph-1 matP[delta]C20::frt-cam-frt
GSE107301	genotype: F- lambda- ilvG- rfb-50 rph-1 phi80+ [delta]hupA::frt- kan -frt [delta]hupB::frt-cam-frt
GSE107301	genotype: F- lambda- ilvG- rfb-50 rph-1phi80+ [delta]mukB::frt- apra [delta]matP::frt-cam-frt
GSE107301	growth condition: LB at 30°C
GSE107301	growth condition: LB at 37°C
GSE107301	growth condition: MM + 0.12% casaminoacids +0.4% glucose at 22°C
GSE107301	growth condition: MM + 0.12% casaminoacids +0.4% glucose at 30°C
GSE107301	Iterative alignment, Min-leght=20, step=5, bowtie2 --very-sensitive
GSE107301	Library strategy: 3C-seq
GSE107301	OTHER
GSE107301	Removal of PCR duplicates based on the 20 first bp of the read containing a 6 nt random tag (home made script).
GSE107301	Removal of un-informative events (uncuts, loops etc) as described in Cournac et al. BMC 2012.
GSE107301	RNA-Seq
GSE107301	RNA-seq of E. coli wt cells in stationary phase 30°C (30h)
GSE107301	RNA-seq of E. coli wt cells in stationary phase 30°C (30h) -Replicate 1
GSE107301	Supplementary_files_format_and_content: rna-seq: genomic position (middle of the 5kb-bin) to each count. 3C seq: contact maps (2D array of 928 5kb-bins x 928 5kb-bins).
GSE107327	Bacterial liquid culture
GSE107327	Counts were depth normalized to a pseudo-reference sample calculated from all samples (ribozero treated samples) or using counts per million counts (total RNA samples).
GSE107327	emptyvec_mRNA_5m_rep1
GSE107327	emptyvec_mRNA_5m_rep2
GSE107327	emptyvec_totalRNA_30m_rep1
GSE107327	emptyvec_totalRNA_30m_rep2
GSE107327	emptyvec_totalRNA_5m_rep1
GSE107327	emptyvec_totalRNA_5m_rep2
GSE107327	ercc spike-in: No
GSE107327	ercc spike-in: Prior to extraction
GSE107327	Escherichia coli
GSE107327	For each uniquely mapped fragment (ribozero treated samples) or all mapped fragments (total RNA samples), at all aligned positions a count was added.
GSE107327	For ribozero treated samples, counts at all positions were log2 transformed and a cleavage ratio was calculated (+ MazF - empty vector) for assessing MazF cleavage in transcripts.
GSE107327	Genome_build: NCBI reference sequence: NC_000913.2
GSE107327	MazF_mRNA_5m_rep1
GSE107327	MazF_mRNA_5m_rep2
GSE107327	MazF_totalRNA_30m_rep1
GSE107327	MazF_totalRNA_30m_rep2
GSE107327	MazF_totalRNA_5m_rep1
GSE107327	MazF_totalRNA_5m_rep2
GSE107327	MazF_totalRNA_60m_rep1
GSE107327	MazF_totalRNA_60m_rep2
GSE107327	Paired-end reads mapped to MG1655 genome using bowtie2 with default settings. Any adapter sequences were removed prior to mapping.
GSE107327	plasmid: pBAD30-empty
GSE107327	plasmid: pBAD30-MazF
GSE107327	ribozero: No
GSE107327	ribozero: Yes
GSE107327	RNA-Seq
GSE107327	RNA was extracted using Trizol (Invitrogen) and Direct-zol RNA MiniPrep kit (Zymo).
GSE107327	See publication for complete protocol. Briefly, samples with rRNA subtraction with treated with bacterial Ribo-Zero kit (Illumina). Next, RNA was fragmented with RNA fragmentation reagents (Ambion). First strand cDNA synthesis was conducted using random primers and Superscript III (Invitrogen). To enable strand specificity, second strand synthesis was conducted using dUTP instead of dTTP with RNase H, E. coli DNA ligase, and E. coli DNA polymerase. Ends were repaired with T4 DNA polymerase, Klenow DNA polymerase, and T4 PNK. 3’ ends were adenylated with the Klenow fragment (3’>5’ exo-). Y-shaped adapters were ligated and 9-12 cycles of PCR were conducted with standard Illumina primers with multiplexing indexes. Libraries were extracted from an acrylamide gel and submitted for sequencing at the MIT BioMicro Center using standard Illumina protocols.
GSE107327	Separate E. coli colonies were picked from LB agar plates for each replicate. Overnight cultures (12-16 hrs) were grown at 37°C in M9 media supplemented with 0.1% casamino acids, 0.4% glycerol, 0.4% glucose, 2 mM MgSO4, and 0.1 mM CaCl2. Overnight cultures were back diluted into fresh media and grown 3-4 hours to an OD600 of ~0.35 at 37°C in an orbital shaker at 200 RPM. Cultures were centrifuged, washed, and back diluted into media lacking glucose. After at least 30 minutes of recovery Para was induced by adding arabinose to 0.2%. Cells were harvested by centrifuging 1 mL of culture for 1 minute at maximum speed on a benchtop centrifuge. Pellets were immediately flash frozen in lN2.
GSE107327	strain: MG1655 delta_mazF
GSE107327	Supplementary_files_format_and_content: 5m_ribozero_counts_cleavage_ratio.csv.gz is a log-transformed list of sequencing depth-normalized counts for every genomic position at both strands for each ribozero treated sample as well as the average cleavage ratio calculated from all samples. total_RNA_rpm.csv.gz is a list of sequencing depth-normalized counts for every genomic position at both strans for all total RNA samples.
GSE107327	time induction: 30 minutes
GSE107327	time induction: 5 minutes
GSE107327	time induction: 60 minutes
GSE107550	Bacteria
GSE107550	Culture of bacterial strains (10 mL) were centrifuged 20 min at 10,000 g and bacterial pellets were washed 3 times with 2 mL of phosphate buffered saline (PBS). DNA extraction was performed using the EasyDNA kit (Invitrogen) following the manufacturer instructions slightly modified. Briefly, the bacterial pellet was incubated 5 min in 200 μL of PBS and 1 μL of protéinase K (20 mg
GSE107550	Escherichia coli K-12
GSE107550	Fluorescence intensities of oligonucleotide spots were extracted from the scanned images using the Feature Extraction software (V11.0, Agilent Technologies). Then data were processed with dedicated scripts based on C++ and Delphi languages. For each probe, median intensity value of the 3 replicates was conserved and used as the probe signal value. The SNR (Signal-to-Noise Ratio), similar to the detection threshold response (positive hybridization) and corresponding to the probe signal value divided by the local background intensity value, was calculated for each probe. The SNR thresholds were set to 3 for 25-mer probes and 6 for 54-mer probes. Such SNR threshold values ensured a very specific response of the FibroChip, except for genes belonging to very close strains from the same species. Results for 25- and 54-mer probes were treated independently and for each probe type, a gene was considered as detected when 65% of probes were positive. The SNR value of a detected gene was then calculated by the mean of the SNR of all 25- or 54-mer probes targeting this gene, meeting or not the defined SNR threshold.
GSE107550	gDNA_Ecoli_K12
GSE107550	Genomic DNA was extracted from 4 bacteria strains. Strains Fibrobacter succinogenes S85 (ATCC 19169), Ruminococcus albus 20 (ATCC 27211) and Bacteroides xylanisolvens XB1A (DSM 18836T) were grown 15 h under strictly anaerobic conditions (Hungate, 1950) in a complex medium containing 20% of clarified rumen fluid (Béra-Maillet et al., 2000) and 0.2 g of cellobiose (Sigma-Aldrich) as carbon source, at 39°C for the two first ones and 37°C for the third one. The strain Escherichia coli K12 (ATCC 10798) was cultivated 15 h at 37°C in Luria-Bertani medium under shaking and aerobic conditions. (
GSE107550	gut origin: Human colon
GSE107550	No treatment
GSE10757	AcrA-Negative, Multidrug Efflux Mutant Strain
GSE10757	AcrB- and EmrAB-Negative, Multidrug Efflux Mutant Strain
GSE10757	AcrB-Negative, Multidrug Efflux Mutant Strain
GSE10757	AG102MB is an isogenic mutant derived from hyper-resistant AG102 (marR1).  It contains a mutation at the acrB locus (marR1, acrB::kan) resulting in a multidrug efflux negative phenotype.
GSE10757	Cultures were grown to mid-log phase in Luria-Bertani (Miller) broth medium at 37C.
GSE10757	Cultures were grown to mid-log phase in Luria-Bertani (Miller) broth medium at 37C.  Cells were cultured with 25 ug
GSE10757	E. coli AcrA Multidrug Efflux Mutant
GSE10757	E. coli AcrB and EmrAB Multidrug Efflux Double Mutant
GSE10757	E. coli AcrB Multidrug Efflux Mutant
GSE10757	Efflux Mutant Parent Strain
GSE10757	Escherichia coli
GSE10757	HNCE3 is an isogenic mutant derived from hyper-resistant AG102 (marR1).  It contains a nonpolar mutation at the acrA locus which allows read-through for acrB expression and results in a multidrug efflux negative phenotype.
GSE10757	HNCE4 is an isogenic mutant derived from drug sensitive AG102MB (marR1, AcrB::kan). It contains an additional mutation at the emrAB locus (marR1, acrB::kan, emrAB::cat) resulting in a multidrug efflux negative phenotype.
GSE10757	The analyzed data were imported to ArrayTrack (NCTR Center for Toxicoinformatics;http:
GSE10757	The parent strain, AG102, was previously derived from AG100 (K-12).  AG102 is drug hyper-resistant due to a mutation in marR (marR1) which increases expression of MarA, a global regulator, which in turn results in overexpression of the AcrAB-TolC multidrug efflux system.
GSE10757	Total RNA was extracted using Qiagen RNeasy kit.
GSE107972	Alignment: reads were mapped to bespoke reference sequence (DL4201_in_lab_reference_genome (available on series record)) using the default parameters of software Bowtie 2 (Langmead, B. and Salzberg, S.L. (2012) Fast gapped-read alignment with Bowtie 2. Nat Methods, 9, 357-359).
GSE107972	All samples were processed following NEB’s protocol from the NEBNext® ChIP-Seq library preparation kit.
GSE107972	background strain: BW27784
GSE107972	Bacterial Cell Lysates
GSE107972	Cells were collected by centrifugation and washed three times in ice-cold 1X PBS. The pellet was then re-suspended in 250 μl ChIP buffer (200 mM Tris-HCl (pH 8.0), 600 mM NaCl 4% Triton X, Complete protease inhibitor cocktail EDTA-free (Roche)). Sonication of crosslinked samples was performed using the Diagenode Bioruptor® at 30s intervals for 10 min at high amplitude. After sonication, 350 μl of ChIP buffer was added to each sample, the samples were mixed by gentle pipetting and 100 μl of each lysate was removed and stored as ‘input’. Immunoprecipitation was performed overnight at 4°C using 1
GSE107972	Cells were grown in LB media supplemented with 0.2% arabinose at 37°C to and OD600nm of 0.2-0.25
GSE107972	ChIP-Seq
GSE107972	DL4184 biological repeat 1 RecA ChIP
GSE107972	DL4184 biological repeat 2 RecA ChIP_reanalyzed
GSE107972	DL4201 biological repeat 1 RecA ChIP
GSE107972	DL4201 biological repeat 2 RecA ChIP_reanalyzed
GSE107972	DL5699 biological repeat 1 RecA ChIP
GSE107972	DL5699 biological repeat 2 RecA ChIP
GSE107972	DL6204 biological repeat 1 RecA ChIP
GSE107972	DL6204 biological repeat 2 RecA ChIP
GSE107972	Escherichia coli K-12
GSE107972	Genome_build: DL4201_in_lab_reference_genome (available on series record)
GSE107972	genotype: BW27784 delta_recD lacZ::XXX mhpR::XXX proA::ISceIcs  tsx::ISceIcs  PBAD-sbcDC  lacZ+ cynX::GmR  lacIq  lacZX-
GSE107972	genotype: BW27784 delta_recD lacZ::XXX mhpR::XXX proA::ISceIcs  tsx::ISceIcs  PBAD-sbcDC  lacZ:: pal246 cynX::GmR  lacIq  lacZX-
GSE107972	genotype: BW27784 lacZ::XXX mhpR::XXX proA::ISceIcs  tsx::ISceIcs  PBAD-sbcDC  lacZ+ cynX::GmR  lacIq  lacZX-
GSE107972	genotype: BW27784 lacZ::XXX mhpR::XXX proA::ISceIcs  tsx::ISceIcs  PBAD-sbcDC  lacZ::pal246 cynX::GmR  lacIq  lacZX-
GSE107972	Normalisation: Counts were normalised by applying a single, sample-specific scaling factor.  To calculate this scaling factor, we implemented the median of ratios normalisation of DESeq software (Anders, S. and Huber, W. (2010) Differential expression analysis for sequence count data. Genome Biol, 11, R106) using R.
GSE107972	Protein DNA interactions were crosslinked for 10 min at 22.5C with 1% formaldehyde and quenched using glycine to a final concentration of 0.5M
GSE107972	Raw counts of mapped reads per reference base pair were then calculated using SAMtools software (with parameter –d set to 10^6).
GSE107972	strain: DL4184
GSE107972	strain: DL4201
GSE107972	strain: DL5966
GSE107972	strain: DL6204
GSE107972	Supplementary_files_format_and_content: txt files of a matrix containing genome position in column 1 and number of depth of mapped reads in column 2. Also, in a CSV file of a matrix containing genome position in column 1 and subsequent coloumns with normalised number of depth of mapped reads (column names have the strain number). CSV file is on the series record.
GSE107972	treatment: induced DNA double strand break
GSE107972	treatment: none
GSE10811	AG102 was previously derived from AG100 (K-12). AG102 is drug hyper-resistant due to a mutation in marR (marR1) which increases expression of MarA, a global regulator, which in turn results in overexpression of the AcrAB-TolC multidrug efflux system.
GSE10811	Cholic Acid Treatment
GSE10811	DMSO-Only Treatment
GSE10811	E. coli Cholic Acid Treatment
GSE10811	E. coli Estradiol Treatment
GSE10811	E. coli Hydrocortisone Treatment
GSE10811	E. coli Progesterone Treatment
GSE10811	E. coli was grown to mid-log phase in Luria-Bertani (Miller) broth medium at 37C in the presence of dimethyl sulfoxide (DMSO)-dissolved cholic acid at 1 mM final culture concentration.
GSE10811	E. coli was grown to mid-log phase in Luria-Bertani (Miller) broth medium at 37C in the presence of dimethyl sulfoxide (DMSO)-dissolved estradiol at 1 mM final culture concentration.
GSE10811	E. coli was grown to mid-log phase in Luria-Bertani (Miller) broth medium at 37C in the presence of dimethyl sulfoxide (DMSO)-dissolved hydrocortisone at 1 mM final culture concentration.
GSE10811	E. coli was grown to mid-log phase in Luria-Bertani (Miller) broth medium at 37C in the presence of dimethyl sulfoxide (DMSO)-dissolved progesterone at 1 mM final culture concentration.
GSE10811	E. coli was grown to mid-log phase in Luria-Bertani (Miller) broth medium at 37C in the presence of dimethyl sulfoxide (DMSO)-only steroid carrier.
GSE10811	Escherichia coli
GSE10811	Estradiol Treatment
GSE10811	Hydrocortisone Treatment
GSE10811	Progesterone Treatment
GSE10811	The analyzed data were imported to ArrayTrack (NCTR Center for Toxicoinformatics.  The raw data were normalized by using median channel (intensity) scaling with no background subtraction.
GSE10811	Total RNA was extracted using Qiagen RNeasy kit.
GSE10855	Bacteria were grown in batch or bioreactor vessels in M9 minimal media supplemented with 0.4% glucose.
GSE10855	DNA extraction: Genomic DNA was isolated and purified according to standard procedures (Ausubel et al. 1994).  Genomic DNA was fragmented by nebulization as described by Girgis et al. PLoS Genetics 3(9): e154 (2007) and purified by phenol
GSE10855	Elements with poor spot morphology or exhibiting uneven hybridization caused by dust particles or scratches, were flagged manually and excluded from further analyses. After local background  subtraction and global normalization relative to the genomic DNA reference, duplicate measurements on the same array were averaged, yielding a single vector for each time-point across a perturbation. The data from all hybridizations were combined into a matrix and scaled relative to each other using quantile-normalization as implemented in the Matlab Bioinformatics  toolbox. Biological duplicates from all experiments were averaged, leading to a single set of time-series data for each perturbation. Seven time-points were assayed for each perturbation, corresponding to 0, 4, 8, 12, 20, 28, and 44 minutes post transition.
GSE10855	Escherichia coli K-12
GSE10855	evolved_temperature_Up_0min
GSE10855	evolved_temperature_Up_16min
GSE10855	evolved_temperature_Up_44min
GSE10855	evolved temperature up shift 0min
GSE10855	evolved temperature up shift 16min
GSE10855	evolved temperature up shift 44min
GSE10855	genomic DNA
GSE10855	Genomic DNA served as a universal reference
GSE10855	MG1655
GSE10855	oxygen_down_0min
GSE10855	oxygen_down_12min
GSE10855	oxygen_down_20min
GSE10855	oxygen_down_28min
GSE10855	oxygen_down_44min
GSE10855	oxygen_down_4min
GSE10855	oxygen_down_8min
GSE10855	oxygen down shift, 0min
GSE10855	oxygen down shift, 12min
GSE10855	oxygen down shift, 20min
GSE10855	oxygen down shift, 28min
GSE10855	oxygen down shift, 44min
GSE10855	oxygen down shift, 4min
GSE10855	oxygen down shift, 8min
GSE10855	oxygen_Up_0min
GSE10855	oxygen_Up_12min
GSE10855	oxygen_Up_20min
GSE10855	oxygen_Up_28min
GSE10855	oxygen_Up_44min
GSE10855	oxygen_Up_4min
GSE10855	oxygen_Up_8min
GSE10855	oxygen up shift, 0min
GSE10855	oxygen up shift, 12min
GSE10855	oxygen up shift, 20min
GSE10855	oxygen up shift, 28min
GSE10855	oxygen up shift, 44min
GSE10855	oxygen up shift, 4min
GSE10855	oxygen up shift, 8min
GSE10855	parental_temperature_Up_0min
GSE10855	parental_temperature_Up_16min
GSE10855	parental_temperature_Up_44min
GSE10855	parental temperature up shift 0min
GSE10855	parental temperature up shift 16min
GSE10855	parental temperature up shift 44min
GSE10855	Physiological perturbations were carried out under a controlled environment in the context of bioreactor (Bioflo 110, New Brunswick Scientific) growth. Thermoelectric sensors and heaters were used to shift temperature profiles between 250 C and 370 C, and polarographic dissolved oxygen sensors (Mettler Toledo) and nitrogen gas was used to rapidly change oxygen saturation between anaerobic (0% dissolved oxygen) and aerobic (16-21% dissolved oxygen) condition.
GSE10855	RNA extraction: A hot-phenol procedure was used to extract total RNA. Cell pellets were lysed with 500 μl TE (pH8.0), 50 μl 10% SDS and lysozyme (0.5 mg
GSE10855	temperature_down_0min
GSE10855	temperature_down_12min
GSE10855	temperature_down_20min
GSE10855	temperature_down_28min
GSE10855	temperature_down_44min
GSE10855	temperature_down_4min
GSE10855	temperature_down_8min
GSE10855	temperature down shift, 0min
GSE10855	temperature down shift, 12min
GSE10855	temperature down shift, 20min
GSE10855	temperature down shift, 28min
GSE10855	temperature down shift, 44min
GSE10855	temperature down shift, 4min
GSE10855	temperature down shift, 8min
GSE10855	temperature_Up_0min
GSE10855	temperature_Up_12min
GSE10855	temperature_Up_20min
GSE10855	temperature_Up_28min
GSE10855	temperature_Up_44min
GSE10855	temperature_Up_4min
GSE10855	temperature_Up_8min
GSE10855	temperature up shift, 0min
GSE10855	temperature up shift, 12min
GSE10855	temperature up shift, 20min
GSE10855	temperature up shift, 28min
GSE10855	temperature up shift, 44min
GSE10855	temperature up shift, 4min
GSE10855	temperature up shift, 8min
GSE108846	Basecalling performed by MiSeq (RTA)
GSE108846	carbon source: Glucose
GSE108846	carbon source: Glycerol
GSE108846	cDNA libraries were barcoded with the TruSeq RNA Sample Prep Kit v2 (Illumina Inc., San Diego, CA). Libraries were sequenced on the Illumina MiSeq to produce 50 bp single reads. All steps in library construction and sequencing were performed according to manufacturer’s standards.
GSE108846	CF104.3.3_u1
GSE108846	CF104.3.3_u7
GSE108846	CF104.3.3_y2
GSE108846	CF104.3.3_y9
GSE108846	CF108.4B_u1
GSE108846	CF108.4B_u2
GSE108846	CF108.4B_y3
GSE108846	CF108.4B_y8
GSE108846	Compile annotated counts using custom Python script (ExtractMapCounts from http:
GSE108846	CON206.3A_u1
GSE108846	CON206.3A_u2
GSE108846	CON206.3A_y1
GSE108846	CON206.3A_y2
GSE108846	CON208.3A_u1
GSE108846	CON208.3A_u8
GSE108846	CON208.3A_y2
GSE108846	CON208.3A_y6
GSE108846	disease state: control
GSE108846	disease state: cystic fibrosis
GSE108846	E. coli strain isolated from CF patient stool
GSE108846	E. coli strain isolated from healthy child stool
GSE108846	Escherichia coli
GSE108846	Experiments were performed at 37°C and followed three steps: seed culture, pre-culture and experimental culture. In the seed culture the cells were grown overnight in Luria Broth, then diluted 1:100 in either M9 minimal media with glycerol or glucose for the pre-cultures. Finally, the experimental cultures were started from the overnight grown pre-cultures containing the same carbon source at a normalized optical density at 600 nm (OD600) of 0.05. Cultures were harvested at mid-exponential phase, cells were immediately spun down and cell pellets stored at -80°C until processed.
GSE108846	Filter for map quality >= 20 using Samtools 0.1.18
GSE108846	Filter out rRNA reads, multi-mapped reads, > 3 mismatches, and gapped mappings using custom Python script (FilterBAM2BAM from http:
GSE108846	Genome_build: Escherichia coli str. K-12 substr. MG1655 (U00096.3)
GSE108846	individual: CF patient
GSE108846	individual: healthy child
GSE108846	Map to MG1655 reference using BWA 0.7.4 (bwa mem, default parameters)
GSE108846	replicate: 1
GSE108846	replicate: 2
GSE108846	RNA-Seq
GSE108846	RNA was extracted using Trizol and chloroform in conjunction with Qiagen’s RNeasy Mini kit (Qiagen, Valencia, CA) following the A. Untergasser protocol (http:
GSE108846	Supplementary_files_format_and_content: expression level files are tab-delimited text with columns as follows: index, hits, RPKM, RPM, start_position, end_position, strand, feature_type, reference_replicon (type), locus_tag, gene_name, product
GSE10974	Bacterial cells were grown in dYT medium (Miller, JH (1972) Experiments in Molecular Genetics (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) supplemented with kanamycin (10 mg
GSE10974	E.coli
GSE10974	E. coli B178 groESL(-) expressing human Hsp60 and Hsp10
GSE10974	E. coli B178 groESL(-) expressing human wt and Val98Ile Hsp60 and Hsp10
GSE10974	E. coli strain B178 (Georgopoulos et al. (1973) J Mol Biol 76: 45-60) in which the endogenous groES and groEL genes have been deleted and that is maintained alive by the pOFX-tac1-derived plasmid carrying an IPTG-inducible operon with cDNA encoding human Hsp10 and the mature part of human wild type Hsp60 (Hansen et al., 2002). These cells were subsequently transformed by electroporation with a second plasmid, derivative of pBAD
GSE10974	Escherichia coli
GSE10974	MAS5.0
GSE10974	Total RNA was purified using the RNAeasy kit (Qiagen).
GSE11010	Data were analyzed using custom software based on the R programming environment and BioConductor packages. Each probe was randomly spotted in three to five replicates to control for positional effects on the array. Data from replicate probes were summarized by the median of the log2-transformed intensities. No normalization or background correction was performed.
GSE11010	E.coli CFT073 genomic DNA
GSE11010	E.coli CFT073 genomic DNA hybridization to LLNL virulence mechanism array v2A
GSE11010	E.coli O157:H7 EDL 933 genomic DNA
GSE11010	E.coli O157:H7 EDL 933 genomic DNA hybridization to LLNL virulence mechanism array v2A
GSE11010	Escherichia coli CFT073
GSE11010	Escherichia coli O157:H7 str. EDL933
GSE11010	Genomic DNA was extracted using the Epicentre DNA extraction kit according to the manufacturer's protocols.
GSE11010	serovar O157:H7 strain EDL933; GenBank accession NC_002655.2
GSE11010	strain CFT073; GenBank accession AE014075.1
GSE11010	The bacterial culture pellets were grown according to the instructions from ATCC.
GSE110255	Escherichia coli
GSE110255	Functional annotation was done using the Database for Annotation, Visualization and Integrated Discovery (DAVID) Bioinformatics Resources 6.7, NIAID, NIH (http:
GSE110255	incubation time: 5 hr
GSE110255	Next, a linear model was built for each comparison using the R LIMMA package and statistics for differential expression analysis were computed. To filter for differential expression, two fold or three-fold change with a FDR ≤0.05 were used as the threshold.
GSE110255	PA20 cultures
GSE110255	PA20 cultures for RNA-seq were grown on T-agar with and without added Sulfamethoxazole-  Trimethoprim at designated levels for the indicated times and temperatures. Working stocks were tested and maintained using LB (Miller formulation) or LB agar. Plasmid pSE380 derivatives were induced by IPTG.
GSE110255	RNA libraries were prepared for sequencing using standard Illumina protocols; rRNAs were removed by Ribozero (gram negative), libraries were prepared using TruSeq protocol.
GSE110255	RNA-Seq
GSE110255	RNA-seq data were mapped to the E. coli O157:H7 Sakai genome using the Subjunc aligner program from the Subread package (v1.4.6)   (http:
GSE110255	Supplementary_files_format_and_content: comma-delimited text files include RPKM values for each Sample
GSE110255	T5_1x_4
GSE110255	T5_27x_1
GSE110255	The alignment Bam files were compared against the gene annotation general feature format (GFF) file, and raw counts for each gene were  generated using the featureCounts tool from Subread. The raw counts data of the expressed genes was normalized for RNA composition using the trimmed mean of M values (TMM) method (http:
GSE110255	Total RNA samples were isolated using RNAzol RT (Molecular Research Center) by following manufature's instructions. Contaminating DNA was   removed from RNA samples by DNase I digestion using the TURBO DNA-free kit (Ambion).
GSE11041	15degrees replicate 1
GSE11041	15degrees replicate 2
GSE11041	15degrees replicate 3
GSE11041	46degrees replicate 1
GSE11041	46degrees replicate 2
GSE11041	46degrees replicate 3
GSE11041	BC-7ppm replicate 1
GSE11041	BC-7ppm replicate 2
GSE11041	BC-7ppm replicate 3
GSE11041	BC-9ppm replicate 1
GSE11041	BC-9ppm replicate 2
GSE11041	BC-9ppm replicate 3
GSE11041	CH3COOH (pH 5.9 ± 0.05); HCl (pH 4.75 ± 0.05); NaOH (pH 9.6 ± 0.05); EtOH (5%); NaCl (4.5%); Glycerol (15%); BC (7 and 9 mg
GSE11041	CH3COOH replicate 1
GSE11041	CH3COOH replicate 2
GSE11041	CH3COOH replicate 3
GSE11041	Control replicate 1
GSE11041	Control replicate 2
GSE11041	Control replicate 3
GSE11041	Escherichia coli str. K-12 substr. MG1655
GSE11041	EtBr replicate 1
GSE11041	EtBr replicate 2
GSE11041	EtBr replicate 3
GSE11041	EtOH replicate 1
GSE11041	EtOH replicate 2
GSE11041	EtOH replicate 3
GSE11041	Glycerol replicate 1
GSE11041	Glycerol replicate 2
GSE11041	Glycerol replicate 3
GSE11041	HCl replicate 1
GSE11041	HCl replicate 3
GSE11041	NaCl replicate 1
GSE11041	NaCl replicate 2
GSE11041	NaCl replicate 3
GSE11041	NaOH replicate 1
GSE11041	NaOH replicate 3
GSE11041	pooled RNA from all conditions including the control, reference
GSE11041	The cultures were prepared by inoculating one colony from tryptone soya agar (TSA) (Oxoid) (overnight growth at 37°C) to 5 ml TSB and incubating overnight at 37°C, with shaking (200 rpm). This culture was initially diluted 1:10 in medium and used to inoculate room-temperature TSB for each of the different stress factors (40 ml total volume) to a final concentration of approx. 1´107 CFU
GSE11041	The fluorescent spot intensities were quantified using ImaGeneÔ 5.6.1 (BioDiscovery Inc.) software. Background subtraction and normalization (LOWESS) was performed in GeneSpringä 7 (Silicon Genetics). (A lowess curve was fit to the log-intensity versus log-ratio plot. 20% of the data was used to calculate the lowess fit at each point. The curve was used to adjust the control value for each measurement. If the control channel was lower than 10 then the value was set to 10). Only data from spots representing E. coli K-12 MG1655 genes were analyzed in our studies. All analyses were based on 3 biological replicates with the exception of the second biological replicate from conditions HCl and NaOH. These two observations were removed due to bad hybridization giving a total of 34 array hybridizations (observations). Genes not present in any of the 34 observations were filtered out, resulting in the analysis of 4279 out of 4289 MG1655 genes on the array. Missing values (data points) were replaced by using the KNNimpute procedure (k=10) on log2 transformed data.
GSE11041	Total RNA was extracted from 1 ml cells using the RNeasy Protect Bacteria Mini Prep kit (Qiagen) as recommended by the manufacturer including the “on-column” DNase treatment.
GSE110831	accession: NC_000913.2+NC_000913.3
GSE110831	After 0.5 M NaCl treatment for 10 min of the early-exponential phase cells, samples were collected.
GSE110831	After 0.5 M NaCl treatment for 20 min of the early-exponential phase cells, samples were collected.
GSE110831	After 0.5 M NaCl treatment for 45 min of the early-exponential phase cells, samples were collected.
GSE110831	Arrays were processed using Nimblegen's standard protocol for Nimblescan ChIP data extraction..
GSE110831	chip antibody: none
GSE110831	chip antibody: RNAP beta subunit antibody
GSE110831	E. coli CC72 was grown in water bath to early-exponential phase (OD600 0.2) at 37°C in LB medium.
GSE110831	E.coli_LB_rep2
GSE110831	E.coli_LB_rep3
GSE110831	E.coli_Na10_rep1
GSE110831	E.coli_Na10_rep2
GSE110831	E.coli_Na10_rep3
GSE110831	E.coli_Na20_rep1
GSE110831	E.coli_Na20_rep2
GSE110831	E.coli_Na20_rep3
GSE110831	E.coli_Na45_rep1
GSE110831	E.coli_Na45_rep2
GSE110831	E.coli_Na45_rep3
GSE110831	Escherichia coli str. K-12 substr. MG1655
GSE110831	genotype: Fusion of venus to the 3' end of rpoC in E. coli wild-type MG1655
GSE110831	RNAP beta subunit ChIP DNA from E. coli CC72 10 min after osmotic stress
GSE110831	RNAP beta subunit ChIP DNA from E. coli CC72 20 min after osmotic stress
GSE110831	RNAP beta subunit ChIP DNA from E. coli CC72 45 min after osmotic stress
GSE110831	RNAP beta subunit ChIP DNA from E. coli CC72 at early-exponential phase
GSE110831	The ChIP experiment was performed essentially as described previously (Herring, Raffaelle et al. 2005). Briefly, the cell cultures were fixed by a 1% formaldehyde and 10 mM sodium phosphate (pH 7.6) solution for 20 min at room temperature. After cell lysis, RNase A treatment and sonication, the chromosome was fragmented to 100-1200 bp. RNAP binding DNA (IP DNA) was immunoprecipitated with RNAP using an antibody against the RNAP β’ subunit and pan mouse magnetic beads. The same sample without the β’ antibody was used as mock immunoprecipitation DNA (mock IP DNA). After washing and de-crosslinking, DNA was purified using the PCR purification kit (Qiagen).
GSE110831	The early-exponential phase cells were collected without NaCl treatment.
GSE11183	A culture volume of 7ml was mixed with the same volume of boiling 2% SDS, 4mM EDTA and heated at 100°C for 3 to 5 minutes then vortexed. At this stage, the extract was either processed further or stored at -20°C.
GSE11183	Affymetrix .CEL files data were normalized with dChip using the array of median brightness (BS). Model method:model-base expression; background substraction: Mismatch Probe (PM
GSE11183	Escherichia coli
GSE11183	exponential phase
GSE11183	JO2057 (WT)
GSE11183	JO2057 (WT), exponential phase, repetition1
GSE11183	JO2057 (WT), exponential phase, repetition2
GSE11183	JO2057 WT, LB, exponential phase, repetition1
GSE11183	JO2057 WT, LB, exponential phase, repetition2
GSE11183	JO2057 WT, LB, stationary phase, repetition1
GSE11183	JO2057 WT, LB, stationary phase, repetition2
GSE11183	JO2057 WT, LB, transition phase
GSE11183	JO2057 (WT), Min Glucose, exponential phase
GSE11183	JO2057 WT, Min Glucose, exponential phase
GSE11183	JO2057 (WT), Min Glucose, stationary phase
GSE11183	JO2057 WT, Min Glucose, stationary phase
GSE11183	JO2057 (WT), Min Glycerol, exponential phase
GSE11183	JO2057 WT, Min Glycerol, exponential phase
GSE11183	JO2057 (WT), Min Glycerol, stationary phase
GSE11183	JO2057 WT, Min Glycerol, stationary phase
GSE11183	JO2057 (WT), stationary phase, repetition1
GSE11183	JO2057 (WT), stationary phase, repetition2
GSE11183	JO2057 (WT), transition phase
GSE11183	JO2081 (hupA)
GSE11183	JO2081 (hupA), exponential phase
GSE11183	JO2081 hupA, LB, exponential phase
GSE11183	JO2081 hupA, LB, stationary phase
GSE11183	JO2081 hupA, LB, transition phase
GSE11183	JO2081 (hupA), stationary phase
GSE11183	JO2081 (hupA), transition phase
GSE11183	JO2083 (hupB)
GSE11183	JO2083 (hupB), exponential phase
GSE11183	JO2083 hupB, LB, exponential phase
GSE11183	JO2083 hupB, LB, stationary phase
GSE11183	JO2083 hupB, LB, transition phase
GSE11183	JO2083 (hupB), stationary phase
GSE11183	JO2083 (hupB), transition phase
GSE11183	JO3020 (hupAB)
GSE11183	JO3020 (hupAB), exponential phase, repetition1
GSE11183	JO3020 (hupAB), exponential phase, repetition2
GSE11183	JO3020 hupAB, LB, exponential phase, repetition1
GSE11183	JO3020 hupAB, LB, exponential phase, repetition2
GSE11183	JO3020 hupAB, LB, stationary phase, repetition1
GSE11183	JO3020 hupAB, LB, stationary phase, repetition2
GSE11183	JO3020 hupAB, LB, transition phase
GSE11183	JO3020 (hupAB), Min Glucose, exponential phase
GSE11183	JO3020 hupAB, Min Glucose, exponential phase
GSE11183	JO3020 (hupAB), Min Glucose, stationary phase
GSE11183	JO3020 hupAB, Min Glucose, stationary phase
GSE11183	JO3020 (hupAB), Min Glycerol exponential phase
GSE11183	JO3020 hupAB, Min Glycerol exponential phase
GSE11183	JO3020 (hupAB), Min Glycerol stationary phase
GSE11183	JO3020 hupAB, Min Glycerol stationary phase
GSE11183	JO3020 (hupAB), stationary phase, repetition1
GSE11183	JO3020 (hupAB), stationary phase, repetition2
GSE11183	JO3020 (hupAB), transition phase
GSE11183	MW30 (rpoS)
GSE11183	MW30 (rpoS), LB, exponential phase
GSE11183	MW30 rpoS, LB, exponential phase
GSE11183	MW30 (rpoS), LB, stationary phase
GSE11183	MW30 rpoS, LB, stationary phase
GSE11183	Seven mililiter of phenol
GSE11183	stationary phase
GSE11183	The five bacterial strains (JO2057, JO2081, JO2083, JO3020 and MW30) were grown in 100ml LB 0.5% NaCl, M9 minimal glucose or M9 minimal glycerol at 200 rpm in New Brunswick laboratory shaker in 2liter flasks. The typical doubling time, observed in exponential phase in LB, was 40min for JO2057, JO2081, JO2083, MW30 and 75 min for JO3020. After growth curve calibration, the various growth phase sample were collected at the following cell densities: exponential phase: OD600 0.6-0.7; transition: 2.2-2.5 and stationary: 4.6-4.8 (3.0 for hupAB).
GSE11183	transition phase
GSE11230	Anaerobic, minus nitrate, IP
GSE11230	Anaerobic, plus nitrate, IP
GSE11230	Chromatin was extracted and processed according to Oxford Gene Technology protocols (www.ogt.co.uk).
GSE11230	Escherichia coli
GSE11230	Escherichia coli, expressing NsrR with a C-terminal Flag-tag, was grown anaerobically in L broth supplemented with glucose.
GSE11230	Escherichia coli, expressing NsrR with a C-terminal Flag-tag, was grown anaerobically in L broth supplemented with glucose. 
GSE11230	Escherichia coli, expressing NsrR with a C-terminal Flag-tag, was grown anaerobically in L broth supplemented with glucose.  
GSE11230	Escherichia coli, expressing NsrR with a C-terminal Flag-tag, was grown anaerobically in L broth supplemented with glucose and nitrate. 
GSE11230	Escherichia coli, expressing NsrR with a C-terminal Flag-tag, was grown anaerobically in L broth supplemented with glucose and nitrate.  
GSE11230	NsrR_Flagtag_rep1
GSE11230	NsrR_Flagtag_rep2
GSE11230	NsrR_Flagtag_rep3
GSE11230	The value is the simple linear ratio of the processed Cy3 and Cy5 signals.
GSE11230	The value is the simple linear ratio of the processed Cy5 and Cy3 signals.
GSE112421	bacteria harvested from blood of chickens
GSE112421	condition: in vivo
GSE112421	Data were extracted with Feature Extraction software 10.7 (Agilent technologies, Santa Clara, CA, US). Raw data were normalized by Quantile algorithm, GeneSpring Software 11.0 (Agilent technologies, Santa Clara, CA, US).
GSE112421	E058 in vivo, biological rep1
GSE112421	E058 in vivo, biological rep2
GSE112421	E058 in vivo, biological rep3
GSE112421	E058ΔrstAB in vivo, biological rep1
GSE112421	E058ΔrstAB in vivo, biological rep2
GSE112421	E058ΔrstAB in vivo, biological rep3
GSE112421	Escherichia coli APEC O2
GSE112421	genotype
GSE112421	strain: E058
GSE112421	The in vivo bacterial samples were harvested with two-step centrifugation. We first centrifuged the collected anticoagulated blood samples at low speed to remove the abundant red and white blood cells and collected the upper serum layer. We then used high-speed centrifugation to precipitate the bacteria from the serum.
GSE112421	To prepare the in vivo samples, the bacteria was harvested from cardiac blood  in 1-day-old chickens at 5 hours post infection.
GSE112421	Total RNA from in vivo samples of APEC E058 and E058ΔrstAB was extracted and purified using RNeasy mini kit (Cat#74106, QIAGEN, GmBH, Germany) following the manufacturer’s instructions.
GSE112430	10.FHI9.IND.HUS
GSE112430	11.FHI12.nIND.HUS
GSE112430	12.FHI12.IND.HUS
GSE112430	13.FHI24.nIND.HUS
GSE112430	15.FHI25.nIND.HUS
GSE112430	16.FHI25.IND.HUS
GSE112430	17.FHI27.nIND.HUS
GSE112430	18.FHI27.IND.HUS
GSE112430	19.FHI36.nIND.nHUS
GSE112430	1.FHI4.nIND.HUS
GSE112430	20.FHI36.IND.nHUS
GSE112430	21.FHI43.nIND.nHUS
GSE112430	22.FHI43.IND.nHUS
GSE112430	23.FHI48.nIND.HUS
GSE112430	25.FHI79.nIND.HUS
GSE112430	26.FHI79.IND.HUS
GSE112430	27.FHI95.nIND.nHUS
GSE112430	28.FHI95.IND.nHUS
GSE112430	29.St. Olav40.nIND.nHUS
GSE112430	2.FHI4.IND.HUS
GSE112430	31.St. Olav104.nIND.nHUS
GSE112430	32.St. Olav104.IND.nHUS
GSE112430	33.St. Olav157.nIND.nHUS
GSE112430	34.St. Olav157.IND.nHUS
GSE112430	35.St. Olav172.nIND.nHUS
GSE112430	37.St. Olav174.nIND.nHUS
GSE112430	38.St. Olav174.IND.nHUS
GSE112430	39.St. Olav178.nIND.nHUS
GSE112430	3.FHI6.nIND.HUS
GSE112430	40.St. Olav178.IND.nHUS
GSE112430	41.St. Olav179.nIND.nHUS
GSE112430	42.St. Olav179.IND.nHUS
GSE112430	43.FHI63.nIND.HUS
GSE112430	44.FHI63.IND.HUS
GSE112430	45.FHI66.nIND.nHUS
GSE112430	46.FHI66.IND.nHUS
GSE112430	47.FHI83.nIND.HUS
GSE112430	48.FHI83.IND.HUS
GSE112430	49.St. Olav17.nIND.nHUS
GSE112430	4.FHI6.IND.HUS
GSE112430	50.St. Olav17.IND.nHUS
GSE112430	51.St. Olav39.IND.nHUS
GSE112430	52.St. Olav63.nIND.nHUS
GSE112430	53.St. Olav63.IND.nHUS
GSE112430	54.St. Olav164 .nIND.HUS
GSE112430	55.St. Olav164 .IND.HUS
GSE112430	56.St. Olav176.IND.HUS
GSE112430	57.St. Olav39.nIND.nHUS
GSE112430	59.St. Olav173.IND.nHUS
GSE112430	5.FHI7.nIND.HUS
GSE112430	60.St. Olav176.nIND.HUS
GSE112430	6.FHI7.IND.HUS
GSE112430	7.FHI8.nIND.HUS
GSE112430	8.FHI8.IND.HUS
GSE112430	9.FHI9.nIND.HUS
GSE112430	A generalized linear model likelihood ratio test was performed to test for differential expression between groups (HUS vs. non-HUS) and condition (induced vs. non-induced), with FDR-adjusted p-values < 0.05 regarded as statistically significant
GSE112430	Bacterial cells from an overnight culture were washed and diluted in fresh SILAC (stable isotope labeling with amino acids in cell culture) medium optimized for non-auxotrophic E. coli (Ping LY et al. J Proteome Res., 2013), before incubation at 37 °C with agitation until reaching an OD600 of approximately 0.3.
GSE112430	Differential expression analysis was performed with R (version 3.1.1) and edgeR (version 3.8.5) (Bioconductor).
GSE112430	E. coli strain FHI12
GSE112430	E. coli strain FHI24
GSE112430	E. coli strain FHI25
GSE112430	E. coli strain FHI27
GSE112430	E. coli strain FHI36
GSE112430	E. coli strain FHI4
GSE112430	E. coli strain FHI43
GSE112430	E. coli strain FHI48
GSE112430	E. coli strain FHI6
GSE112430	E. coli strain FHI63
GSE112430	E. coli strain FHI66
GSE112430	E. coli strain FHI7
GSE112430	E. coli strain FHI79
GSE112430	E. coli strain FHI8
GSE112430	E. coli strain FHI83
GSE112430	E. coli strain FHI9
GSE112430	E. coli strain FHI95
GSE112430	E. coli strain St. Olav104
GSE112430	E. coli strain St. Olav157
GSE112430	E. coli strain St. Olav164 
GSE112430	E. coli strain St. Olav17
GSE112430	E. coli strain St. Olav172
GSE112430	E. coli strain St. Olav173
GSE112430	E. coli strain St. Olav174
GSE112430	E. coli strain St. Olav176
GSE112430	E. coli strain St. Olav178
GSE112430	E. coli strain St. Olav179
GSE112430	E. coli strain St. Olav39
GSE112430	E. coli strain St. Olav40
GSE112430	E. coli strain St. Olav63
GSE112430	Escherichia coli
GSE112430	genome accession: GCA_000752975
GSE112430	genome accession: GCA_000753215
GSE112430	genome accession: GCA_000753275
GSE112430	genome accession: GCA_000936225
GSE112430	genome accession: GCA_000936245
GSE112430	genome accession: GCA_000936475
GSE112430	genome accession: GCA_000937275
GSE112430	genome accession: GCA_000938695
GSE112430	genome accession: GCA_000938995
GSE112430	genome accession: GCA_000939195
GSE112430	genome accession: GCA_000939755
GSE112430	genome accession: GCA_000939955
GSE112430	genome accession: GCA_000941395
GSE112430	genome accession: GCA_000941895
GSE112430	genome accession: GCA_000946755
GSE112430	genome accession: GCA_000947315
GSE112430	genome accession: GCA_000951835
GSE112430	genome accession: GCA_000951875
GSE112430	genome accession: GCA_000951915
GSE112430	genome accession: GCA_000965545
GSE112430	genome accession: GCA_000965555
GSE112430	genome accession: GCA_000965575
GSE112430	genome accession: GCA_000965625
GSE112430	genome accession: GCA_000965635
GSE112430	genome accession: GCA_000965655
GSE112430	genome accession: GCA_000965665
GSE112430	genome accession: GCA_000965705
GSE112430	genome accession: GCA_000965715
GSE112430	genome accession: GCA_000966935
GSE112430	genome accession: PVRW00000000
GSE112430	group (hus
GSE112430	induced
GSE112430	Library preparation was performed with TruSeq Stranded Total RNA HT Sample Prep Kit (Illumina). Libraries were sequenced with 50 bp single read configuration on a HiSeq 2500 system (Illumina).
GSE112430	Lowly expressed genes (<1 read per million) were removed.
GSE112430	Normalization factors were calculated using a non-linear Loess model using csaw (Bioconductor)
GSE112430	Reads aligning to each protein-encoding gene family with strand-specific mapping quality above 23 were counted using HTSeq-count
GSE112430	Reads were end-to-end aligned, with no mismatches allowed, to the respective draft genomes using Bowtie2 with default settings
GSE112430	RNA-Seq
GSE112430	strain: FHI12
GSE112430	strain: FHI24
GSE112430	strain: FHI25
GSE112430	strain: FHI27
GSE112430	strain: FHI36
GSE112430	strain: FHI4
GSE112430	strain: FHI43
GSE112430	strain: FHI48
GSE112430	strain: FHI6
GSE112430	strain: FHI63
GSE112430	strain: FHI66
GSE112430	strain: FHI7
GSE112430	strain: FHI79
GSE112430	strain: FHI8
GSE112430	strain: FHI83
GSE112430	strain: FHI9
GSE112430	strain: FHI95
GSE112430	strain: St. Olav104
GSE112430	strain: St. Olav157
GSE112430	strain: St. Olav164 
GSE112430	strain: St. Olav17
GSE112430	strain: St. Olav172
GSE112430	strain: St. Olav173
GSE112430	strain: St. Olav174
GSE112430	strain: St. Olav176
GSE112430	strain: St. Olav178
GSE112430	strain: St. Olav179
GSE112430	strain: St. Olav39
GSE112430	strain: St. Olav40
GSE112430	strain: St. Olav63
GSE112430	Supplementary_files_format_and_content: Processed data files contain raw counts for CDS genomic features, locations of genomic features are provided in associated .gtf files
GSE112430	Tagwise dispersion was estimated using the weighted likelihood empirical Bayes method
GSE112430	The exponential phase culture was split in two, and one part was induced with mitomycin C at a final concentration of 0.25 μg
GSE112430	Total RNA was isolated from cell pellets using Aurum total RNA mini kit (Bio-Rad) according to the manufacturer’s instructions, and RNA quality was controlled using the RNA 6000 nano kit and 2100 Bioanalyzer (Agilent). Ribosomal RNA was removed using Ribo-Zero rRNA Removal Kit for Gram-Negative Bacteria (Epicentre).
GSE112878	Alignment, Quantiatino and Normalization, Differential Expression : We used the SPARTA(version 1) software package for alignment, differential expression analysis, and post-analysis diagnostics. SPARTA is an RNA-Seq package specifically designed for bacterial studies. It uses the Bowtie(version 1.1.1) short read aligner, HTSeq(version 0.6.1) to count gene features, and edgeR for differential expression.
GSE112878	Annotation : The reference genome (Escherichia_coli_cft073.ASM744v1.dna.chromosome.Chromosome.fa) and annotations (Escherichia_coli_cft073.ASM744v1.32.gtf ) were downloaded from EnsemblBacteria
GSE112878	Bacteria
GSE112878	Cells were then lysed with 0.2 µM of lysozyme in TE (10 mM Tris-Cl, 1 mM EDTA, pH 8.0) for 5 min at room temperature, and total RNA was extracted using the RNeasy Mini Kit (Qiagen). DNA contamination was eliminated by treatment with TURBO DNase (Thermo Fisher). Depletion of ribosomal RNA was accomplished with the Ribominus Transcriptome Isolation Kit (Thermo Fisher) followed by ethanol precipitation.
GSE112878	CFT073 +pBAD rep 1
GSE112878	CFT073 +pBAD rep 2
GSE112878	CFT073 +pBAD rep 3
GSE112878	CFT073 +pBAD-tosR rep 1
GSE112878	CFT073 +pBAD-tosR rep 2
GSE112878	CFT073 +pBAD-tosR rep 3
GSE112878	Depletion of ribosomal RNA was accomplished with the Ribominus Transcriptome Isolation Kit (Thermo Fisher) followed by ethanol precipitation. A stranded library was prepared using a ScriptSeq kit (Illumina) using manufacturer’s recommended protocols.  Each sample was tagged with a six nucleotide barcode unique to each sample to allow multiplexing. The products are purified and enriched by PCR to create the final cDNA library. Final libraries were checked for quality and quantity by TapeStation (Agilent) and qPCR using Kapa’s library quantification kit for Illumina Sequencing platforms (Kapa Biosystems) following the manufacturer's recommended protocols.  Six samples were sequenced per lane on a 50 cycle single end run on a HiSeq 2500 (Illumina) in high output mode using version 4 reagents.
GSE112878	E. coli CFT073 carrying either pBAD or pBAD-tosR-his6 were cultured overnight in biological triplicates in LB medium containing ampicillin (100 µg
GSE112878	Escherichia coli
GSE112878	Genome_build: CFT073 E. coli
GSE112878	plasmid: pBAD
GSE112878	plasmid: pBAD-tosR
GSE112878	qC: We checked the quality of the raw reads data for each sample using FastQC (version 0.11.3) to identify features of the data that may indicate quality problems (e.g. low quality scores, over-represented sequences, inappropriate GC content, etc.).
GSE112878	RNA-Seq
GSE112878	strain: CFT073
GSE112878	Supplementary_files_format_and_content: .xls,  spreadsheet of normalized read counts for each gene for each sample, differential expression data, and annotation
GSE114262	After chilling on ice, each 100-ml culture was mixed with 25 ml ice-cold ethanol
GSE114262	Bacterial cultures
GSE114262	culture temperature: 30 °C for 60 min
GSE114262	culture temperature: 42 °C for 60 min
GSE114262	dnaB-Ts_30°C
GSE114262	dnaB-Ts_42°C
GSE114262	dnaB-Ts ΔahpC_30°C
GSE114262	dnaB-Ts ΔahpC_42°C
GSE114262	Escherichia coli
GSE114262	Genome_build: E.coli K12 BW25113
GSE114262	Illumina Casava1.7 software used for basecalling.
GSE114262	medium: SB broth
GSE114262	Overnight cultures of the dnaB-Ts single mutant (strain 2429) and the dnaB-Ts ΔahpC double mutant (strain 3780) were diluted 100-fold into fresh SB medium (3.2% peptone, 2% yeast extract and 1% NaCl), and they were then grown at 30 °C to early-log phase (OD600 = 0.15).  Next these log-phase cultures were diluted 20-fold into 200 ml pre-warmed, fresh SB medium, and they were grown at 30 °C for another 60 min.
GSE114262	Reads Per Kilobase of exon per Megabase of library size (RPKM) were calculated using a protocol from Chepelev et al., Nucleic Acids Research, 2009.
GSE114262	RNA-Seq
GSE114262	rRNA was removed from total RNA by using the Ribo-Zero rRNA removal kit. Reverse transcription and cDNA amplification were performed with the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech). Libraries were constructed using the Illumina Nextera XT kit and analyzed for concentration , size distribution and quantification of viable sequencing templates via qPCR.
GSE114262	Samples (200-ml) of the above cultures for each strain were split into two aliquots (each 100 ml), and the aliquots were then incubated at 30 °C or 42 °C for another 60 min.
GSE114262	Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to E.coli K2 BW25113 whole genome using bowtie v0.12.2
GSE114262	strain: 2429
GSE114262	strain: 3780
GSE114262	Supplementary_files_format_and_content: Tab-delimited text files include RPKM values for each sample.
GSE114262	To generate Illumina-compatible sequencing libraries for each sample, molecular indexes were added to each library, allowing samples to be pooled and sequenced on the Illumina HiSeq 2500 with a 1 x 50 bp single-end configuration. More than 250 million reads were generated per sample, and at least 80% bases had quality scores above Q30.
GSE114917	1 ml aliquot of culture was transferred to pressure vessel and pressurized at 1MPa for 15 min
GSE114917	bacterial cells
GSE114917	E. coli K-12 MG 1655 was grown  in LB-Miller broth at 37°C ,160rpm to  an O.D.600 nm of 0. 7
GSE114917	Escherichia coli str. K-12 substr. MG1655
GSE114917	Gene annotation was obtained from the EcoCyc E. coli Database (https:
GSE114917	Genome_build: U00096.3
GSE114917	MiSeq for base calling
GSE114917	RNA-Seq
GSE114917	stimulus: 1 MPa for 15 min
GSE114917	stimulus: Control
GSE114917	strain: K-12 substr. MG1655
GSE114917	Supplementary_files_format_and_content: Table of read counts with genes as  rows and samples as columns.
GSE114917	The counts of reads 150 aligning to genomic features were obtained using the 'feaureCounts' function from the R package 'Rsubread'
GSE114917	The lysates were applied to gDNA removal columns and rRNA was removed from total RNA using a Ribo-Zero rRNA removal kit (Illumina, UK) following the manufacture’s instruction for Gram-positive bacteria. The sequencing libraries were prepared from the enriched mRNA using the NEBNext Ultra RNA library prep kit (NEB, UK), and independently indexed using NEBNext multi-plex oligos for Illumina (NEB, UK). The libraries were pooled at equimolar ratios before they were sequenced using MiSeq Reagent Kit v3 600 cycles (Illumina,UK).
GSE114917	The quality of sequencing data was assessed using FastQC, (V11.2) before the reads were trimmed using Trimmomatic (V0.33).
GSE114917	The R package 'DESeq2' (Version 1.12.4) was used to calculate differential gene expression between the LP group and the HP group.
GSE114917	The trimmed reads were aligned against E. 149 coli MG1655 (GenBank: U00096.3) using bowtie2 (Version 2.2.4)
GSE114917	tissue: bacterial cells
GSE114917	Total RNAs from two biological replicate, each with two technical replicates were extracted using the Total RNA Purification Kit (Norgen Biotek, UK) according to the manufacturer’s protocol with the addition of 1 mg
GSE116304	all cultures were grown in 10 ml LB broth at 37C
GSE116304	bacterial pellet
GSE116304	Control_1
GSE116304	Control_2
GSE116304	Escherichia coli
GSE116304	media: LB broth
GSE116304	NN2_0018_1
GSE116304	NN2_0018_2
GSE116304	Omega17_1
GSE116304	Omega17_2
GSE116304	Omega76_1
GSE116304	Omega76_2
GSE116304	RNA was extracted using Qiagen’s RNeasy minikit Cat#74106
GSE116304	Samples were background corrected using the normexp() function in the Limma package in R. This was followed by quantile normalization and log2 transformation.
GSE117186	1 ml of overnight culture was prepared for E. coli DY 330 GyrA-SPA or E. coli DY 330 GyrA-SPA MuSGS by seeding 2YT medium supplemented with antibiotics (kanamycin 50 µg
GSE117186	Cfx_IN_10mkM_3
GSE117186	Cfx_IN_Mu_10mkM_1
GSE117186	Cfx_IN_Mu_10mkM_2
GSE117186	Cfx_IP_10mkM_3
GSE117186	Cfx_IP_Mu_10mkM_1
GSE117186	Cfx_IP_Mu_10mkM_2
GSE117186	ChIP-Seq
GSE117186	Ciprofloxacin Rep 1 +A-IP
GSE117186	Ciprofloxacin Rep 1 +A+IP
GSE117186	Ciprofloxacin Rep 2 +A-IP
GSE117186	Ciprofloxacin Rep 2 +A+IP
GSE117186	Ciprofloxacin Rep 3 +A-IP
GSE117186	Ciprofloxacin Rep 3 +A+IP
GSE117186	Cultures (+A and -A) were incubated at 32°C with shaking for additional 15 min, then cells were pelleted by centrifugation at 10°C (4500xg) and resuspended in 10 ml of TES buffer (10 mM Tris-Cl pH7.5, 1 mM EDTA, 250 mM NaCl). Washing procedure was repeated twice to remove culture liquid and excess of gyrase poison.
GSE117186	DNA was extracted from resulting supernatant with phenol
GSE117186	Escherichia coli
GSE117186	For proteolysis, affinity gel obtained after the last centrifugation step was diluted with TES buffer up to final volume 200 μl, proteinase K (Sigma-Aldrich) was added (0.5 mg
GSE117186	Genome_build: Escherichia coli W3110 MuSGS (on the basis of NC_007779.1). FASTA and GFF are included on series record.
GSE117186	Gyrase Cleavage Sites (GCSs) were called using custom script (GCSs_calling.py, github: https:
GSE117186	Lysates were diluted with 1 ml of TES buffer and 100 μl of ANTI-FLAG® M2 affinity gel (Sigma-Aldrich) was added. Immunoprecipitation was performed for 1.5-2 hours at room temperature with moderate mixing, then affinity gel was washed 4 times by repeating steps of centrifugation (1.5 minute, 1000xg at room temperature) and resuspention (x2 with 1 ml of TESS buffer, x1 with 1 ml of TES buffer, x1 with 1 ml of TE buffer).
GSE117186	Microcin B17 Rep 1 +A-IP
GSE117186	Microcin B17 Rep 1 +A+IP
GSE117186	Microcin B17 Rep 2 +A-IP
GSE117186	Microcin B17 Rep 2 +A+IP
GSE117186	Microcin B17 Rep 3 +A-IP
GSE117186	Microcin B17 Rep 3 +A+IP
GSE117186	Microcin_IN_50mkM_3
GSE117186	Microcin_IN_Mu_10mkM_1
GSE117186	Microcin_IN_Mu_10mkM_2
GSE117186	Microcin_IP_50mkM_3
GSE117186	MIcrocin_IP_Mu_10mkM_1
GSE117186	Microcin_IP_Mu_10mkM_2
GSE117186	musgs presence: -
GSE117186	musgs presence: MuSGS
GSE117186	Oxo_IN_120mkM_3
GSE117186	Oxo_IN_Mu_120mkM_1
GSE117186	Oxo_IN_Mu_120mkM_2
GSE117186	Oxo_IP_120mkM_3
GSE117186	Oxo_IP_Mu_120mkM_1
GSE117186	Oxo_IP_Mu_120mkM_2
GSE117186	Oxolinic acid Rep 1 +A-IP
GSE117186	Oxolinic acid Rep 1 +A+IP
GSE117186	Oxolinic acid Rep 2 +A-IP
GSE117186	Oxolinic acid Rep 2 +A+IP
GSE117186	Oxolinic acid Rep 3 +A-IP
GSE117186	Oxolinic acid Rep 3 +A+IP
GSE117186	Raw reads were aligned to the E. coli w3110 MuSGS genome (containing a strong gyrase binding site from bacteriophage Mu) with BWA MEM (default settings)
GSE117186	Resulting SAM files were processed with custom script (SAM_to_coverage_and_N5E_N3E.py, github: https:
GSE117186	Rifampicine Ciprofloxacin Rep 1 -A-IP
GSE117186	Rifampicine Ciprofloxacin Rep 1 +A-IP
GSE117186	Rifampicine Ciprofloxacin Rep 1 +A+IP
GSE117186	Rifampicine Ciprofloxacin Rep 2 +A-IP
GSE117186	Rifampicine Ciprofloxacin Rep 2 +A+IP
GSE117186	Rifampicine Ciprofloxacin Rep 3 +A-IP
GSE117186	Rifampicine Ciprofloxacin Rep 3 +A+IP
GSE117186	RifCfx_IN_Mu_122mkM_10mkM_1
GSE117186	RifCfx_IN_Mu_122mkM_10mkM_2
GSE117186	RifCfx_IN_Mu_122mkM_10mkM_3
GSE117186	RifCfx_IP_Mu_122mkM_10mkM_1
GSE117186	RifCfx_IP_Mu_122mkM_10mkM_2
GSE117186	RifCfx_IP_Mu_122mkM_10mkM_3
GSE117186	Rif_IN_Mu_122mkM_1
GSE117186	Sequencing libraries were prepared with Accel NGS 1S kit (Swift Bioscience) in accordanse with manufacturer’s protocol.
GSE117186	Starter was cultivated at 32°C with shaking (180 rpm), then was inoculated into 100 ml of 2YT without antibiotics and cultivation was proceeded under the same conditions until culture reaching mid-logphase (OD600=0.6-0.8).
GSE117186	strain: DY330
GSE117186	Supplementary_files_format_and_content: tar archives contain the following:
GSE117186	tab-delimited text files with GCSs coordinates, N3E values (\height of the peak\) and GCSs scores (score of the sequence under the GCS obtained after scanning the genome with DNA-gyrase binding motif)
GSE117186	tagged gyrase subunit: GyrA-SPA
GSE117186	text wig files contain coverage depth data
GSE117186	text wig files contain N3E values (number of DNA fragments 3' ends for each position of the genome)
GSE117186	Un_IN_3
GSE117186	Un_IN_Mu_1
GSE117186	Un_IN_Mu_2
GSE117186	Un_IP_3
GSE117186	Un_IP_Mu_1
GSE117186	Un_IP_Mu_2
GSE117186	Untreated Rep 1 -A-IP
GSE117186	Untreated Rep 1 -A+IP
GSE117186	Untreated Rep 2 -A-IP
GSE117186	Untreated Rep 2 -A+IP
GSE117186	Untreated Rep 3 -A-IP
GSE117186	Untreated Rep 3 -A+IP
GSE117186	Washed pellets were resuspended in 1 ml of TESS buffer (10 mM Tris-Cl pH7.5, 1 mM EDTA, 250 mM NaCl, 0.02% SDS, 0.2% Tween-20) with addition of proteases inhibitors cocktail (cOmplete ultra EDTA free, Roche) and RNAse A (Thermo Scientific). Resulting suspensions were sonicated with parameters optimized to obtain DNA fragments between 200 and 700 bp (SONOPULS HD 3100). Lysates were diluted with 1 ml of TES buffer and 100 μl of ANTI-FLAG® M2 affinity gel (Sigma-Aldrich) was added. Immunoprecipitation was performed for 1.5-2 hours at room temperature with moderate mixing, then affinity gel was washed 4 times by repeating steps of centrifugation (1.5 minute, 1000xg at room temperature) and resuspention (x2 with 1 ml of TESS buffer, x1 with 1 ml of TES buffer, x1 with 1 ml of TE buffer).
GSE117186	When reaching  the optical density indicated (OD600=0.6-0.8) the culture was bisected and DNA gyrase poison (ciprofloxacin, oxolinic acid or microcin B17) was added to the first half (+A samples), while second served as a control (-A samples).
GSE117326	After exposed under the red light with a specific ON
GSE117326	BW25113
GSE117326	envz3600
GSE117326	envz600
GSE117326	envz900
GSE117326	envzM1200
GSE117326	envzM2400
GSE117326	envzM3600
GSE117326	envzM600
GSE117326	envzM900
GSE117326	Escherichia coli
GSE117326	input signal frequency: 1
GSE117326	In the 15 ml centrifuge tube (Corning, 430791), the overnight culture was diluted to 2ml in fresh LB medium containing Ampicillin (50 ng
GSE117326	PCA analysis was performed using the top 500 genes with the most variations.
GSE117326	plasmid: pLCenvZM, pPCB (mutation)
GSE117326	Plasmid pLCenvZ or pLCenvZM was co-transformed with pPCB into the competent cells of E. coli JW3367 and spread on LB agar plates containing Ampicillin (50 ng
GSE117326	plasmid: pLCenvZ, pPCB (wild type)
GSE117326	Read counts per gene determined using HTseq count before normalized using DESeq2
GSE117326	RNA libraries were prepared for sequencing using standard Illumina protocols
GSE117326	RNA-Seq
GSE117326	Sequencing reads were mapped to the E. coli genome with bowtie2
GSE117326	strain: JW3367
GSE117326	Supplementary_files_format_and_content: The txt file includes the gene expression profiles of all the samples. The xlsx file contains the PC1 and PC2 values of all the samples.
GSE11779	BW25113 sdiA-empty vector 12h biofilm cells at 30oC
GSE11779	BW25113 sdiA-SdiA1E11 12h biofilm cells at 30oC
GSE11779	BW25113 sdiA-WTSdiA 12h biofilm cells at 30oC
GSE11779	Channel 1
GSE11779	Escherichia coli
GSE11779	MAS 5.0 Expression Analysis Default Setting
GSE11779	mutant SdiA1E11
GSE11779	RNA extracted from biofilm cells of K-12 sdiA-no SdiA 1 after 12h of growth in LB + 1 mMIPTG and 30 microM Cm with glass wool at 30oC
GSE11779	RNA extracted from biofilm cells of K-12 sdiA-SdiA1E11 after 12h of growth in LB + 1 mMIPTG and 30 microM Cm with glass wool at 30oC
GSE11779	RNA extracted from biofilm cells of K-12 sdiA-WTSdiA after 12h of growth in LB + 1 mMIPTG and 30 microM Cm with glass wool at 30oC
GSE11779	To lyse the cells, 1.0 mL RLT buffer (Qiagen, Inc., Valencia, CA) and 0.2 mL 0.1 mm zirconia
GSE11779	wild type SdiA
GSE11894	After 50 hours, samples (10 ml) were harvested directly into RNA Protect (Qiagen) to stabilize RNA, and total RNA was purified using Qiagen’s RNeasy Mini kit as recommended by the suppliers.  RNA was quantified using a BioPhotometer (Eppendorf).
GSE11894	Escherichia coli
GSE11894	Spots automatically flagged as bad, negative or poor in the Imagene software were removed before the statistical analysis was carried out in GeneSight.  The mean values from each channel were log2 transformed and normalised using the Lowess method to remove intensity-dependent effects in the log2(ratios) values.  The Cy3
GSE11894	Steady-state continuously-cultured control samples in the presence of adequate Zn
GSE11894	Steady-state continuously-cultured experiment samples in the total absence of Zn
GSE11894	Steady-state continuously-cultured experiment samples in total absence of Zn
GSE11894	Steady-state continuously-cultured MG1655 in the presence of adequate Zn
GSE11894	Steady-state continuously-cultured MG1655 in the total absence of Zn
GSE11894	Transcriptional profiling of Escherichia coli cultured under severe zinc limitation Chemostat 1A
GSE11894	Transcriptional profiling of Escherichia coli cultured under severe zinc limitation Chemostat 1B
GSE11894	Transcriptional profiling of Escherichia coli cultured under severe zinc limitation Chemostat 2A
GSE11894	Transcriptional profiling of Escherichia coli cultured under severe zinc limitation Chemostat 2B
GSE11894	Transcriptional profiling of Escherichia coli cultured under severe zinc limitation Chemostat 3A
GSE11894	Transcriptional profiling of Escherichia coli cultured under severe zinc limitation Chemostat 3B
GSE12006	1.Holme T, Arvidson S, Lindholm B, and Pavlu B. 1970. Enzymes: Laboratory-scale production. Process Biochemistry 62-66.
GSE12006	1. Neubauer, A., J. Soini, M. Bollok, M. Zenker, J. Sandqvist, J. Myllyharju, and P. Neubauer. 2007. Fermentation process for tetrameric human collagen prolyl 4-hydroxylase in Escherichia coli: improvement by gene optimisation of the PDI
GSE12006	E.coli W3110, 15 minutes after oxygen downshift, sample S2
GSE12006	E.coli W3110, 15 minutes before oxygen downshift, sample S1
GSE12006	E.coli W3110, 45 minutes after oxygen downshift, sample S3
GSE12006	E.coli W3110, 75 minutes after oxygen downshift, sample S4
GSE12006	E.coli W3110, fermentation sample taken 15 minutes after oxygen downshift
GSE12006	E.coli W3110, fermentation sample taken 15 minutes before oxygen downshift
GSE12006	E.coli W3110, fermentation sample taken 45 minutes after oxygen downshift
GSE12006	E.coli W3110, fermentation sample taken 75 minutes after oxygen downshift
GSE12006	Escherichia coli
GSE12006	GCOS 1.0
GSE12006	References
GSE12006	References:
GSE12006	Samples for microarray analysis were collected as described earlier [1], (Samples were shortly mixed by vortexing, divided in 0.5 mL aliquots and 1. centrifuged for 3 min at 16,100 ×g and +4 °C. The pellets were resuspended in 250 µL of RNALater (Ambion, USA) and stored at -20 °C until analysis. RNA was extracted using the total RNA kit (A&A Biotechnology, Poland) .
GSE12006	Strain: Escherichia coli W3110 [F– IN(rrnD-rrnE)1]
GSE12006	The cultivations were performed in a Biostat C 15 L bioreactor with the DCU-3 controlling unit and MFCS-win supervisory system (Sartorius) with an initial working volume of 8 L. The mineral salt medium contained per liter: 14.6 g K2HPO4, 3.6 g NaH2PO4 × 2 H2O, 2.0 g Na2SO4, 2.47 g (NH4)2SO4, 0.5 g NH4Cl, 1.0 g (NH4)2-H-citrate, 2 mM MgSO4, 0.1 g thiamine hydrochloride, 0.1 mL antifoam 204 (Sigma) and 2 mL trace element solution (1). The initial glucose concentration was 40 g L-1. The feed solution contained 650 g L-1 glucose. 2 mL L-1 of sterile filtered 1M MgSO4 were added regularly per OD600=10 increase.
GSE12006	Two precultures were performed in LB medium and mineral salt medium with 10 g L 1 of glucose without antifoam agent consecutively at 37 °C at a rotary shaker at 180 rpm. Main cultivations were started as batch cultures at a temperature of 37 °C. The pH was kept at 7.0 by controlled addition of 25% ammonia solution. At the end of the exponential growth phase (cell dry weight about 16 g L-1) the stirrer rate was lowered from 1000 rpm to 500 rpm, to provoke oxygen limitation by decreased oxygen transfer. Constant glucose feed of 100 g L-1 h-1 was started 15 min after the oxygen drop which was enough to ensure glucose excess during the whole cultivation.
GSE12190	Background correction, normalization and calculation of the expression measures were performed using RMA procedure with the WebArray platform (http:
GSE12190	Cell suspension was ammended with 1.25 M sucrose to an osmotic pressure of 2.7 Os kg-1 for 10 minutes. The biomass was centrifuged at 4000 rpm and the pellet treated with RNAProtect (Qiagen) following the manufacturer's protocol.
GSE12190	Cell suspension was ammended with 1.37 M NaCl to obtain an osmotic pressure of 2.7 Os kg-1 for 10 minutes. The biomass was centrifuged at 4000 rpm and the pellet treated with RNAProtect (Qiagen) following the manufacturer's protocol.
GSE12190	E. coli control, biological replicate 1
GSE12190	E. coli control (biological replicate 2)
GSE12190	E. coli Frag1 (biological replicate 2)
GSE12190	E. coli Frag1 (control sample 1)
GSE12190	E. coli Frag1, hyperosmotic NaCl treatment (biological replicate 1)
GSE12190	E. coli Frag1, NaCl hyperosmotic treatment (biological replicate 2)
GSE12190	E.coli Frag1, sucrose hyperosmotic treatment (biological replicate 1)
GSE12190	E. coli Frag1, sucrose hyperosmotic treatment (biological replicate 2)
GSE12190	E. coli NaCl hyperosmotic treatment (biological replicate 1)
GSE12190	E. coli NaCl hyperosmotic treatment (biological replicate 2)
GSE12190	E. coli, strain Frag1
GSE12190	E. coli sucrose hyperosmotic treatment (biological replicate 1)
GSE12190	E. coli sucrose hyperosmotic treatment (biological replicate 2)
GSE12190	Escherichia coli
GSE12190	Grown in Davis's Mineral Salts medium (Gibco BRL Life Technologies Inc.) with 0.1% D-glucose at 25 C (100 r.p.m. shaking) until an OD (550 nm) of 0.6.
GSE12190	No treatment (control sample).
GSE12190	RNA was obtained using the RNAeasy MIDI RNA extraction kit (Qiagen) using lysis buffer containing 0.1% beta-mercaptoethanol. RNA was extracted from lysates and purified according to the manufacturer’s standard protocol and subsequently stored at -80°C. RNA quality was assessed with electrophoresis using a RNA bioanalyser 2100 and Lab RNAChip (Agilent Technologies) before progression to microarray hybridization.
GSE12373	E. coli 15 minute 5 µM cadmium dye swap treatment
GSE12373	E. coli 15 minute 5 µM cadmium treatment
GSE12373	E. coli 15 minute pH only dye swap treatment
GSE12373	E. coli 15 minute pH only treatment
GSE12373	E. coli, 15 minutes, 5 µM cadmium, pH 5
GSE12373	E. coli, 15 minutes, 5 µM cadmium, pH 7
GSE12373	E. coli, 15 minutes, no cadmium, pH 5
GSE12373	E. coli, 15 minutes, no cadmium, pH 7
GSE12373	E. coli 5 minute 5 µM cadmium dye swap treatment
GSE12373	E. coli 5 minute 5 µM cadmium treatment
GSE12373	E. coli 5 minute pH only dye swap treatment
GSE12373	E. coli 5 minute pH only treatment
GSE12373	E. coli, 5 minutes, 5 µM cadmium, pH 5
GSE12373	E. coli, 5 minutes, 5 µM cadmium, pH 7
GSE12373	E. coli, 5 minutes, no cadmium, pH 5
GSE12373	E. coli, 5 minutes, no cadmium, pH 7
GSE12373	E. coli was grown in M9 medium supplemented with 0.4% glucose. The cultures were grown on a rotary shaker (200 rpm) at 37 °C until the contents of the flask reached an OD600 of 0.3 (mid-log phase of growth). Each culture was divided into 25 mL aliquots, transferred to 50 mL conical tubes, and centrifuged at 2540 x g for 12 minutes. The supernatant was decanted, and the cells were resuspended in 25 mL of M9 medium at pH 7 in the presence of 5.4 µM (1 µg
GSE12373	E. coli was grown in M9 medium supplemented with 0.4% glucose. The cultures were grown on a rotary shaker (200 rpm) at 37 °C until the contents of the flask reached an OD600 of 0.3 (mid-log phase of growth). Each culture was divided into 25 mL aliquots, transferred to 50 mL conical tubes, and centrifuged at 2540 x g for 12 minutes. The supernatant was decanted, and the cells were resuspended in 25 mL of M9 medium at pH 7. The cultures were incubated at 25 °C for 15 minutes with manual rotations of the flasks once per minute to resuspend the cells.
GSE12373	E. coli was grown in M9 medium supplemented with 0.4% glucose. The cultures were grown on a rotary shaker (200 rpm) at 37 °C until the contents of the flask reached an OD600 of 0.3 (mid-log phase of growth). Each culture was divided into 25 mL aliquots, transferred to 50 mL conical tubes, and centrifuged at 2540 x g for 12 minutes. The supernatant was decanted, and the cells were resuspended in 25 mL of M9 medium at pH 7. The cultures were incubated at 25 °C for 5 minutes with manual rotations of the flasks once per minute to resuspend the cells.
GSE12373	E. coli was grown in M9 medium supplemented with 0.4% glucose.  The cultures were grown on a rotary shaker (200 rpm) at 37 °C  until the contents of the flask reached an OD600 of 0.3 (mid-log phase of growth).  Each culture was divided into 25 mL aliquots, transferred to four 50 mL conical tubes, and centrifuged at 2540 x g for 12 minutes.  The supernatant was decanted, and the cells were resuspended in 25 mL of M9 medium at pH 5 in the presence of 5.4 µM (1 µg
GSE12373	E. coli was grown in M9 medium supplemented with 0.4% glucose. The cultures were grown on a rotary shaker (200 rpm) at 37 °C until the contents of the flask reached an OD600 of 0.3 (mid-log phase of growth). Each culture was divided into 25 mL aliquots, transferred to four 50 mL conical tubes, and centrifuged at 2540 x g for 12 minutes. The supernatant was decanted, and the cells were resuspended in 25 mL of M9 medium at pH 5 in the presence of 5.4 µM (1 µg
GSE12373	E. coli was grown in M9 medium supplemented with 0.4% glucose. The cultures were grown on a rotary shaker (200 rpm) at 37 °C until the contents of the flask reached an OD600 of 0.3 (mid-log phase of growth). Each culture was divided into 25 mL aliquots, transferred to four 50 mL conical tubes, and centrifuged at 2540 x g for 12 minutes. The supernatant was decanted, and the cells were resuspended in 25 mL of M9 medium at pH 5. The cultures were incubated at 25 °C for 15 minutes with manual rotations of the flasks once per minute to resuspend the cells.
GSE12373	E. coli was grown in M9 medium supplemented with 0.4% glucose. The cultures were grown on a rotary shaker (200 rpm) at 37 °C until the contents of the flask reached an OD600 of 0.3 (mid-log phase of growth). Each culture was divided into 25 mL aliquots, transferred to four 50 mL conical tubes, and centrifuged at 2540 x g for 12 minutes. The supernatant was decanted, and the cells were resuspended in 25 mL of M9 medium at pH 5. The cultures were incubated at 25 °C for 5 minutes with manual rotations of the flasks once per minute to resuspend the cells.
GSE12373	E. coli was grown in M9 medium supplemented with 0.4% glucose.  The cultures were grown on a rotary shaker (200 rpm) at 37 °C  until the contents of the flask reached an OD600 of 0.3 (mid-log phase of growth).  Each culture was divided into 25 mL aliquots, transferred to four 50 mL conical tubes, and centrifuged at 2540 x g for 12 minutes.  The supernatant was decanted, and the cells were resuspended in 25 mL of M9 medium at pH 7 in the presence of 5.4 µM (1 µg
GSE12373	E. coli was grown in M9 medium supplemented with 0.4% glucose. The cultures were grown on a rotary shaker (200 rpm) at 37 °C until the contents of the flask reached an OD600 of 0.3 (mid-log phase of growth). Each culture was divided into 25 mL aliquots, transferred to four 50 mL conical tubes, and centrifuged at 2540 x g for 12 minutes. The supernatant was decanted, and the cells were resuspended in 25 mL of M9 medium at pH 7 in the presence of 5.4 µM (1 µg
GSE12373	Escherichia coli str. K-12 substr. MG1655
GSE12373	MG1655 strain of E. coli K-12
GSE12373	RNA was extracted and purified using a Masterpure RNA purification kit (Epicentre Technologies).
GSE12373	RNA was extracted and purified using a Masterpure RNA purification kit (Epicentre Technologies).  
GSE12373	Spot intensities and locations were determined using TIGR Spotfinder, Version 3.1.1.  All subsequent analyses were performed using the ma-anova package in the open-source statistical software package, R (www.r-project.org), Version 2.4.1.  The data were normalized using the regional lowess method.
GSE12373	Spot intensities and locations were determined using TIGR Spotfinder, Version 3.1.1. All subsequent analyses were performed using the ma-anova package in the open-source statistical software package, R (www.r-project.org), Version 2.4.1. The data were normalized using the regional lowess method.
GSE12411	Cells corresponding to 10 ml culture volume were harvested at 0 hrs using centrifugation. The cell pellet was immediately resuspended in RNAlater (Ambion, Austin, TX, USA) and stored at -20°C until further processing. Prior to RNA extraction using MasterPure RNA purification kit (Epicentre, Madison, WI, USA) the pellet was washed in cold phosphate-buffered saline to remove RNAlater.
GSE12411	Cells corresponding to 10 ml culture volume were harvested at 1.5 hrs after induction with 0.1 mM IPTG using centrifugation. The cell pellet was immediately resuspended in RNAlater (Ambion, Austin, TX, USA) and stored at -20°C until further processing. Prior to RNA extraction using MasterPure RNA purification kit (Epicentre, Madison, WI, USA) the pellet was washed in cold phosphate-buffered saline to remove RNAlater.
GSE12411	Cells corresponding to 10 ml culture volume were harvested at 1.5 hrs after induction with 0 mM IPTG using centrifugation. The cell pellet was immediately resuspended in RNAlater (Ambion, Austin, TX, USA) and stored at -20°C until further processing. Prior to RNA extraction using MasterPure RNA purification kit (Epicentre, Madison, WI, USA) the pellet was washed in cold phosphate-buffered saline to remove RNAlater.
GSE12411	Cells corresponding to 10 ml culture volume were harvested at 1.5 hrs after induction with 1.0 mM IPTG using centrifugation. The cell pellet was immediately resuspended in RNAlater (Ambion, Austin, TX, USA) and stored at -20°C until further processing. Prior to RNA extraction using MasterPure RNA purification kit (Epicentre, Madison, WI, USA) the pellet was washed in cold phosphate-buffered saline to remove RNAlater.
GSE12411	Cells corresponding to 10 ml culture volume were harvested at 3.5 hrs after induction with 0.1 mM IPTG using centrifugation. The cell pellet was immediately resuspended in RNAlater (Ambion, Austin, TX, USA) and stored at -20°C until further processing. Prior to RNA extraction using MasterPure RNA purification kit (Epicentre, Madison, WI, USA) the pellet was washed in cold phosphate-buffered saline to remove RNAlater.
GSE12411	Cells corresponding to 10 ml culture volume were harvested at 3.5 hrs after induction with 0 mM IPTG using centrifugation. The cell pellet was immediately resuspended in RNAlater (Ambion, Austin, TX, USA) and stored at -20°C until further processing. Prior to RNA extraction using MasterPure RNA purification kit (Epicentre, Madison, WI, USA) the pellet was washed in cold phosphate-buffered saline to remove RNAlater.
GSE12411	Cells corresponding to 10 ml culture volume were harvested at 3.5 hrs after induction with 1.0 mM IPTG using centrifugation. The cell pellet was immediately resuspended in RNAlater (Ambion, Austin, TX, USA) and stored at -20°C until further processing. Prior to RNA extraction using MasterPure RNA purification kit (Epicentre, Madison, WI, USA) the pellet was washed in cold phosphate-buffered saline to remove RNAlater.
GSE12411	E.coli cells at 1.5 hrs after addition of high IPTG (1.0 mM), biological rep1, technical rep 1
GSE12411	E.coli cells at 1.5 hrs after addition of high IPTG (1.0 mM), biological rep1, technical rep2
GSE12411	E.coli cells at 1.5 hrs after addition of high IPTG (1.0 mM), biological rep2, technical rep 1
GSE12411	E.coli cells at 1.5 hrs after addition of high IPTG (1.0 mM), biological rep2, technical rep2
GSE12411	E.coli cells at 1.5 hrs after addition of low IPTG (0.1 mM), biological rep1, technical rep 1
GSE12411	E.coli cells at 1.5 hrs after addition of low IPTG (0.1 mM), biological rep1, technical rep2
GSE12411	E.coli cells at 1.5 hrs after addition of low IPTG (0.1 mM), biological rep2, technical rep 1
GSE12411	E.coli cells at 1.5 hrs after addition of low IPTG (0.1 mM), biological rep2, technical rep2
GSE12411	E.coli cells at 1.5 hrs after addition of no IPTG (0 mM), biological rep1, technical rep 1
GSE12411	E.coli cells at 1.5 hrs after addition of no IPTG (0 mM), biological rep1, technical rep2
GSE12411	E.coli cells at 1.5 hrs after addition of no IPTG (0 mM), biological rep2, technical rep 1
GSE12411	E.coli cells at 1.5 hrs after addition of no IPTG (0 mM), biological rep2, technical rep2
GSE12411	E.coli cells at 1.5 hrs after induction with 0.1 mM IPTG
GSE12411	E.coli cells at 1.5 hrs after induction with 0 mM IPTG
GSE12411	E.coli cells at 1.5 hrs after induction with 1.0 mM IPTG
GSE12411	E.coli cells at 3.5 hrs after addition of high IPTG (1.0 mM), biological rep1, technical rep 1
GSE12411	E.coli cells at 3.5 hrs after addition of high IPTG (1.0 mM), biological rep1, technical rep2
GSE12411	E.coli cells at 3.5 hrs after addition of high IPTG (1.0 mM), biological rep2, technical rep 1
GSE12411	E.coli cells at 3.5 hrs after addition of high IPTG (1.0 mM), biological rep2, technical rep2
GSE12411	E.coli cells at 3.5 hrs after addition of low IPTG (0.1 mM), biological rep1, technical rep 1
GSE12411	E.coli cells at 3.5 hrs after addition of low IPTG (0.1 mM), biological rep1, technical rep2
GSE12411	E.coli cells at 3.5 hrs after addition of low IPTG (0.1 mM), biological rep2, technical rep 1
GSE12411	E.coli cells at 3.5 hrs after addition of low IPTG (0.1 mM), biological rep2, technical rep2
GSE12411	E.coli cells at 3.5 hrs after addition of no IPTG (0 mM), biological rep1, technical rep 1
GSE12411	E.coli cells at 3.5 hrs after addition of no IPTG (0 mM), biological rep1, technical rep2
GSE12411	E.coli cells at 3.5 hrs after addition of no IPTG (0 mM), biological rep2, technical rep 1
GSE12411	E.coli cells at 3.5 hrs after addition of no IPTG (0 mM), biological rep2, technical rep2
GSE12411	E.coli cells at 3.5 hrs after induction with 0.1 mM IPTG
GSE12411	E.coli cells at 3.5 hrs after induction with 0 mM IPTG
GSE12411	E.coli cells at 3.5 hrs after induction with 1.0 mM IPTG
GSE12411	E.coli cells at the time of IPTG induction
GSE12411	E.coli cells at the time of IPTG induction (T=0 hrs), biological rep1, technical rep 1
GSE12411	E.coli cells at the time of IPTG induction (T=0 hrs), biological rep1, technical rep2
GSE12411	E.coli cells at the time of IPTG induction (T=0 hrs), biological rep2, technical rep 1
GSE12411	E.coli cells at the time of IPTG induction (T=0 hrs), biological rep2, technical rep2
GSE12411	Escherichia coli
GSE12411	The probe intensity data  was analyzed using Genetraffic software (Iobion Informatics LLC, La Jolla, CA, USA). The probe intensity data was normalized using GC-RMA algorithm.
GSE12411	Total RNA was extracted using MasterPure RNA purification kits (Epicentre, Madison, WI, USA) according to the manufacturer’s protocol
GSE12797	Acidic Hot Phenol
GSE12797	Cells were grown in M63 glucose (0.2%) minimal media at 37oC at 200 rpm. Overnight cultures were inoculated with single, independent colonies in triplicate, incubated aerobically overnight at 37oC, and sub-cultured to a starting OD600 of 0.0001. Cultures were harvested at an OD600 = 0.3 after being maintained in exponential phase for at least eight generations.
GSE12797	Cells were grown in M63 glucose (0.2%) minimal media at 37oC at 200 rpm. Overnight cultures were inoculated with single, independent colonies in triplicate, incubated aerobically overnight at 37oC, and sub-cultured to a starting OD600 of 0.0001. Cultures were harvested at an OD600 = 1.5.
GSE12797	E. coli K12 grown in M63 glucose (0.2%) minimal media, sampled in exponential phase OD600=0.3
GSE12797	E. coli K12 grown in M63 glucose (0.2%) minimal media, sampled in stationary phase OD600=1.5
GSE12797	Escherichia coli K-12
GSE12797	Exp-rpoS-Rep1
GSE12797	Exp-rpoS-Rep2
GSE12797	Exp-rpoS-Rep3
GSE12797	Exp-WT-Rep1
GSE12797	Exp-WT-Rep2
GSE12797	Exp-WT-Rep3
GSE12797	GCRMA normalized
GSE12797	MG1655 rpoS mutants
GSE12797	MG1655 wild type
GSE12797	Stat-rpoS-Rep1
GSE12797	Stat-rpoS-Rep2
GSE12797	Stat-rpoS-Rep3
GSE12797	Stat-WT-Rep1
GSE12797	Stat-WT-Rep2
GSE12797	Stat-WT-Rep3
GSE12831	Ambion RiboPure RNA Isolation
GSE12831	Ambion RiboPure RNA Isolation 
GSE12831	Data has not been processed other than those protocols within GCOSv1.4
GSE12831	E. coli 8624
GSE12831	E. coli 8624 qseF deletion mutant
GSE12831	E. coli 8624 WT
GSE12831	Escherichia coli
GSE12831	Escherichia coli 8624 grown in DMEM
GSE12831	Escherichia coli 8624 qseF deletion mutant
GSE12831	Escherichia coli 8624 qseF deletion mutant grown in DMEM media
GSE12831	strain: Escherichia coli 8624
GSE12877	Aerobic E. coli exposed to CO-RMs for 15 minutes
GSE12877	Aerobic E. coli not exposed to CO-RMs for 15 minutes (control cells)
GSE12877	Aerobic MG1655 exposed to CO-RMs for 15 minutes
GSE12877	Aerobic MG1655 not exposed to CO-RMs for 15 minutes (control cells)
GSE12877	Escherichia coli
GSE12877	Escherichia coli after addition of CO-RMs to aerobically growing cells- Sample 1a
GSE12877	Escherichia coli after addition of CO-RMs to aerobically growing cells- Sample 1b
GSE12877	Escherichia coli after addition of CO-RMs to aerobically growing cells- Sample 2a
GSE12877	Escherichia coli after addition of CO-RMs to aerobically growing cells- Sample 2b
GSE12877	Escherichia coli after addition of CO-RMs to aerobically growing cells- Sample 3a
GSE12877	Escherichia coli after addition of CO-RMs to aerobically growing cells- Sample 3b
GSE12877	Escherichia coli after addition of CO-RMs to aerobically growing cells- Sample 4a
GSE12877	Escherichia coli after addition of CO-RMs to aerobically growing cells- Sample 4b
GSE12877	Samples (30 ml) were harvested directly into cold phenol ethanol (187 µl phenol, 3.56 ml ethanol) to stabilize RNA, and total RNA was purified using Qiagen’s RNeasy Mini kit as recommended by suppliers. RNA was quantified using a BioPhotometer (Eppendorf).
GSE12877	Spots automatically flagged as bad, negative or poor in the Imagene software were removed before the statistical analysis was carried out in GeneSight.  The mean values from each channel were log2 transformed and normalised using the Lowess method to remove intensity-dependent effects in the log2(ratios) values.  The Cy3
GSE12878	Anaerobic E. coli exposed to CO-RMs for 15 minutes
GSE12878	Anaerobic E. coli not exposed to CO-RMs for 15 minutes (control cells)
GSE12878	Anaerobic E. coli were exposed to CO-RMs for 15 minutes
GSE12878	Anaerobic MG1655 exposed to CO-RMs for 15 minutes
GSE12878	Anaerobic MG1655 not exposed to CO-RMs for 15 minutes (control cells)
GSE12878	Anaerobic MG1655 were exposed to CO-RMs for 15 minutes
GSE12878	Escherichia coli
GSE12878	Escherichia coli after addition of CO-RMs to anaerobically growing cells- Sample 1a
GSE12878	Escherichia coli after addition of CO-RMs to anaerobically growing cells- Sample 1b
GSE12878	Escherichia coli after addition of CO-RMs to anaerobically growing cells- Sample 2a
GSE12878	Escherichia coli after addition of CO-RMs to anaerobically growing cells- Sample 2b
GSE12878	Escherichia coli after addition of CO-RMs to anaerobically growing cells- Sample 3a
GSE12878	Escherichia coli after addition of CO-RMs to anaerobically growing cells- Sample 3b
GSE12878	Escherichia coli after addition of CO-RMs to anaerobically growing cells- Sample 4a
GSE12878	Escherichia coli after addition of CO-RMs to anaerobically growing cells- Sample 4b
GSE12878	Samples (30 ml) were harvested directly into cold phenol ethanol (187 µl phenol, 3.56 ml ethanol) to stabilize RNA, and total RNA was purified using Qiagen’s RNeasy Mini kit as recommended by suppliers. RNA was quantified using a BioPhotometer (Eppendorf).
GSE12878	Spots automatically flagged as bad, negative or poor in the Imagene software were removed before the statistical analysis was carried out in GeneSight.  The mean values from each channel were log2 transformed and normalised using the Lowess method to remove intensity-dependent effects in the log2(ratios) values.  The Cy3
GSE13011	Bexp_Bstat_dyeswap1
GSE13011	Bexp_Bstat_dyeswap2
GSE13011	Bexp_Bstat_rep1
GSE13011	Bexp_Bstat_rep2
GSE13011	Bexp_Kexp_dyeswap1
GSE13011	Bexp_Kexp_dyeswap2
GSE13011	Bexp_Kexp_rep1
GSE13011	Bexp_Kexp_rep2
GSE13011	Bexp_Kstat_dyeswap1
GSE13011	Bexp_Kstat_dyeswap2
GSE13011	Bexp_Kstat_rep1
GSE13011	Bexp_Kstat_rep2
GSE13011	Escherichia coli
GSE13011	Following background subtraction, spot signal intensities were calculated as percentages of total signal intensities of Cy-3 or Cy-5 signals on each microarray, as a means of normalization. Spots with low intensities were excluded.
GSE13011	MG1655, exponential phase, LB
GSE13011	MG1655, stationary phase, LB
GSE13011	REL606, exponential phase, LB
GSE13011	REL606, stationary phase, LB
GSE13011	Total RNA was isolated from cells grown in LB medium using the Qiagen RNeasy column.
GSE13444	Ecoli_ko_arcA_1%_isobutanol_Sample1_TechRep1
GSE13444	Ecoli_ko_arcA_1%_isobutanol_Sample1_TechRep2
GSE13444	Ecoli_ko_arcA_1%_isobutanol_Sample2_TechRep1
GSE13444	Ecoli_ko_arcA_1%_isobutanol_Sample2_TechRep2
GSE13444	Ecoli_ko_arcA_1%_isobutanol_Sample3_TechRep1
GSE13444	Ecoli_ko_arcA_1%_isobutanol_Sample3_TechRep2
GSE13444	Ecoli_ko_arcA_1%_isobutanol_Sample4_TechRep1
GSE13444	Ecoli_ko_arcA_1%_isobutanol_Sample4_TechRep2
GSE13444	Ecoli ko-arcA grown in MOPS
GSE13444	Ecoli ko-arcA grown in MOPS, 10 minutes after 1% isobutanol treatment
GSE13444	Ecoli_ko_fur_1%_isobutanol_Sample1_TechRep1
GSE13444	Ecoli_ko_fur_1%_isobutanol_Sample1_TechRep2
GSE13444	Ecoli_ko_fur_1%_isobutanol_Sample2_TechRep1
GSE13444	Ecoli_ko_fur_1%_isobutanol_Sample2_TechRep2
GSE13444	Ecoli_ko_fur_1%_isobutanol_Sample3_TechRep1
GSE13444	Ecoli_ko_fur_1%_isobutanol_Sample3_TechRep2
GSE13444	Ecoli_ko_fur_1%_isobutanol_Sample4_TechRep1
GSE13444	Ecoli_ko_fur_1%_isobutanol_Sample4_TechRep2
GSE13444	Ecoli ko-fur grown in MOPS
GSE13444	Ecoli ko-fur grown in MOPS, 10 minutes after 1% isobutanol treatment
GSE13444	Ecoli ko-furgrown in MOPS, 10 minutes after 1% isobutanol treatment
GSE13444	Ecoli_ko_ihfA_1%_isobutanol_Sample1_TechRep1
GSE13444	Ecoli_ko_ihfA_1%_isobutanol_Sample1_TechRep2
GSE13444	Ecoli_ko_ihfA_1%_isobutanol_Sample2_TechRep1
GSE13444	Ecoli_ko_ihfA_1%_isobutanol_Sample2_TechRep2
GSE13444	Ecoli_ko_ihfA_1%_isobutanol_Sample3_TechRep1
GSE13444	Ecoli_ko_ihfA_1%_isobutanol_Sample3_TechRep2
GSE13444	Ecoli_ko_ihfA_1%_isobutanol_Sample4_TechRep1
GSE13444	Ecoli_ko_ihfA_1%_isobutanol_Sample4_TechRep2
GSE13444	Ecoli ko-ihfA grown in MOPS
GSE13444	Ecoli ko-ihfA grown in MOPS, 10 minutes after 1% isobutanol treatment
GSE13444	Ecoli_ko_phoB_1%_isobutanol_Sample1_TechRep1
GSE13444	Ecoli_ko_phoB_1%_isobutanol_Sample1_TechRep2
GSE13444	Ecoli_ko_phoB_1%_isobutanol_Sample2_TechRep1
GSE13444	Ecoli_ko_phoB_1%_isobutanol_Sample2_TechRep2
GSE13444	Ecoli_ko_phoB_1%_isobutanol_Sample3_TechRep1
GSE13444	Ecoli_ko_phoB_1%_isobutanol_Sample3_TechRep2
GSE13444	Ecoli_ko_phoB_1%_isobutanol_Sample4_TechRep1
GSE13444	Ecoli_ko_phoB_1%_isobutanol_Sample4_TechRep2
GSE13444	Ecoli ko-phoB grown in MOPS
GSE13444	Ecoli ko-phoB grown in MOPS, 10 minutes after 1% isobutanol treatment
GSE13444	Ecoli_ko_ubiE_1%_isobutanol_Sample1_TechRep1
GSE13444	Ecoli_ko_ubiE_1%_isobutanol_Sample1_TechRep2
GSE13444	Ecoli_ko_ubiE_1%_isobutanol_Sample2_TechRep1
GSE13444	Ecoli_ko_ubiE_1%_isobutanol_Sample2_TechRep2
GSE13444	Ecoli ko-ubiE grown in MOPS
GSE13444	Ecoli ko-ubiE grown in MOPS, 10 minutes after 1% isobutanol treatment
GSE13444	Ecoli_wildtype_1%_butanol_Sample1_TechRep1
GSE13444	Ecoli_wildtype_1%_butanol_Sample1_TechRep2
GSE13444	Ecoli_wildtype_1%_butanol_Sample2_TechRep1
GSE13444	Ecoli_wildtype_1%_butanol_Sample2_TechRep2
GSE13444	Ecoli_wildtype_1%_butanol_Sample3_TechRep1
GSE13444	Ecoli_wildtype_1%_butanol_Sample3_TechRep2
GSE13444	Ecoli_wildtype_1%_butanol_Sample4_TechRep1
GSE13444	Ecoli_wildtype_1%_butanol_Sample4_TechRep2
GSE13444	Ecoli_wildtype_1%_isobutanol_Sample1_TechRep1
GSE13444	Ecoli_wildtype_1%_isobutanol_Sample1_TechRep2
GSE13444	Ecoli_wildtype_1%_isobutanol_Sample2_TechRep1
GSE13444	Ecoli_wildtype_1%_isobutanol_Sample2_TechRep2
GSE13444	Ecoli_wildtype_1%_isobutanol_Sample3_TechRep1
GSE13444	Ecoli_wildtype_1%_isobutanol_Sample3_TechRep2
GSE13444	Ecoli_wildtype_1%_isobutanol_Sample4_TechRep1
GSE13444	Ecoli_wildtype_1%_isobutanol_Sample4_TechRep2
GSE13444	Ecoli_wildtype_1%_isobutanol_Sample5_TechRep1
GSE13444	Ecoli_wildtype_1%_isobutanol_Sample5_TechRep2
GSE13444	Ecoli_wildtype_3%_ethanol_Sample1_TechRep1
GSE13444	Ecoli_wildtype_3%_ethanol_Sample1_TechRep2
GSE13444	Ecoli_wildtype_3%_ethanol_Sample2_TechRep1
GSE13444	Ecoli_wildtype_3%_ethanol_Sample2_TechRep2
GSE13444	Ecoli_wildtype_3%_ethanol_Sample3_TechRep1
GSE13444	Ecoli_wildtype_3%_ethanol_Sample3_TechRep2
GSE13444	Ecoli_wildtype_3%_ethanol_Sample4_TechRep1
GSE13444	Ecoli_wildtype_3%_ethanol_Sample4_TechRep2
GSE13444	Ecoli_wildtype_calibration_Sample1_TechRep1
GSE13444	Ecoli_wildtype_calibration_Sample1_TechRep2
GSE13444	Ecoli_wildtype_calibration_Sample2_TechRep1
GSE13444	Ecoli_wildtype_calibration_Sample2_TechRep2
GSE13444	Ecoli wildtype grown in MOPS
GSE13444	Ecoli wildtype grown in MOPS, 10 minutes after 1% butanol treatment
GSE13444	Ecoli wildtype grown in MOPS, 10 minutes after 1% isobutanol treatment
GSE13444	Ecoli wildtype grown in MOPS, 10 minutes after 3% ethanol treatment
GSE13444	Escherichia coli
GSE13444	Qiagen RNeasy Midikit
GSE13444	Quantification of the scans were performed with ImaGene (Version 6.0.1; BioDiscovery; El Segundo, CA; www.biodiscovery.com); with the results presented in the associated text files.  The normalized data VALUE was generated using LOWESS normalization with rank invariant selection, as implemented in lcDNA (receptor.seas.ucla.edu
GSE13444	RNA from 1% isobutanol treated sample and untreated sample were mixed after RNA purification
GSE13444	strain: BW25113
GSE13444	Strain:BW25113
GSE13444	Strain: BW25113
GSE13444	Treated with 1% vol
GSE13444	Treated with 3% vol
GSE13698	BW25113, H2O2
GSE13698	BW25113, water (negative control)
GSE13698	BW25113 ychH, H2O2
GSE13698	BW25113 ychH, water (negative control)
GSE13698	BW25113 ygiW, H2O2
GSE13698	BW25113 ygiW, water (negative control)
GSE13698	Channel 1
GSE13698	Escherichia coli
GSE13698	MAS 5.0 Expression Analysis Default Setting
GSE13698	RNA extracted from cells of BW25113 at OD 1.0 after contacting for 10 min with 2 mM H2O2 in LB at 37oC.
GSE13698	RNA extracted from cells of BW25113 at OD 1.0 after contacting for 10 min with water (negative control) in LB at 37oC.
GSE13698	RNA extracted from cells of BW25113 ychH at OD 1.0 after contacting for 10 min with 2 mM H2O2 in LB at 37oC.
GSE13698	RNA extracted from cells of BW25113 ychH at OD 1.0 after contacting for 10 min with water (negative control) in LB at 37oC.
GSE13698	RNA extracted from cells of BW25113 ygiW at OD 1.0 after contacting for 10 min with 2 mM H2O2 in LB at 37oC.
GSE13698	RNA extracted from cells of BW25113 ygiW at OD 1.0 after contacting for 10 min with water (negative control) in LB at 37oC.
GSE13698	RNA extracted from cells of TG1
GSE13698	To lyse the cells, 1.0 mL RLT buffer (Qiagen, Inc., Valencia, CA) and 0.2 mL 0.1 mm zirconia
GSE13938	Cell pellets (from initial 50 ml of culture) were thawed and resuspended in 250ul of IP buffer (100 mM Tris pH 8, 300 mM NaCl, 2% TritonX-100) and sonicated using a microtip sonicator set at 10% output for 20 second intervals with periods of cooling in between. Cells were then treated for one hour at 4 °C with RNase A (2 ng
GSE13938	Cells were grown with vigorous shaking at 37 °C to mid-log (light scattering at 600 nm equivalent to 0.4 OD). Sodium phosphate (1
GSE13938	Escherichia coli
GSE13938	Genomic DNA control
GSE13938	Genomic DNA control from E. coli K-12 MG1655 cells
GSE13938	Genomic DNA control from E. coli K-12 MG1655 cells treated with 100ug
GSE13938	Genomic DNA control from E. coli K-12 MG1655 cells treated with 20ug
GSE13938	Genomic DNA control from E. coli K-12 MG1655 HA3::nusG cells
GSE13938	Monoclonal antibody for HA (12CA5)
GSE13938	Monoclonal antibody for NusA (1NA1)
GSE13938	Monoclonal antibody for RNA polymerase Beta' subunit (NT73)
GSE13938	Monoclonal antibody for Sigma70 (2G10)
GSE13938	NusA ChIP-chip in E. coli K-12 MG1655 cells (Dataset 56226)
GSE13938	NusA ChIP-chip in E. coli K-12 MG1655 cells (Dataset 61392)
GSE13938	NusA ChIP-chip in E. coli K-12 MG1655 cells (Dataset 64131)
GSE13938	NusA ChIP in E. coli K-12 MG1655 cells
GSE13938	NusG ChIP-chip in E. coli K-12 MG1655 cells (Dataset 70568)
GSE13938	NusG ChIP-chip in E. coli K-12 MG1655 HA3::nusG cells (Dataset 62261)
GSE13938	NusG ChIP-chip in E. coli K-12 MG1655 HA3::nusG cells (Dataset 62263)
GSE13938	NusG ChIP in E. coli K-12 MG1655 cells
GSE13938	NusG ChIP in E. coli K-12 MG1655 HA3::nusG cells
GSE13938	Polyclonal antibody for NusG (raised for this study)
GSE13938	Polyclonal antibody for Rho (gift from Jeff Roberts)
GSE13938	Rho ChIP-chip in E. coli K-12 MG1655 cells (Dataset 3421602)
GSE13938	Rho ChIP-chip in E. coli K-12 MG1655 cells (Dataset 70261)
GSE13938	Rho ChIP in E. coli K-12 MG1655 cells
GSE13938	RNA polymerase (Beta') ChIP-chip in E. coli K-12 MG1655 cells (Dataset 100040)
GSE13938	RNA polymerase (Beta') ChIP-chip in E. coli K-12 MG1655 cells (Dataset 56706)
GSE13938	RNA polymerase (Beta’) ChIP-chip in E. coli K-12 MG1655 cells (Dataset 62215)
GSE13938	RNA polymerase (Beta') ChIP-chip in E. coli K-12 MG1655 cells treated with 100ug
GSE13938	RNA polymerase (Beta') ChIP-chip in E. coli K-12 MG1655 cells treated with 20ug
GSE13938	RNA polymerase (Beta') ChIP in E. coli K-12 MG1655 cells
GSE13938	RNA polymerase (Beta’) ChIP in E. coli K-12 MG1655 cells
GSE13938	RNA polymerase (Beta') ChIP in E. coli K-12 MG1655 cells treated with 100ug
GSE13938	RNA polymerase (Beta') ChIP in E. coli K-12 MG1655 cells treated with 20ug
GSE13938	Sigma70 ChIP-chip in E. coli K-12 MG1655 cells (Dataset 56859)
GSE13938	Sigma70 ChIP-chip in E. coli K-12 MG1655 cells (Dataset 62214)
GSE13938	Sigma70 ChIP-chip in E. coli K-12 MG1655 cells (Dataset 64194)
GSE13938	Sigma70 ChIP-chip in E. coli K-12 MG1655 cells treated with 100ug
GSE13938	Sigma70 ChIP in E. coli K-12 MG1655 cells
GSE13938	Sigma70 ChIP in E. coli K-12 MG1655 cells treated with 100ug
GSE13938	Strain MG1655 or isogenic strain MG1655 HA3::nusG cells were grown in MOPS minimal medium supplemented with 0.2% glucose (www.genome.wisc.edu
GSE13938	VALUE=log2(Cy3_signal
GSE13938	VALUE=log2(Cy5_signal
GSE13982	E.coli_15min_AE_1
GSE13982	E.coli_15min_AE_2
GSE13982	E.coli_15min_aerobic
GSE13982	E.coli_15min_ANA_1
GSE13982	E. coli_15min_ANA_2
GSE13982	E. coli_15min_anaerobic
GSE13982	E.coli_15min_anaerobic
GSE13982	E.coli_15min_CORM-2 treated_aerobic
GSE13982	E.coli_15min_CORM-2 treated_anaerobic
GSE13982	E.coli_15min_CORM_AE_1
GSE13982	E.coli_15min_CORM_AE_2
GSE13982	E.coli_15min_CORM_ANA_1
GSE13982	E.coli_15min_CORM_ANA_2
GSE13982	Escherichia coli MG1655
GSE13982	Escherichia coli str. K-12 substr. MG1655
GSE13982	Scanned arrays were analyzed with Affymetrix GCOS 1.4 software to obtain Detection calls and Expression values based on MAS 5.0 algorithms. All arrays were scaled to a target value of 500.
GSE13982	The hot-phenol method was used to extract total RNA from two independent cultures of cells grown aerobically
GSE13982	The hot-phenol method was used to extract total RNA from two independent cultures of cells grown aerobically and treated with 250 μM CORM-2 during 15 min.
GSE13982	The hot-phenol method was used to extract total RNA from two independent cultures of cells grown anaerobically
GSE13982	The hot-phenol method was used to extract total RNA from two independent cultures of cells grown anaerobically and treated with 250 μM CORM-2 during 15 min.
GSE14069	Acid adaptation was done in DMEM at pH 5.0 at room temperature, followed by acid-stress at pH 3.0 for 30 minutes
GSE14069	Acid shocking was done in DMEM at pH 3.0 at room temperature for 30 minutes
GSE14069	Acid shocking was done in DMEM at pH 3.0 (unbuffered) at room temperature for 15 minutes
GSE14069	Bacteria were grown in LB broth overnight and subcultured in DMEM
GSE14069	Bacteria were grown in LB broth overnight and subcultured in DMEM prior to acid stress
GSE14069	Control treatment. Bacteria were grown in DMEM pH 7.4 (unstressed)
GSE14069	Cy3 labeled EHEC grown in DMEM pH 7.4
GSE14069	Cy3 labeled EHEC grown in DMEM pH 7.4, 15 minutes
GSE14069	Cy5 labeled EHEC acid-adapted in DMEM pH 5, followed by 30 minutes pH 3
GSE14069	Cy5 labeled EHEC acid-stressed in DMEM pH 3, 15 minutes
GSE14069	Cy5 labeled EHEC acid-stressed in DMEM pH 3, 30minutes
GSE14069	EHEC strain 86-24
GSE14069	Escherichia coli
GSE14069	RNA was extracted using Trizol (Invitrogen)
GSE14069	Signal intensities were averaged among the technical replicates.  Two types of data analysis were performed: to indentify density-dependent changes in gene expression, single averaged normalized signal intensities for each treatment point were compared to the average of corresponding unstressed control signal intensities.  Genes which showed a relative signal log2ratio (SLR) value above 1.0 or below -1.0 were selected for further analysis. 
GSE14069	Signal intensities were averaged among the technical replicates. Two types of data analysis were performed: to indentify density-dependent changes in gene expression, single averaged normalized signal intensities for each treatment point were compared to the average of corresponding unstressed control signal intensities. Genes which showed a relative signal log2ratio (SLR) value above 1.0 or below -1.0 were selected for further analysis. 
GSE14069	Treatment 1: UA30 (EHEC 86-24 exposed to pH 3 for 30 min)
GSE14069	Treatment 2: AA30 (EHEC 86-24 pH 5.0, followed by 30 min pH 3.0)
GSE14069	Treatment 3: UA15 (EHEC 86-24 exposed to pH 3 for 15 min)
GSE14203	BW25113
GSE14203	BW25113 mqsR mutant at OD600=0.5 LB 37C suspension cell
GSE14203	BW25113 wt at OD600=0.5 LB 37C suspension cell
GSE14203	Chipchip BW25113
GSE14203	E. coli K-12 BW25113
GSE14203	E. coli K-12 BW25113 mqsR mutant at OD600=0.5 LB 37C suspension cell
GSE14203	E. coli K-12 BW25113 wt at OD600=0.5 LB 37C suspension cell
GSE14203	Escherichia coli
GSE14203	His-tagged DNA extracted from biofilm cells of E. coli K-12 wild type BW25113
GSE14203	His-tagged DNA extracted from planktonic cells of E. coli K-12 wild type BW25113
GSE14203	MAS 5.0 Expression Analysis Default Setting
GSE14203	RNA extracted from suspension cells of E. coli K-12 BW25113
GSE14203	RNA extracted from suspension cells of E. coli K-12 BW25113 mqsR deleted mutant after OD600=0.5 of growth in LB at 37oC
GSE14203	RNA extracted from suspension cells of E. coli K-12 BW25113 wild type after OD600=0.5 of growth in LB at 37oC
GSE14203	The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) for forming biofilm. After incubation for 24 h at 37oC with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0oC. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0oC. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104).
GSE14203	The overnight culture was used to inoculate 25 ml of fresh LB medium. After incubation for OD600=0.5 at 37oC under 2 mM IPTG with shaking (250 rpm), the planktonic cells were quickly removed and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104).
GSE14203	The overnight culture was used to inoculate 25 ml of fresh LB medium. After incubation for OD600=0.5 at 37oC with shaking (250 rpm), the planktonic cells were quickly removed and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104).
GSE14203	The overnight culture was used to inoculate 25 ml of fresh LB medium. After incubation for OD600=0.8 at 37oC with shaking (250 rpm), adding 0.5% L-arabinose and incubated for 24 h
GSE14796	10,000U Pencillin G in media
GSE14796	72hr colony growth equiv. to wildtype colony size
GSE14796	Escherichia coli str. K-12 substr. W3110
GSE14796	L-form, brain heart infusion agar+Sucrose+MgSO4+Pen G, rep 1
GSE14796	L-form, brain heart infusion agar+Sucrose+MgSO4+Pen G, rep 2
GSE14796	L-form, brain heart infusion agar+Sucrose+MgSO4+Pen G, rep 3
GSE14796	L-form colony morphology
GSE14796	MasterPure RNA purification Kit
GSE14796	overnight colony growth
GSE14796	strain: L-form
GSE14796	strain: wildtype
GSE14796	The data were analyzed with GCOS 1.4 software.  All probe sets scaling was performed with a target signal value of 500.  No normalization was performed.
GSE14796	wildtype, brain heart infusion agar, rep 1
GSE14796	wildtype, brain heart infusion agar, rep 2
GSE14796	wildtype, brain heart infusion agar, rep 3
GSE14796	wildtype, brain heart infusion agar +Sucrose+MgSO4, rep 1
GSE14796	wildtype, brain heart infusion agar +Sucrose+MgSO4, rep 2
GSE14796	wildtype, brain heart infusion agar +Sucrose+MgSO4, rep 3
GSE14796	wildtype colony morphology
GSE15050	Ambion RiboPure RNA Isolation
GSE15050	Data included in file has not been processed other than those protocols within GCOSv1.4
GSE15050	Escherichia coli
GSE15050	Escherichia coli 8624
GSE15050	Escherichia coli 8624 grown in DMEM with AI3
GSE15050	Escherichia coli 8624 grown in DMEM with Epinephrine
GSE15050	Escherichia coli 8624 grown in LB
GSE15050	Escherichia coli 8624 in LB
GSE15050	Escherichia coli 8624 kdpE deletion mutant
GSE15050	Escherichia coli 8624 kdpE deletion mutant grown in DMEM
GSE15050	Escherichia coli 8624 qseB deletion mutant
GSE15050	Escherichia coli 8624 qseB deletion mutant grown in DMEM
GSE15050	Escherichia coli 8624 qseC deletion mutant grown in DMEM
GSE15050	Escherichia coli 8624 qseC deletion mutant grown in DMEM with AI3
GSE15050	Escherichia coli 8624 qseC deletion mutant grown in DMEM with Epinephrine
GSE15050	Escherichia coli 8624 qseC mutant grown in  LB
GSE15050	Escherichia coli 8624 qseC mutant in DMEM
GSE15050	Escherichia coli 8624 qseC mutant in DMEM with AI3
GSE15050	Escherichia coli 8624 qseC mutant in DMEM with epinephrine
GSE15050	Escherichia coli 8624 qseC mutant in LB
GSE15050	grown to OD600=1.0 in DMEM
GSE15050	grown to OD600=1.0 in DMEM with 50 uM epinephrine
GSE15050	grown to OD600=1.0 in DMEM with AI3
GSE15050	grown to OD600=1.0 in DMEM with AI3 signaling molecule
GSE15050	grown to OD600=1.0 in DMEM with Epinephrine
GSE15050	grown to OD600=1.0 in LB
GSE15050	strain: Escherichia coli 8624
GSE15050	strain: Escherichia coli strain 8624
GSE15050	strain: Escherichia coli strain 8624 kdpE mutant
GSE15050	strain: Escherichia coli strain 8624 qseB mutant
GSE15050	strain: Escherichia coli strain 8624 qseC
GSE15050	strain: Escherichia coli strain 8624 qseC mutant
GSE15391	E. coli strain B-a
GSE15391	E. coli strain B-b
GSE15391	E. coli strain B DNA
GSE15391	E. coli strain K12-a
GSE15391	E. coli strain K12-b
GSE15391	E. coli strain K12-c
GSE15391	E. coli strain K12-d
GSE15391	E. coli strain K12 DNA
GSE15391	Escherichia coli B
GSE15391	Escherichia coli K-12
GSE15391	Genomic bacterial DNA was extracted following the protocol described in Maniatis Sambrook (Sambrook et al., 1989). DNA was sonicated in a Bioruptor (Diagenode, Liege, Belgium) to obtain fragments of approximately 500 bp.
GSE15391	Signals of each slide were smoothed using the NMPP program (Wang et al., 2006). Normalisation per chip to 50th percentile and further analyses were performed in GeneSpring GX v7.3.1 (Agilent Technologies, Basel, Switzerland).
GSE15391	strain: B
GSE15391	strain: K-12
GSE15409	Adenosine addition
GSE15409	Alanine addition
GSE15409	Amino acid or nucleotide added to final concentration of 1 mM not exceeding 1
GSE15409	Arginine addition
GSE15409	Aspartate addition
GSE15409	Cysteine addition
GSE15409	Cytidine addition
GSE15409	E. coli cells 0 min before perturbation
GSE15409	E. coli cells 10 min after specific perturbation
GSE15409	E. coli cells grown to mid-exponential phase after 6-8 generations after stationary phase in M9 minimal medium + 0.4 % glucose.
GSE15409	Escherichia coli str. K-12 substr. MG1655
GSE15409	Glutamate addition
GSE15409	Glutamine addition
GSE15409	Glycine addition
GSE15409	Guanosine addition
GSE15409	Histidine addition
GSE15409	Images were quantified using GenePix Pro software
GSE15409	Isoleucine addition
GSE15409	Lysine addition
GSE15409	Median of intensity data was extracted, LOESS normalized and an ANOVA model was fit using the MAANOVA package in R. The Log (Cy5
GSE15409	Methionine addition
GSE15409	Phenylalanine addition
GSE15409	Proline addition
GSE15409	Serine addition
GSE15409	stress: Adenosine addition
GSE15409	stress: Alanine addition
GSE15409	stress: Arginine addition
GSE15409	stress: Aspartate addition
GSE15409	stress: control (before perturbation)
GSE15409	stress: Cysteine addition
GSE15409	stress: Cytidine addition
GSE15409	stress: Glutamate addition
GSE15409	stress: Glutamine addition
GSE15409	stress: Glycine addition
GSE15409	stress: Guanosine addition
GSE15409	stress: Histidine addition
GSE15409	stress: Isoleucine addition
GSE15409	stress: Lysine addition
GSE15409	stress: Methionine addition
GSE15409	stress: Phenylalanine addition
GSE15409	stress: Proline addition
GSE15409	stress: Serine addition
GSE15409	stress: Threonine addition
GSE15409	stress: Thymidine addition
GSE15409	stress: Tryptophan addition
GSE15409	stress: Uridine addition
GSE15409	stress: Valine addition
GSE15409	Threonine addition
GSE15409	Thymidine addition
GSE15409	Total RNA extracted using Qiagen RNEASY kit according to directions
GSE15409	Tryptophan addition
GSE15409	Uridine addition
GSE15409	Valine addition
GSE15588	antibody: IgG
GSE15588	antibody: RNAP beta subunit (NT63)
GSE15588	Cells at appropriate cell density were cross-linked by 1% formaldehyde at room temperature for 25 min. Following quenching the unused formaldehyde with a final concentration of 125 mM glycine at room temperature for 5 min. The cross-linked cells were harvested and washed three times with 50 mL of ice-cold TBS (Tris Buffered Saline). The washed cells were re-suspended in 0.5 mL lysis buffer composed of 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM EDTA, 1 ug
GSE15588	condition: heat-shocked condition without rifampicin treatment
GSE15588	condition: mid-exponential condition without rifampicin treatment
GSE15588	condition: mid-exponential condition with rifampicin treatment
GSE15588	condition: nitrogen-limiting condition without rifampicin treatment
GSE15588	condition: stationary condition without rifampicin treatment
GSE15588	Cross-linked and sonicated chromatin complex of RNAP beta-subunit and DNA was immunoprecipitated by normal mouse IgG (Upstate) for the control (mock-IP).
GSE15588	Cross-linked and sonicated chromatin complex of RNAP beta-subunit and DNA was immunoprecipitated by NT63 mouse antibody.
GSE15588	E.coli_heat_dynamic_1
GSE15588	E.coli_heat_dynamic_2
GSE15588	E.coli_log_dynamic_1
GSE15588	E.coli_log_dynamic_2
GSE15588	E.coli_log_dynamic_3
GSE15588	E.coli_log_rif_1
GSE15588	E.coli_log_rif_2
GSE15588	E.coli_log_rif_3
GSE15588	E. coli MG1655 strain was cultured in M9 complete medium at 37 °C with constant agitation and harvested at mid-exponential phase. (OD600nm ~ 0.6)
GSE15588	E. coli MG1655 strain was cultured in M9 complete medium at 37 °C with constant agitation and harvested at stationary phase. (OD600nm ~ 1.5)
GSE15588	E. coli MG1655 strain was cultured in M9 complete medium at 37 °C with constant agitation. For heat-shock, culture was mix with pre-warmed medium (50 °C) and incubated at 45 °C for 10 min.
GSE15588	E. coli MG1655 strain was cultured in W2 minimal medium (for nitrogen-limiting condition) at 37 °C with constant agitation and harvested at mid-exponential phase. (OD600nm ~ 0.6) (Powell, B. S. et al. J of Biol. Chem.270(9):4822)
GSE15588	E.coli_nitrogen_dynamic_1
GSE15588	E.coli_nitrogen_dynamic_2
GSE15588	E.coli RNAP beta subunit ChIP DNA from heat-shocked condition without rifampicin treatment
GSE15588	E.coli RNAP beta subunit ChIP DNA from mid-exponential condition without rifampicin treatment
GSE15588	E.coli RNAP beta subunit ChIP DNA from mid-exponential condition with rifampicin treatment
GSE15588	E.coli RNAP beta subunit ChIP DNA from nitrogen-limiting condition without rifampicin treatment
GSE15588	E.coli RNAP beta subunit ChIP DNA from stationary condition without rifampicin treatment
GSE15588	E.coli_stat_dynamic_1
GSE15588	E.coli_stat_dynamic_2
GSE15588	Escherichia coli str. K-12 substr. MG1655
GSE15588	Input DNA from heat-shocked condition without rifampicin treatment
GSE15588	Input DNA from mid-exponential condition without rifampicin treatment
GSE15588	Input DNA from mid-exponential condition with rifampicin treatment
GSE15588	Input DNA from nitrogen-limiting condition without rifampicin treatment
GSE15588	Input DNA from stationary condition without rifampicin treatment
GSE15588	reference: Input DNA
GSE15588	strain: MG1655
GSE15588	test: ChIP DNA
GSE15588	The raw data (.pair file) was subjected to per channel quantile normalization (Bolstad et al. Bioinformatics 19(2):185), IP
GSE15783	5 ml of the culture was mixed with 1
GSE15783	bovine-biased-1 strain grown to exponential phase of growth
GSE15783	bovine-biased-2 strain grown to exponential phase of growth
GSE15783	bovine-biased-3 strain grown to exponential phase of growth
GSE15783	bovine-biased-4 strain grown to exponential phase of growth
GSE15783	clinical-1 strain grown to exponential phase of growth
GSE15783	Clinical-1 vs Bovine-biased-1
GSE15783	Clinical-1 vs Bovine-biased-2
GSE15783	Clinical-1 vs Bovine-biased-3
GSE15783	Clinical-1 vs Bovine-biased-4
GSE15783	clinical-2 strain grown to exponential phase of growth
GSE15783	Clinical-2 vs Bovine-biased-1
GSE15783	Clinical-2 vs Bovine-biased-2
GSE15783	Clinical-2 vs Bovine-biased-3
GSE15783	Clinical-2 vs Bovine-biased-4
GSE15783	clinical-3 strain grown to exponential phase of growth
GSE15783	Clinical-3 vs Bovine-biased-1
GSE15783	Clinical-3 vs Bovine-biased-2
GSE15783	Clinical-3 vs Bovine-biased-3
GSE15783	Clinical-3 vs Bovine-biased-4
GSE15783	clinical-4 strain grown to exponential phase of growth
GSE15783	Clinical-4 vs Bovine-biased-1
GSE15783	Clinical-4 vs Bovine-biased-2
GSE15783	Clinical-4 vs Bovine-biased-3
GSE15783	Clinical-4 vs Bovine-biased-4
GSE15783	Escherichia coli
GSE15783	replicate: 1
GSE15783	replicate: 2
GSE15783	replicate: 3
GSE15783	replicate: 4
GSE15783	strain: e. coli o157 H7 strain TW10915
GSE15783	strain: e. coli o157 H7 strain TW10916
GSE15783	strain: e. coli o157 H7 strain TW10917
GSE15783	strain: e. coli o157 H7 strain TW10938
GSE15783	strain: e. coli o157 H7 strain TW10948
GSE15783	strain: e. coli o157 H7 strain TW10950
GSE15783	strain: e. coli o157 H7 strain TW10957
GSE15783	strain: e. coli o157 H7 strain TW10967
GSE15783	The microarray data were analyzed using R (v. 2.2.1) and the MAANOVA (v. 0.98.8) package. Raw intensity values from replicate probes were averaged and log2 transformed after normalization with the pin-tip LOWESS method. The normalized intensity values were fitted to a mixed model ANOVA considering array and biological replicates as random factors and dye, strain as fixed factors. The linear model tested was Y (intensity) = array + dye + strain (clinical or bovine-biased)+ sample (biological replicate) + error. Significant differences in expression due to strain were determined using the Fs test in MAANOVA which uses a shrinkage estimator for gene-specific variance components that makes no assumption about the variances across genes with 500 random permutations to estimate the p-values. The q-value package in R was used for determining the false discovery rate (FDR). SAM provided by TMEV was also used for data analysis.
GSE15783	The microarray data were analyzed using R (v. 2.2.1) and the MAANOVA (v. 0.98.8) package. Raw intensity values from replicate probes were averaged and log2 transformed after normalization with the pin-tip LOWESS method. The normalized intensity values were fitted to a mixed model ANOVA considering array and biological replicates as random factors and dye, strain as fixed factor. The linear model tested was Y (intensity) = array + dye + strain (clinical or bovine-biased)+ sample (biological replicate) + error. Significant differences in expression due to strain were determined using the Fs test in MAANOVA which uses a shrinkage estimator for gene-specific variance components that makes no assumption about the variances across genes with 500 random permutations to estimate the p-values. The q-value package in R was used for determining the false discovery rate (FDR). SAM provided by TMEV was also used for data analysis.
GSE15783	TW10915 cells were grown in DMEM medium upto exponential phase (OD600~0.5, 2.5 h after inoclulation) at 37C.
GSE15783	TW10916 cells were grown in DMEM medium upto exponential phase (OD600~0.5, 2.5 h after inoclulation) at 37C.
GSE15783	TW10917 cells were grown in DMEM medium upto exponential phase (OD600~0.5, 2.5 h after inoclulation) at 37C.
GSE15783	TW10938 cells were grown in DMEM medium upto exponential phase (OD600~0.5, 2.5 h after inoclulation) at 37C.
GSE15783	TW10948 cells were grown in DMEM medium upto exponential phase (OD600~0.5, 2.5 h after inoclulation) at 37C.
GSE15783	TW10950 cells were grown in DMEM medium upto exponential phase (OD600~0.5, 2.5 h after inoclulation) at 37C.
GSE15783	TW10957 cells were grown in DMEM medium upto exponential phase (OD600~0.5, 2.5 h after inoclulation) at 37C.
GSE15783	TW10967 cells were grown in DMEM medium upto exponential phase (OD600~0.5, 2.5 h after inoclulation) at 37C.
GSE16414	Batch cultures of E. coli MG1655 were grown at 37°C with shaking in Luria-Bertani medium (0.1% Bacto Tryptone, 0.05% yeast extract, 0.05% NaCl).
GSE16414	Escherichia coli
GSE16414	For cross-linking, 30 mL of cells were mixed with 300 uL 1M sodium phosphates (pH 7.6) and 810 uL 37% formaldehyde. Cross-linking was quenched by addition of 2 mL 2M glycine. Protein-DNA complexes were isolated from cells grown to early (2.4 x 10^7 CFU
GSE16414	Genomic DNA Extraction: Genomic DNA was extracted according to Current Protocols in Molecular Biology.  Protein-DNA complex isolation: Protein-DNA complexes were isolated by phenol extraction with 150 μL 10 mM Tris and 500 μL 25:24:1 phenol : chloroform : isoamyl alcohol.  A white disk was readily discernible at the aqueous
GSE16414	genomic_ref1
GSE16414	genomic_ref2
GSE16414	genomic_ref3
GSE16414	genomic_ref4
GSE16414	genomic_ref5
GSE16414	genomic_ref6
GSE16414	IPOD_early_log_1
GSE16414	IPOD_early_log_2
GSE16414	IPOD_late_log_1
GSE16414	IPOD_late_log_2
GSE16414	IPOD_MDS42
GSE16414	MDS42 DNA isolated from early-phase DNA-protein complexes
GSE16414	MG1655 DNA isolated from early-phase DNA-protein complexes
GSE16414	MG1655 DNA isolated from late-phase DNA-protein complexes
GSE16414	MG1655 genomic DNA
GSE16414	MG1655 RNA
GSE16414	RNA_1
GSE16414	RNA_2
GSE16414	strain: MDS42
GSE16414	strain: MG1655
GSE16414	We developed in-house computational and statistical analysis tools for use with the E. coli tiling array.  We used a previous study (Choe et al., 2005) as a model for perfect match adjustment on single arrays.  Analysis scripts were written in Perl, MatLab, and R to standardize the statistical manipulations across all data sets. The output file from the scanning process is a CEL file. The raw CEL data were used as the basis for the manuscript; no processed data are available.
GSE16562	antibody: Monoclonal antibody for RNA polymerase Beta' subunit (NT73)
GSE16562	antibody: Monoclonal antibody for RNA polymerase Beta subunit (W0002)
GSE16562	Cell pellets (from initial 50 ml of culture) were thawed and resuspended in 250ul of IP buffer (100 mM Tris pH 8, 300 mM NaCl, 2% TritonX-100) and sonicated using a microtip sonicator set at 10% output for 20 second intervals with periods of cooling in between. Cells were then treated for one hour at 4 °C with RNase A (2 ng
GSE16562	Cells were grown with vigorous shaking at 37 °C to mid-log (light scattering at 600 nm equivalent to 0.4 OD). Sodium phosphate (1
GSE16562	Escherichia coli
GSE16562	Genomic DNA control from E. coli K-12 MG1655 cells treated with 20ug
GSE16562	Genomic DNA control from E. coli K-12 MG1655 cells, untreated
GSE16562	reference: input Genomic DNA control
GSE16562	RNA polymerase (Beta') ChIP-chip in E. coli K-12 MG1655 cells (Dataset 100040)
GSE16562	RNA polymerase (Beta) ChIP-chip in E. coli K-12 MG1655 cells (Dataset 3427302)
GSE16562	RNA polymerase (Beta') ChIP-chip in E. coli K-12 MG1655 cells treated with 20ug
GSE16562	RNA polymerase (Beta) ChIP-chip in E. coli K-12 MG1655 cells treated with 20ug
GSE16562	RNA polymerase (Beta') ChIP in E. coli K-12 MG1655 cells treated with 20ug
GSE16562	RNA polymerase (Beta) ChIP in E. coli K-12 MG1655 cells treated with 20ug
GSE16562	RNA polymerase (Beta') ChIP in E. coli K-12 MG1655 cells, untreated
GSE16562	RNA polymerase (Beta) ChIP in E. coli K-12 MG1655 cells, untreated
GSE16562	Strain MG1655 cells were grown in MOPS minimal medium supplemented with 0.2% glucose (www.genome.wisc.edu
GSE16562	The log2-ratio is computed and scaled to center the ratio data around zero. Scaling is performed by subtracting the bi-weight mean for the log2-ratio values for all features on the array from each log2-ratio value.
GSE16562	VALUE=log2(Cy5_signal
GSE16762	Escherichia coli
GSE16762	Escherichia coli O157:H7 EDL933 Inside Acanthamoeba
GSE16762	Escherichia coli O157:H7 EDL933 Inside Acanthamoeba vs. Control Slide 1
GSE16762	Escherichia coli O157:H7 EDL933 Inside Acanthamoeba vs. Control Slide 2
GSE16762	Escherichia coli O157:H7 EDL933 Inside Acanthamoeba vs. Control Slide 3
GSE16762	Escherichia coli O157:H7 EDL933 Inside Acanthamoeba vs. Control Slide 4
GSE16762	Escherichia coli O157:H7 EDL933 Inside Acanthamoeba vs. Control Slide 5
GSE16762	Escherichia coli O157:H7 EDL933 Inside Acanthamoeba vs. Control Slide 6
GSE16762	Escherichia coli O157:H7 EDL933 Inside Acanthamoeba vs. Control Slide 7
GSE16762	Escherichia coli O157:H7 EDL933 Inside Acanthamoeba vs. Control Slide 8
GSE16762	Escherichia coli O157:H7 EDL933 Inside Acanthamoeba vs. Control Slide 9
GSE16762	Escherichia coli O157:H7 EDL933 Outside Control
GSE16762	growth condition: Inside Acanthamoeba
GSE16762	growth condition: Outside Control
GSE16762	Mixed model analysis was conducted as previously described (Madsen, et al., 2006) excluding slide region and slide-by-region interaction effects. The value column was not used for analysis or in publication. The normalized values for duplicate spots were averaged within each array to produce one normalized measure of expression for each of the probe sequences and each of the RNA samples. [mean log transformed median centered lowess normalized signal intensity]
GSE16762	RNA was isolated from samples using the RNeasy Mini Kit (Qiagen). Prior to lysis all samples were incubated for 30 min on ice in RNA stop solution (0.1% SDS, 1% Acidic phenol, 19% ethanol, ice cold). The lysis and digestion protocol was followed with two 50 μl ddH20 elutions. Each sample was treated with 2 μl of DNase (Ambion, Austin, TX) at 37°C for 30 min. Samples were purified and concentrated using Microcon YM-30 columns (Millipore, Billerica, MA), and the quantity and purity were determined using an ND-1000 spectrophotometer (Nanodrop, Wilmington, DE). Samples were determined to be free of contaminating genomic DNA by absence of a band on a DNA electrophoresis gel after 30 rounds of PCR.
GSE16946	BRP Induction 10 Minutes against 5 Minutes
GSE16946	BRP Induction -10 minutes against 60 minutes
GSE16946	BRP Induction 20 minutes against 10 minutes
GSE16946	BRP Induction 30 minutes against 20 minutes
GSE16946	BRP Induction 45 minutes against 30 minutes
GSE16946	BRP Induction 5 minutes against 2 minutes
GSE16946	BRP Induction 60 minutes against 45 minutes
GSE16946	E.coli 0 minutes after BRP induction
GSE16946	E.coli -10 minutes after BRP induction
GSE16946	E.coli 10 minutes after BRP induction
GSE16946	E.coli 20 minutes after BRP induction
GSE16946	E.coli 2 minutes after BRP induction
GSE16946	E.coli 30 minutes after BRP induction
GSE16946	E.coli 45 minutes after BRP induction
GSE16946	E.coli 5 minutes after BRP induction
GSE16946	E.coli 60 minutes after BRP induction
GSE16946	Escherichia coli
GSE16946	Genomic response analysis of E.coli during coexpression of a bacteriocin release protein
GSE16946	The scanning process of the hybridized chips included a fourteen-fold scan of each chip at different settings, altering both PMT and laser power settings. The following primary analysis served as a quantification method and is performed with the Gene Pix Pro 6.0™ (Molecular Devices, Sunnyvale, USA) software tool. 
GSE16946	The secondary analysis is subsequently conducted using the data from the primary analysis. Therefore, data from different scans is first searched for saturation effects, which are eliminated. A locally weighted linear regression (Lowess) has been employed as a normalization method in order to account for intensity-dependent effects. Due to the lacking gene replicates on the commercial whole genome array, a t-test could not be applied. Instead, the quotients of respectively two states have been calculated for the assessment of the regulation. A absolute value of log-ratio (to base2) higher than 1 is used as criteria for a regulated gene.
GSE16946	The strain was cultivated in 5L defined medium with glycerol as carbon source in a 7L (total) MBR-bioreactor. When the OD at 600 nm reached a value of around 5, the BAD – promoter was induced by adding 1g per litre and OD arabinose to the medium. Samples were taken at –10, 0, 2, 5, 10, 20, 30, 45 and 60 minutes related to point of induction.
GSE16946	time point: 0 minutes related to point of BRP induction
GSE16946	time point: -10 minutes related to point of BRP induction
GSE16946	time point: 10 minutes related to point of BRP induction
GSE16946	time point: 20 minutes related to point of BRP induction
GSE16946	time point: 2 minutes related to point of BRP induction
GSE16946	time point: 30 minutes related to point of BRP induction
GSE16946	time point: 45 minutes related to point of BRP induction
GSE16946	time point: 5 minutes related to point of BRP induction
GSE16946	time point: 60 minutes related to point of BRP induction
GSE16946	Total RNA is extracted from 10^9 cells by phenol-chloroform extraction according to Sambrook et al. and ethanol precipitation with 5M NaCl. Subsequently a DNAse I digest at 37°C for 30 minutes and an additional phenol-chloroform extraction step is performed. Integrity of the total RNA is electrophoretically confirmed using the Agilent 2100 Bioanalyzer. 
GSE16946	Total RNA is extracted from 10^9 cells by phenol-chloroform extraction and ethanol precipitation with 5M NaCl. Subsequently a DNAse I digest at 37°C for 30 minutes and an additional phenol-chloroform extraction step is performed. Integrity of the total RNA is electrophoretically confirmed using the Agilent 2100 Bioanalyzer. 
GSE16973	0 min, 0.8% butanol
GSE16973	0min-1
GSE16973	0min-2
GSE16973	0min-3
GSE16973	0 min, unstressed
GSE16973	195 min, 0.8% butanol
GSE16973	195min-1
GSE16973	195min-2
GSE16973	195min-3
GSE16973	195 min, unstressed
GSE16973	30 min, 0.8% butanol
GSE16973	30min-1
GSE16973	30min-2
GSE16973	30min-3
GSE16973	30 min, unstressed
GSE16973	80 min, 0.8% butanol
GSE16973	80min-1
GSE16973	80min-2
GSE16973	80min-3
GSE16973	80 min, unstressed
GSE16973	Biomass was snap frozen in liquid nitrogen and stored at -80 C prior to extraction with Qiagen RNeasy Midi kits.  RNA integrity was verified with a 2100 Bioanalyzer (Agilent).
GSE16973	Escherichia coli
GSE16973	Feature fluorescence intensities [F532 media-B532 and F635media-B635] were extracted using GenePix Pro 6.0.  Local hybridization and intensity-dependent artifacts were removed with Lowess normalization using Standardization and Normalization of Microarray Data (SNOMAD, http:
GSE16973	Individual clones of E. coli DH1 were grown in M9 MOPS media in 300 mL media in 1 L baffled flasks
GSE16973	strain: E. coli DH1
GSE16973	time: 0 min
GSE16973	time: 195 min
GSE16973	time: 30 min
GSE16973	time: 80 min
GSE16973	treatment: 0.8% n-butanol was added at time 0
GSE17036	81-4420
GSE17036	83-2315
GSE17036	86-1390
GSE17036	86-4220
GSE17036	87-4725
GSE17036	88-1861
GSE17036	88-4299
GSE17036	89-56-196
GSE17036	91-19-172
GSE17036	Data obtained from E. coli O157:H7 microarrays were normalized using the Ratio-based and Lowess methods in Acuity 3.1 (Axon instruments) before analysis. The normalized data for all strains were converted into log2 (Fluor 647
GSE17036	EDL (O157:H7)
GSE17036	Escherichia coli
GSE17036	Escherichia coli O157:H7
GSE17036	Escherichia coli O157:H7 str. EDL933
GSE17036	Escherichia coli O157:H7 str. Sakai
GSE17036	Escherichia coli str. K-12 substr. MG1655
GSE17036	Overnight bacterial culture in BHI broth.
GSE17036	referece: The three genomes contributing to the ORFs on the microarray.
GSE17036	Sakai (O157:H7)
GSE17036	See the paper Variation in the Genomic islands of porcine enteropathogenic Escherichia coli strains of serogroup O45 revealed by comparative genomic hybridization and PCR by Bruant and Zhang et al. 2009
GSE17036	strain: EHEC strain
GSE17036	strain: Porcine EPEC strain O45
GSE17036	strain: Rabbit EPEC strain O103
GSE17036	The cultures were centrifuged at 8000 rpm for 10 minutes and the pellet was dissolved in 15 mL of 10 mM NaCl, 20 mM Tris-HCl (pH 8.0), 1 mM EDTA, 100 μg
GSE17070	Escherichia coli
GSE17070	FRIK2000 Cy3 rep1 vs EDL933 pool Cy5
GSE17070	FRIK2000 Cy3 rep3 vs EDL933 pool Cy5
GSE17070	FRIK2000 Cy5 rep2 vs EDL933 pool Cy3
GSE17070	FRIK2000 Cy5 rep4 vs EDL933 pool Cy3
GSE17070	FRIK966 Cy3 rep1 vs EDL933 pool Cy5
GSE17070	FRIK966 Cy3 rep3 vs EDL933 pool Cy5
GSE17070	FRIK966 Cy5 rep2 vs EDL933 pool Cy3
GSE17070	FRIK966 Cy5 rep4 vs EDL933 pool Cy3
GSE17070	isolate: bovine isolate of e coli o157: H7 FRIK2000 lineage II
GSE17070	isolate: bovine isolate of e coli o157: H7 FRIK966 lineage II
GSE17070	isolate: clinical isolate e coli o157: H7 lineage I
GSE17070	late log phase grown e coli 966 into RNAprotect solution, RNA extracted with qiagen RNA bacteria kits
GSE17070	late log phase grown e coli EDL933 into RNAprotect solution, RNA extracted with qiagen RNA bacteria kits
GSE17070	Microarray data analyses were performed using Acuity 4.0 software. Slides were normalized using standard ratio-based methods. Data were analyzed based upon Log ratio (635
GSE17070	RNA from late log phase E coli EDL933 pooled reference
GSE17070	RNA from late log phase E coli FRIK2000 rep 1
GSE17070	RNA from late log phase E coli FRIK2000 rep 2
GSE17070	RNA from late log phase E coli FRIK2000 rep 3
GSE17070	RNA from late log phase E coli FRIK2000 rep 4
GSE17070	RNA from late log phase E coli FRIK966 rep 1
GSE17070	RNA from late log phase E coli FRIK966 rep 2
GSE17070	RNA from late log phase E coli FRIK966 rep 3
GSE17070	RNA from late log phase E coli FRIK966 rep 4
GSE17070	strain: EDL933
GSE17070	strain: FRIK2000
GSE17070	strain: FRIK966
GSE17074	e.coli , 37°C, 60min
GSE17074	E.coli, 37°C, 60min
GSE17074	E.coli,37°C, 60min
GSE17074	E.coli，37°C，60min 
GSE17074	e.coli , 43°C, 60min
GSE17074	E.coli, 43°C, 60min
GSE17074	E.coli,43°C, 60min
GSE17074	E.coli，43°C，60min 
GSE17074	E. coli heat shock gene expression data using direct labeling method (replicate-1)
GSE17074	E. coli heat shock gene expression data using direct labeling method (replicate-2)
GSE17074	E. coli heat shock gene expression data using PAOD method (replicate-1)
GSE17074	E. coli heat shock gene expression data using PAOD method (replicate-2)
GSE17074	E. coli heat shock gene expression data using random priming method (replicate-1)
GSE17074	E. coli heat shock gene expression data using random priming method (replicate-2)
GSE17074	Escherichia coli
GSE17074	strain: DH5α
GSE17074	The raw data were normalized using a space and intensity-dependant LOWESS program. Data from faint spots were removed, in which the intensity was lower than the average intensity plus 2 standard deviations of the negative controls on the array. For each experimental and control sample, amplification and hybridization were performed by a dye-swap strategy in two independent experiments. Differentially expressed genes were identified with at least 2 fold changes and q<0.001 criteria using SAM software .
GSE17074	Total RNA was isolated from E.coli cells using NucleoSpin® RNA II kit according to the manufacturers’ instructions (Macherey Nagel, Duren, Germany). RNA samples were examined in a 1.5% denaturing agarose gel, quantitated by absorbance at 260 nm and stored until further use for microarray and RT-PCR verification
GSE17074	Total RNA was isolated from E.coli cells using NucleoSpin® RNA II kit according to the manufacturers’ instructions (Macherey Nagel, Duren, Germany). RNA samples were examined in a 1.5% denaturing agarose gel, quantitated by absorbance at 260 nm and stored until further use for microarray and RT-PCR verification.
GSE1735	DNA detected with GyrA immunoglobulin
GSE1735	Escherichia coli
GSE1735	gyrase binding (ChIP-chip) no. 1
GSE1735	gyrase binding (ChIP-chip) no. 2
GSE1735	gyrase binding (ChIP-chip) no. 3
GSE1735	gyrase binding (ChIP-chip) no. 4
GSE1735	gyrase binding (ChIP-chip) no. 5
GSE1735	gyrase binding (ChIP-chip) no. 6
GSE1735	gyrase binding (ChIP-chip) no. 7
GSE1735	gyrase binding (ChIP-chip) no. 8
GSE1735	Reference Genomic DNA
GSE17420	Acidic Hot Phenol
GSE17420	Cells were grown in Luria Bertani (LB) media at 37C at 200 rpm. Overnight cultures were inoculated with single, independent colonies in triplicate, incubated aerobically overnight at 37oC, and sub-cultured to a starting OD600 of 0.0001. Cultures were harvested at OD600 = 0.3 in exponential phase and at OD600 = 1.5 in stationary phase.
GSE17420	Escherichia coli O157:H7 str. EDL933
GSE17420	Exponential phase culture of EDL933 rpoS mutants in LB at OD600 of 0.3
GSE17420	Exponential phase culture of EDL933 wild type in LB at OD600 of 0.3
GSE17420	Exp-rpoS-rep1
GSE17420	Exp-rpoS-rep2
GSE17420	Exp-rpoS-rep3
GSE17420	Exp-WT-rep1
GSE17420	Exp-WT-rep2
GSE17420	Exp-WT-rep3
GSE17420	GCRMA method
GSE17420	genotype: rpoS
GSE17420	genotype: WT
GSE17420	growth phase: Exponential
GSE17420	growth phase: Stationary
GSE17420	Stationary phase culture of EDL933 rpoS mutants in LB at OD600 of 1.5
GSE17420	Stationary phase culture of EDL933 wild type in LB at OD600 of 1.5
GSE17420	Stat-rpoS-rep1
GSE17420	Stat-rpoS-rep2
GSE17420	Stat-rpoS-rep3
GSE17420	Stat-WT-rep1
GSE17420	Stat-WT-rep2
GSE17420	Stat-WT-rep3
GSE17441	agent: no triclosan
GSE17441	agent: triclosan
GSE17441	E. coli imp fabI(G93V) [control]
GSE17441	E. coli imp fabI(G94V) [control]
GSE17441	Escherichia coli
GSE17441	imp mutation: contains a 23 codon deletion allele in imp (increased membrane permeability),substitution of the 93th codon of fabI, NTG treatment; fabI(G93V), substitution of Gly(the 93th codon) of fabI with Val, NTG treatment to be high resistance to triclosan
GSE17441	imp mutation: contains a 23 codon deletion allele in imp (increased membrane permeability),substitution of the 94th codon of fabI, NTG treatment; fabI(G93V), substitution of Gly(the 94th codon) of fabI with Val, NTG treatment to be high resistance to triclosan
GSE17441	imp mutation: contains a 23 codon detion allele in imp (increased membrane permeability),substitution of the 93th codon of fabI; fabI(G93V), substitution of Gly(the 93th codon) of fabI with Val
GSE17441	imp mutation: contains a 23 codon detion allele in imp (increased membrane permeability),substitution of the 94th codon of fabI; fabI(G93V), substitution of Gly(the 94th codon) of fabI with Val
GSE17441	LOWESS normalized, background subtracted data obtained from log2 of processed Red signal
GSE17441	No triclosan treatment
GSE17441	NTG-treated E. coli imp fabI(G93V) [E. coli IFN4]
GSE17441	NTG-treated E. coli imp fabI(G93V) [E. coli IFN5]
GSE17441	ntg treatment: yes
GSE17441	passage: 4
GSE17441	strain: E. coli imp 4231(G93V)
GSE17441	strain: E. coli imp 4231(G93V), substitution of the 93th codon of fabI
GSE17441	strain: E. coli imp 4231(G93V), substitution of the 94th codon of fabI
GSE17441	The cells were cultivated in 100 ml LB broth containing 2 mg
GSE17441	Total RNA extracted using RNAprotect Bacterial Reagent (Qiagen) and an RNeasy Mini kit (Qiagen).
GSE17441	Transcription profiles of NTG-treated E. coli imp fabI(G93V) and its control strain in the absence of triclosan
GSE17441	Transcription profiles of NTG-treated E. coli imp fabI(G93V) and its control strain in the presence of triclosan
GSE17441	Treatment of sub-lethal triclosan; 50 mg
GSE17467	5mL of culture was mixed with 5mL of hot acid phenol:chloroform. Samples were held at 65ºC with periodic shaking for at least 10 minutes before centrifuging at 4000 rpm for 20 min. Supernatant was extracted again with acid-phenol:chloroform and then with chloroform:isoamyl alcohol (24.1). RNA was precipitated overnight at –80ºC in 2.5V 100% ethanol and 1
GSE17467	EcJR-8 grown to OD600 = 0.5 in DMEM-MOPS 0.4% glucose at a 10:1 flask-to-media volume in a rotary shaker (180 RPM).
GSE17467	EcJR-8 grown to OD600 = 1.8 in DMEM-MOPS 0.4% glucose at a 10:1 flask-to-media volume in a rotary shaker (180 RPM).
GSE17467	Escherichia coli O157:H7 str. Sakai
GSE17467	genotype: rpoN mutant (EcJR-8)
GSE17467	genotype: wild type
GSE17467	growth protocol: logarithmic phase in DMEM-MOPS
GSE17467	growth protocol: transition phase in DMEM-MOPS
GSE17467	Logarithmic phase sample 1
GSE17467	Logarithmic phase sample 2
GSE17467	Logarithmic phase sample 3
GSE17467	Logarithmic phase sample 4
GSE17467	rpoN mutant grown to logarithmic phase
GSE17467	rpoN mutant grown to transition phase
GSE17467	Sakai grown to OD600 = 1.8 in DMEM-MOPS 0.4% glucose at a 10:1 flask-to-media volume in a rotary shaker (180 RPM).
GSE17467	The microarray data were analyzed using R (v. 2.2.1) and the MAANOVA (v. 0.98.8) package. Raw intensity values from replicate probes were averaged and log2 transformed after normalization with the pin-tip LOWESS method. The normalized intensity values were fitted to a mixed model ANOVA considering array and biological replicates as random factors and dye, strain and growth phase as fixed factors. The linear model tested was Y (intensity) = array + dye + strain (wild type or mutant) + growth phase (exponential or stationary) + strain*growth phase + sample (biological replicate) + error. Significant differences in expression due to strain, growth phase and strain*growth phase were determined using the Fs test in MAANOVA which uses a shrinkage estimator for gene-specific variance components that makes no assumption about the variances across genes with 500 random permutations to estimate the p-values. The q-value package in R was used for determining the false discovery rate (FDR).
GSE17467	Transition phase sample 1
GSE17467	Transition phase sample 2
GSE17467	Transition phase sample 3
GSE17467	Transition phase sample 4
GSE17467	wild type grown to logarithmic phase
GSE17467	wild type grown to transition phase
GSE17506	E. coli, 1-h, serine hydroxamate
GSE17506	Escherichia coli
GSE17506	Fifteen mL fermentation broth was used for each RNA extraction. Harvested cells were rapidly cooled in a -80°C ethanol bath, then centrifuged at 5000 g for seven minutes at 4°C. The supernatant was discarded. The cell pellet was frozen at -80°C. Thawed (on ice) cell pellets were suspended in 150 mL of TE buffer (10 mM Tris-HCl, pH 7.6, 0.1 mM EDTA) containing 0.75 mg
GSE17506	Microarray suit 5.0 (Affymetrix Inc.) was used to average the scans and process the data, further data analysis was conducted using Affymetrix® Data Mining Tool (DMT 3.0).
GSE17506	One set of fermentations were exposed to 5 mM IPTG and one set was not exposed to IPTG.  Samples were taken 0, 1, and 4 hours post-synchronization (Time S0, S1, and S4).
GSE17506	plasmid: pPROEx-CAT
GSE17506	Recombinant, high cell density, Time 0, no IPTG
GSE17506	Recombinant, high cell density, Time 1 h, 5 mM IPTG
GSE17506	Recombinant, high cell density, Time 1 h, no IPTG
GSE17506	Recombinant, high cell density, Time 4 h, no IPTG
GSE17506	Recombinant, high cell density, Time S0, no IPTG, 1
GSE17506	Recombinant, high cell density, Time S0, no IPTG, 2
GSE17506	Recombinant, high cell density, Time S0, no IPTG, 3
GSE17506	Recombinant, high cell density, Time S1, IPTG, 1
GSE17506	Recombinant, high cell density, Time S1, IPTG, 2
GSE17506	Recombinant, high cell density, Time S1, IPTG, 3
GSE17506	Recombinant, high cell density, Time S1, no IPTG, 1
GSE17506	Recombinant, high cell density, Time S1, no IPTG, 2
GSE17506	Recombinant, high cell density, Time S1, no IPTG, 3
GSE17506	Recombinant, high cell density, Time S4, no IPTG, 1
GSE17506	Recombinant, high cell density, Time S4, no IPTG, 2
GSE17506	Recombinant, high cell density, Time S4, no IPTG, 3
GSE17506	Serine Hydroxamate stressed, replicate #1
GSE17506	Serine Hydroxamate stressed, replicate #2
GSE17506	Serine Hydroxamate stressed, replicate #3
GSE17506	Serine hydrxamate (100 mg
GSE17506	strain: MG1655
GSE17506	The strain Escherichia coli MG1655 [pPROEx-CAT] was cultured in a fed-batch fermenter in LB media w
GSE17506	The strain MG1655 [pPROEx-CAT] was cultured in a fed-batch fermenter in LB media w
GSE17517	1A 1y
GSE17517	1A 4y
GSE17517	1A T0
GSE17517	2A 1y
GSE17517	2A 4y
GSE17517	3A 1m
GSE17517	3A 1y
GSE17517	3A 4y
GSE17517	4A 1m
GSE17517	4A 1y
GSE17517	4A 4y
GSE17517	5A 1m
GSE17517	6A 1m
GSE17517	9A 3y
GSE17517	9A 5y
GSE17517	9A T0
GSE17517	Alert
GSE17517	Archaea
GSE17517	Bacteria
GSE17517	Bio1 1m
GSE17517	Bio1 1y
GSE17517	Bio2 1m
GSE17517	Bio2 1y
GSE17517	Bio3 1m
GSE17517	Bio3 1y
GSE17517	Bio4 1m
GSE17517	Bio4 1y
GSE17517	Bio-6
GSE17517	Bio Contro
GSE17517	bioremediation treatment: Alert (ex situ)
GSE17517	bioremediation treatment: Eureka (in situ)
GSE17517	BZNT
GSE17517	CompA
GSE17517	CompB
GSE17517	contamination status: hydrocarbon contaminated
GSE17517	Escherichia coli
GSE17517	Eureka
GSE17517	Lambda phage
GSE17517	NFNT
GSE17517	phage: Lambda
GSE17517	Poly
GSE17517	sample: 1A
GSE17517	sample: 23S
GSE17517	sample: 2A
GSE17517	sample: 32D
GSE17517	sample: 33D
GSE17517	sample: 35B
GSE17517	sample: 3A
GSE17517	sample: 4A
GSE17517	sample: 5A
GSE17517	sample: #6
GSE17517	sample: 6A
GSE17517	sample: 9A
GSE17517	sample: Bio-1
GSE17517	sample: Bio-2
GSE17517	sample: Bio-3
GSE17517	sample: Bio-4
GSE17517	sample: Biopile control
GSE17517	sample: BZ-NT
GSE17517	sample: Composite A
GSE17517	sample: Composite B
GSE17517	sample: LC-1
GSE17517	sample: NC
GSE17517	sample: NF-NT
GSE17517	sample: Polygons
GSE17517	sample: Vegetated
GSE17517	Soil DNA was extracted from a 0.5g soil sub-sample using the MoBio DNA Power Soil kit (MoBio Laboratories, Carlsbad, CA).
GSE17517	The intensity of each spot was measured with ScanArray Express using the histogram quantitation method; the percentile ranges for histograms were 80% for low signal range, 95% for high signal range, 5% for low background range and 20% for high background range. The median intensity minus the median background intensity was used for further calculations performed in Microsoft Excel. The background measurement refers to the local spot background intensity. Prior to normalization, all spots with a Signal-to-Noise ratio (SNR) lower than 3 were removed. The SNR was calculated using the following formula: (Median Signal – Median Background)
GSE17517	year: 2000
GSE17517	year: 2001
GSE17517	year: 2003
GSE17517	year: 2004
GSE17517	year: 2005
GSE17517	year: 2006
GSE17517	year: 2007
GSE17517	year: 2008
GSE17519	0.5% (w
GSE17519	0% sodiumbenzoate_0min
GSE17519	0% sodiumbenzoate_15min
GSE17519	0% sodiumbenzoate_30min
GSE17519	0% sodiumbenzoate_5min
GSE17519	0% sodiumbenzoate_60min
GSE17519	Affymetrix Microarray Suite
GSE17519	Cells were incubated at 37C prior to extraction
GSE17519	E.coliO157_0.5% (w
GSE17519	E.coliO157_0%sodiumbenzoate_0min_rep1
GSE17519	E.coliO157_0%sodiumbenzoate_0min_rep2
GSE17519	E.coliO157_0%sodiumbenzoate_15min_rep1
GSE17519	E.coliO157_0%sodiumbenzoate_15min_rep2
GSE17519	E.coliO157_0%sodiumbenzoate_30min_rep1
GSE17519	E.coliO157_0%sodiumbenzoate_30min_rep2
GSE17519	E.coliO157_0%sodiumbenzoate_5min_rep1
GSE17519	E.coliO157_0%sodiumbenzoate_5min_rep2
GSE17519	E.coliO157_0%sodiumbenzoate_60min_rep1
GSE17519	E.coliO157_0%sodiumbenzoate_60min_rep2
GSE17519	Escherichia coli O157:H7 str. EDL933
GSE17519	growth phase: stationary
GSE17519	One hundred µl tris-EDTA buffer (10 mM Tris-Cl, 1 mM EDTA, ph 8.0; Promega; Madison, WI) containing lysozyme (3 mg
GSE17519	Stationary phase growth (24hr) ~8 log CFU
GSE17519	The RNeasy Mini Purification Kit (Qiagen; Valencia, CA) was used to extract total RNA from E. coli O157:H7 cultures.  RNAlater Stabilization Reagent (1.2 ml) (Qiagen; Valencia, CA) was combined with 0.6 ml E. coli O157:H7.  After 10 min at room temperature, the mixture was centrifuged at 8000 x g for 10 min under refrigeration.  The supernatant was decanted and the bacterial pellet was stored at -70°C until further processed (2-10 h).
GSE17568	0.5 hour expression of synthetic protein DX in E. coli
GSE17568	1.5 hour expression of synthetic protein DX in E. coli
GSE17568	1 hour expression of synthetic protein DX in E. coli
GSE17568	2 hour expression of synthetic protein DX in E. coli
GSE17568	3.5 hour expression of synthetic protein DX in E. coli
GSE17568	3 hour expression of synthetic protein DX in E. coli
GSE17568	4 hour expression of synthetic protein DX in E. coli
GSE17568	According to Invitrogen PureLink Micro-to-Midi Total RNA Purification System
GSE17568	Data was processed by MATLAB to median normalize each channel and lowess normalize the sample set.
GSE17568	E. coli cells containing a pBAD18 vector encoding synthetic protein DX exposed to arabinose inducer for 0.5h.  RNA extracted with Invitrogen PureLink kit.
GSE17568	Escherichia coli
GSE17568	Identical to Channel 1 with no arabinose added
GSE17568	reference: E. coli TOP10 containing pBAD18 vector with no arabinose added
GSE17568	RNA from E. coli 0.5 hours after inoculation
GSE17568	RNA from E. coli 1.5 hours after inoculation
GSE17568	RNA from E. coli 2 hours after inoculation
GSE17568	RNA from E. coli 3.5 hours after inoculation
GSE17568	RNA from E. coli 3 hours after inoculation
GSE17568	RNA from E. coli 4 hours after inoculation
GSE17568	RNA from E. coli expressing synthetic protein DX for 0.5 hours
GSE17568	RNA from E. coli expressing synthetic protein DX for 1.5 hours
GSE17568	RNA from E. coli expressing synthetic protein DX for 1 hours
GSE17568	RNA from E. coli expressing synthetic protein DX for 2 hours
GSE17568	RNA from E. coli expressing synthetic protein DX for 3.5 hours
GSE17568	RNA from E. coli expressing synthetic protein DX for 3 hours
GSE17568	RNA from E. coli expressing synthetic protein DX for 4 hours
GSE17568	test: E. coli TOP10 containing pBAD18 vector exposed to arabinose inducer
GSE17853	cell type: biofilm
GSE17853	Escherichia coli K-12
GSE17853	growth protocol: biofilm grown on glass wool, 37C
GSE17853	MAS 5.0 Expression Analysis Default Setting
GSE17853	medium: LB
GSE17853	pCA24N-hns biofilm
GSE17853	pCA24N-hnsK57N biofilm
GSE17853	strain: BW25113 hha hns 
GSE17853	The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) for forming biofilm. After incubation for 7 h at 37°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104).
GSE17853	time: 7 hours
GSE17991	Adapted E. coli (DST160, tolerant to high succinic acid concentration)
GSE17991	E. coli W3110 (control)
GSE17991	Escherichia coli str. K-12 substr. W3110
GSE17991	High succinic acid tolerance E.coli_rep Dn
GSE17991	High succinic acid tolerance E.coli_rep Up
GSE17991	sample type: control
GSE17991	sample type: test
GSE17991	Scanned images were analyzed with GenePix Pro 3.0 software (Axon Instruments, Union City, CA) to obtain gene expression ratios. Logged gene expression ratios were normalized by LOWESS regression (Yang et al., 2002) using the GeneSpring GX 7.3 software (Agilent Technologies).
GSE17991	The medium for continuous culture contained 3 g glucose medium consisted with 0.8 g NH4Cl, 0.5 g NaCl, 7.5 g Na2HPO4•2H2O, 3 g KH2PO4 with separately added trace element of 0.2 g MgSO4•7H2O, 0.1 g CaCl2, 1 mg thiamine per liter and the concentraiton of added succinate gradually was raised from 30 g
GSE17991	The medium for continuous culture contained 3 g glucose medium consisted with 0.8 g NH4Cl, 0.5 g NaCl, 7.5 g Na2HPO4•2H2O, 3 g KH2PO4 with separately added trace element of 0.2 g MgSO4•7H2O, 0.1 g CaCl2, 1 mg thiamine per liter.  The fermentor was maintained at 37℃, 350 rpm with air gas flushing and the feeding and outlet pumps were maintained at flow rate of 0.1 h-1.
GSE17991	The medium for continuous culture contained 3 g glucose medium consisted with 0.8 g NH4Cl, 0.5 g NaCl, 7.5 g Na2HPO4•2H2O, 3 g KH2PO4 with separately added trace element of 0.2 g MgSO4•7H2O, 0.1 g CaCl2, 1 mg thiamine per liter.  The fermentor was maintained at 37℃, 350 rpm with air gas flushing and the feeding and outlet pumps were maintained at flow rate of 0.1 h-1. 
GSE17991	Transcriptome of cells was prepared using a RNA extraction kit (RNeasy mini kit;Qiagen, Hilden, Germany)
GSE18059	Biofilms were grown on nylon membranes using agar as the source of nutrients and water.  Aliquots of 10 ml Luria agar were transferred to petri dishes to produce layers of agar approximately 3 mm in depth.  Nylon membrane filters (47 mm diameter) with a 0.2 μm pore size (Whatman) were autoclaved in Milli-Q water, dried and placed on the agar surface.  A 100 μl aliquot of an overnight culture (approximately 108 cells) was applied to the membrane as a single spot and allowed to dry.  All of these steps were performed on a level table so as not to introduce unwanted gradients.  Dishes were then inverted and incubated at 37 oC for 24 h.
GSE18059	Biofilms were individually removed from the incubator and, using a small scalpel blade and sterile forceps, the distinctive outer perimeter of biofilm growth was cut away from the rest of the biofilm.  The two resulting sections of membrane were submerged in separate volumes of RNAprotect Bacteria Reagent and vortexed to release the cells.  The sections of membrane were then removed from the resulting suspension before RNA extraction.
GSE18059	Cells were harvested by centrifugation at 5,000 g for 5 min.  Total RNA was purified using the RNeasy Mini kit (Qiagen) according to the supplier’s protocol (the composition of the RNeasy solutions are unknown).  The supernatant was decanted and 200 μl of TE buffer (10 mM Tris, 1 mM EDTA in DEPC-treated water, pH 8) plus lysosyme (Sigma) was used to resuspend the pellet.  This was mixed vigorously and incubated with intermittent shaking for 5 min at room temperature.  Buffer RLT (700 μl) with β-mercaptoethanol (10 μl of 14.3 M β-mercaptoethanol per 1 ml RTL) was then added to the solution.  The lysate was then mixed with 500 μl of absolute ethanol before applying the solution to an RNeasy Mini column.  This was then centrifuged for 15 s at 8,000 x g.  Buffer RW1 (700 μl) was applied to the column and centrifuged to wash the RNA.  At this point an RNase-free DNase on-column digest (Qiagen) was carried out, before the wash process was repeated twice with 500 μl of RPE buffer.  The RNA was eluted twice in one 30 μl volume of RNase-free water and stored at -70 oC.
GSE18059	Colony Biofilm Replicate 1
GSE18059	Colony Biofilm Replicate 2
GSE18059	Colony Biofilm Replicate 3
GSE18059	Colony Biofilm Replicate 4
GSE18059	Escherichia coli
GSE18059	Escherichia coli Colony Biofilm Interior
GSE18059	Escherichia coli Colony Biofilm Perimeter
GSE18059	strain: TG-1
GSE18059	strain: TG-2
GSE18059	The average fluorescent signal intensity and local background correction for each spot were obtained using commercially available software from Biodiscovery Inc (Imagene, version 4.0 and Genesight, version 3.5).  Spots with a signal intensity lower than the background signal or those with blemishes were omitted from subsequent analysis.  The mean values from each channel were then log2 transformed and normalised using the LOWESS method to remove intensity-dependent effects in the log2 (ratios) values.  The Cy3
GSE18183	A-stat gene expression changes 0.3
GSE18183	A-stat gene expression changes 0.47
GSE18183	Escherichia coli
GSE18183	Escherichia coli K12 MG1655 were grown in M9 minimal medium with 10 g
GSE18183	specific growth rate: 0.3 h-1
GSE18183	Specific growth rate 0.3 h-1
GSE18183	specific growth rate: 0.47 h-1
GSE18183	Specific growth rate 0.47 h-1
GSE18183	Spot intensities and corresponding background signals were quantified with Genepix Pro (version 6; Axon Instruments [http:
GSE18183	strain: Escherichia coli K12 MG1655
GSE18183	Total RNA was extracted using RNeasy Mini Kit (QIAGEN, Valencia, CA) and the genomic DNA was removed using RNase-Free DNase Set (QIAGEN).
GSE19053	After collecting 50 ml culture as ‘non crosslinked’ sample, the rest of the cells was crosslinked.Crosslinked and non crosslinked cells were washed and sonicated. 400 µl of the sonicated extracts were mixed with 400 µl TE buffer and incubated with 2 µl RNase A (20 mg
GSE19053	Cells were grown at 37 °C to an OD600 of about 0.15 in 100 ml LB (+ 0.2% glucose).
GSE19053	Cells were grown at 37 °C to an OD600 of about 0.15 in 50 ml LB (+ 0.2% glucose) before crosslinking.
GSE19053	Cells were grown in 65 ml LB medium at 30 °C to an OD600 of about 0.3. Subsequently 30 ml of culture were transformed to a pre warmed flask at 43 °C and the remainder kept at 30 °C (see control sample).
GSE19053	Cells were grown in 65 ml LB medium at 30 °C to an OD600 of about 0.3. Subsequently 30 ml of culture were transformed to a pre warmed flask at 43 °C (see heat sample) and the remainder kept at 30 °C.
GSE19053	chip antibody: none
GSE19053	chip antibody: RNA polymerase subunit β
GSE19053	chip antibody: SeqA
GSE19053	chip antibody: σ32
GSE19053	Crosslink
GSE19053	Crosslinked
GSE19053	Cultures of E. coli MG1655 and its derivates were cross linked by addition of 27 µl of formaldehyde (37%) per ml medium (final concentration 1%). Crosslinking was performed at slow shaking (100 rpm) for 20 min followed by quenching with 0.2 ml of 2.5 M glycine per ml medium (final concentration 0.5 M). Cells were collected by centrifugation and washed twice with cold TBS (pH7.5). After resuspension in 1 ml lysis buffer (10mM Tris (pH 8.0), 20% sucrose, 50mM NaCl, 10mM EDTA, 10 mg
GSE19053	Escherichia coli str. K-12 substr. MG1655
GSE19053	fraction: input DNA
GSE19053	fraction: input DNA, SeqA ChIP supernatant
GSE19053	fraction: input DNA, σ32 ChIP supernatant
GSE19053	genotype: wildtype
GSE19053	genotype: ΔseqA
GSE19053	Input DNA from E. Coli MG1655
GSE19053	Input DNA from E. Coli MG1655 ΔseqA
GSE19053	Input DNA from SeqA ChIP supernatant
GSE19053	Input DNA from ΔseqA-SeqA ChIP supernatant
GSE19053	Input DNA from σ32 ChIP supernatant
GSE19053	Non-crosslinked DNA
GSE19053	RNAP ChIP DNA, old protocol
GSE19053	RNAP old rep1
GSE19053	RNAP old rep2
GSE19053	SeqA ChIP DNA, new protocol
GSE19053	SeqA ChIP DNA, old protocol
GSE19053	SeqA new deltaSeqA
GSE19053	SeqA new rep1
GSE19053	SeqA new rep2
GSE19053	SeqA old deltaSeqA
GSE19053	SeqA old rep1
GSE19053	SeqA old rep2
GSE19053	Spot intensities were extracted using the Feature Extraction software 10.5.1.1 from Applied Biosystems with a linear dye normalization correction method. The gProcessedSignal and rProcessedSignal was used for further analysis with the statistics software R. Ratios of g (sample) to r (control) were calculated after background substraction and normalized to the array wide average. Data points with a value below 0 after background subtraction were set 'null'. Data points form non-unique regions on the chromosome were excluded from analysis.
GSE19053	strain: MG1655
GSE19053	strain: MG1655 ΔseqA
GSE19053	σ32 30°C rep1
GSE19053	σ32 30°C rep2
GSE19053	σ32 30°C short RNase
GSE19053	σ32 43°C rep1
GSE19053	σ32 43°C rep2
GSE19053	σ32 43°C short RNase
GSE19053	σ32 ChIP DNA, control
GSE19053	σ32 ChIP DNA, heat
GSE19053	σ32 ChIP DNA, short RNase digestion
GSE19742	At OD600~0.3, serine hydroxamate was added to a final concentration of 0.5mg
GSE19742	Cells were grown in M9 medium supplemented with 0.2% glucose and 0.4% casamino acid at 37℃
GSE19742	Delta dksA Cells
GSE19742	Delta dksA Cells Replicate 1
GSE19742	Delta dksA Cells Replicate 2
GSE19742	Delta dksA Cells Replicate 3
GSE19742	Escherichia coli str. K-12 substr. MG1655
GSE19742	GenePix Pro (v 6.1) was used for background subtraction and normalization.
GSE19742	growth stage: log phase
GSE19742	pooled reference RNA
GSE19742	RNA was extracted using QIAGEN RNeasy Mini Kit following manufacturer's instructions.
GSE19742	SHX-treated Delta dksA Cells
GSE19742	SHX-treated Delta dksA Cells Replicate 1
GSE19742	SHX-treated Delta dksA Cells Replicate 2
GSE19742	SHX-treated Delta dksA Cells Replicate 3
GSE19742	SHX-treated Wild-type Cells
GSE19742	SHX-treated Wild-type Cells Replicate 1
GSE19742	SHX-treated Wild-type Cells Replicate 2
GSE19742	SHX-treated Wild-type Cells Replicate 3
GSE19742	strain: MG1655 delta lac
GSE19742	strain: MG1655 delta lac delta dksA
GSE19742	strain: MG1655 delta lac + MG1655 delta lac delta dksA
GSE19742	treatment: 0.5mg
GSE19742	treatment: No treatment
GSE19742	treatment: Pooled RNA from mixture of the same amount of wt, wt+SHX, dksA, dksA+SHX RNA samples
GSE19742	Wild-type Cells
GSE19742	Wild-type Cells Replicate 1
GSE19742	Wild-type Cells Replicate 2
GSE19742	Wild-type Cells Replicate 3
GSE19841	Biotinylated GST protein
GSE19841	Escherichia coli
GSE19841	GSH-sepharose 4b purification
GSE19841	GST control Protoarray replicate 1
GSE19841	protein: GST expressed in E. coli BL21(DE3) from pGEX-4T-3
GSE19841	purification: Protein purified using GSH-sepharose 4b (GE Life Sciences)
GSE19841	Scanned spot signals were normalized using internal Protoarray control proteins and Z scores subsequently determined based on comparisons of mean signals for each spot pair to the mean spot intensity for the array. Z scores greater than 3.0 were considered significant
GSE19842	After the final wash & staining step, Affymetrix GeneChip® E.coli Genome array was scanned using Affymetrix Model 3000 G7 scanner and the image data was extracted through Affymetrix Commnad Console software. The raw .cel file generated through above procedure meant expression intensity data and was used for the next step.
GSE19842	EDL 933 at 37oC at OD 1.0
GSE19842	EDL 933 with 0.1 mg
GSE19842	Escherichia coli
GSE19842	Expression data were normalized using the Affymetrix microarray suite 5(MAS5) algorithm implemented in Affymetrix expression console software .  To reduce noise for the significance analysis, probe sets that did not show detection call rate at least 50% of the samples in the comparison were filtered out. Highly expressed genes that showed a 2-fold change in expression were selected. 
GSE19842	(http:
GSE19842	strain: EDL 933
GSE19842	The web-based tool, DAVID (the Database for Annotation, Visualization, and Integrated Discovery) was used to perform the biological interpretation of differentially expressed genes. Then, these genes were classified based on the information of gene function in Gene ontology database. 
GSE19842	Total RNA was isolated using Ribopure Bacteria Kit as described by the manufacturer (Ambion, Huntingdon, UK). RNA quality was assessed by Agilent 2100 bioanalyser using the RNA 6000 Nano Chip (Agilent Technologies, Amstelveen, The Netherlands), and quantity was determined by ND-1000 Spectrophotometer (NanoDrop Technologies, Inc., DE, USA).
GSE19879	Cells harvested at mid-exponential phase, spun, washed twice with M9 medium and shifted to limiting or no thymine medium. Samples taken at listed intervals.
GSE19879	E. coli - 0 min before nutrient shift
GSE19879	E. coli - 15 min after shift to limiting medium
GSE19879	E. coli - 15 min after shift to thymineless medium
GSE19879	E. coli - 30 min after shift to limiting medium
GSE19879	E. coli - 30 min after shift to thymineless medium
GSE19879	E. coli - 45 min after shift to limiting medium
GSE19879	E. coli - 45 min after shift to thymineless medium
GSE19879	E. coli - 60 min after shift to limiting medium
GSE19879	E. coli - 60 min after shift to thymineless medium
GSE19879	E. coli - 90 min after shift to limiting medium
GSE19879	E. coli - 90 min after shift to thymineless medium
GSE19879	E. coli MG1655 thyA- cells grown in M9 minimal medium + 0.2% glucose and 20 ug
GSE19879	Escherichia coli
GSE19879	Lowess normalized data. Resultant data is log2 normalized.
GSE19879	strain: MG1655 thyA-
GSE19879	TLD-15-rep1
GSE19879	TLD-15-rep2
GSE19879	TLD-30-rep1
GSE19879	TLD-30-rep2
GSE19879	TLD-45-rep1
GSE19879	TLD-45-rep2
GSE19879	TLD-60-rep1
GSE19879	TLD-60-rep2
GSE19879	TLD-90-rep1
GSE19879	TLD-90-rep2
GSE19879	TLM-15
GSE19879	TLM-30
GSE19879	TLM-45
GSE19879	TLM-60
GSE19879	TLM-90
GSE19879	Total RNA extracted using QIAGEN RNeasy kit according to manufacturer's instructions
GSE19953	Channel 1
GSE19953	E. coli O157:H7 86-24 in LB at 37oC at OD 4.0
GSE19953	E. coli O157:H7 86-24 was inoculated in 25 ml of LB in 250 ml shake flasks with overnight cultures that were diluted 1:100. Cells were shaken at 250 rpm and 37°C for an absorbance of 4.0 at 600 nm.  Cells were immediately chilled with dry ice and 95% ethanol (to prevent RNA degradation) for 30 sec before centrifugation at 13,000 g for 2 min; cell pellets were frozen immediately with dry ice and stored -80°C.  RNA was isolated using Qiagen RNeasy mini Kit (Cat# 74104).
GSE19953	E. coli O157:H7 EDL933 in LB at 37oC at OD 4.0
GSE19953	E. coli O157:H7 EDL933 was inoculated in 25 ml of LB in 250 ml shake flasks with overnight cultures that were diluted 1:100. Cells were shaken at 250 rpm and 37°C for an absorbance of 4.0 at 600 nm.  Cells were immediately chilled with dry ice and 95% ethanol (to prevent RNA degradation) for 30 sec before centrifugation at 13,000 g for 2 min; cell pellets were frozen immediately with dry ice and stored -80°C.  RNA was isolated using Qiagen RNeasy mini Kit (Cat# 74104).
GSE19953	Escherichia coli
GSE19953	MAS 5.0 Expression Analysis Default Setting
GSE19953	strain: 86-24
GSE19953	strain: EDL933
GSE20305	All cultures were grown aerobically in a thermostatically controlled 37oC culture room. Cultures (150ml culture volume) were stirred by magnetic stirrers at 330 rpm (Thermo Scientific Variomag Multipoint 6in) 1000ml Erlenmeyer flask. Starting cultures were inoculated from a single colony and grown overnight. Each experimental culture was then inoculated from such an overnight culture at a dilution of 1:20 into 150 ml fresh MOPS minimal medium in a 1000 ml flask. The minimal medium used for all experiments was a modification of MOPS (morpholinopropane sulfonate) minimal medium obtained from Teknova, CA (product number M2006) which contains 86 mM NaCl, 9.5 mM NH4Cl, 5 mM K2HPO4 and 0.2% glucose.
GSE20305	coli_coldstress_timepoint1_rep1
GSE20305	coli_coldstress_timepoint1_rep2
GSE20305	coli_coldstress_timepoint1_rep3
GSE20305	coli_coldstress_timepoint2_rep1
GSE20305	coli_coldstress_timepoint2_rep2
GSE20305	coli_coldstress_timepoint2_rep3
GSE20305	coli_coldstress_timepoint3_rep1
GSE20305	coli_coldstress_timepoint3_rep2
GSE20305	coli_coldstress_timepoint3_rep3
GSE20305	coli_coldstress_timepoint4_rep1
GSE20305	coli_coldstress_timepoint4_rep2
GSE20305	coli_coldstress_timepoint4_rep3
GSE20305	coli_coldstress_timepoint5_rep1
GSE20305	coli_coldstress_timepoint5_rep2
GSE20305	coli_coldstress_timepoint5_rep3
GSE20305	coli_coldstress_timepoint6_rep1
GSE20305	coli_coldstress_timepoint6_rep2
GSE20305	coli_coldstress_timepoint6_rep3
GSE20305	coli_coldstress_timepoint7_rep1
GSE20305	coli_coldstress_timepoint7_rep2
GSE20305	coli_coldstress_timepoint7_rep3
GSE20305	coli_coldstress_timepoint8_rep1
GSE20305	coli_coldstress_timepoint8_rep2
GSE20305	coli_coldstress_timepoint8_rep3
GSE20305	coli_control_timepoint1_rep1
GSE20305	coli_control_timepoint1_rep2
GSE20305	coli_control_timepoint1_rep3
GSE20305	coli_control_timepoint2_rep1
GSE20305	coli_control_timepoint2_rep2
GSE20305	coli_control_timepoint2_rep3
GSE20305	coli_control_timepoint3_rep1
GSE20305	coli_control_timepoint3_rep2
GSE20305	coli_control_timepoint3_rep3
GSE20305	coli_control_timepoint4_rep1
GSE20305	coli_control_timepoint4_rep2
GSE20305	coli_control_timepoint4_rep3
GSE20305	coli_control_timepoint5_rep1
GSE20305	coli_control_timepoint5_rep2
GSE20305	coli_control_timepoint5_rep3
GSE20305	coli_control_timepoint6_rep1
GSE20305	coli_control_timepoint6_rep2
GSE20305	coli_control_timepoint6_rep3
GSE20305	coli_control_timepoint7_rep1
GSE20305	coli_control_timepoint7_rep2
GSE20305	coli_control_timepoint7_rep3
GSE20305	coli_control_timepoint8_rep1
GSE20305	coli_control_timepoint8_rep2
GSE20305	coli_control_timepoint8_rep3
GSE20305	coli_heatstress_timepoint1_rep1
GSE20305	coli_heatstress_timepoint1_rep2
GSE20305	coli_heatstress_timepoint1_rep3
GSE20305	coli_heatstress_timepoint2_rep1
GSE20305	coli_heatstress_timepoint2_rep2
GSE20305	coli_heatstress_timepoint2_rep3
GSE20305	coli_heatstress_timepoint3_rep1
GSE20305	coli_heatstress_timepoint3_rep2
GSE20305	coli_heatstress_timepoint3_rep3
GSE20305	coli_heatstress_timepoint4_rep1
GSE20305	coli_heatstress_timepoint4_rep2
GSE20305	coli_heatstress_timepoint4_rep3
GSE20305	coli_heatstress_timepoint5_rep1
GSE20305	coli_heatstress_timepoint5_rep2
GSE20305	coli_heatstress_timepoint5_rep3
GSE20305	coli_heatstress_timepoint6_rep1
GSE20305	coli_heatstress_timepoint6_rep2
GSE20305	coli_heatstress_timepoint6_rep3
GSE20305	coli_heatstress_timepoint7_rep1
GSE20305	coli_heatstress_timepoint7_rep2
GSE20305	coli_heatstress_timepoint7_rep3
GSE20305	coli_heatstress_timepoint8_rep1
GSE20305	coli_heatstress_timepoint8_rep2
GSE20305	coli_heatstress_timepoint8_rep3
GSE20305	coli_lactose_timepoint2_rep1
GSE20305	coli_lactose_timepoint2_rep2
GSE20305	coli_lactose_timepoint2_rep3
GSE20305	coli_lactose_timepoint3_rep1
GSE20305	coli_lactose_timepoint3_rep3
GSE20305	coli_lactose_timepoint4_rep1
GSE20305	coli_lactose_timepoint4_rep2
GSE20305	coli_lactose_timepoint4_rep3
GSE20305	coli_lactose_timepoint5_rep1
GSE20305	coli_lactose_timepoint5_rep2
GSE20305	coli_lactose_timepoint5_rep3
GSE20305	coli_lactose_timepoint6_rep1
GSE20305	coli_lactose_timepoint6_rep2
GSE20305	coli_lactose_timepoint6_rep3
GSE20305	coli_lactose_timepoint7_rep1
GSE20305	coli_lactose_timepoint7_rep2
GSE20305	coli_oxidativestress_timepoint10_rep1
GSE20305	coli_oxidativestress_timepoint10_rep2
GSE20305	coli_oxidativestress_timepoint10_rep4
GSE20305	coli_oxidativestress_timepoint11_rep1
GSE20305	coli_oxidativestress_timepoint11_rep2
GSE20305	coli_oxidativestress_timepoint11_rep4
GSE20305	coli_oxidativestress_timepoint12_rep2
GSE20305	coli_oxidativestress_timepoint1_rep1
GSE20305	coli_oxidativestress_timepoint1_rep2
GSE20305	coli_oxidativestress_timepoint1_rep4
GSE20305	coli_oxidativestress_timepoint2_rep1
GSE20305	coli_oxidativestress_timepoint2_rep2
GSE20305	coli_oxidativestress_timepoint2_rep4
GSE20305	coli_oxidativestress_timepoint3_rep1
GSE20305	coli_oxidativestress_timepoint3_rep2
GSE20305	coli_oxidativestress_timepoint3_rep4
GSE20305	coli_oxidativestress_timepoint4_rep1
GSE20305	coli_oxidativestress_timepoint4_rep2
GSE20305	coli_oxidativestress_timepoint4_rep4
GSE20305	coli_oxidativestress_timepoint5_rep1
GSE20305	coli_oxidativestress_timepoint5_rep2
GSE20305	coli_oxidativestress_timepoint5_rep4
GSE20305	coli_oxidativestress_timepoint6_rep1
GSE20305	coli_oxidativestress_timepoint6_rep2
GSE20305	coli_oxidativestress_timepoint6_rep4
GSE20305	coli_oxidativestress_timepoint7_rep1
GSE20305	coli_oxidativestress_timepoint7_rep2
GSE20305	coli_oxidativestress_timepoint7_rep4
GSE20305	coli_oxidativestress_timepoint8_rep1
GSE20305	coli_oxidativestress_timepoint8_rep2
GSE20305	coli_oxidativestress_timepoint8_rep4
GSE20305	coli_oxidativestress_timepoint9_rep1
GSE20305	coli_oxidativestress_timepoint9_rep2
GSE20305	coli_oxidativestress_timepoint9_rep4
GSE20305	Escherichia coli_stress experiment
GSE20305	Escherichia coli str. K-12 substr. MG1655
GSE20305	For further analyses the processed signal intensities of all coding regions and RNA genes were extracted and used. Variance stabilization and normalization of the extracted intensities were performed with the vsn packages of the R software environment (R Development Core Team, 2007) and back-transformed to normal intensity scale. For each probeset, e.g. all probes representing for example, a single coding gene, outliers were removed by boxplot statistics and the outlier-removed probe intensities were averaged in a robust way by computing the Tukey biweight.
GSE20305	Oxidative stress 200 ug
GSE20305	RNA was extracted using the Qiagen RNeasy Mini Kit (74104) and mechanical cell disruption with glass beads but without enzymatic lysis. This was carried out in the Qiagen RNeasy kit lysis RLT buffer with beta-mercaptethanol, according to the manufacturer’s recommendations. Mechanical cell disruption was completed through shaking for five min using a Retsch mill (Retsch MM200) on maximum speed. RNA was subsequently cleaned on-column with an additional DNase treatment (Qiagen 79254). The quality of extracted RNA was determined with an Agilent 2100 bioanalyzer having used an Agilent RNA 6000 Nano Kit according to the manufacturer’s recommendations.
GSE20305	treatment group: cold stress
GSE20305	treatment group: control
GSE20305	treatment group: heat stress
GSE20305	treatment group: lactose shift
GSE20305	treatment group: oxidative stress
GSE20305	treatment time: T10: 210 min after stress
GSE20305	treatment time: T11: 235 min after stress
GSE20305	treatment time: T12: 260 min after stress
GSE20305	treatment time: T1: OD 0.3
GSE20305	treatment time: T1: OD 0.5
GSE20305	treatment time: T2: OD 0.5
GSE20305	treatment time: T2: OD 0.6
GSE20305	treatment time: T3: 10 min after reaching OD 0.6
GSE20305	treatment time: T3: 10 min after stress
GSE20305	treatment time: T3: OD 0.6
GSE20305	treatment time: T3: OD 0.7
GSE20305	treatment time: T4: 10 min after growth lag
GSE20305	treatment time: T4: 10 min after stress
GSE20305	treatment time: T4: 20 min after reaching OD 0.6
GSE20305	treatment time: T4: 20 min after stress
GSE20305	treatment time: T5: 20 min after growth lag
GSE20305	treatment time: T5: 20 min after stress
GSE20305	treatment time: T5: 30 min after reaching OD 0.6
GSE20305	treatment time: T5: 30 min after stress
GSE20305	treatment time: T6: 30 min after growth lag
GSE20305	treatment time: T6: 30 min after stress
GSE20305	treatment time: T6: 40 min after reaching OD 0.6
GSE20305	treatment time: T6: 40 min after stress
GSE20305	treatment time: T7: 40 min after growth lag
GSE20305	treatment time: T7: 40 min after stress
GSE20305	treatment time: T7: 50 min after reaching OD 0.6
GSE20305	treatment time: T7: 50 min after stress
GSE20305	treatment time: T8: 90 min after reaching OD 0.6
GSE20305	treatment time: T8: 90 min after stress
GSE20305	treatment time: T9: 150 min after stress
GSE20380	bile+1
GSE20380	bile+2
GSE20380	bile+3
GSE20380	ctrl1
GSE20380	ctrl2
GSE20380	ctrl3
GSE20380	E.coli O157:H7 in LB at mid-log phase
GSE20380	Escherichia coli
GSE20380	growth media: LB
GSE20380	growth media: LB; 0.8% bile salts
GSE20380	growth phase: mid-log phase
GSE20380	Hot phenol extraction of total RNA.
GSE20380	O157:H7 cells were grown to mid-log phase in Luria broth with or without 0.8% bile salts.
GSE20380	strain: strain O157:H7
GSE20380	The data were imported into FlexArray using gc-RMA preprocessing for analysis.
GSE20397	8 ml of the culture was mixed with 1
GSE20397	Escherichia coli
GSE20397	serotype: o157:H7 clade 2, stx 1 and 2
GSE20397	serotype: o157:H7 clade 2, stx 2
GSE20397	serotype: o157:H7 clade 8, stx 2
GSE20397	serotype: o157:H7 clade 8, stx 2 and 2c
GSE20397	strains TW014359 vs TW04863 epithelial exposure
GSE20397	strains TW014359 vs TW11037 epithelial exposure
GSE20397	strains TW02883 vs TW11028 epithelial exposure
GSE20397	strains TW04863 vs TW14279 epithelial exposure
GSE20397	strains TW07591 vs TW09098 epithelial exposure
GSE20397	strains TW07937 vs TW11185 epithelial exposure
GSE20397	strains TW07961 vs TW08610 epithelial exposure
GSE20397	strains TW07961 vs TW11029 epithelial exposure
GSE20397	strains TW08030 vs TW10045 epithelial exposure
GSE20397	strains TW08609 vs TW08030 epithelial exposure
GSE20397	strains TW08609 vs TW08623 epithelial exposure
GSE20397	strains TW08609 vs TW11110 epithelial exposure
GSE20397	strains TW08610 vs TW11110 epithelial exposure
GSE20397	strains TW08623 vs TW02883 epithelial exposure
GSE20397	strains TW08623 vs TW08030 epithelial exposure
GSE20397	strains TW08635 vs TW09098 epithelial exposure
GSE20397	strains TW09098 vs TW11308 epithelial exposure
GSE20397	strains TW09189 vs TW11032 epithelial exposure
GSE20397	strains TW09189 vs TW14279 epithelial exposure
GSE20397	strains TW10012 vs TW11037 epithelial exposure
GSE20397	strains TW10012 vs TW14313 epithelial exposure
GSE20397	strains TW10045 vs TW07937 epithelial exposure
GSE20397	strains TW11028 vs TW07937 epithelial exposure
GSE20397	strains TW11028 vs TW11308 epithelial exposure
GSE20397	strains TW11029 vs TW02883 epithelial exposure
GSE20397	strains TW11029 vs TW08610 epithelial exposure
GSE20397	strains TW11032 vs TW04863 epithelial exposure
GSE20397	strains TW11032 vs TW09189 epithelial exposure
GSE20397	strains TW11037 vs TW08635 epithelial exposure
GSE20397	strains TW11110 vs TW10012 epithelial exposure
GSE20397	strains TW11185 vs TW014313 epithelial exposure
GSE20397	strains TW11185 vs TW08635 epithelial exposure
GSE20397	strains TW11308 vs TW07591 epithelial exposure
GSE20397	strains TW14279 vs TW10045 epithelial exposure
GSE20397	strains TW14313 vs TW07591 epithelial exposure
GSE20397	strains TW14359 vs TW07961 epithelial exposure
GSE20397	strain TW02883
GSE20397	strain TW02883 
GSE20397	strain TW04863
GSE20397	strain TW07591
GSE20397	strain TW07937
GSE20397	strain TW07961
GSE20397	strain TW07961 
GSE20397	strain TW08030
GSE20397	strain TW08609
GSE20397	strain TW08609 
GSE20397	strain TW08610
GSE20397	strain TW08623
GSE20397	strain TW08635
GSE20397	strain TW08635 
GSE20397	strain TW09098
GSE20397	strain TW09098 
GSE20397	strain TW09189
GSE20397	strain TW10012
GSE20397	strain TW10045
GSE20397	strain TW10045 
GSE20397	strain TW11028
GSE20397	strain TW11029
GSE20397	strain TW11029 
GSE20397	strain TW11032
GSE20397	strain TW11032 
GSE20397	strain TW11037
GSE20397	strain TW11110
GSE20397	strain TW11110 
GSE20397	strain TW11185
GSE20397	strain TW11185 
GSE20397	strain TW11308
GSE20397	strain TW11308 
GSE20397	strain TW14279
GSE20397	strain TW14279 
GSE20397	strain TW14313
GSE20397	strain TW14359
GSE20397	Thirty-six dye-swap hybridizations were performed between four groups with six strains per group, according to a balanced double loop design.  Strains were grouped based on cladestx profiles and each strain was considered an independent biological replicate of its group (n=6).  The six strains from each group were randomly hybridized with six strains from every other group; each hybridization compared a pair of strains that differed in either clade or stx profile, or both.  Subsequent to local Lowess normalization, averaging of replicate probes and log2 transformation,  the microarray data were fitted to a 2-factor mixed ANOVA model (intensity = Array + Dye + Clade + Stx + Clade:Stx + Sample; where the biological replicate (Sample) and array effects were considered random effects, while all other effects were considered fixed effects), using the MAANOVA package (version 0.98-8) in R software (version 2.2.1).  This model allows independent consideration of the effect of ‘Clade’ (clade divergence) and ‘Stx’ (stx type variation) parameters on differences in gene expression among O157:H7 strains, as well as their interaction (combined) effect (Clade:Stx).  Overall differences in gene expression between groups were determined using the Fs test, followed by pair-wise contrasts to determine significant differential expression between each pair of groups.  Subsequently, the Fs statistic was estimated for the ‘Clade’ effect to determine significant differences in gene expression between clades 8 (n=12) and 2 (n=12), regardless of stx profile.  Similarly, the Fs statistic was estimated for the ‘Stx’ effect as well as the ‘Clade:Stx’ interaction effect to examine the combined effect of clade and stx type on differences in gene expression among O157:H7 strains.  In other words, this analysis will determine whether the expression of any given gene among groups with different stx types is also dependent on clade.  An interaction effect would be observed if expression estimates between strain groups clade8stx2 and clade2stx2 are different from expression estimates between strain groups clade8stx2,2c and clade2stx1,2.  For every analysis, 1000 permutations of the data were performed to generate P values; estimates were considered significant if the P value was < 0.05 after adjusting for multiple comparisons. 
GSE2065	Escherichia coli
GSE2065	-Leu t=0
GSE2065	-Leu t=0 charged
GSE2065	-Leu t=0 total
GSE2065	-Leu t=17
GSE2065	-Leu t=17 charged
GSE2065	-Leu t=17 total
GSE2065	-Leu t=2
GSE2065	-Leu t=2 charged
GSE2065	-Leu t=2 total
GSE2065	-Leu t=32
GSE2065	-Leu t=32 charged
GSE2065	-Leu t=32 total
GSE2065	-Leu t=7
GSE2065	-Leu t=7 charged
GSE2065	-Leu t=7 total
GSE21115	Bear feces isolate B1
GSE21115	Bear feces isolate B3
GSE21115	Bear feces isolate B5
GSE21115	Bear III versus MG1655 technical replicate 1
GSE21115	Bear III versus MG1655 technical replicate 2
GSE21115	Bear II versus MG1655 technical replicate 1
GSE21115	Bear II versus MG1655 technical replicate 2
GSE21115	Bear I versus MG1655 technical replicate 1
GSE21115	Bear I versus MG1655 technical replicate 2
GSE21115	Cattle feces isolate C1A
GSE21115	Cattle feces isolate C4A
GSE21115	Cattle feces isolate C6D
GSE21115	Cattle III versus MG1655 technical replicate 1
GSE21115	Cattle III versus MG1655 technical replicate 2
GSE21115	Cattle II versus MG1655 technical replicate 1
GSE21115	Cattle II versus MG1655 technical replicate 2
GSE21115	Cattle I versus MG1655 technical replicate 1
GSE21115	Cattle I versus MG1655 technical replicate 2
GSE21115	Deer feces isolate D1
GSE21115	Deer feces isolate D3
GSE21115	Deer feces isolate W6A
GSE21115	Deer III versus MG1655 technical replicate 1
GSE21115	Deer III versus MG1655 technical replicate 2
GSE21115	Deer II versus MG1655 technical replicate 1
GSE21115	Deer II versus MG1655 technical replicate 2
GSE21115	Deer I versus MG1655 technical replicate 1
GSE21115	Deer I versus MG1655 technical replicate 2
GSE21115	E. coli K12 MG1655
GSE21115	Escherichia coli
GSE21115	Escherichia coli str. K-12 substr. MG1655
GSE21115	Genomic DNA was extracted using an SDS lysis
GSE21115	Human III versus MG1655 technical replicate 1
GSE21115	Human III versus MG1655 technical replicate 2
GSE21115	Human II versus MG1655 technical replicate 1
GSE21115	Human II versus MG1655 technical replicate 2
GSE21115	Human I versus MG1655 technical replicate 1
GSE21115	Human I versus MG1655 technical replicate 2
GSE21115	Human sewage isolate H1
GSE21115	Human sewage isolate H2
GSE21115	Human sewage isolate H3
GSE21115	Images were analyzed using a combination of GenePix Pro 6.0, the freely available TIGR TM4 software suite (www.tm4.org ) and Microsoft Excel.  Spots with an intensity: background ratio > 1.5 and overall intensity > 350 in the reference channel and an intensity:background ratio of > 1.0 in the experimental channel were considered acceptable for downstream processing.  Local background was subtracted for each spot, the corresponding log2 ratios were normalized using total intensity normalization, and replicate spots were averaged using TIGR MIDAS.  Genes that had missing data (i.e. unacceptable spots) for more than one-third of the samples were excluded from the downstream analysis leaving 3993 ORFs in the final data set.  Each sample was hybridized twice and the results averaged in Microsoft Excel after processing with MIDAS.  A strict cutoff of log2 ratio > 0.9 or < 0.9 was applied for the determination of gene amplifications and gene absences, respectively.
GSE21115	strain: Bear feces isolate B1
GSE21115	strain: Bear feces isolate B3
GSE21115	strain: Bear feces isolate B5
GSE21115	strain: Cattle feces isolate C1A
GSE21115	strain: Cattle feces isolate C4A
GSE21115	strain: Cattle feces isolate C6D
GSE21115	strain: Deer feces isolate D1
GSE21115	strain: Deer feces isolate D3
GSE21115	strain: Deer feces isolate W6A
GSE21115	strain: E. coli K12 MG1655
GSE21115	strain: Human sewage isolate H1
GSE21115	strain: Human sewage isolate H2
GSE21115	strain: Human sewage isolate H3
GSE21341	At time point 0, rifampicin was added to a final concentration of 500ug
GSE21341	E.coli strain, DY330, was grown at 30C in M9 media supplemented with 0.4% glucose, vitamins and amino acids.
GSE21341	Escherichia coli
GSE21341	RNA-Seq
GSE21341	RNA was purified from lysates by phenol
GSE21341	Sequence reads were obtained and mapped to the W3110 genome (NCBI) using the Illumina Genome Analyzer Pipeline. All reads mapping with two or fewer mismatches were retained. Repeated sequences were ignored (rRNA). The counts in each sample was normalized by ssrA RNA and then converted to logarithmic values. A value of 1 was added to every count before the logarithmic conversion to avoid an undefined logarithm of 0. The lifetime was determined from the inverse of the slope of a linear fit to the logarithmic values.
GSE21341	strain: DY330 (W3110)
GSE21341	The measured lifetime of mRNA is available as a supplementary file (real_rna_life.txt) on the Series record.
GSE21341	The RNA was fragmented using Ambion’s Fragmentation Reagent at 70°C for 5 min, and collected by Zymo’s RNA columns. RNA seq libraries were prepared according to Illumna’s protocol, using NEB enzymes and barcoded adapters (Integrated DNA Technologies). The libraries were pooled and sequenced with an Illumina GA II machine (Center for Systems Biology, Harvard University).
GSE21341	time point 0
GSE21341	time point 2
GSE21341	time point 4
GSE21341	time point 6
GSE21341	time point 8
GSE21341	treatment group: rifampicin time point 0
GSE21341	treatment group: rifampicin time point 2
GSE21341	treatment group: rifampicin time point 4
GSE21341	treatment group: rifampicin time point 6
GSE21341	treatment group: rifampicin time point 8
GSE2140	10min
GSE2140	10min (additional)
GSE2140	15min
GSE2140	15min (additional)
GSE2140	5min
GSE2140	5min (additional)
GSE2140	control
GSE2140	control (additional)
GSE2140	E. coli cell
GSE2140	Escherichia coli
GSE21820	Cells grew in MOPS minimal medium with 0.4% glucose and 0.2 mM K2HPO4 and harvested at the OD600 value of 1.0.
GSE21820	E. coli MG1655 PhoB knock-out strain grows under phosphate starvation condition
GSE21820	E. coli MG1655 wildtype strain grows under phosphate starvation condition
GSE21820	Escherichia coli
GSE21820	genotype
GSE21820	PhoB knock-out strain, rep1
GSE21820	PhoB knock-out strain, rep2
GSE21820	strain: MG1655
GSE21820	The data were normalized by RMA method and then analyzed by limma package to identify differentially expressed genes (bioconductor).
GSE21820	Trizol extraction of total RNA was performed according to the manufacturer's instructions.
GSE21820	Wildtype strain, rep1
GSE21820	wildtype strain, rep2
GSE21839	E4 -O2 1
GSE21839	E4 +O2 1
GSE21839	E4 -O2 2
GSE21839	E4 +O2 2
GSE21839	E4 -O2 3
GSE21839	E4 +O2 3
GSE21839	E. coli MG1655, M9 media with 4 g
GSE21839	Escherichia coli str. K-12 substr. MG1655
GSE21839	No specific treatment was done. Samples were collected in the mid-log growth phase for expression analysis
GSE21839	Respiratory defecient E. coli mutant (ECOM4), M9 media with 4 g
GSE21839	strain: ECOM4
GSE21839	strain: K-12 MG1655
GSE21839	The data were analyzed with ArrayStar 3 (DNASTAR) using RMA normalization method. Genes with at least two-fold expression level change and FDR-adjusted P-value (T-test) of less than 0.05 were considered significant.
GSE21839	total RNA was extreacted using Quagen RNA mini kit. DNA was removed by DNase digestion. RNA quality and concentration was determined by analysis with an Thermo NanoDrop 1000.
GSE21839	Wild type and the mutant were grown on minimal M9 media with 4 g
GSE21839	WT -O2 1
GSE21839	WT +O2 1
GSE21839	WT -O2 2
GSE21839	WT +O2 2
GSE21839	WT -O2 3
GSE21839	WT +O2 3
GSE21856	Cells grew in MOPS minimal medium with 0.4% glucose and 0.2 mM K2HPO4 and harvested at the OD600 value of 1.0.
GSE21856	ChIP DNA from MG1655_PhoB_FLAG
GSE21856	ChIP DNA from MG1655 wild type strain
GSE21856	Cultures were grown to the OD600 value of 1.0 and treated with 1% formaldehyde for 10 min. To quench the reaction, glycine was added at the final concentration of 0.125 M for 5 min. Cells were washed twice with lysis buffer (10 mM Tris-HCl (pH 7.4), 0.1 M NaCl, 1 mM EDTA and 0.5% Tween-20). The washed cells were then lysed with the lysis buffer containing 8 KU
GSE21856	Escherichia coli
GSE21856	genotype
GSE21856	PhoB_ChIP, rep1
GSE21856	PhoB_ChIP, rep2
GSE21856	PhoB_ChIP, rep3
GSE21856	strain: MG1655
GSE21856	The R package, Ringo, was used to read the pair files and the limma package for within- and between-array normalization. ChIP-chip data were bi-weighted scaled within each array and aquantile normalized between arrays.
GSE22060	0.15% Bile Salt Mix Stress, 90 minutes, static, 5% CO2 (EHEC strain: 86-24)
GSE22060	Bacteria were grown in LB broth overnight and subcultured in DMEM to OD600 of 0.4. Bacteria were then spun down, media removed and repalced with DMEM. 
GSE22060	Bacteria were grown in LB broth overnight and subcultured in DMEM to OD600 of 0.4. Bacteria were then spun down, media removed and repalced with DMEM plus 0.15% bile salt mix. 
GSE22060	Bile salt stress was done in DMEM at pH 7.4 (unbuffered) at 37C, 5% CO2, static incubation for 90 minutes
GSE22060	Control treatment. Bacteria were grown in DMEM pH 7.4, 90 minutes, 37C, 5% CO2, static (unstressed)
GSE22060	Cy3 labeled EHEC grown in DMEM pH 7.4, 90 minutes
GSE22060	Cy5 labeled EHEC bile salt-stressed in DMEM, 90 minutes
GSE22060	ehec strain: 86-24
GSE22060	Escherichia coli
GSE22060	RNA was extracted using Trizol (Invitrogen)
GSE22060	Signal intensities were averaged among the technical replicates.  Two types of data analysis were performed: to indentify density-dependent changes in gene expression, single averaged normalized signal intensities for each treatment point were compared to the average of corresponding unstressed control signal intensities.  Genes which showed a relative signal log2ratio (SLR) value above 1.0 or below -1.0 were selected for further analysis. 
GSE22207	After quality controls of data distribution the raw data (CEL files) were used to perform, normalization and probe set summarization through RMA algorithm (Robust Multiarray Analysis) by using the Affymetrix Gene Expression Console Software (www.affymetrix.com).   Normalized data were then uploaded into OneChannelGUI Software (http:
GSE22207	E.coli_IVT-RNA_sigma70-1
GSE22207	E.coli_IVT-RNA_sigma70-2
GSE22207	E.coli_IVT-RNA_sigmaS
GSE22207	E.coli_IVT-RNA_sigmaS-2
GSE22207	E. coli RNA polymerase core enzyme was purchased from Epicentre (Madison, WI, USA). Histidine-tagged σ factors were produced and purified as described (Lacour et al., 2003; Checroun et al., 2004); proteins appeared pure from contaminants as determined by denaturing protein gel electrophoresis (data not shown). For reconstitution of RNA polymerase holoenzymes, the core enzyme was incubated for 10 minutes at 37 °C with either σS or σ70 at a 1:10 ratio. For calculation of RNA polymerase concentrations in transcription assays, it was assumed that, after reconstitution, core enzyme would be 100% active and fully saturated by either σ factor. 2 ug of genomic DNA from E. coli MG1655 digested with EcoRI were used in transcription assays for ROMA experiments. RNA polymerase holoenzyme concentrations were 100 nM in 50 ul reaction mixture. Ten independent run-off transcription assays were performed, and transcripts were pooled together (ca. 1 ug total RNA).
GSE22207	Escherichia coli str. K-12 substr. MG1655
GSE22207	RNA produced by in vitro transcription, with RNA polymerase E σ70, of 2 ug of genomic DNA from E. coli MG1655 digested with EcoRI
GSE22207	RNA produced by in vitro transcription, with RNA polymerase E σS, of 2 ug of genomic DNA from E. coli MG1655 digested with EcoRI
GSE22207	sample type: cDNA produced by RT of RNA deriving from vitro transcription, with RNA polymerase E σ70, of 2 ug of genomic DNA from E. coli MG1655 digested with EcoRI
GSE22207	sample type: cDNA produced by RT of RNA deriving from vitro transcription, with RNA polymerase E σS, of 2 ug of genomic DNA from E. coli MG1655 digested with EcoRI
GSE22885	Cells in RNAlater were aliquoted into two. One served as non-sorted cells and kept at 4 degree C. The other aliquot was homogenized with OMNI TH homogenizer for 2 min on ice and further aliquoted into small vials. Cells in each vial were then re-suspended in nuclease-free phosphate buffered saline, incubated with anti-E. coli antibody and microbeads, followed by separation on a MACS separator (Miltenyi, Auburn, CA) at 4 degree C. Sorted cells were re-suspended into RNAlater.
GSE22885	Data was analyzed in the software Acuity 4.0 (Molecular Devices, Sunnyvale, CA). LOWESS normalization was performed with three iterations using a smoothing factor of 0.4. Hybridized spots having a high QC (quality control) value >0.1, good flag tags (A, B and C) in both Cy3
GSE22885	E. coli cells were grown in annular reactor (BioSurface Technologies, Bozeman, MT) inoculated with 1 ml overnight cultures and supplied with fresh 10-fold diluted Luria broth at 100 ml
GSE22885	Escherichia coli
GSE22885	growth mode: planktonic culture in annular reactor
GSE22885	growth time: 7-day
GSE22885	non-sorted E. coli cells from culture 1
GSE22885	non-sorted E. coli cells from culture 2
GSE22885	RNAlater was removed from cells by filtration. Total RNA was extracted from cells using a hot SDS
GSE22885	sorted E. coli cells from culture 1
GSE22885	sorted E. coli cells from culture 2
GSE22885	sorted vs. non-sorted cells bioreplicate 1 technical replicate 1
GSE22885	sorted vs. non-sorted cells bioreplicate 1 technical replicate 2
GSE22885	sorted vs. non-sorted cells bioreplicate 2 technical replicate 1
GSE22885	sorted vs. non-sorted cells bioreplicate 2 technical replicate 2
GSE22885	strain: K-12 PHL644
GSE22885	treatment: non-sorted
GSE22885	treatment: sorted
GSE23417	Bacteria were inoculated by direct injection of the mouse bladder, and kidney samples were taken at day 2 post-infection
GSE23417	cDNA made from strain KMD extracted from mouse kidney on day 2 post infection
GSE23417	cDNA made from strain PC1012(marArobsoxS) extracted from mouse kidney on day 2 post infection
GSE23417	Escherichia coli
GSE23417	Infected kidney solutions were centrifuged at 5000xg for 10 min to separate bacteria (pellet) from kidney (surface of RNA-later solution) cells.  The kidney cells were evacuated from the top of the solution, and the remaining solution was spun once more at 12000xg for 10 min, followed by disposal of the supernatant.  Pelleted cells were resuspended in TE buffer and treated with lysozyme (Sigma) at 1mg
GSE23417	KMD 1
GSE23417	KMD 2
GSE23417	KMD 3
GSE23417	Mouse kidneys were homogonized in RNALater solution (Ambion) and bacterial titers were taken.  Samples were pooled, and centrifuged as described below
GSE23417	PC 1
GSE23417	PC 2
GSE23417	PC 3
GSE23417	strain: KMD
GSE23417	strain: PC1012
GSE23417	The data were analyzed with Microarray Suite version 5.0 (MAS 5.0) using Affymetrix default analysis settings and global scaling as normalization method. The trimmed mean target intensity of each array was arbitrarily set to 100.
GSE23417	tissue source: kidney from CD-1 mice
GSE23578	Cells aerobically grown to mid-log phase in MOPS
GSE23578	Control
GSE23578	Ecoli_WT_100uM_KCN_Sample1_TechRep1
GSE23578	Ecoli_WT_100uM_KCN_Sample1_TechRep2
GSE23578	Ecoli_WT_100uM_KCN_Sample2_TechRep1
GSE23578	Ecoli_WT_100uM_KCN_Sample2_TechRep2
GSE23578	Ecoli_WT_100uM_KCN_Sample3_TechRep1
GSE23578	Ecoli_WT_100uM_KCN_Sample3_TechRep2
GSE23578	Ecoli_WT_100uM_KCN_Sample4_TechRep1
GSE23578	Ecoli_WT_100uM_KCN_Sample4_TechRep2
GSE23578	Escherichia coli
GSE23578	Quantification of the scans were performed with ImaGene (Version 6.0.1; BioDiscovery; El Segundo, CA; www.biodiscovery.com); with the results presented in the associated text files. The normalized data VALUE was generated using LOWESS normalization with rank invariant selection, as implemented in lcDNA (receptor.seas.ucla.edu
GSE23578	RNA extracted by hot phenol choloroform folled by Qiagen RNA Midi column.
GSE23578	strain: BW25113
GSE23578	Treated with 100 uM KCN for 5 minutes before harvesting
GSE23578	Untreated
GSE23920	Astat_chemostat
GSE23920	A-stat, specific growth rate 0.48 1
GSE23920	chemostat, specific growth rate 0.51 1
GSE23920	cultivation: continuous cultivation, A-stat
GSE23920	cultivation: continuous cultivation, chemostat
GSE23920	eco_0.21_0.11
GSE23920	eco_0.26_0.11
GSE23920	eco_0.31_0.11
GSE23920	eco_0.36_0.11
GSE23920	eco_0.40_0.11
GSE23920	eco_0.48_0.11
GSE23920	Escherichia coli K12 MG1655 was cultivated using M9 minimal medium containing 4.5 g
GSE23920	Escherichia coli str. K-12 substr. MG1655
GSE23920	Image was analized with Genepix 6 pro followed by background substration and global LOWESS normalization in R environment (KTH package). Spots with signal to noise ratio lower that 3 and
GSE23920	RNA degradation was stopped using Qiagen's RNAprotect reagent
GSE23920	specific growth rate 0.11 1
GSE23920	specific growth rate 0.21 1
GSE23920	specific growth rate 0.26 1
GSE23920	specific growth rate 0.31 1
GSE23920	specific growth rate 0.36 1
GSE23920	specific growth rate 0.40 1
GSE23920	specific growth rate 0.48 1
GSE23920	Total RNA was extracted with Qiagen's Rneasy Mini Kit
GSE24353	Bordetella sp. IITR-02
GSE24353	ECDH5_GD_RP1
GSE24353	Escherichia coli BL21
GSE24353	Escherichia coli DH5[alpha]
GSE24353	Escherichia coli K-12
GSE24353	Genomic DNA of all strains (degraders and non-degraders) isolated individually and mixed in equal ratio (500ng each)
GSE24353	Genomic DNA of Escherichia coli DH5α
GSE24353	Genomic DNA of mixed culture containing only non-degraders in equal ratio
GSE24353	Genomic DNA of mixed culture (Degraders and non-degraders in 2:1 ratio)
GSE24353	Genomic DNA of mixed culture (Degraders: NM-05, IITR-02, RHA1; Non-degraders: DH5α, BL21 and K12 in equal ratio)
GSE24353	Images were quantified using Agilent Feature Extraction Software (10.5.1.1) and obtained background subtracted and spatially detrended Processed Signal intensities.
GSE24353	Images were quantified using Agilent Feature Extraction Software (version 9.5.1.1 & 10.5.1.1) and obtained background subtracted and spatially detrended Processed Signal intensities.
GSE24353	isolation source: Mixed culture
GSE24353	isolation source: Pure culture
GSE24353	MC_Val_G1
GSE24353	MC_Val_G2
GSE24353	MC_Val_G3
GSE24353	MC_Val_G5
GSE24353	Rhodococcus jostii RHA1
GSE24353	Sphingomonas sp. NM05
GSE24353	The genomic DNA from pure and mixed bacterial cultures was isolated using the Wizard genomic DNA isolation kit (Promega corporation, Madison, USA) as per manufacturer's instructions. The concentration of DNA was analyzed by Nanodrop spectrophotometer (Nanodrop Technologies Inc, Rockland, USA), and quality was determined by analysis on DNA 12000 kit (Caliper Sciences, USA) using the Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA).
GSE24353	The Sphingomonas sp. strain NM-05 used in the study is a known degrader of γ-hexachlorocyclohexane (γ-HCH) and has been isolated from the vicinity of an industry India Pesticide Limited, Chinhat industrial area, Lucknow which is involved in manufacturing chlorinated pesticides for last 25 years. The strain was harvested in mineral salt medium with 0.34mM γ-HCH as sole source of carbon and energy. The strain Bordetella sp. strain IITR-02 used in this study has been isolated from the vicinity of the industry India Pesticide Limited, Chinhat, Lucknow and is found to be a degrader of 1,2-, 1,4-dichloro and 1,2,3- and 1,2,4-trichlorobenzene. The strain was harvested in mineral salt medium with 3.2mM of 1,2,4-trichlorobenzene as sole source of carbon and energy. The bacterium Rhodococcus sp. strain RHA1 which is a known degrader of polychlorinated biphenyls, substituted phenols, benzoates and phthalates was grown on 0.2% biphenyl and 20mM of benzoate as carbon sources. The strain Escherichia coli DH5α and Escherichia coli BL21 were grown in Luria-Bertani medium and strain Escherichia coli K12  was grown in nutrient broth to an OD560nm of 0.4 at 37 degree centigrade with continuous shaking.
GSE24353	The Sphingomonas sp. strain NM-05 used in the study is a known degrader of γ-hexachlorocyclohexane (γ-HCH) and has been isolated from the vicinity of an industry India Pesticide Limited, Chinhat industrial area, Lucknow which is involved in manufacturing chlorinated pesticides for last 25 years. The strain was harvested in mineral salt medium with 0.34mM γ-HCH as sole source of carbon and energy. The strain Escherichia coli DH-5α was grown in Luria-Bertani medium to an O.D. of 0.4 at 37 degree centigrade with continuous shaking. The soil
GSE24353	The total DNA to be used as target for microarray hybridization was isolated from soil
GSE24373	Data from two independent experiments were normalized and then analyzed using the GenePix Pro 3.0 software (Axon Instruments).
GSE24373	Escherichia coli ptsN mutant strain
GSE24373	Escherichia coli str. K-12 substr. MG1655
GSE24373	Escherichia coli wild type strain
GSE24373	genotype
GSE24373	ptsN mutant replicate 1
GSE24373	ptsN mutant replicate 2
GSE24373	RNA was extracted from each sample using a QIAGEN RNA extraction kit according to the manufacturer’s instruction
GSE24373	The E. coli K12 strain MG1655 and its isogenic ptsN mutant were grown in M9 minimal medium containing 0.5% glucose as carbon source. Cells from duplicate experiments were harvested in exponential growth phase when cultures reached an A600 of 0.4.
GSE24912	Cells for inoculation were from overnight planktonic culture in 10% Luria-Bertani broth at 30 degree Celsius. Cells were washed in equal volume of fresh 10% LB broth before inoculation and were inoculated into 5 ml 10% LB in a disposable petri dish (60 mm x 15 mm). 50 ul E. coli culture was inoculated for mono-species pure culture. 50 ul E. coli and 10 ul S. maltophilia were mixed and inoculated for mixed-species culture. Petri dishes were set static at room temperature (20 C) for 18 h for biofilm growth.
GSE24912	culture media: 10% Luria broth
GSE24912	culture system: static petri dish (disposable)
GSE24912	culture temperature: room temperature (20 C)
GSE24912	culture time: 18 h
GSE24912	Data was analyzed in the software Acuity 4.0 (Molecular Devices, Sunnyvale, CA). Hybridized spots for E. coli K12 having a high QC (quality control) value >0.1, good flag tags (A, B and C) in both Cy3
GSE24912	Escherichia coli K-12
GSE24912	Escherichia coli_MixedSpeciesBiofilm_bioreplicate1_techreplicate_1
GSE24912	Escherichia coli_MixedSpeciesBiofilm_bioreplicate1_techreplicate_2
GSE24912	Escherichia coli_MixedSpeciesBiofilm_bioreplicate1_techreplicate_3
GSE24912	Escherichia coli_MixedSpeciesBiofilm_bioreplicate2_techreplicate_1
GSE24912	Escherichia coli_MixedSpeciesBiofilm_bioreplicate2_techreplicate_2
GSE24912	RNAlater was removed from cells by filtration. Total RNA was extracted from cells using a hot SDS
GSE24912	sorted E. coli cells from dual-species biofilms 1
GSE24912	sorted E. coli cells from dual-species biofilms 2
GSE24912	sorted E. coli cells from mono-species biofilms 1
GSE24912	sorted E. coli cells from mono-species biofilms 2
GSE24912	Suspended cells were then removed and biofilms were washed 3 times with 1 ml 10% LB broth. Biofilms from each petri dish were then scraped into a vial containing 1 ml 10% LB. Scraped biofilms in each vial were concentrated from 1 ml into 50 ul by centrifugation. 500 ul RNAlater was added and mixed well. Samples in RNAlater were kept in 4C fridge overnight.  Each vial was homogenized with OMNI TH homogenizer for 2 min on ice and further aliquoted into small vials. Cells in each vial were then re-suspended in nuclease-free phosphate buffered saline, incubated with anti-E. coli antibody (ViroStat) and microbeads (Miltenyi), followed by separation on a MACS separator (Miltenyi, Auburn, CA) at 4 degree C. Sorted cells were re-suspended into RNAlater until RNA extractions.
GSE24912	treatment: with homogenization and separation
GSE24913	Cells for inoculation were from overnight planktonic culture in 10% Luria-Bertani broth at 30 degree Celsius. Cells were washed in equal volume of fresh 10% LB broth before inoculated into 30 ml 10% LB in a flask. 300 ul E. coli culture was inoculated for mono-species pure culture. 150 ul E. coli and 60 ul S. maltophilia were mixed and inoculated for mixed-species cultures. Flasks were set on a shaker (250 rpm) at room temperature (20 C) for 18 h.
GSE24913	Cells were harvested and resuspended in RNAlater and kept in 4C fridge overnight. Cells were aliquoted into vials containing around 2x10^8 cells. Cells in each vial were then re-suspended in nuclease-free phosphate buffered saline, incubated with anti-E. coli antibody (ViroStat) and microbeads (Miltenyi), followed by separation on a MACS separator (Miltenyi, Auburn, CA) at 4 degree C. Sorted cells were re-suspended into RNAlater until RNA extraction.
GSE24913	culture media: 10% Luria broth
GSE24913	culture system: flask with continous shaking (250 rpm)
GSE24913	culture system: flask with continuous shaking (250 rpm)
GSE24913	culture temperature: room temperature (20 C)
GSE24913	culture time: 18 h
GSE24913	Data was analyzed in the software Acuity 4.0 (Molecular Devices, Sunnyvale, CA). Hybridized spots for E. coli K12 having a high QC (quality control) value >0.1, good flag tags (A, B and C) in both Cy3
GSE24913	Escherichia coli K-12
GSE24913	Escherichia coli_MixedSpeciesPlanktonic_bioreplicate1_techreplicate_1
GSE24913	Escherichia coli_MixedSpeciesPlanktonic_bioreplicate1_techreplicate_2
GSE24913	Escherichia coli_MixedSpeciesPlanktonic_bioreplicate2_techreplicate_1
GSE24913	Escherichia coli_MixedSpeciesPlanktonic_bioreplicate2_techreplicate_2
GSE24913	RNAlater was removed from cells by filtration. Total RNA was extracted from cells using a hot SDS
GSE24913	sorted E. coli cells from dual-species planktonic culture 1
GSE24913	sorted E. coli cells from dual-species planktonic culture 2
GSE24913	sorted E. coli cells from mono-species pure planktonic culture 1
GSE24913	sorted E. coli cells from mono-species pure planktonic culture 2
GSE24913	treatment: with homogenization and separation
GSE24914	Cells for inoculation were from overnight planktonic culture in 10% Luria-Bertani broth at 30 degree Celsius. Cells were washed in equal volume of fresh 10% LB broth before inoculation. Planktonic cultures were conducted in flasks with 30 ml 10% LB, inoculated with 300 ul E. coli overnight culture. Flasks were set on a shaker (250 rpm) at room temperature (20 C) for 18 h. Biofilms were cultivated in static disposable petri dishes (60 mm x 15 mm) with 5 ml 10% LB, inoculated with 50 ul E. coli overnight culture. The petri dishes were set static at room temperature (20 C) for 18 h.
GSE24914	culture media: 10% Luria broth
GSE24914	culture system: flask with continuous shaking (250 rpm)
GSE24914	culture system: static petri dish (disposable)
GSE24914	culture temperature: room temperature (20 C)
GSE24914	culture time: 18 h
GSE24914	Data was analyzed in the software Acuity 4.0 (Molecular Devices, Sunnyvale, CA). Hybridized spots for E. coli K12 having a high QC (quality control) value >0.1, good flag tags (A, B and C) in both Cy3
GSE24914	E. coli cells from biofilm 1
GSE24914	E. coli cells from biofilm 2
GSE24914	E. coli cells from planktonic culture 1
GSE24914	E. coli cells from planktonic culture 2
GSE24914	Escherichia coli_Biofilm_bioreplicate1_techreplicate_1
GSE24914	Escherichia coli_Biofilm_bioreplicate1_techreplicate_2
GSE24914	Escherichia coli_Biofilm_bioreplicate2_techreplicate_1
GSE24914	Escherichia coli_Biofilm_bioreplicate2_techreplicate_2
GSE24914	Escherichia coli K-12
GSE24914	Planktonic cultures of E. coli were harvested and resuspended in RNAlater and kept in 4C fridge overnight. Suspended cells were removed from petri dishes and biofilms were washed three times with fresh 10% LB before being craped from the bottom surface of petri dishes. Biofilms were also re-suspeded into RNAlater and kept at 4C overnight. Both planktonic and biofilm samples were homogenized for 2 min on ice with an Omni TH homogenizer. Cells were then aliquoted into vials containing around 2x10^8 cells. Cells in each vial were then re-suspended in nuclease-free phosphate buffered saline, incubated with anti-E. coli antibody and microbeads, followed by separation on a MACS separator (Miltenyi, Auburn, CA) at 4 degree C. Sorted cells were re-suspended into RNAlater.
GSE24914	RNAlater was removed from cells by filtration. Total RNA was extracted from cells using a hot SDS
GSE24914	treatment: with homogenization and separation
GSE24991	chip antibody: FLAG antibody
GSE24991	chip antibody: RNAP beta subunit antibody
GSE24991	ChIP-Seq
GSE24991	[E-MTAB-332] fis early-exponential
GSE24991	[E-MTAB-332] fis mid-exponential
GSE24991	[E-MTAB-332] H-NS early-exponential
GSE24991	[E-MTAB-332] H-NS mid-exponential
GSE24991	[E-MTAB-332] H-NS stationary
GSE24991	[E-MTAB-332] H-NS transition-to-stationary
GSE24991	[E-MTAB-332] rpo delfis mid-exponential
GSE24991	[E-MTAB-332] rpo delhns mid-exponential
GSE24991	[E-MTAB-332] rpo wt mid-exponential
GSE24991	Escherichia coli
GSE24991	Fis, EE
GSE24991	Fis, ME
GSE24991	genotype: del-fis
GSE24991	genotype: del-hns
GSE24991	genotype: fis::3xFLAG
GSE24991	genotype: hns::3xFLAG
GSE24991	genotype: wild_type
GSE24991	growth condition: early-exponential
GSE24991	growth condition: mid-exponential
GSE24991	growth condition: stationary
GSE24991	growth condition: transition-to-stationary
GSE24991	grow | The E. coli K-12 MG1655 bacterial strains used in this work are the following: E. coli MG1655 (F- lambda- ilvG- rfb-50 rph-1); MG1655 hns (hns::Kanr); MG1655 fis (fis::Kanr); MG1655 hns-FLAG (hns::3xFLAG::Kanr); MG1655 fis-FLAG (fis::3xFLAG::Kanr). Luria-Bertani (0.5% NaCl) broth and agar (15 g
GSE24991	H-NS, EE
GSE24991	H-NS, ME
GSE24991	H-NS, S
GSE24991	H-NS, TS
GSE24991	material type: whole_organism
GSE24991	nucleic_acid_extraction | ChIP was performed as previously described (Grainger et al, 2004) with some modifications to the protdegree Col. Cells were grown aerobically at 37degree C to the desired OD600 and formaldehyde was added to a final concentration of 1%. After 20 min of incubation, glycine was added to a final concentration of 0.5 M to quench the reaction and incubated for a further 5 min. Cross-linked cells were harvested by centrifugation and washed twice with ice-cold TBS (pH 7.5). Cells were resuspended in 1 ml of lysis buffer (10 mM Tris [pH 8.0], 20% sucrose, 50 mM NaCl, 10 mM EDTA, 20 mg
GSE24991	rpo, delfis, ME
GSE24991	rpo, delhns, ME
GSE24991	rpo, wt, ME
GSE24991	Sequences obtained from the Illumina Genome Analyzer were mapped to both strands of the E. coli K12 MG1655 genome using BLAT allowing no gaps and up to two mismatches. Each alignment was extended to 200bp the approximate average length of DNA fragments on the 3' end. Only reads which mapped to a single region of the genome were considered for further analysis. For each base position on the genome, the number of reads that mapped to that position was calculated.
GSE24991	sequencing| Immunoprecipitated samples and the sheared DNA following the Bioruptor were de-crosslinked in 0.5x elution buffer containing 0.8 mg
GSE24991	strainorline: K-12 substr. MG1655
GSE25106	Cells were grown at 37oC without shaking in 18 mm test tubes containing 5 ml of the MOPS-based culture medium designed by Neidhardt. Mouse cecal mucus was prepared from streptomycin-treated CD-1 mice (not colonized with E. coli). Cultures were grown to A600 = 0.4 in MOPS medium containing glucose or mannose (0.2%) and also in 10 mg
GSE25106	Cultures were diluted into DNA-RNA Protect (Sierra Diagnostics) to inhibit RNA degradation and the RNA was purified using RNeasy minkits with the optional DNase treatment (Qiagen).
GSE25106	E. coli flhD, A600=0.2 on mucus
GSE25106	E. coli flhD, A600=0.4 on glucose
GSE25106	E. coli flhD, A600=0.4 on mannose
GSE25106	E. coli flhD, A600=0.5 on mucus
GSE25106	E. coli MG1655star, A600=0.2 on mucus
GSE25106	E. coli MG1655star, A600=0.4 on glucose
GSE25106	E. coli MG1655star, A600=0.4 on mannose
GSE25106	E. coli MG1655star, A600=0.5 on mucus
GSE25106	E. coli wild-type, A600=0.2 on mucus
GSE25106	E. coli wild-type, A600=0.4 on glucose
GSE25106	E. coli wild-type, A600=0.4 on mannose
GSE25106	E. coli wild-type, A600=0.5 on mucus
GSE25106	Escherichia coli str. K-12 substr. MG1655
GSE25106	flhD-glucose
GSE25106	flhD-mannose
GSE25106	flhD-mucus-P1
GSE25106	flhD-mucus-P2
GSE25106	genotype
GSE25106	MG1655star-glucose
GSE25106	MG1655star-mannose
GSE25106	MG1655star-mucus-P1
GSE25106	MG1655star-mucus-P2
GSE25106	RMA with quartile normalization according to method of Irizarry et al, 2003. The raw .cel files were processed in RMA using Bioconductor R package: affy Version:1.8.1 Date:2005-09-03, with the option Filter.genes containing a subset of probesets corresponding to MG1655 genes and intergenic regions listed in the matrix data. Replicates were averaged for ratio calculations.
GSE25106	WT-glucose-Rep1
GSE25106	WT-glucose-Rep2
GSE25106	WT-mannose
GSE25106	WT-mucus-P1
GSE25106	WT-mucus-P2
GSE25601	1. Use Agilent software Feature Extraction to analyze spotted arrays.
GSE25601	252978410001_B7A_CY5_BCE001MS16_CY3.mev.refIsIB.out
GSE25601	252978410001_B7A_CY5_BCE022DS6_CY3.mev.refIsIB.out
GSE25601	252978410001_B7A_CY5_BCE063MS14_CY3.mev.refIsIB.out
GSE25601	252978410001_B7A_CY5_ETP98015_CY3.mev.refIsIB.out
GSE25601	252978410002_B7A_CY5_BCE007_CY3.mev.refIsIB.out
GSE25601	252978410002_B7A_CY5_BCE041_MS11_CY3.mev.refIsIB.out
GSE25601	252978410002_B7A_CY5_BCE063_DS4_CY3.mev.refIsIB.out
GSE25601	252978410002_B7A_CY5_ETP98028_CY3.mev.refIsIB.out
GSE25601	252978410003_B7A_CY5_C35662_CY3.mev.refIsIB.out
GSE25601	252978410003_B7A_CY5_ETP05_007_CY3.mev.refIsIB.out
GSE25601	252978410003_B7A_CY5_ETP05_017_CY3.mev.refIsIB.out
GSE25601	252978410003_B7A_CY5_ETP98062_CY3.mev.refIsIB.out
GSE25601	252978410004_B7A_CY5_BCE003_DS5_CY3.mev.refIsIB.out
GSE25601	252978410004_B7A_CY5_BCE058_MS13_CY3.mev.refIsIB.out
GSE25601	252978410004_B7A_CY5_BCE069_MS9_CY3.mev.refIsIB.out
GSE25601	252978410004_B7A_CY5_BCE129_DS2_CY3.mev.refIsIB.out
GSE25601	252978410005_B7A_CY5_BCE008_MS13_CY3.mev.refIsIB.out
GSE25601	252978410005_B7A_CY5_BCE013_DS1_CY3.mev.refIsIB.out
GSE25601	252978410005_B7A_CY5_BCE035_MS8_CY3.mev.refIsIB.out
GSE25601	252978410005_B7A_CY5_BCE039_DS2_CY3.mev.refIsIB.out
GSE25601	252978410006_B7A_CY5_ETP05_012_CY3.mev.refIsIB.out
GSE25601	252978410006_B7A_CY5_ETP05_019_CY3.mev.refIsIB.out
GSE25601	252978410006_B7A_CY5_ETP05_026_CY3.mev.refIsIB.out
GSE25601	252978410006_B7A_CY5_ETP05_044_CY3.mev.refIsIB.out
GSE25601	252978410007_B7A_CY5_BCE002_MS12_CY3.mev.refIsIB.out
GSE25601	252978410007_B7A_CY5_BCE021_DS7_CY3.mev.refIsIB.out
GSE25601	252978410007_B7A_CY5_BCE049_MS9_CY3.mev.refIsIB.out
GSE25601	252978410007_B7A_CY5_ETP98061_CY3.mev.refIsIB.out
GSE25601	252978410008_B7A_CY5_180050_CY3.mev.refIsIB.out
GSE25601	252978410008_B7A_CY5_ETP98103_CY3.mev.refIsIB.ou
GSE25601	252978410008_B7A_CY5_ETP98111_CY3.mev.refIsIB.out
GSE25601	252978410008_B7A_CY5_TW03741_CY3.mev.refIsIB.out
GSE25601	252978410009_B7A_CY5_E1787_CY3.mev.refIsIB.out
GSE25601	252978410009_B7A_CY5_E747_0_CY3.mev.refIsIB.out
GSE25601	252978410009_B7A_CY5_F595C_CY3.mev.refIsIB.out
GSE25601	252978410009_B7A_CY5_WS3572A1.mev.refIsIB.out
GSE25601	252978410010_B7A_CY5_229_1_CY3.mev.refIsIB.out
GSE25601	252978410010_B7A_CY5_ICDDR_B_p13_CY3.mev.refIsIB.out
GSE25601	252978410010_B7A_CY5_ICDDR_B_p1_CY3.mev.refIsIB.out
GSE25601	252978410010_B7A_CY5_ICDDR_B_p4_CY3.mev.refIsIB.out
GSE25601	252978410011_B7A_CY5_DS26_1_CY3.mev.refIsIB.out
GSE25601	252978410011_B7A_CY5_E1777_CY3.mev.refIsIB.out
GSE25601	252978410011_B7A_CY5_E9034A_CY3.mev.refIsIB.out
GSE25601	252978410011_B7A_CY5_NN_34_1_3_CY3.mev.refIsIB.out
GSE25601	252978410012_B7A_CY5_42_1_C1_CY3.mev.refIsIB.out
GSE25601	252978410012_B7A_CY5_ETEC_18_2_CY3.mev.refIsIB.out
GSE25601	252978410012_B7A_CY5_ICDDR_B_p12_CY3.mev.refIsIB.out
GSE25601	252978410012_B7A_CY5_LSN02_012560_A_CY3.mev.refIsIB.out
GSE25601	252978410013_B7A_CY5_180600_CY3.mev.refIsIB.out
GSE25601	252978410013_B7A_CY5_ETEC_10_1_CY3.mev.refIsIB.out
GSE25601	252978410013_B7A_CY5_TW3574_CY3.mev.refIsIB.out
GSE25601	252978410013_B7A_CY5_TW3585_CY3.mev.refIsIB.out
GSE25601	252978410014_B7A_CY5_E20738A_CY3.mev.refIsIB.out
GSE25601	252978410014_B7A_CY5_PUTI_O26_UMN_O26_CY3.mev.refIsIB.out
GSE25601	252978410014_B7A_CY5_sPRH450_CY3.mev.refIsIB.out
GSE25601	252978410015_B7A_CY5_E1392_75_CY3.mev.refIsIB.out
GSE25601	252978410015_B7A_CY5_ICDDR_B_p5_CY3.mev.refIsIB.out
GSE25601	252978410015_B7A_CY5_ICDDR_B_p8_CY3.mev.refIsIB.out
GSE25601	252978410015_B7A_CY5_sPRH613_CY3.mev.refIsIB.out
GSE25601	252978410016_B7A_CY5_D02_2_CY3.mev.refIsIB.out
GSE25601	252978410016_B7A_CY5_E1785_CY3.mev.refIsIB.out
GSE25601	252978410016_B7A_CY5_ETP98068_CY3.mev.refIsIB.out
GSE25601	252978410016_B7A_CY5_ICDDR_B_p11_CY3.mev.refIsIB.out
GSE25601	252978410017_B7A_CY5_C35776_CY3.mev.refIsIB.out
GSE25601	252978410017_B7A_CY5_E1788_CY3.mev.refIsIB.out
GSE25601	252978410017_B7A_CY5_ETEC_JURUA_18_11_CY3.mev.refIsIB.out
GSE25601	252978410017_B7A_CY5_ICDDR_B_p9_CY3.mev.refIsIB.out
GSE25601	252978410018_B7A_CY5_ARG3_CY3.mev.refIsIB.out
GSE25601	252978410018_B7A_CY5_E1792_CY3.mev.refIsIB.out
GSE25601	252978410018_B7A_CY5_MG1655_CY3.mev.refIsIB.out
GSE25601	252978410018_B7A_CY5_sPRH21_CY3.mev.refIsIB.out
GSE25601	252978410019_B7A_CY5_E1786_CY3.mev.refIsIB.out
GSE25601	252978410019_B7A_CY5_WS0115A_CY3.mev.refIsIB.out
GSE25601	252978410020_B7A_CY5_179550_CY3.mev.refIsIB.out
GSE25601	252978410020_B7A_CY5_BCE046_DS2_CY3.mev.refIsIB.out
GSE25601	252978410020_B7A_CY5_BCE046_DS7_CY3.mev.refIsIB.out
GSE25601	252978410020_B7A_CY5_ETP98114_CY3.mev.refIsIB.out
GSE25601	252978410021_B7A_CY5_1080200_CY3.mev.refIsIB.out
GSE25601	252978410021_B7A_CY5_BCE008_MS1_CY3.mev.refIsIB.out
GSE25601	252978410021_B7A_CY5_BCE054_MS24_CY3.mev.refIsIB.out
GSE25601	252978410021_B7A_CY5_ETP05_046_CY3.mev.refIsIB.out
GSE25601	252978410022_B7A_CY5_BCE062_DS2_CY3.mev.refIsIB.out
GSE25601	252978410022_B7A_CY5_BCE069_DS2_CY3.mev.refIsIB.out
GSE25601	252978410022_B7A_CY5_ETP98038_CY3.mev.refIsIB.out
GSE25601	252978410022_B7A_CY5_ETP98042_CY3.mev.refIsIB.out
GSE25601	252978410023_B7A_CY5_173150_CY3.mev.refIsIB.out
GSE25601	252978410023_B7A_CY5_174750_CY3.mev.refIsIB.out
GSE25601	252978410023_B7A_CY5_178850_CY3.mev.refIsIB.out
GSE25601	252978410023_B7A_CY5_ETP98115_CY3.mev.refIsIB.out
GSE25601	252978410024_B7A_CY5_BCE018_DS6_CY3.mev.refIsIB.out
GSE25601	252978410024_B7A_CY5_BCE019_MS16_CY3.mev.refIsIB.out
GSE25601	252978410024_B7A_CY5_BCE046_MS16_CY3.mev.refIsIB.out
GSE25601	252978410024_B7A_CY5_BCE069_MS15_CY3.mev.refIsIB.out
GSE25601	252978410025_B7A_CY5_BCE007_MS11_CY3.mev.refIsIB.out
GSE25601	252978410025_B7A_CY5_BCE039_MS13_CY3.mev.refIsIB.out
GSE25601	252978410025_B7A_CY5_C35959_CY3.mev.refIsIB.out
GSE25601	252978410025_B7A_CY5_ETP05_050_CY3.mev.refIsIB.out
GSE25601	252978410026_B7A_CY5_E24377A_CY3.mev.refIsIB.out
GSE25601	252978410026_B7A_CY5_sPRH_418_CY3.mev.refIsIB.out
GSE25601	252978410026_B7A_CY5_WS1896A_CY3.mev.refIsIB.out
GSE25601	252978410026_B7A_CY5_WS2068A_CY3.mev.refIsIB.out
GSE25601	252978410027_B7A_CY5_LSN03_016011_A_CY3.mev.refIsIB.out
GSE25601	252978410027_B7A_CY5_sPRH_414_CY3.mev.refIsIB.out
GSE25601	252978410027_B7A_CY5_sPRH_420_CY3.mev.refIsIB.out
GSE25601	252978410027_B7A_ETEC20_10_CY3.mev.refIsIB.out
GSE25601	252978410028_B7A_CY5_ETP98073_CY3.mev.refIsIB.out
GSE25601	252978410028_B7A_CY5_TW3439_CY3.mev.refIsIB.out
GSE25601	252978410028_B7A_CY5_TW3576_CY3.mev.refIsIB.out
GSE25601	252978410028_B7A_CY5_WS3080A_CY3.mev.refIsIB.out
GSE25601	252978410029_B7A_CY5_sPRH_403_CY3.mev.refIsIB.out
GSE25601	252978410029_B7A_CY5_sPRH_443_CY3.mev.refIsIB.out
GSE25601	252978410029_B7A_CY5_sPRH_604_CY3.mev.refIsIB.out
GSE25601	252978410029_B7A_CY5_sPRH_606_CY3.mev.refIsIB.out
GSE25601	252978410030_B7A_CY5_C36255_CY3.mev.refIsIB.out
GSE25601	252978410030_B7A_CY5_ETP05_008_CY3.mev.refIsIB.out
GSE25601	252978410030_B7A_CY5_ETP98105_CY3.mev.refIsIB.out
GSE25601	252978410030_B7A_ETP98066_CY3.mev.refIsIB.out
GSE25601	252978410031_B7A_CY5_BCE054_DS4_CY3.mev.refIsIB.out
GSE25601	252978410031_B7A_CY5_BCE068_MS10_CY3.mev.refIsIB.out
GSE25601	252978410031_B7A_CY5_BCE068_MS23.mev.refIsIB.out
GSE25601	252978410031_B7A_CY5_ETP05_015_CY3.mev.refIsIB.out
GSE25601	252978410032_B7A_CY5_BCE011_DS3_CY3.mev.refIsIB.out
GSE25601	252978410032_B7A_CY5_BCE049_DS3_CY3.mev.refIsIB.out
GSE25601	252978410032_B7A_CY5_BCE062_MS24_CY3.mev.refIsIB.out
GSE25601	252978410032_B7A_CY5_BCE066_DS5_CY3.mev.refIsIB.out
GSE25601	252978410033_B7A_CY5_BCE035_DS6_CY3.mev.refIsIB.out
GSE25601	252978410033_B7A_CY5_C35209_CY3.mev.refIsIB.out
GSE25601	252978410033_B7A_CY5_ETP_98004_CY3.mev.refIsIB.out
GSE25601	252978410033_B7A_CY5_ETP98056_CY3.mev.refIsIB.out
GSE25601	252978410034_B7A_CY5_BCE005_MS23_CY3.mev.refIsIB.out
GSE25601	252978410034_B7A_CY5_BCE061_DS1_CY3.mev.refIsIB.out
GSE25601	252978410034_B7A_CY5_ETP05_038_CY3.mev.refIsIB.out
GSE25601	252978410034_B7A_CY5_ETP98053_CY3.mev.refIsIB.out
GSE25601	252978410035_B7A_CY5_BCE055_DS1_CY3.mev.refIsIB.out
GSE25601	252978410035_B7A_CY5_ETP05_016_CY3.mev.refIsIB.out
GSE25601	252978410035_B7A_CY5_ETP05_020_CY3.mev.refIsIB.out
GSE25601	252978410035_B7A_CY5_ETP05_039_CY3.mev.refIsIB.out
GSE25601	252978410058_B7A_CY5_178900_CY3.mev.refIsIB.out
GSE25601	252978410058_B7A_CY5_179100_CY3.mev.refIsIB.out
GSE25601	252978410058_B7A_CY5_ETP05_009_CY3.mev.refIsIB.out
GSE25601	252978410058_B7A_CY5_ETP05_010_CY3.mev.refIsIB.out
GSE25601	252978410059_B7A_CY5_532_WS6866B1_CY3.mev.refIsIB.out
GSE25601	252978410059_B7A_CY5_ETP05_047_CY3.mev.refIsIB.out
GSE25601	252978410059_B7A_CY5_ETP98097_CY3.mev.refIsIB.out
GSE25601	252978410059_B7A_CY5_ETP98112_CY3.mev.refIsIB.out
GSE25601	252978410060_B7A_CY5_ARG2_CY3.mev.refIsIB.out
GSE25601	252978410060_B7A_CY5_C35134_CY3.mev.refIsIB.out
GSE25601	252978410060_B7A_CY5_E1791_CY3.mev.refIsIB.out
GSE25601	252978410060_B7A_CY5_WS3596_A4_CY3.mev.refIsIB.out
GSE25601	252978410061_B7A_CY5_COCAR07_40_CY3.mev.refIsIB.out
GSE25601	252978410061_B7A_CY5_COSIN07_88_CY3.mev.refIsIB.out
GSE25601	252978410061_B7A_CY5_COSIN07_92_CY3.mev.refIsIB.out
GSE25601	252978410062_B7A_CY5_DS168_1_CY3.mev.refIsIB.out
GSE25601	252978410062_B7A_CY5_PE360_CY3.mev.refIsIB.out
GSE25601	252978410062_B7A_CY5_WS4087_A1_CY3.mev.refIsIB.out
GSE25601	252978410062_B7A_CY5_WS7179_A2_CY3.mev.refIsIB.out
GSE25601	252978410063_B7A_CY5_B7A_CY3.mev.refIsIB.out
GSE25601	252978410063_B7A_CY5_COSIN07_14_CY3.mev.refIsIB.out
GSE25601	252978410063_B7A_CY5_sPRH372_CY3.mev.refIsIB.out
GSE25601	252978410063_B7A_CY5_TW3452_CY3.mev.refIsIB.out
GSE25601	252978410064_B7A_CY5_E1789_CY3.mev.refIsIB.out
GSE25601	252978410064_B7A_CY5_E1790_CY3.mev.refIsIB.out
GSE25601	252978410064_B7A_CY5_HS_CY3.mev.refIsIB.out
GSE25601	252978410064_B7A_CY5_sPRH609_CY3.mev.refIsIB.out
GSE25601	252978410065_B7A_CY5_350C1A_CY3.mev.refIsIB.out
GSE25601	252978410065_B7A_CY5_E2528_C1_CY3.mev.refIsIB.out
GSE25601	252978410065_B7A_CY5_E8775_CY3.mev.refIsIB.out
GSE25601	252978410065_B7A_CY5_M424_C1_CY3.mev.refIsIB.out
GSE25601	252978410066_B7A_CY5_2230_CY3.mev.refIsIB.out
GSE25601	252978410066_B7A_CY5_ICDDR_P_2_CY3.mev.refIsIB.out
GSE25601	252978410066_B7A_CY5_WS1933D_CY3.mev.refIsIB.out
GSE25601	252978410066_B7A_CY5_WS6582_A1_CY3.mev.refIsIB.out
GSE25601	252978410067_B7A_CY5_B2C_CY3.mev.refIsIB.out
GSE25601	252978410067_B7A_CY5_ETEC_8_11_CY3.mev.refIsIB.out
GSE25601	252978410067_B7A_CY5_F5656_C1_CY3.mev.refIsIB.out
GSE25601	252978410067_B7A_CY5_WS7162_A1_CY3.mev.refIsIB.out
GSE25601	252978410068_B7A_CY5_CFT073_CY3.mev.refIsIB.out
GSE25601	252978410068_B7A_CY5_ICDDR_B_p_10_CY3.mev.refIsIB.out
GSE25601	252978410068_B7A_CY5_M408C1_CY3.mev.refIsIB.out
GSE25601	252978410068_B7A_CY5_WS3294A_CY3.mev.refIsIB.out
GSE25601	252978410069_B7A_CY5_278485_1_CY3.mev.refIsIB.out
GSE25601	252978410069_B7A_CY5_sPRH25_CY3.mev.refIsIB.out
GSE25601	252978410069_B7A_CY5_sPRH421_CY3.mev.refIsIB.out
GSE25601	252978410069_B7A_CY5_sPRH610_CY3.mev.refIsIB.out
GSE25601	252978410070_B7A_CY5_ICDDR_B_p7_CY3.mev.refIsIB.out
GSE25601	252978410070_B7A_CY5_NR_12_CY3.mev.refIsIB.out
GSE25601	252978410070_B7A_CY5_sPRH20_CY3.mev.refIsIB.out
GSE25601	252978410070_B7A_CY5_sPRH612_CY3.mev.refIsIB.out
GSE25601	252978410071_B7A_CY5_292_1_CY3.mev.refIsIB.out
GSE25601	252978410071_B7A_CY5_COCAR07_043_CY3.mev.refIsIB.out
GSE25601	252978410071_B7A_CY5_COSIN07_61_CY3.mev.refIsIB.out
GSE25601	252978410071_B7A_CY5_O157_h7_CY3.mev.refIsIB.out
GSE25601	252978410072_B7A_CY5_COSIN07_36_CY3.mev.refIsIB.out
GSE25601	252978410072_B7A_CY5_ICDDR_B_p6_CY3.mev.refIsIB.out
GSE25601	252978410072_B7A_CY5_O63_nm_CY3.mev.refIsIB.out
GSE25601	252978410072_B7A_CY5_sPRH605_CY3.mev.refIsIB.out
GSE25601	252978410073_B7A_CY5_214_4_CY3.mev.refIsIB.out
GSE25601	252978410073_B7A_CY5_E7476A_CY3.mev.refIsIB.out
GSE25601	252978410073_B7A_CY5_WS1896_A1_CY3.mev.refIsIB.out
GSE25601	252978410073_B7A_CY5_WS2173A_CY3.mev.refIsIB.out
GSE25601	252978410075_B7A_CY5_ETP05_011_CY3.mev.refIsIB.out
GSE25601	252978410075_B7A_CY5_ETP05_035_CY3.mev.refIsIB.out
GSE25601	252978410075_B7A_CY5_O78_h11_CY3.mev.refIsIB.out
GSE25601	252978410075_B7A_CY5_sPRH445_CY3.mev.refIsIB.out
GSE25601	252978410076_B7A_CY5_178200_CY3.mev.refIsIB.out
GSE25601	252978410076_B7A_CY5_C35213_CY3.mev.refIsIB.out
GSE25601	252978410076_B7A_CY5_C35605_CY3.mev.refIsIB.out
GSE25601	252978410076_B7A_CY5_ETP98109_CY3.mev.refIsIB.out
GSE25601	252978410077_B7A_CY5_174900_CY3.mev.refIsIB.out
GSE25601	252978410077_B7A_CY5_C34666_CY3.mev.refIsIB.out
GSE25601	252978410077_B7A_CY5_ETP05_002_CY3.mev.refIsIB.out
GSE25601	252978410077_B7A_CY5_ETP05_003_CY3.mev.refIsIB.out
GSE25601	252978410078_B7A_CY5_2_1_CY3.mev.refIsIB.out
GSE25601	252978410078_B7A_CY5_WS2741_A1_CY3.mev.refIsIB.out
GSE25601	252978410078_B7A_CY5_WS4264_A1_CY3.mev.refIsIB.out
GSE25601	252978410078_B7A_CY5_WS5874_A1_CY3.mev.refIsIB.out
GSE25601	2. Use TM4 suite software ExpressConverter to modify Agilent Feature Extraction file into *.mev. 
GSE25601	    3a). If both channels (QUERY_MEDIAN_INTENSITY and REF_MEDIAN_INTENSITY) are zero, assign the value \null\.
GSE25601	    3b). If one channel is zero and the other is not zero, substitute the zero with one (1) and then, assign the log2 ratio of QUERY_MEDIAN_INTENSITY
GSE25601	3. Calculate the value of log2 ratio (Reference
GSE25601	    3c). If neither channel is zero, assign the log2 ratio of QUERY_MEDIAN_INTENSITY
GSE25601	cells were grown in LB overnight at 37 degrees celcius.
GSE25601	Escherichia coli
GSE25601	Genomic DNA purified from wild type bacteri
GSE25601	Genomic DNA purified from wild type bacteria
GSE25601	Genomic DNA was isolated by lysozyme and proteinase K treatment.
GSE25601	Genomic DNA was isolated by lysozyme and proteinase K treatment.  
GSE25601	mev data obtained from the feature extraction file used, no further normalization needed
GSE25601	None
GSE25601	Procedures to calculate the value of log2 ratio:
GSE25601	strain: 173150
GSE25601	strain: 174750
GSE25601	strain: 174900
GSE25601	strain: 178200
GSE25601	strain: 178850
GSE25601	strain: 178900
GSE25601	strain: 179100
GSE25601	strain: 179550
GSE25601	strain: 180050
GSE25601	strain: 180200
GSE25601	strain: 180600
GSE25601	strain: 2-1
GSE25601	strain: 214-4
GSE25601	strain: 2230
GSE25601	strain: 229-1
GSE25601	strain: 278485-1
GSE25601	strain: 292-1
GSE25601	strain: 350C1A
GSE25601	strain: 42-1 C1
GSE25601	strain: ARG-2
GSE25601	strain: ARG-3
GSE25601	strain: B2C
GSE25601	strain: B7A
GSE25601	strain: BCE001, MS16
GSE25601	strain: BCE002, MS12
GSE25601	strain: BCE003, DS5
GSE25601	strain: BCE005, MS23
GSE25601	strain: BCE007
GSE25601	strain: BCE007, MS11
GSE25601	strain: BCE008_MS1
GSE25601	strain: BCE008, MS13
GSE25601	strain: BCE011, DS3
GSE25601	strain: BCE013, DS1
GSE25601	strain: BCE018, DS6
GSE25601	strain: BCE019, MS16
GSE25601	strain: BCE021, DS7
GSE25601	strain: BCE022DS6
GSE25601	strain: BCE035, DS6
GSE25601	strain: BCE035, MS8
GSE25601	strain: BCE039, DS2
GSE25601	strain: BCE039, MS13
GSE25601	strain: BCE041, MS11
GSE25601	strain: BCE046, DS2
GSE25601	strain: BCE046, DS7
GSE25601	strain: BCE046, MS16
GSE25601	strain: BCE049, DS3
GSE25601	strain: BCE049, MS9
GSE25601	strain: BCE054, DS4
GSE25601	strain: BCE054, MS24
GSE25601	strain: BCE055, DS1
GSE25601	strain: BCE058, MS13
GSE25601	strain: BCE061, DS1
GSE25601	strain: BCE062, DS2
GSE25601	strain: BCE062, MS24
GSE25601	strain: BCE063, DS4
GSE25601	strain: BCE063, MS14
GSE25601	strain: BCE066, DS5
GSE25601	strain: BCE068, MS10
GSE25601	strain: BCE068, MS23
GSE25601	strain: BCE069, DS2
GSE25601	strain: BCE069, MS15
GSE25601	strain: BCE069, MS9
GSE25601	strain: BCE129, DS2
GSE25601	strain: C-34666
GSE25601	strain: C-35134
GSE25601	strain: C-35209
GSE25601	strain: C-35213
GSE25601	strain: C-35605
GSE25601	strain: C-35662
GSE25601	strain: C-35776
GSE25601	strain: C-35959
GSE25601	strain: C-36255
GSE25601	strain: CFT073
GSE25601	strain: cocar 07-043
GSE25601	strain: cocar 07-40
GSE25601	strain: cosin 07-14
GSE25601	strain: cosin 07-36
GSE25601	strain: cosin 07-61
GSE25601	strain: cosin 07-88
GSE25601	strain: cosin 07-92
GSE25601	strain: D02-2
GSE25601	strain: DS168-1
GSE25601	strain: DS26-1
GSE25601	strain: E1392
GSE25601	strain: E1777
GSE25601	strain: E1785
GSE25601	strain: E1786
GSE25601	strain: E1787
GSE25601	strain: E1788
GSE25601	strain: E1789
GSE25601	strain: E1790
GSE25601	strain: E1791
GSE25601	strain: E1792
GSE25601	strain: E20738A
GSE25601	strain: E24377A
GSE25601	strain: E2528C1
GSE25601	strain: E7473
GSE25601	strain: E7476A
GSE25601	strain: E8775
GSE25601	strain: E9034A
GSE25601	strain: ETEC 10
GSE25601	strain: ETEC 18
GSE25601	strain: ETEC 20
GSE25601	strain: ETEC 8
GSE25601	strain: ETEC Jurua
GSE25601	strain: ETP05-002
GSE25601	strain: ETP05-003
GSE25601	strain: ETP05-007
GSE25601	strain: ETP05-008
GSE25601	strain: ETP05-009
GSE25601	strain: ETP05-010
GSE25601	strain: ETP05-011
GSE25601	strain: ETP05-012
GSE25601	strain: ETP05-015
GSE25601	strain: ETP05-016
GSE25601	strain: ETP05-017
GSE25601	strain: ETP05-019
GSE25601	strain: ETP05-020
GSE25601	strain: ETP05-026
GSE25601	strain: ETP05-035
GSE25601	strain: ETP05-038
GSE25601	strain: ETP05-039
GSE25601	strain: ETP05-044
GSE25601	strain: ETP05-046
GSE25601	strain: ETP05-047
GSE25601	strain: ETP05-050
GSE25601	strain: ETP98004
GSE25601	strain: ETP98015
GSE25601	strain: ETP98028
GSE25601	strain: ETP98038
GSE25601	strain: ETP98042
GSE25601	strain: ETP98053
GSE25601	strain: ETP98056
GSE25601	strain: ETP98061
GSE25601	strain: ETP98062
GSE25601	strain: ETP98066
GSE25601	strain: ETP98068
GSE25601	strain: ETP98073
GSE25601	strain: ETP98097
GSE25601	strain: ETP98103
GSE25601	strain: ETP98105
GSE25601	strain: ETP98109
GSE25601	strain: ETP98111
GSE25601	strain: ETP98112
GSE25601	strain: ETP98114
GSE25601	strain: ETP98115
GSE25601	strain: F5656-C1
GSE25601	strain: F595C
GSE25601	strain: HS
GSE25601	strain: ICDDR,B_p1
GSE25601	strain: ICDDR,B_p10
GSE25601	strain: ICDDR,B_p11
GSE25601	strain: ICDDR,B_p12
GSE25601	strain: ICDDR,B_p13
GSE25601	strain: ICDDR,B_p2
GSE25601	strain: ICDDR,B_p4
GSE25601	strain: ICDDR,B_p5
GSE25601	strain: ICDDR,B_p6
GSE25601	strain: ICDDR,B_p7
GSE25601	strain: ICDDR,B_p8
GSE25601	strain: ICDDR,B_p9
GSE25601	strain: LSN02-012560
GSE25601	strain: LSN03-016011
GSE25601	strain: M408C1
GSE25601	strain: M424C1
GSE25601	strain: MG1655
GSE25601	strain: NN-34-1-3
GSE25601	strain: NR-12
GSE25601	strain: O157: h7
GSE25601	strain: O63:nm
GSE25601	strain: O78: h11
GSE25601	strain: PE360
GSE25601	strain: PUTI O26 UMN O26
GSE25601	strain: sPRH-20
GSE25601	strain: sPRH-21
GSE25601	strain: sPRH-25
GSE25601	strain: sPRH-372
GSE25601	strain: sPRH-403
GSE25601	strain: sPRH-414
GSE25601	strain: sPRH-418
GSE25601	strain: sPRH-420
GSE25601	strain: sPRH-421
GSE25601	strain: sPRH-443
GSE25601	strain: sPRH-445
GSE25601	strain: sPRH-450
GSE25601	strain: sPRH-604
GSE25601	strain: sPRH-605
GSE25601	strain: sPRH-606
GSE25601	strain: sPRH-609
GSE25601	strain: sPRH-610
GSE25601	strain: sPRH-612
GSE25601	strain: sPRH-613
GSE25601	strain: TW03439
GSE25601	strain: TW03452
GSE25601	strain: TW03574
GSE25601	strain: TW03576
GSE25601	strain: TW03585
GSE25601	strain: TW03741
GSE25601	strain: WS 0115A
GSE25601	strain: WS1896A
GSE25601	strain: WS1896 A-1
GSE25601	strain: WS 1933D
GSE25601	strain: WS2068A
GSE25601	strain: WS 2173A
GSE25601	strain: WS2741 A-1
GSE25601	strain: WS3080A
GSE25601	strain: WS 3294A
GSE25601	strain: WS 3572 A-1
GSE25601	strain: WS 3596 A-4
GSE25601	strain: WS4087 A-1
GSE25601	strain: WS4264 A-1
GSE25601	strain: WS5874 A-1
GSE25601	strain: WS6582 A-1
GSE25601	strain: WS 6866B-1
GSE25601	strain: WS 7162 A-1
GSE25601	strain: WS7179 A-2
GSE25745	CFT073 in LB, after 5 hours of growth.
GSE25745	CFT073 in LB+PACs (100 µg
GSE25745	CFT073_LB+PACs_rep1
GSE25745	CFT073_LB+PACs_rep2
GSE25745	CFT073_LB+PACs_rep3
GSE25745	CFT073_LB_rep1
GSE25745	CFT073_LB_rep2
GSE25745	CFT073_LB_rep3
GSE25745	Cultures of E. coli CFT073 were maintained at –80ºC in Luria-Bertani broth with 15% glycerol. Cultures were streaked onto LB agar plates and incubated (37°C, 24 h).  A single colony was inoculated into 150 mL of LB broth (in a 500 mL baffled flask).  Three inoculated flasks contained LB broth alone (controls), and three inoculated flasks were supplemented with cranberry derived PAC extract (100 µg
GSE25745	Escherichia coli
GSE25745	growth condition: LB broth alone (control)
GSE25745	growth condition: LB broth supplemented with cranberry PACs (100 µg
GSE25745	One volume of bacterial culture was added to two volumes of RNAprotect Bacteria Reagent (Qiagen) and RNA was extracted using RNeasy mini kit (Qiagen).  All samples were on-column treated with DNase I.
GSE25745	RNA extraction was performed according to the manufacturer's (Qiagen) instructions.
GSE25745	strain: CFT073
GSE25745	The data were analyzed with FlexArray 1.4.1 software program (http:
GSE25982	Comparison cya mutant with wt under glucose-limited conditions (replicate 1)
GSE25982	Comparison cya mutant with wt under glucose-limited conditions (replicate 2)
GSE25982	Comparison cya mutant with wt under glucose-limited conditions (replicate 3)
GSE25982	Comparison rpoS mutant with wt under glucose-limited conditions (replicate 1)
GSE25982	Comparison rpoS mutant with wt under glucose-limited conditions (replicate 2)
GSE25982	Comparison rpoS mutant with wt under glucose-limited conditions (replicate 3)
GSE25982	condition: glucose limited
GSE25982	control
GSE25982	cya mutant
GSE25982	Escherichia coli K-12
GSE25982	genotype: cya mutant
GSE25982	genotype: rpoS mutant
GSE25982	genotype: wild-type
GSE25982	rpoS mutant
GSE25982	strain: MG1655
GSE25982	The data provided are the original data generated with the Jaguar software from the microarray images. The VALUEs reported represent normalized log10 (Cy5
GSE25982	Total RNA was isolated as described (Sambrook et al., 1989). The extracted RNA was checked for purity by gel electrophoresis and was quantified by measuring extinction spectrophotometrically at 260 nm.
GSE26017	200µl of prepared E.coli O157 cells within LB broth is spreaded to LB agar plate, and sterilized 6mm filtered paper disk was placed on the plate tightly, where E.coli O157 is spreaded. Each filtered fractions are injected to each paper disk and Distilled water and Ampicillin were used as negative- and positive control each and then cultured at 37℃ for 24 hours. Finally the diameter of the cleared zone arisen around the paper disk was measured.
GSE26017	50µl of total RNA of the cells affected by the Chrysanthemum herba methyl chloride fraction was isolated. The RNA extraction procedure was carried out using the RNeasy mini kit (Qiagen, Inc.) according to the manufacturer’s instructions. Briefly, 1ml of bacterial culture was added to 2ml of RNA protect bacteria reagent (Qiagen, Inc.). Centrifugation (5000 g for 10 minutes) of the mixture was performed to precipitate the cells. The harvested cells were incubated in TE buffer with 1 mg
GSE26017	Data analysis was carried out using the Agilent GeneSpring GX. Robust Multi-array Average (RMA) normalization performed using of signal intensity spot data which obtained by scanning process and it is indicated as a scatter plot data. Distribution of all genes which obtained result of the experiment is indicated as a histogram. Accuracy of the results of the experiment was determined through comparison of the histogram with the scatter plot data.
GSE26017	EDL932 exposure to CL MC fraction
GSE26017	EDL932 unexposed
GSE26017	Escherichia coli
GSE26017	O157_CL MC fraction vs control
GSE26017	strain: E.coli O157:H7 EDL 932
GSE26017	The bacterial cells were grown at 37℃ for 17 hours on Luria-Bertani (LB) agar plate. An isolated colony was picked and inoculated into 100ml of sterilized LB broth (10g of tryptone, 5g of yeast extract and 10g of sodium chloride per liter) and incubated overnight for 17 hours at 37℃ with shaking at 250 rpm. A 1:100 dilution of the culture was performed using pre-warmed LB broth. The diluted culture was incubated at 37℃ with shaking at 250rpm until a final optical density (OD600) of 0.8 (early logarithmic phase) was attained. A further 1:10 dilution was performed using LB broth and incubated at 37℃ with shaking at 250 rpm.
GSE26054	antibody: 9E10 Myc tag antibody
GSE26054	antibody manufacturer: Upstate
GSE26054	antibody: normal mouse IgG
GSE26054	ArgR_Arginine_1
GSE26054	ArgR_Arginine_2
GSE26054	ArgR_NH4Cl_1
GSE26054	ArgR_NH4Cl_2
GSE26054	Cells at appropriate cell density were cross-linked by 1% formaldehyde at room temperature for 25 min. Following quenching the unused formaldehyde with a final concentration of 125 mM glycine at room temperature for 5 min. The cross-linked cells were harvested and washed three times with 50 mL of ice-cold TBS (Tris Buffered Saline). The washed cells were re-suspended in 0.5 mL lysis buffer composed of 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM EDTA, 1 ug
GSE26054	Cross-linked and sonicated chromatin complex of ArgR-8myc and DNA was immunoprecipitated by 9E10 myc antibody.
GSE26054	Cross-linked and sonicated chromatin complex of ArgR-8myc and DNA was immunoprecipitated by using normal mouse IgG for the control.
GSE26054	Cross-linked and sonicated chromatin complex of Lrp-8myc and DNA was immunoprecipitated by 9E10 myc antibody.
GSE26054	Cross-linked and sonicated chromatin complex of Lrp-8myc and DNA was immunoprecipitated by using normal mouse IgG for the control.
GSE26054	Cross-linked and sonicated chromatin complex of TrpR-8myc and DNA was immunoprecipitated by 9E10 myc antibody.
GSE26054	Cross-linked and sonicated chromatin complex of TrpR-8myc and DNA was immunoprecipitated by using normal mouse IgG for the control.
GSE26054	E. Coli ArgR ChIP DNA Arginine 1
GSE26054	E. Coli ArgR ChIP DNA Arginine 2
GSE26054	E. Coli ArgR ChIP DNA NH4Cl 1
GSE26054	E. Coli ArgR ChIP DNA NH4Cl 2
GSE26054	E. Coli Lrp ChIP DNA Leucine 1
GSE26054	E. Coli Lrp ChIP DNA Leucine 2
GSE26054	E. Coli Lrp ChIP DNA Leucine 3
GSE26054	E. Coli Lrp ChIP DNA NH4Cl 1
GSE26054	E. Coli Lrp ChIP DNA NH4Cl 2
GSE26054	E. Coli Lrp ChIP DNA NH4Cl 3
GSE26054	E. coli strains harboring ArgR-8myc were grown in glucose (2 g
GSE26054	E. coli strains harboring Lrp-8myc were grown in glucose (2 g
GSE26054	E. coli strains harboring TrpR-8myc were grown in glucose (2 g
GSE26054	E. Coli TrpR ChIP DNA glucose
GSE26054	E. Coli TrpR ChIP DNA Tryptophan
GSE26054	Escherichia coli str. K-12 substr. MG1655
GSE26054	genotype: ArgR-8myc
GSE26054	genotype: Lrp-8myc
GSE26054	genotype: TrpR-8myc
GSE26054	Lrp_Leu_1
GSE26054	Lrp_Leu_2
GSE26054	Lrp_Leu_3
GSE26054	Lrp_NH4Cl_1
GSE26054	Lrp_NH4Cl_2
GSE26054	Lrp_NH4Cl_3
GSE26054	The raw data (.pair file) was subjected to per channel quantile normalization (Bolstad et al. Bioinformatics 19(2):185), IP
GSE26054	treatment: glucose (2 g
GSE26054	TrpR_glucose
GSE26054	TrpR_Trp
GSE26187	agent: H2O
GSE26187	agent: ZnSO4
GSE26187	E. coli 0 mins
GSE26187	E. coli 10 mins
GSE26187	E. coli 2.5 mins
GSE26187	E. coli 30 mins
GSE26187	E. coli 7 mins
GSE26187	Escherichia coli
GSE26187	Spots automatically flagged as bad, negative or poor in the Imagene software were removed before the statistical analysis was carried out in GeneSight.  The mean values from each channel were log2 transformed and normalised using the Lowess method to remove intensity-dependent effects in the log2(ratios) values.  The Cy3
GSE26187	strain: MG1655
GSE26187	The average signal intensity and local background correction were obtained using a commercially available software package from Biodiscovery, Inc (Imagene, version 4.0 and GeneSight, version 3.5).
GSE26187	time: 0 mins
GSE26187	time: 10 mins
GSE26187	time: 2.5 mins
GSE26187	time: 30 mins
GSE26187	time: 7 mins
GSE26187	Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (0A1)
GSE26187	Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 0A2)
GSE26187	Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 0B1)
GSE26187	Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 0B2)
GSE26187	Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 10A1)
GSE26187	Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 10A2)
GSE26187	Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 10A3)
GSE26187	Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 10B1)
GSE26187	Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 10B2)
GSE26187	Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 2.5A1)
GSE26187	Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 2.5A2)
GSE26187	Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 2.5B1)
GSE26187	Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 2.5B2)
GSE26187	Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 30A1)
GSE26187	Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 30A2)
GSE26187	Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 30B1)
GSE26187	Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 30B2)
GSE26187	Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 7A1)
GSE26187	Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 7A2)
GSE26187	Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 7B1)
GSE26187	Transcriptional profiling of Escherichia coli during a transition from zinc starvation to surfeit (slide 7B2)
GSE26187	Zn-depleted custom-built chemostats were grown for 50 h.  At this point, ZnSO4.7H2O in water was added to a final concentration of 0.2 M in the chemostat.  A 10 ml sample of culture was taken using a polypropylene pipette tip immediately prior to Zn addition and 2.5, 7, 10 and 30 min after addition.  The culture was pipetted directly into RNAprotect (Qiagen) to stabilize RNA.  Total RNA was purified using Qiagen’s RNeasy Mini kit as recommended by the suppliers.  RNA was quantified using a BioPhotometer (Eppendorf).  A control experiment was carried out in which water was added.  
GSE26223	Butanol_Challenge_Step_1-1
GSE26223	Butanol_Challenge_Step_1-2
GSE26223	Butanol_Challenge_Step_2-1
GSE26223	Butanol_Challenge_Step_2-2
GSE26223	Butanol_Challenge_Step_3-1
GSE26223	Butanol_Challenge_Step_3-2
GSE26223	Butanol_Challenge_Step_4-1
GSE26223	Butanol_Challenge_Step_4-2
GSE26223	cell type: bacterial liquid culture
GSE26223	Control_Step_1-1
GSE26223	Control_Step_1-2
GSE26223	Control_Step_2-1
GSE26223	Control_Step_2-2
GSE26223	Control_Step_3-1
GSE26223	Control_Step_3-2
GSE26223	Control_Step_4-1
GSE26223	Control_Step_4-2
GSE26223	Escherichia coli
GSE26223	extracted molecule: plasmid DNA
GSE26223	Genomic Library of E. coli was enriched via serial transfers. The cells were grown in M9 minimal media (5 g
GSE26223	Non-challenged Library
GSE26223	other extracted using alkalyne lysis preparation. Plasmid DNA was clean and concentrated using Zymo Clean & Concentrated -5 kit
GSE26223	The image analysis performed using GenePix Pro 6.0 Software (Molecular Devices), normalized with MIDAS (LOWESS method), with clustering analysis in MeV (CAST)
GSE26340	Bacterial RNA was stabilized in vivo, by using RNA protect Bacteria Reagent (Qiagen). Total RNA was isolated by using RNeasy Kits for RNA purification (Qiagen) as per the manufacturer’s protocol.
GSE26340	Cells were grown to an OD of 0.4 and then 0.5 mM IPTG was added to induce the protein expression
GSE26340	Data extraction from Images was done using Feature Extraction software v 9.5.1 of Agilent. Feature extracted raw data was analyzed using GeneSpring GX V 7.3.1 software from Agilent. Normalization of the data was done in GeneSpring GX using the recommended one color Per Chip and Per Gene Data Transformation: Set measurements less than 0.01 to 0.01, Per Chip: Normalize to 50th percentile, Per Gene: Normalize to Specific Samples. Significant genes up and down regulated showing one fold and above among the samples was identified.
GSE26340	E. coli BL21(DE3) cells expressing catalytically inactive mutant of  M.HpyAVIB
GSE26340	E. coli BL21(DE3) cells expressing wild-type M.HpyAVIB
GSE26340	Escherichia coli BL21(DE3)
GSE26340	genotype
GSE26340	mutant
GSE26340	wild type
GSE26589	antibody: normal mouse IgG (Upstate)
GSE26589	Cells at appropriate cell density were cross-linked by 1% formaldehyde at room temperature for 25 min. Following quenching the unused formaldehyde with a final concentration of 125 mM glycine at room temperature for 5 min. The cross-linked cells were harvested and washed three times with 50 mL of ice-cold TBS (Tris Buffered Saline). The washed cells were re-suspended in 0.5 mL lysis buffer composed of 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM EDTA, 1 ug
GSE26589	chip antibody: 9E10 Myc tag antibody
GSE26589	Cross-linked and sonicated chromatin complex of PurR-8myc and DNA was immunoprecipitated by 9E10 myc antibody.
GSE26589	Cross-linked and sonicated chromatin complex of PurR-8myc and DNA was immunoprecipitated by using normal mouse IgG for the control.
GSE26589	E. Coli PurR ChIP DNA Adenine 1
GSE26589	E. Coli PurR ChIP DNA Adenine 2
GSE26589	E. Coli PurR ChIP DNA glucose 1
GSE26589	E. Coli PurR ChIP DNA glucose 2
GSE26589	E. Coli PurR Input DNA Adenine 1
GSE26589	E. Coli PurR Input DNA Adenine 2
GSE26589	E. Coli PurR Input DNA glucose 1
GSE26589	E. Coli PurR Input DNA glucose 2
GSE26589	E. coli strains harboring PurR-8myc were grown in minimal M9 medium supplemented with glucose (2 g
GSE26589	Escherichia coli str. K-12 substr. MG1655
GSE26589	genotype: PurR-8myc
GSE26589	growth condition: Adenine
GSE26589	growth condition: glucose
GSE26589	PurR_Adenine_1
GSE26589	PurR_Adenine_2
GSE26589	PurR_glucose_1
GSE26589	PurR_glucose_2
GSE26589	The raw data (.pair file) was subjected to per channel quantile normalization (Bolstad et al. Bioinformatics 19(2):185), IP
GSE26687	10_HF_HP_noDP_noRh [COPRO-Seq]
GSE26687	12_HF_LP_noDP [COPRO-Seq]
GSE26687	13_HF_LP_noDP [COPRO-Seq]
GSE26687	14_HF_LP_noDP [COPRO-Seq]
GSE26687	15_HF_LP_noDP [COPRO-Seq]
GSE26687	17_HF_HP_noDP [COPRO-Seq]
GSE26687	18_HF_HP_noDP [COPRO-Seq]
GSE26687	19_HF_HP_noDP [COPRO-Seq]
GSE26687	1_HF_LP_noDP_noRh [COPRO-Seq]
GSE26687	20_HF_HP_noDP [COPRO-Seq]
GSE26687	2_HF_LP_noDP_noRh [COPRO-Seq]
GSE26687	3_HF_LP_noDP_noRh [COPRO-Seq]
GSE26687	5_HF_LP_noDP_noRh [COPRO-Seq]
GSE26687	6_HF_HP_noDP_noRh [COPRO-Seq]
GSE26687	7_HF_HP_noDP_noRh [COPRO-Seq]
GSE26687	9_HF_HP_noDP_noRh [COPRO-Seq]
GSE26687	After dividing sequence runs by barcode, we mapped the reads to the relevant genomes using the ssaha2 algorithm. Minimum score thresholds for ssaha were selected based on the distribution of scores for all mapped reads of a 32nt barcoded sample and a 36-nt non-barcoded sample (29 was selected as the minimum score for 32nt barcoded samples; 33 was the minimum score used for 36-nt non-barcoded samples). Although an 18-nt read is sufficient to map more than 90% of the sequencing reads, even at 32-36nt there is a large fraction of the reads that map to multiple locations within a genome or across genomes. Reads that map non-uniquely were discarded.
GSE26687	Bacteroides caccae ATCC 43185
GSE26687	Bacteroides ovatus ATCC 8483
GSE26687	Bacteroides thetaiotaomicron VPI-5482
GSE26687	Blautia hydrogenotrophica DSM 10507
GSE26687	[Clostridium] symbiosum
GSE26687	Collinsella aerofaciens ATCC 25986
GSE26687	D2_14_m10 [COPRO-Seq]
GSE26687	D2_14_m11 [COPRO-Seq]
GSE26687	D2_14_m12 [COPRO-Seq]
GSE26687	D2_14_m13 [COPRO-Seq]
GSE26687	D2_14_m1 [COPRO-Seq]
GSE26687	D2_14_m2 [COPRO-Seq]
GSE26687	D2_14_m3 [COPRO-Seq]
GSE26687	D2_14_m4 [COPRO-Seq]
GSE26687	D2_14_m5 [COPRO-Seq]
GSE26687	D2_14_m7 [COPRO-Seq]
GSE26687	D2_14_m8 [COPRO-Seq]
GSE26687	D2_14_m9 [COPRO-Seq]
GSE26687	D2_1_m12 [COPRO-Seq]
GSE26687	D2_1_m13 [COPRO-Seq]
GSE26687	D2_1_m1 [COPRO-Seq]
GSE26687	D2_1_m2 [COPRO-Seq]
GSE26687	D2_1_m3 [COPRO-Seq]
GSE26687	D2_1_m4 [COPRO-Seq]
GSE26687	D2_1_m5 [COPRO-Seq]
GSE26687	D2_1_m6 [COPRO-Seq]
GSE26687	D2_1_m7 [COPRO-Seq]
GSE26687	D2_1_m8 [COPRO-Seq]
GSE26687	D2_1_m9 [COPRO-Seq]
GSE26687	D2_2_m10 [COPRO-Seq]
GSE26687	D2_2_m12 [COPRO-Seq]
GSE26687	D2_2_m13 [COPRO-Seq]
GSE26687	D2_2_m1 [COPRO-Seq]
GSE26687	D2_2_m2 [COPRO-Seq]
GSE26687	D2_2_m3 [COPRO-Seq]
GSE26687	D2_2_m4 [COPRO-Seq]
GSE26687	D2_2_m5 [COPRO-Seq]
GSE26687	D2_2_m6 [COPRO-Seq]
GSE26687	D2_2_m7 [COPRO-Seq]
GSE26687	D2_2_m8 [COPRO-Seq]
GSE26687	D2_2_m9 [COPRO-Seq]
GSE26687	D2_4_m10 [COPRO-Seq]
GSE26687	D2_4_m11 [COPRO-Seq]
GSE26687	D2_4_m12 [COPRO-Seq]
GSE26687	D2_4_m13 [COPRO-Seq]
GSE26687	D2_4_m1 [COPRO-Seq]
GSE26687	D2_4_m3 [COPRO-Seq]
GSE26687	D2_4_m4 [COPRO-Seq]
GSE26687	D2_4_m5 [COPRO-Seq]
GSE26687	D2_4_m6 [COPRO-Seq]
GSE26687	D2_4_m7 [COPRO-Seq]
GSE26687	D2_4_m8 [COPRO-Seq]
GSE26687	D2_4_m9 [COPRO-Seq]
GSE26687	D2_7_m10 [COPRO-Seq]
GSE26687	D2_7_m11 [COPRO-Seq]
GSE26687	D2_7_m12 [COPRO-Seq]
GSE26687	D2_7_m13 [COPRO-Seq]
GSE26687	D2_7_m1 [COPRO-Seq]
GSE26687	D2_7_m3 [COPRO-Seq]
GSE26687	D2_7_m4 [COPRO-Seq]
GSE26687	D2_7_m5 [COPRO-Seq]
GSE26687	D2_7_m6 [COPRO-Seq]
GSE26687	D2_7_m8 [COPRO-Seq]
GSE26687	D2_7_m9 [COPRO-Seq]
GSE26687	D3_10_m1
GSE26687	D3_10_m10
GSE26687	D3_10_m11
GSE26687	D3_10_m12
GSE26687	D3_10_m13
GSE26687	D3_10_m2
GSE26687	D3_10_m3
GSE26687	D3_10_m4
GSE26687	D3_10_m5
GSE26687	D3_10_m6
GSE26687	D3_10_m7
GSE26687	D3_10_m8
GSE26687	D3_10_m9
GSE26687	D3_14_m10 [COPRO-Seq]
GSE26687	D3_14_m11 [COPRO-Seq]
GSE26687	D3_14_m12 [COPRO-Seq]
GSE26687	D3_14_m13 [COPRO-Seq]
GSE26687	D3_14_m2 [COPRO-Seq]
GSE26687	D3_14_m3 [COPRO-Seq]
GSE26687	D3_14_m4 [COPRO-Seq]
GSE26687	D3_14_m5 [COPRO-Seq]
GSE26687	D3_14_m6 [COPRO-Seq]
GSE26687	D3_14_m7 [COPRO-Seq]
GSE26687	D3_14_m8 [COPRO-Seq]
GSE26687	D3_14_m9 [COPRO-Seq]
GSE26687	D3_1_m10 [COPRO-Seq]
GSE26687	D3_1_m11 [COPRO-Seq]
GSE26687	D3_1_m13 [COPRO-Seq]
GSE26687	D3_1_m1 [COPRO-Seq]
GSE26687	D3_1_m2 [COPRO-Seq]
GSE26687	D3_1_m3 [COPRO-Seq]
GSE26687	D3_1_m4 [COPRO-Seq]
GSE26687	D3_1_m5 [COPRO-Seq]
GSE26687	D3_1_m6 [COPRO-Seq]
GSE26687	D3_1_m7 [COPRO-Seq]
GSE26687	D3_1_m8 [COPRO-Seq]
GSE26687	D3_2_m10 [COPRO-Seq]
GSE26687	D3_2_m11 [COPRO-Seq]
GSE26687	D3_2_m12 [COPRO-Seq]
GSE26687	D3_2_m13 [COPRO-Seq]
GSE26687	D3_2_m2 [COPRO-Seq]
GSE26687	D3_2_m4 [COPRO-Seq]
GSE26687	D3_2_m5 [COPRO-Seq]
GSE26687	D3_2_m6 [COPRO-Seq]
GSE26687	D3_2_m7 [COPRO-Seq]
GSE26687	D3_4_m10 [COPRO-Seq]
GSE26687	D3_4_m11 [COPRO-Seq]
GSE26687	D3_4_m12 [COPRO-Seq]
GSE26687	D3_4_m13 [COPRO-Seq]
GSE26687	D3_4_m1 [COPRO-Seq]
GSE26687	D3_4_m2 [COPRO-Seq]
GSE26687	D3_4_m3 [COPRO-Seq]
GSE26687	D3_4_m4 [COPRO-Seq]
GSE26687	D3_4_m5 [COPRO-Seq]
GSE26687	D3_4_m6 [COPRO-Seq]
GSE26687	D3_4_m7 [COPRO-Seq]
GSE26687	D3_4_m8 [COPRO-Seq]
GSE26687	D3_4_m9 [COPRO-Seq]
GSE26687	D3_7_m10 [COPRO-Seq]
GSE26687	D3_7_m11 [COPRO-Seq]
GSE26687	D3_7_m12 [COPRO-Seq]
GSE26687	D3_7_m13 [COPRO-Seq]
GSE26687	D3_7_m1 [COPRO-Seq]
GSE26687	D3_7_m2 [COPRO-Seq]
GSE26687	D3_7_m3 [COPRO-Seq]
GSE26687	D3_7_m4 [COPRO-Seq]
GSE26687	D3_7_m5 [COPRO-Seq]
GSE26687	D3_7_m6 [COPRO-Seq]
GSE26687	D3_7_m9 [COPRO-Seq]
GSE26687	D4_10_m1
GSE26687	D4_10_m10
GSE26687	D4_10_m11
GSE26687	D4_10_m12
GSE26687	D4_10_m13
GSE26687	D4_10_m2
GSE26687	D4_10_m3
GSE26687	D4_10_m4
GSE26687	D4_10_m5
GSE26687	D4_10_m6
GSE26687	D4_10_m7
GSE26687	D4_10_m8
GSE26687	D4_10_m9
GSE26687	D4_14_m10 [COPRO-Seq]
GSE26687	D4_14_m11 [COPRO-Seq]
GSE26687	D4_14_m12 [COPRO-Seq]
GSE26687	D4_14_m13 [COPRO-Seq]
GSE26687	D4_14_m1 [COPRO-Seq]
GSE26687	D4_14_m2 [COPRO-Seq]
GSE26687	D4_14_m3 [COPRO-Seq]
GSE26687	D4_14_m5 [COPRO-Seq]
GSE26687	D4_14_m6 [COPRO-Seq]
GSE26687	D4_14_m7 [COPRO-Seq]
GSE26687	D4_14_m8 [COPRO-Seq]
GSE26687	D4_14_m9 [COPRO-Seq]
GSE26687	D4_1_m10 [COPRO-Seq]
GSE26687	D4_1_m11 [COPRO-Seq]
GSE26687	D4_1_m12 [COPRO-Seq]
GSE26687	D4_1_m13 [COPRO-Seq]
GSE26687	D4_1_m7 [COPRO-Seq]
GSE26687	D4_1_m8 [COPRO-Seq]
GSE26687	D4_1_m9 [COPRO-Seq]
GSE26687	D4_2_m10 [COPRO-Seq]
GSE26687	D4_2_m11 [COPRO-Seq]
GSE26687	D4_2_m12 [COPRO-Seq]
GSE26687	D4_2_m13 [COPRO-Seq]
GSE26687	D4_2_m2 [COPRO-Seq]
GSE26687	D4_2_m3 [COPRO-Seq]
GSE26687	D4_2_m4 [COPRO-Seq]
GSE26687	D4_2_m5 [COPRO-Seq]
GSE26687	D4_2_m6 [COPRO-Seq]
GSE26687	D4_2_m7 [COPRO-Seq]
GSE26687	D4_2_m8 [COPRO-Seq]
GSE26687	D4_2_m9 [COPRO-Seq]
GSE26687	D4_4_m10 [COPRO-Seq]
GSE26687	D4_4_m12 [COPRO-Seq]
GSE26687	D4_4_m13 [COPRO-Seq]
GSE26687	D4_4_m2 [COPRO-Seq]
GSE26687	D4_4_m4 [COPRO-Seq]
GSE26687	D4_4_m5 [COPRO-Seq]
GSE26687	D4_4_m6 [COPRO-Seq]
GSE26687	D4_4_m7 [COPRO-Seq]
GSE26687	D4_4_m8 [COPRO-Seq]
GSE26687	D4_4_m9 [COPRO-Seq]
GSE26687	D4_7_m1 [COPRO-Seq]
GSE26687	D4_7_m2 [COPRO-Seq]
GSE26687	D4_7_m3 [COPRO-Seq]
GSE26687	D4_7_m4 [COPRO-Seq]
GSE26687	D4_7_m5 [COPRO-Seq]
GSE26687	D4_7_m6 [COPRO-Seq]
GSE26687	Desulfovibrio piger GOR1
GSE26687	diet: Mouse was fed a meal of human pureed food in the following concentrations (g
GSE26687	diet: Mouse was fed Harlan Teklad Diet TD.09049
GSE26687	diet: Mouse was fed Harlan Teklad Diet TD.09050
GSE26687	diet: Mouse was fed Harlan Teklad Diet TD.09051
GSE26687	diet: Mouse was fed Harlan Teklad Diet TD.09052
GSE26687	diet: Mouse was fed Harlan Teklad Diet TD.09053
GSE26687	diet: Mouse was fed Harlan Teklad Diet TD.09054
GSE26687	diet: Mouse was fed Harlan Teklad Diet TD.09055
GSE26687	diet: Mouse was fed Harlan Teklad Diet TD.09055.
GSE26687	diet: Mouse was fed Harlan Teklad Diet TD.09056
GSE26687	diet: Mouse was fed Harlan Teklad Diet TD.09057
GSE26687	diet: Mouse was fed Harlan Teklad Diet TD.09057.
GSE26687	diet: Mouse was fed Harlan Teklad Diet TD.09058
GSE26687	diet: Mouse was fed Harlan Teklad Diet TD.09059
GSE26687	diet: Mouse was fed Harlan Teklad Diet TD.09620
GSE26687	diet: Mouse was fed Harlan Teklad Diet TD.09621
GSE26687	diet: Mouse was fed Harlan Teklad Diet TD.09622
GSE26687	diet: Mouse was fed Harlan Teklad Diet TD.09623
GSE26687	diet: Mouse was fed Harlan Teklad Diet TD.09624
GSE26687	diet: Mouse was fed Harlan Teklad Diet TD.09625
GSE26687	Double stranded cDNA was generated using Superscript II (Invitrogen) to generate the first strand followed by E. coli DNA polymerase, RNaseH, and E.coli DNA ligase (NEB) to generate the second strand.
GSE26687	Double stranded cDNA was generated using Superscript II (Invitrogen) to generate the first strand followed by E. coli DNA polymerase, RNaseH, and E.coli DNA ligase (NEB) to generate the second strand.isoamyl alcohol (25:24:1, pH 8.0; Ambion) and lysed by using a bead beater (BioSpec Products). Cellular debris was removed by centrifugation (8,000g; 3 min). The nucleic acids were precipitated with isopropanol and sodium acetate and resuspended in 100 ul TE. The resuspension was further purified with a Qiagen PCR column and eluted into 30 ul of EB buffer.
GSE26687	E11_1_m1 [COPRO-Seq]
GSE26687	E11_1_m3 [COPRO-Seq]
GSE26687	E11_1_m4 [COPRO-Seq]
GSE26687	E11_1_m5 [COPRO-Seq]
GSE26687	E11_1_m6 [COPRO-Seq]
GSE26687	E11_1_m7 [COPRO-Seq]
GSE26687	E11_1_m8 [COPRO-Seq]
GSE26687	E1_14_m1
GSE26687	E1_14_m1 [COPRO-Seq]
GSE26687	E11_4_m1 [COPRO-Seq]
GSE26687	E1_14_m2
GSE26687	E1_14_m2 [COPRO-Seq]
GSE26687	E1_14_m3
GSE26687	E1_14_m3 [COPRO-Seq]
GSE26687	E1_14_m4
GSE26687	E1_14_m4 [COPRO-Seq]
GSE26687	E11_4_m4 [COPRO-Seq]
GSE26687	E1_14_m5 [COPRO-Seq]
GSE26687	E11_4_m5 [COPRO-Seq]
GSE26687	E1_14_m6 [COPRO-Seq]
GSE26687	E1_14_m7 [COPRO-Seq]
GSE26687	E11_4_m7 [COPRO-Seq]
GSE26687	E1_14_m8
GSE26687	E1_14_m8 [COPRO-Seq]
GSE26687	E11_4_m8 [COPRO-Seq]
GSE26687	E11_6_m2 [COPRO-Seq]
GSE26687	E11_6_m3 [COPRO-Seq]
GSE26687	E11_6_m4 [COPRO-Seq]
GSE26687	E11_6_m5 [COPRO-Seq]
GSE26687	E11_7_m1 [COPRO-Seq]
GSE26687	E11_7_m2 [COPRO-Seq]
GSE26687	E11_7_m3 [COPRO-Seq]
GSE26687	E11_7_m4 [COPRO-Seq]
GSE26687	E11_7_m6 [COPRO-Seq]
GSE26687	E11_7_m7 [COPRO-Seq]
GSE26687	E11_7_m8 [COPRO-Seq]
GSE26687	E1_1_m1 [COPRO-Seq]
GSE26687	E1_1_m2 [COPRO-Seq]
GSE26687	E1_1_m4 [COPRO-Seq]
GSE26687	E1_1_m5 [COPRO-Seq]
GSE26687	E1_1_m7 [COPRO-Seq]
GSE26687	E1_1_m8 [COPRO-Seq]
GSE26687	E1_2_m1 [COPRO-Seq]
GSE26687	E1_2_m2 [COPRO-Seq]
GSE26687	E1_2_m3 [COPRO-Seq]
GSE26687	E1_2_m4 [COPRO-Seq]
GSE26687	E1_2_m5 [COPRO-Seq]
GSE26687	E1_2_m6 [COPRO-Seq]
GSE26687	E1_2_m7 [COPRO-Seq]
GSE26687	E1_2_m8 [COPRO-Seq]
GSE26687	E13_1_m1 [COPRO-Seq]
GSE26687	E13_1_m2 [COPRO-Seq]
GSE26687	E13_1_m3 [COPRO-Seq]
GSE26687	E13_1_m4 [COPRO-Seq]
GSE26687	E13_1_m5 [COPRO-Seq]
GSE26687	E13_1_m6 [COPRO-Seq]
GSE26687	E13_1_m7 [COPRO-Seq]
GSE26687	E13_1_m8 [COPRO-Seq]
GSE26687	E13_4_m1 [COPRO-Seq]
GSE26687	E13_4_m3 [COPRO-Seq]
GSE26687	E13_4_m4 [COPRO-Seq]
GSE26687	E13_4_m5 [COPRO-Seq]
GSE26687	E13_4_m6 [COPRO-Seq]
GSE26687	E13_4_m7 [COPRO-Seq]
GSE26687	E13_4_m8 [COPRO-Seq]
GSE26687	E13_6_m1 [COPRO-Seq]
GSE26687	E13_6_m4 [COPRO-Seq]
GSE26687	E13_6_m5 [COPRO-Seq]
GSE26687	E13_7_m1 [COPRO-Seq]
GSE26687	E13_7_m2 [COPRO-Seq]
GSE26687	E13_7_m4 [COPRO-Seq]
GSE26687	E13_7_m5 [COPRO-Seq]
GSE26687	E13_7_m6 [COPRO-Seq]
GSE26687	E13_7_m7 [COPRO-Seq]
GSE26687	E13_7_m8 [COPRO-Seq]
GSE26687	E1_4_m1 [COPRO-Seq]
GSE26687	E1_4_m2 [COPRO-Seq]
GSE26687	E1_4_m3 [COPRO-Seq]
GSE26687	E1_4_m4 [COPRO-Seq]
GSE26687	E1_4_m5 [COPRO-Seq]
GSE26687	E1_4_m6 [COPRO-Seq]
GSE26687	E1_4_m7 [COPRO-Seq]
GSE26687	E1_4_m8 [COPRO-Seq]
GSE26687	E15_1_m1 [COPRO-Seq]
GSE26687	E15_1_m2 [COPRO-Seq]
GSE26687	E15_1_m3 [COPRO-Seq]
GSE26687	E15_1_m4 [COPRO-Seq]
GSE26687	E15_1_m5 [COPRO-Seq]
GSE26687	E15_1_m7 [COPRO-Seq]
GSE26687	E15_1_m8 [COPRO-Seq]
GSE26687	E15_4_m1 [COPRO-Seq]
GSE26687	E15_4_m2 [COPRO-Seq]
GSE26687	E15_4_m3 [COPRO-Seq]
GSE26687	E15_4_m4 [COPRO-Seq]
GSE26687	E15_4_m6 [COPRO-Seq]
GSE26687	E15_4_m7 [COPRO-Seq]
GSE26687	E15_4_m8 [COPRO-Seq]
GSE26687	E15_6_m1 [COPRO-Seq]
GSE26687	E15_6_m3 [COPRO-Seq]
GSE26687	E15_6_m5 [COPRO-Seq]
GSE26687	E15_6_m6 [COPRO-Seq]
GSE26687	E15_6_m7 [COPRO-Seq]
GSE26687	E15_6_m8 [COPRO-Seq]
GSE26687	E15_7_m1 [COPRO-Seq]
GSE26687	E15_7_m3 [COPRO-Seq]
GSE26687	E15_7_m4 [COPRO-Seq]
GSE26687	E15_7_m5 [COPRO-Seq]
GSE26687	E15_7_m7 [COPRO-Seq]
GSE26687	E15_7_m8 [COPRO-Seq]
GSE26687	E17_1_m1 [COPRO-Seq]
GSE26687	E17_1_m2 [COPRO-Seq]
GSE26687	E17_1_m3 [COPRO-Seq]
GSE26687	E17_1_m4 [COPRO-Seq]
GSE26687	E17_1_m5 [COPRO-Seq]
GSE26687	E17_1_m6 [COPRO-Seq]
GSE26687	E17_1_m7 [COPRO-Seq]
GSE26687	E17_1_m8 [COPRO-Seq]
GSE26687	E17_4_m1 [COPRO-Seq]
GSE26687	E17_4_m2 [COPRO-Seq]
GSE26687	E17_4_m3 [COPRO-Seq]
GSE26687	E17_4_m4 [COPRO-Seq]
GSE26687	E17_4_m5 [COPRO-Seq]
GSE26687	E17_4_m6 [COPRO-Seq]
GSE26687	E17_4_m7 [COPRO-Seq]
GSE26687	E17_4_m8 [COPRO-Seq]
GSE26687	E17_6_m1 [COPRO-Seq]
GSE26687	E17_6_m3 [COPRO-Seq]
GSE26687	E17_6_m4 [COPRO-Seq]
GSE26687	E17_6_m5 [COPRO-Seq]
GSE26687	E17_6_m6 [COPRO-Seq]
GSE26687	E17_6_m7 [COPRO-Seq]
GSE26687	E17_6_m8 [COPRO-Seq]
GSE26687	E17_7_m1 [COPRO-Seq]
GSE26687	E17_7_m2 [COPRO-Seq]
GSE26687	E17_7_m3 [COPRO-Seq]
GSE26687	E17_7_m4 [COPRO-Seq]
GSE26687	E17_7_m6 [COPRO-Seq]
GSE26687	E17_7_m7 [COPRO-Seq]
GSE26687	E1_7_m1 [COPRO-Seq]
GSE26687	E1_7_m2 [COPRO-Seq]
GSE26687	E1_7_m3 [COPRO-Seq]
GSE26687	E1_7_m4 [COPRO-Seq]
GSE26687	E1_7_m5 [COPRO-Seq]
GSE26687	E1_7_m6 [COPRO-Seq]
GSE26687	E1_7_m7 [COPRO-Seq]
GSE26687	E1_7_m8 [COPRO-Seq]
GSE26687	E19_1_m1 [COPRO-Seq]
GSE26687	E19_1_m2 [COPRO-Seq]
GSE26687	E19_1_m3 [COPRO-Seq]
GSE26687	E19_1_m4 [COPRO-Seq]
GSE26687	E19_1_m5 [COPRO-Seq]
GSE26687	E19_1_m6 [COPRO-Seq]
GSE26687	E19_1_m7 [COPRO-Seq]
GSE26687	E19_1_m8 [COPRO-Seq]
GSE26687	E19_4_m2 [COPRO-Seq]
GSE26687	E19_4_m3 [COPRO-Seq]
GSE26687	E19_4_m4 [COPRO-Seq]
GSE26687	E19_4_m5 [COPRO-Seq]
GSE26687	E19_4_m6 [COPRO-Seq]
GSE26687	E19_4_m7 [COPRO-Seq]
GSE26687	E19_4_m8 [COPRO-Seq]
GSE26687	E19_6_m1 [COPRO-Seq]
GSE26687	E19_6_m2 [COPRO-Seq]
GSE26687	E19_6_m3 [COPRO-Seq]
GSE26687	E19_6_m4 [COPRO-Seq]
GSE26687	E19_6_m5 [COPRO-Seq]
GSE26687	E19_6_m6 [COPRO-Seq]
GSE26687	E19_6_m7 [COPRO-Seq]
GSE26687	E19_6_m8 [COPRO-Seq]
GSE26687	E19_7_m1 [COPRO-Seq]
GSE26687	E19_7_m2 [COPRO-Seq]
GSE26687	E19_7_m3 [COPRO-Seq]
GSE26687	E19_7_m4 [COPRO-Seq]
GSE26687	E19_7_m5 [COPRO-Seq]
GSE26687	E19_7_m6 [COPRO-Seq]
GSE26687	E19_7_m7 [COPRO-Seq]
GSE26687	E19_7_m8 [COPRO-Seq]
GSE26687	E2_14_m1
GSE26687	E2_14_m1 [COPRO-Seq]
GSE26687	E2_14_m2 [COPRO-Seq]
GSE26687	E2_14_m3
GSE26687	E2_14_m3 [COPRO-Seq]
GSE26687	E2_14_m4
GSE26687	E2_14_m4 [COPRO-Seq]
GSE26687	E2_14_m5 [COPRO-Seq]
GSE26687	E2_14_m6
GSE26687	E2_14_m6 [COPRO-Seq]
GSE26687	E2_14_m7 [COPRO-Seq]
GSE26687	E2_14_m8
GSE26687	E2_1_m1 [COPRO-Seq]
GSE26687	E2_1_m2 [COPRO-Seq]
GSE26687	E2_1_m3 [COPRO-Seq]
GSE26687	E2_1_m4 [COPRO-Seq]
GSE26687	E2_1_m5 [COPRO-Seq]
GSE26687	E2_1_m6 [COPRO-Seq]
GSE26687	E2_1_m7 [COPRO-Seq]
GSE26687	E2_1_m8 [COPRO-Seq]
GSE26687	E2_2_m1 [COPRO-Seq]
GSE26687	E2_2_m2 [COPRO-Seq]
GSE26687	E2_2_m3 [COPRO-Seq]
GSE26687	E2_2_m4 [COPRO-Seq]
GSE26687	E2_2_m5 [COPRO-Seq]
GSE26687	E2_2_m6 [COPRO-Seq]
GSE26687	E2_2_m7 [COPRO-Seq]
GSE26687	E2_2_m8 [COPRO-Seq]
GSE26687	E2_4_m1 [COPRO-Seq]
GSE26687	E2_4_m2 [COPRO-Seq]
GSE26687	E2_4_m3 [COPRO-Seq]
GSE26687	E2_4_m4 [COPRO-Seq]
GSE26687	E2_4_m5 [COPRO-Seq]
GSE26687	E2_4_m6 [COPRO-Seq]
GSE26687	E2_4_m7 [COPRO-Seq]
GSE26687	E2_4_m8 [COPRO-Seq]
GSE26687	E2_7_m1 [COPRO-Seq]
GSE26687	E2_7_m2 [COPRO-Seq]
GSE26687	E2_7_m3 [COPRO-Seq]
GSE26687	E2_7_m4 [COPRO-Seq]
GSE26687	E2_7_m5 [COPRO-Seq]
GSE26687	E2_7_m6 [COPRO-Seq]
GSE26687	E2_7_m7 [COPRO-Seq]
GSE26687	E2_7_m8 [COPRO-Seq]
GSE26687	E3_14_m1 [COPRO-Seq]
GSE26687	E3_14_m2 [COPRO-Seq]
GSE26687	E3_14_m3 [COPRO-Seq]
GSE26687	E3_14_m4 [COPRO-Seq]
GSE26687	E3_14_m6 [COPRO-Seq]
GSE26687	E3_14_m7 [COPRO-Seq]
GSE26687	E3_14_m8 [COPRO-Seq]
GSE26687	E3_1_m1 [COPRO-Seq]
GSE26687	E3_1_m2 [COPRO-Seq]
GSE26687	E3_1_m3 [COPRO-Seq]
GSE26687	E3_1_m4 [COPRO-Seq]
GSE26687	E3_1_m5 [COPRO-Seq]
GSE26687	E3_1_m6 [COPRO-Seq]
GSE26687	E3_1_m7 [COPRO-Seq]
GSE26687	E3_1_m8 [COPRO-Seq]
GSE26687	E3_2_m1 [COPRO-Seq]
GSE26687	E3_2_m2 [COPRO-Seq]
GSE26687	E3_2_m3 [COPRO-Seq]
GSE26687	E3_2_m4 [COPRO-Seq]
GSE26687	E3_2_m5 [COPRO-Seq]
GSE26687	E3_2_m6 [COPRO-Seq]
GSE26687	E3_2_m7 [COPRO-Seq]
GSE26687	E3_2_m8 [COPRO-Seq]
GSE26687	E3_4_m2 [COPRO-Seq]
GSE26687	E3_4_m3 [COPRO-Seq]
GSE26687	E3_4_m4 [COPRO-Seq]
GSE26687	E3_4_m5 [COPRO-Seq]
GSE26687	E3_4_m6 [COPRO-Seq]
GSE26687	E3_4_m7 [COPRO-Seq]
GSE26687	E3_4_m8 [COPRO-Seq]
GSE26687	E3_7_m1 [COPRO-Seq]
GSE26687	E3_7_m2 [COPRO-Seq]
GSE26687	E3_7_m3 [COPRO-Seq]
GSE26687	E3_7_m4 [COPRO-Seq]
GSE26687	E3_7_m5 [COPRO-Seq]
GSE26687	E3_7_m6 [COPRO-Seq]
GSE26687	E3_7_m7 [COPRO-Seq]
GSE26687	E3_7_m8 [COPRO-Seq]
GSE26687	E9_1_m1 [COPRO-Seq]
GSE26687	E9_1_m2 [COPRO-Seq]
GSE26687	E9_1_m3 [COPRO-Seq]
GSE26687	E9_1_m4 [COPRO-Seq]
GSE26687	E9_1_m5 [COPRO-Seq]
GSE26687	E9_1_m6 [COPRO-Seq]
GSE26687	E9_1_m7 [COPRO-Seq]
GSE26687	E9_1_m8 [COPRO-Seq]
GSE26687	E9_4_m1 [COPRO-Seq]
GSE26687	E9_4_m2 [COPRO-Seq]
GSE26687	E9_4_m3 [COPRO-Seq]
GSE26687	E9_4_m4 [COPRO-Seq]
GSE26687	E9_4_m5 [COPRO-Seq]
GSE26687	E9_4_m6 [COPRO-Seq]
GSE26687	E9_4_m7 [COPRO-Seq]
GSE26687	E9_4_m8 [COPRO-Seq]
GSE26687	E9_6_m2 [COPRO-Seq]
GSE26687	E9_6_m3 [COPRO-Seq]
GSE26687	E9_6_m4 [COPRO-Seq]
GSE26687	E9_6_m5 [COPRO-Seq]
GSE26687	E9_6_m7 [COPRO-Seq]
GSE26687	E9_7_m2 [COPRO-Seq]
GSE26687	E9_7_m3 [COPRO-Seq]
GSE26687	E9_7_m4 [COPRO-Seq]
GSE26687	E9_7_m5 [COPRO-Seq]
GSE26687	E9_7_m6 [COPRO-Seq]
GSE26687	E9_7_m7 [COPRO-Seq]
GSE26687	E9_7_m8 [COPRO-Seq]
GSE26687	Escherichia coli str. K-12 substr. MG1655
GSE26687	[Eubacterium] rectale ATCC 33656
GSE26687	Fecal samples obtained from mice were immediately frozen in liquid nitrogen and stored at -80 °C until processing. All of the samples were suspended in a solution containing 500 ul of acid-washed glass beads (Sigma-Aldrich), 500 ul of extraction buffer A (200 mM Tris [pH 8], 200 mM NaCl, 20 mM EDTA), 200 ul of 20% SDS, and 500 ul of a mixture of phenol:chloroform:isoamyl alcohol (25:24:1, pH 8.0; Ambion) and lysed by using a bead beater (BioSpec Products). Cellular debris was removed by centrifugation (8,000g; 3 min). The nucleic acids were precipitated with isopropanol and sodium acetate and resuspended in 100 ul TE. The resuspension was further purified with a Qiagen PCR column and eluted into 30 ul of EB buffer.
GSE26687	Fecal samples obtained from mice were immediately frozen in liquid nitrogen and stored at -80 °C until processing. All of the samples were treated with RNAProtect (Qiagen) and suspended in a solution containing 500 μl of acid-washed glass beads (Sigma-Aldrich), 500 μl of extraction buffer A (200 mM NaCl, 20 mM EDTA), 210 μl of 20% SDS, and 500 μl of a mixture of phenol:chloroform:isoamyl alcohol (125:24:1, pH 4.5; Ambion) and lysed by using a bead beater (BioSpec Products). Cellular debris was removed by centrifugation (8,000 × g; 3 min). The nucleic acids were precipitated with isopropanol and sodium acetate (pH 5.5).
GSE26687	Fecal samples obtained from mice were span frozen in liquid nitrogen and stored at -80°C and maintained at this temperature prior to processing.
GSE26687	Libraries were prepared according to Illumina's instructions accompanying the genomic DNA Sample Kit. Briefly, cDNA was sonicated in a biorupter sonicator, cleaned up
GSE26687	Libraries were prepared according to Illumina's instructions accompanying the genomic DNA Sample Kit. Briefly, gDNA was sonicated in a biorupter sonicator, cleaned up
GSE26687	Marvinbryantia formatexigens DSM 14469
GSE26687	mouse feces
GSE26687	OTHER
GSE26687	RNA-Seq
GSE26687	rRNA depletion: Genomic DNA was removed with TURBO DNAse (Ambion), and then total RNA was run over two MEGAClear columns (Ambion) to deplete tRNAs and 5S rRNA. In between the two column purifications, a second DNAse digestion was performed (Baseline-ZERO Epicenter).  16S and 23S rRNA were depleted using MICROBExpress (Ambion) and custom depletion oligos (Rey et.al. 2010; JBC).
GSE26687	sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria
GSE26687	sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09049
GSE26687	sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09050
GSE26687	sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09051
GSE26687	sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09052
GSE26687	sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09053
GSE26687	sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09054
GSE26687	sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09055
GSE26687	sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09056
GSE26687	sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09057
GSE26687	sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09058
GSE26687	sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09059
GSE26687	sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09620
GSE26687	sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09621
GSE26687	sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09622
GSE26687	sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09623
GSE26687	sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09624
GSE26687	sample source: Fecal pellet from a mouse (c57Bl6) colonized with 10-gut bacteria. Mouse was fed Harlan Teklad Diet TD.09625
GSE26687	sample source: Fecal pellet from a mouse (c57Bl6) colonized with 8-gut bacteria
GSE26687	sample source: Fecal pellet from a mouse (c57Bl6) colonized with 9-gut bacteria
GSE26687	time: Sample was taken after mouse was on the diet for 14 days.
GSE26687	time: Sample was taken after mouse was on the diet for 1 days.
GSE26687	time: Sample was taken after mouse was on the diet for 2 days.
GSE26687	time: Sample was taken after mouse was on the diet for 4 days.
GSE26687	time: Sample was taken after mouse was on the diet for 6 days.
GSE26687	time: Sample was taken after mouse was on the diet for 7 days.
GSE27607	AW1.7, steady-state continuous cultured experimental samples at 37°C
GSE27607	AW1.7, steady-state continuous cultured experimental samples at 37°C and then 15 minutes heatshock at 50 °C
GSE27607	Cultures were inoculated from a single colony, incubated overnight, sub-cultured with a 1% inoculum, and grown to the late exponential growth phase, corresponding to an OD600 nm of 0.6 – 0.7.
GSE27607	Escherichia coli
GSE27607	First biological repeat 37°C
GSE27607	First biological repeat 50°C
GSE27607	For RNA isolation, 0.5 mL of the cultures were mixed with 1 mL RNA protect (Qiagen, Ontario, Canada) and RNA was isolated using the RNeasy Mini kit (Qiagen). RNA was quantified with a Nanodrop Spectrophotometer (Thermo scientific, Wilmington, USA) and RNA quality was determined with a Bioanalyzer 2100 (Agilent Technologies, Santa Clara, USA). RNA samples (approximately 30 µg) were treated with 1U RNase free DNase I (Ambion, Ontario, Canada) at 37°C for 30 min and 1U RNase inhibitor (Ambion) was added prior to storage at 4°C. RNA was reverse-transcribed using the Array 900MPX Expression Array Detection Kit (Genisphere, Hatfield, USA) according to the instructions of the manufacturer. The cDNA was purified using the MinElute PCR Purification Kit (Quiagen), and the purified DNA was used for microarray and qPCR experiments.
GSE27607	GGG10, steady-state continuous cultured experimental samples at 37°C
GSE27607	GGG10, steady-state continuous cultured experimental samples at 37°C and then 15 minutes heatshock at 50 °C
GSE27607	heat sensitivity: resistant
GSE27607	heat sensitivity: sensitive
GSE27607	Raw data were normalized and log2 transformed with the Acuity 4.0 software package, and data with low fluorescence intensities were eliminated. Genes were considered to be differentially expressed if the absolute values of log2 mean expression ratios were ≥ 1.
GSE27607	RNA was isolated from late exponential cultures, or from late exponential cells heat-shocked by exposure to 50°C for 15 min.
GSE27607	Second biological repeat 37°C
GSE27607	Second biological repeat 50°C
GSE27607	strain: AW1.7
GSE27607	strain: GGG10
GSE27607	The data did not undergo normalization across samples.
GSE27607	Third biological repeat 37°C
GSE27607	Third biological repeat 50°C
GSE27607	treatment: 37°C
GSE27607	treatment: 50°C heatshock
GSE28144	agent: 0.05 mg
GSE28144	agent: control
GSE28144	E. coli O157:H7 EDL933 in LB at 37oC at 7 hrs incubation
GSE28144	E. coli O157:H7 EDL933 in LB at 37oC at 7 hrs incubation with phloretin
GSE28144	E. coli O157:H7 EDL933 was inoculated in 25 ml of LB in 250 ml shake flasks with overnight cultures that were diluted 1:100. Cells were shaken at 100 rpm and 37°C for 7 hrs.  Cells were immediately chilled with dry ice and 95% ethanol (to prevent RNA degradation) for 30 sec before centrifugation in 50 ml centrifuge tubes at 13,000 g for 2 min; cell pellets were frozen immediately with dry ice and stored -80°C.  RNA was isolated using Qiagen RNeasy mini Kit (Cat# 74104) with Qiagen RNase-free DNase I (Cat# 79254).
GSE28144	Escherichia coli
GSE28144	MAS 5.0 Expression Analysis Default Setting
GSE28144	rna extracted from e. coli o157: H7 EDL933 cells grown (7 hrs incubation) in LB at 37ºC
GSE28144	rna extracted from e. coli o157: H7 EDL933 cells grown (7 hrs incubation) in LB at 37ºC with 0.05 mg
GSE28193	agent: 0.5% honey
GSE28193	agent: control
GSE28193	E. coli O157:H7 EDL933 in LB at 37oC for 7 hrs incubation
GSE28193	E. coli O157:H7 EDL933 in LB at 37oC for 7 hrs incubation with honey
GSE28193	E. coli O157:H7 EDL933 was inoculated in 250 ml of LB in 1000 ml shake flasks with overnight cultures that were diluted 1:100. Cells were shaken with 10 g of glass wool at 100 rpm and 37°C for 7 hrs.  Cells were immediately chilled with dry ice and 95% ethanol (to prevent RNA degradation) for 30 sec before centrifugation in 50 ml centrifuge tubes at 13,000 g for 2 min; cell pellets were frozen immediately with dry ice and stored -80°C.  RNA was isolated using Qiagen RNeasy mini Kit (Cat# 74104) with Qiagen RNase-free DNase I (Cat# 79254).
GSE28193	Escherichia coli
GSE28193	MAS 5.0 Expression Analysis Default Setting
GSE28193	rna extracted from e. coli o157: H7 EDL933 cells grown (7 hrs incubation) in LB at 37ºC
GSE28193	rna extracted from e. coli o157: H7 EDL933 cells grown (7 hrs incubation) in LB at 37ºC with 0.5% honey
GSE28210	Cells were transferred to the fresh minimal media, mM63, in the presence or absence of histidine. The initial cell concentrations were controlled as 104-105 cells
GSE28210	Control strain exponentially grown in the absence of histidine
GSE28210	Control strain exponentially grown in the presence of histidine (1 mM)
GSE28210	Escherichia coli
GSE28210	genotype: DH1 ΔhisC::cat ΔintC::Ptrc-rfp-tetR-zeocinr ΔgalK::PtetA-gfp-hisC-kanr
GSE28210	genotype: DH1 ΔhisC::cat ΔintC::Ptrc-rfp-tetR-zeocinr ΔgalK::PtetA-gfp-kanr
GSE28210	HisC rewired strain exponentially grown in the absence of histidine
GSE28210	HisC rewired strain exponentially grown in the presence of histidine (1 mM)
GSE28210	log10 mRNA concentration (pM) data are provided as a supplementary file on the SERIES record.
GSE28210	Microarray data were processed using custom scripts written in R based on the finite hybridisation (FH) model (Ono et al (2008) An improved physico-chemical model of hybridization on high-density oligonucleotide microarrays. Bioinformatics 24: 1278-1285.) and the thermodynamic model of non-specific binding (NSB) on short nucleotide microarrays (Furusawa et al, 2009).
GSE28210	OSU11, nurishment, biological rep 1
GSE28210	OSU11, nurishment, biological rep 2
GSE28210	OSU11, nurishment, biological rep 3
GSE28210	OSU11, starved, biological rep 1
GSE28210	OSU11, starved, biological rep 2
GSE28210	OSU11, starved, biological rep 3
GSE28210	OSU12-hisC, nurishment, biological rep 1
GSE28210	OSU12-hisC, nurishment, biological rep 2
GSE28210	OSU12-hisC, nurishment, biological rep 3
GSE28210	OSU12-hisC, starved, biological rep 1
GSE28210	OSU12-hisC, starved, biological rep 2
GSE28210	OSU12-hisC, starved, biological rep 3
GSE28210	platform_id design: EcFS_1
GSE28210	platform_id design: EcFS_2
GSE28210	The cell culture was put into cold phenol-ethanol solution (1 g of phenol in 10 mL of ethanol) prepared in advance. The cells were collected by centrifugation at 16,000 × g for 5 min at 4°C, and the pelleted cells were stored at –80°C prior to use.
GSE28210	Total RNAs were extracted using an RNeasy mini kit (Qiagen) in accordance with the manufacturer’s instructions.
GSE28280	10 ml of cell culture was mixed with 5 ml ice cold killing buffer (20mM Tris and 5mM MgCl2 and 20mM NaN3) and cells collected by centrifugation (8000g, 4C, 3min). The supernatant was discarded and the pellet resuspended in 300μL TE with 40 μl 10% SDS and 3 μl 0.5 M EDTA. After incubation for 5 min at 65°C 750μl isopropanole was added before centrifugation at 15600 rcf for 5 min. The pellet was resuspended in 500μL TE and 2μL RNase A (25mg
GSE28280	500 ng chrom. DNA was digested with 10U of MseI (NEB) in 10μL volume for 3h at 37°C and heat inactivated for 20 min at 65°C. To prepare adapters 100pmol of MseIlong (AGTGGGATTCCGCATGCTAGT) and MseIshortnewNo (TAACTAGCATGC)  were annealed in 8µl ddH2O by heating to 95°C for 3 min and than cooling to 70°C and subsequently to 15°C with 1°C per min. At 15°C 10µl MseI digested DNA, 2µl ligase buffer and 400U T4-ligase (NEB) were added and ligated over night. Ligase was inactivated at 65°C for 10 min. One halve of the ligation mix was digested with 20 U DpnI for 2h at 37°C in a volume of 50µl and the other halve treated similar with water instead of DpnI as control. 5µl of the DNA was amplified in a 50 µl PCR reaction with 0.2mM dNTPs, 0.5µM primer MseIlong, 10µl Phusion HF buffer and 1U Phusion DNA polymerase (Finnzymes) with the program 30sec 98°C, 20x(30sec 98°C, 30 sec 62°C, 60sec 72°C), 10 min 72°C. DNA was purified with a Qiagen PCR cleanup kit.
GSE28280	Cell cultures were cross linked by addition of 27 µl of formaldehyde (37%) per ml medium (final concentration 1%). Crosslinking was performed at slow shaking (100 rpm) for 20 min followed by quenching with 0.2 ml of 2.5 M glycine per ml medium (final concentration 0.5 M). Cells were collected from 15 ml by centrifugation and washed twice with cold TBS (pH7.5).The pellet wa resuspended in 300μL TE with 40 μl 10% SDS and 3 μl 0.5 M EDTA. After incubation for 5 min at 65°C 750μl isopropanole was added before centrifugation at 15600 rcf for 5 min. The pellet was resuspended in 500μL TE and 3μL RNase A (25mg
GSE28280	Cells were grown at 30 °C to an OD450 of about 0.07 in AB glucose CAA medium, shifted to 39 °C for 70min and back to 30°C for 0min before crosslinking.
GSE28280	Cells were grown at 30 °C to an OD450 of about 0.07 in AB glucose CAA medium, shifted to 39 °C for 70min and back to 30°C for 15min before crosslinking.
GSE28280	Cells were grown at 30 °C to an OD450 of about 0.07 in AB glucose CAA medium, shifted to 39 °C for 70min and back to 30°C for 16min before crosslinking.
GSE28280	Cells were grown at 30 °C to an OD450 of about 0.07 in AB glucose CAA medium, shifted to 39 °C for 70min and back to 30°C for 17min before crosslinking.
GSE28280	Cells were grown at 30 °C to an OD450 of about 0.07 in AB glucose CAA medium, shifted to 39 °C for 70min and back to 30°C for 35min before crosslinking.
GSE28280	Cells were grown at 30 °C to an OD450 of about 0.07 in AB glucose CAA medium, shifted to 39 °C for 70min and back to 30°C for 50min before crosslinking.
GSE28280	Cells were grown at 30 °C to an OD450 of about 0.07 in AB glucose CAA medium, shifted to 39 °C for 70min and back to 30°C for 5min before crosslinking.
GSE28280	Cells were grown at 37 °C to an OD450 of about 0.15 in 100 ml AB acetate medium before crosslinking.
GSE28280	Cells were grown at 37 °C to an OD600 of about 0.15 in 50 ml LB (+ 0.2% glucose) before crosslinking.
GSE28280	chip antibody: SeqA
GSE28280	Cultures of E. coli MG1655 and its derivates were cross linked by addition of 27 µl of formaldehyde (37%) per ml medium (final concentration 1%). Crosslinking was performed at slow shaking (100 rpm) for 20 min followed by quenching with 0.2 ml of 2.5 M glycine per ml medium (final concentration 0.5 M). Cells were collected by centrifugation and washed twice with cold TBS (pH7.5). After resuspension in 1 ml lysis buffer (10mM Tris (pH 8.0), 20% sucrose, 50mM NaCl, 10mM EDTA, 10 mg
GSE28280	Escherichia coli
GSE28280	Escherichia coli str. K-12 substr. MG1655
GSE28280	genotype: dnaC2
GSE28280	genotype: dnaC2, pMQ430
GSE28280	genotype: GATC-cluster::hisA
GSE28280	genotype: GATC-cluster::srlA
GSE28280	genotype: GATC-cluster::ter
GSE28280	genotype: GATC-cluster::tnaA
GSE28280	genotype: wildtype
GSE28280	input DNA
GSE28280	Methylation in 0 min dnaC2 rep1
GSE28280	Methylation in 0 min dnaC2 rep2
GSE28280	Methylation in 15 min dnaC2 rep1
GSE28280	Methylation in 15 min dnaC2 rep2
GSE28280	SeqA ChIP DNA
GSE28280	SeqA in 0 min dnaC2 rep1
GSE28280	SeqA in 0 min dnaC2 rep2
GSE28280	SeqA in 15 min dnaC2 LB
GSE28280	SeqA in 15 min dnaC2 LB dam++ rep1
GSE28280	SeqA in 15 min dnaC2 LB dam++ rep2
GSE28280	SeqA in 15 min dnaC2 rep1
GSE28280	SeqA in 15 min dnaC2 rep2
GSE28280	SeqA in 15 min dnaC2 rep3
GSE28280	SeqA in 16 min dnaC2 rep1
GSE28280	SeqA in 16 min dnaC2 rep2
GSE28280	SeqA in 17 min dnaC2 rep1
GSE28280	SeqA in 17 min dnaC2 rep2
GSE28280	SeqA in 35 min dnaC2 rep1
GSE28280	SeqA in 35 min dnaC2 rep2
GSE28280	SeqA in 50 min dnaC2 rep1
GSE28280	SeqA in 50 min dnaC2 rep2
GSE28280	SeqA in 5 min dnaC2 rep1
GSE28280	SeqA in 5 min dnaC2 rep2
GSE28280	SeqA in AB acetate rep1
GSE28280	SeqA in AB acetate rep2
GSE28280	SeqA in hisA GATC cluster rep1
GSE28280	SeqA in hisA GATC cluster rep2
GSE28280	SeqA in srlA GATC cluster rep1
GSE28280	SeqA in srlA GATC cluster rep2
GSE28280	SeqA in ter GATC cluster rep1
GSE28280	SeqA in ter GATC cluster rep2
GSE28280	SeqA in tnaA GATC cluster rep1
GSE28280	SeqA in tnaA GATC cluster rep2
GSE28280	Spot intensities were extracted using the Feature Extraction software 10.5.1.1 from Applied Biosystems with a linear dye normalization correction method. The gProcessedSignal and rProcessedSignal was used for further analysis with the statistics software R. Ratios of g (sample) to r (control) were calculated after background substraction and normalized to the array wide average. Data points with a value below 0 after background subtraction were set 'null'. Data points form non-unique regions on the chromosome were excluded from analysis.
GSE28280	Spot intensities were extracted using the Feature Extraction software 10.5.1.1 from Applied Biosystems with a linear dye normalization correction method. The gProcessedSignal and rProcessedSignal was used for further analysis with the statistics software R. Ratios of g (sample) to r (control) were calculated after background substraction. Data points with a value below 0 after background subtraction were set 'null'. Data points form non-unique regions on the chromosome were excluded from analysis.
GSE28280	strain: MG1655
GSE28280	strain: MG1655dnaC2
GSE28280	strain: TB16
GSE28280	strain: TWx30
GSE28280	strain: TWx31
GSE28280	strain: TWx34
GSE28280	strain: TWx48
GSE28280	treatment: control
GSE28280	treatment: DpnI digested DNA
GSE28280	untreated control
GSE28320	285c
GSE28320	All strains were grown in M9 minimal media supplemented with 25 ug
GSE28320	Control samples (285c
GSE28320	Data were normalized using LOWESS (MIDAS) and analyzed for statistical significance using the Rank Product method in the MultiExperimentViewer
GSE28320	Escherichia coli
GSE28320	genotype: 285c rpoD mutation
GSE28320	Sigma70 LB
GSE28320	Sigma70 LB-1
GSE28320	Sigma70 LB-2
GSE28320	Sigma70 LB-3
GSE28320	Sigma70 LP
GSE28320	Sigma70 LP-1
GSE28320	Sigma70 LP-2
GSE28320	Sigma70 LP-3
GSE28320	The Zymo Fungal
GSE28320	transformation: empty vector
GSE28320	transformation: pSigma70-LB
GSE28320	transformation: pSigma70-LP
GSE28320	treatment: 30 C
GSE28320	treatment: 42 C
GSE28399	Cells from single colonies were grown on LB agar and then inoculated into liquid LB and grown to saturation. Then 50 µl was inoculated into 5 ml of K-medium and grown to saturation again. The cultures were then inoculated into the separate media as follows: 25 μl into K-medium, 50 µl into K-medium + 0.3M NaCl, 75 µl into K-medium + 0.6M urea; the final volume was 5ml in all cases. These cultures were grown overnight. The cultures were incubated in 250 ml Erlenmeyer flasks in the three media in a water bath at 30ºC.
GSE28399	CFT073 in K-med
GSE28399	CFT073 in NaCl
GSE28399	CFT073 in urea
GSE28399	CFT073 K-med biological rep 1
GSE28399	CFT073 K-med biological rep 2
GSE28399	CFT073 K-med biological rep 3
GSE28399	CFT073 NaCl biological rep 1
GSE28399	CFT073 NaCl biological rep 2
GSE28399	CFT073 NaCl biological rep 3
GSE28399	CFT073 urea biological rep 1
GSE28399	CFT073 urea biological rep 2
GSE28399	CFT073 urea biological rep 3
GSE28399	Escherichia coli CFT073
GSE28399	GCOS was used to obtain detection calls for each microarray.  The statistical difference for mRNA expression were analyzed using CarmaWeb. Affymetrix GeneChip analysis was performed using MAS for background correction, VSN for normalization, MAS for PM correction and Medianpolish for Expression.  VSN normalized data not provided by submitter.
GSE28399	growth condition: 25 μl into K-medium
GSE28399	growth condition: 50 µl into K-medium + 0.3M NaCl
GSE28399	growth condition: 75 µl into K-medium + 0.6M urea
GSE28399	Total RNA was extracted by the hot phenol–chloroform method.
GSE28399	When the samples had reached an OD600 of 0.4-0.5, 25 ml of each culture was added to a 2.5 ml mixture of cold 95% ethanol and 5% phenol to preserve the mRNA. The cells were cooled rapidly on ice and immediately harvested by centrifugation at 4°C, and the pellet was frozen on dry ice.
GSE28630	1. library(maanova)
GSE28630	2. Read data:
GSE28630	3. Log transformation:
GSE28630	4. Normalization by Glowess method:
GSE28630	5. Save the plot files
GSE28630	6. close the graph:
GSE28630	7. output:
GSE28630	Add 100 μl 1 mg
GSE28630	Bacterial lysis
GSE28630	Column purification
GSE28630	Data = read.madata(\NormInput.txt\, designfile=\Designfile1.txt\, header=TRUE, spotflag=TRUE, metarow=1, metacol=2, row=3, col=4, geneID=5, pmt=6)
GSE28630	Data selection
GSE28630	E. coli K12 cells, M9, 8 h
GSE28630	E. coli K12_WT_M9_rep1
GSE28630	E. coli K12_WT_M9_rep2
GSE28630	E. coli K12 ybjN mutant cells, M9, 8 h
GSE28630	E. coli K12_ybjN_MUTANT_M9_rep1
GSE28630	E. coli K12_ybjN_MUTANT_M9_rep2
GSE28630	E. coli K12_ybjN_MUTANT_M9_rep3
GSE28630	E. coli K12 ybjN over-expression cells, M9, 8 h
GSE28630	E. coli K12_ybjN_OVER-EXPRESSION_M9_rep1
GSE28630	E. coli K12_ybjN_OVER-EXPRESSION_M9_rep2
GSE28630	E. coli K12_ybjN_OVER-EXPRESSION_M9_rep3
GSE28630	Escherichia coli
GSE28630	genotype: wild type
GSE28630	genotype: ybjN mutant
GSE28630	genotype: ybjN over-expression
GSE28630	go to the directory:
GSE28630	graphics.off()
GSE28630	Grow bacteria overnight in LB medium, reinoculate in M9 minimal medium at an initial OD600 of 0.005. After eight hours growth at 34°C in M9 medium, 2 mL of RNA Protect Reagent (Qiagen) was added to 1 ml bacterial cultures (at OD600 of about 0.5-0.8) to stabilize RNA. Centrifuge for 10 min at 4000 g. Decant the supernatant.
GSE28630	growing condition: M9 minimal medium
GSE28630	LogData = createData(Data, n.rep=1, log.trans=TRUE)
GSE28630	Microarray data normalization
GSE28630	Microarray normalization is carried out using maanova function in R program version 2.2.1. Eight arrays in one slide were globally normalized using glowess method.
GSE28630	NormalData=transform.madata(LogData, method=c(\glowess\))
GSE28630	norm.temp<-cbind(NormalData$metarow, NormalData$metacol,NormalData$row, NormalData$col, NormalData$geneID, NormalData$data)
GSE28630	postscript(file=\PlotGLOWESS.ps\)
GSE28630	postscript(file=\PlotRawData.ps\)
GSE28630	riplot(LogData, onScreen=FALSE)
GSE28630	riplot(NormalData, onScreen=FALSE)
GSE28630	Sample collection from M9 medium
GSE28630	setwd(\C:\\Documents and Settings\\Wang\\Desktop\\Erwinia in vivo\\rcsC MBMA\)
GSE28630	Stage: logarithm phase
GSE28630	Statistical comparisons were performed using multiple testing procedures to evaluate statistical significance for differentially expressed genes. A modified t-test (p-value) was computed to measure the significance associated with each differential expression value. A gene expression value was decided to be significantly different in the mutant and over-expression strains when the p-value was less than 0.05 (except otherwise mentioned) and the expression ratio was ≥ 2.0or ≤ 0.5. Gene functions were assigned using data from EcoCyc (http:
GSE28630	strain: K12
GSE28630	Total RNA isolation was performed using the RNeasy Protect Bacteria system from Qiagen.
GSE28630	Transfer 700 μl lysate into RNeasy Mini column place in a 2 ml collection tube and centrifuge for 30 s at highest speed. Add 350 μl Buffer RW1 to the column and centrifuge for 30 s. Discard flow-through and reuse the collection tube. Add 10 μl DNase stock solution to 70 μ l RDD Buffer. Add the DNase I solution into the column and incubate at RT for 15 min. Add 350 μl Buffer RW1 to the column and wait for 5 min, centrifuge for 30 s. Discard the flow-through and collection tubes. Place the RNeasy Mini spin column in a new 2 ml collection tube. Add 500 μl Buffer RPE to the column. Centrifuge for 30 s. Place the column in a new 1.5 ml tube, and centrifuge for 1 min to eliminate any residue ethanol. Place the column in a new collection tube. Add 50 μl RNase free water, centrifuge for 1 min. Store RNA samples at -20°C.
GSE28630	write.table(norm.temp, file=\Normal_Data.csv\, sep=\,\, row.names=FALSE, col.names=TRUE, quote=FALSE)
GSE29486	Average Normalization using GeneChip Operating Software Version 1.4
GSE29486	Control Strain at specific growth rate 0.5h-1 0h
GSE29486	Control Strain at specific growth rate 0.5h-1 10h
GSE29486	Control Strain at specific growth rate 0.5h-1 16h
GSE29486	Control Strain at specific growth rate 0.5h-1 20h
GSE29486	Control Strain at specific growth rate 0.5h-1 6h
GSE29486	Control Strain at specific growth rate 0.5h-1 8h
GSE29486	Culture samples frozen in liquid methanol
GSE29486	Escherichia coli
GSE29486	Fed batch high cell density cultivation
GSE29486	Indole treated at specific growth rate 0.5h-1 0h
GSE29486	Indole treated at specific growth rate 0.5h-1 10h
GSE29486	Indole treated at specific growth rate 0.5h-1 16h
GSE29486	Indole treated at specific growth rate 0.5h-1 5h
GSE29486	Indole treated at specific growth rate 0.5h-1 8h
GSE29486	Qiagen RNA extraction kit
GSE29486	specific growth rate: 0.5h-1
GSE29486	strain: W3110hns∆93-1
GSE29486	time post-induction: 0h
GSE29486	time post-induction: 10h
GSE29486	time post-induction: 16h
GSE29486	time post-induction: 20h
GSE29486	time post-induction: 5h
GSE29486	time post-induction: 6h
GSE29486	time post-induction: 8h
GSE29486	treatment group: control
GSE29486	treatment group: indole treated
GSE29954	Briefly, total RNA were isolated from cell culture with Total RNA Extraction Kit (RBC Bioscience) according to manufacturer's specifications. DNA was degraded by DNAse (Promega).
GSE29954	control
GSE29954	double mutant (PPK1 and PPX)
GSE29954	Escherichia coli K-12
GSE29954	exopolyphosphatase (PPX) mutant
GSE29954	genotype
GSE29954	Microarray data analysis was performed with free software genArise, developed in the Computing Unit of Cellular Physiology Institute of UNAM (http:
GSE29954	polyphosphate kinase 1 (PPK1) mutant
GSE29954	PPK1-PPX double mutant
GSE29954	single mutant in exopolyphosphatase (PPX)
GSE29954	single mutant in polyphosphate kinase 1 (PPK1)
GSE29954	zi = (Ri – mean(R)) 
GSE30005	E. coli K-12 strain BW25113 was evolved in chemostats. The cells were grown in M9 minimal media (5 g
GSE30005	Escherichia coli K-12
GSE30005	growth medium: liquid culture
GSE30005	P2-08
GSE30005	P2-08_R1
GSE30005	P2-08_R2
GSE30005	P2-08_R3
GSE30005	P2-51
GSE30005	P2-51_R1
GSE30005	P2-51_R2
GSE30005	P2-51_R3
GSE30005	P2-58
GSE30005	P2-58_R1
GSE30005	P2-58_R2
GSE30005	P2-58_R3
GSE30005	P2-66
GSE30005	P2-66_R1
GSE30005	P2-66_R2
GSE30005	P2-66_R3
GSE30005	P2-77
GSE30005	P2-77_R1
GSE30005	P2-77_R2
GSE30005	P2-77_R3
GSE30005	PF2-04
GSE30005	PF2-04_R1
GSE30005	PF2-04_R2
GSE30005	PF2-04_R3
GSE30005	PF2-08
GSE30005	PF2-08_R1
GSE30005	PF2-08_R2
GSE30005	PF2-08_R3
GSE30005	PF2-12
GSE30005	PF2-12_R1
GSE30005	PF2-12_R2
GSE30005	PF2-12_R3
GSE30005	RNA was extracted using the RNeasy Mini Kit (QIAGEN). The SuperScript indirect cDNA labeling system (Invitrogen) was used to generate cDNA.
GSE30005	strain: BW25113
GSE30005	The image analysis was performed using GenePix Pro 6.0 Software (Molecular Devices). Data were normalized with MIDAS (LOWESS method), with clustering analysis in MeV (CAST).
GSE30005	wild-type
GSE30005	wt or mutant: P2-08
GSE30005	wt or mutant: P2-51
GSE30005	wt or mutant: P2-58
GSE30005	wt or mutant: P2-66
GSE30005	wt or mutant: P2-77
GSE30005	wt or mutant: PF2-04
GSE30005	wt or mutant: PF2-08
GSE30005	wt or mutant: PF2-12
GSE30005	wt or mutant: WT @ 0.8%But
GSE30345	cpxA-ala-1
GSE30345	cpxA-ala-2
GSE30345	cpxA mutant in Ala media
GSE30345	cpxA mutant in Gln media
GSE30345	cysQ-gln-1
GSE30345	cysQ-gln-2
GSE30345	cysQ mutantin Ala media
GSE30345	cysQ mutantin Gln media
GSE30345	dnaJ-ala-1
GSE30345	dnaJ-ala-2
GSE30345	dnaJ-gln-1
GSE30345	dnaJ-gln-2
GSE30345	dnaJ mutant in Ala media
GSE30345	dnaJ mutant in Gln media
GSE30345	Escherichia coli str. K-12 substr. MG1655
GSE30345	gcvT-ala-1
GSE30345	gcvT-ala-2
GSE30345	gcvT mutant in Ala media
GSE30345	gcvT mutant in Gln media
GSE30345	genotype
GSE30345	hfq-gln-1
GSE30345	hfq-gln-2
GSE30345	hfq mutant in Ala media
GSE30345	hfq mutant in Gln media
GSE30345	Irp mutant in Ala media
GSE30345	Irp mutant in Gln media
GSE30345	LB-grown overnight cultures were pelleted by centrifugation, washed, and resuspended in M9-glutamine of M9-alanine media.  Cultures were shaken at 250 rpm at 37C.  Samples were taken in mid-exponential phase (OD600 =0.15 for glutamine and OD600=0.2 for alanine on an Ultraspec 3100 pro) after ~5 generations of growth in the media.
GSE30345	lrp-gln-1
GSE30345	lrp-gln-2
GSE30345	pgi-ala-1
GSE30345	pgi-ala-2
GSE30345	pgi mutantin Ala media
GSE30345	pgi mutantin Gln media
GSE30345	strain: AH28
GSE30345	strain: ZD1
GSE30345	strain: ZD26
GSE30345	strain: ZD51
GSE30345	strain: ZD56
GSE30345	strain: ZD59
GSE30345	strain: ZD60
GSE30345	strain: ZD8
GSE30345	The ‘LogRatio’ value was used in subsequent analyses.  All values for the same ORF were averaged as were the values from the two biological replicates performed for each comparison.
GSE30345	When the cultures reached the desired density, 2 ml of culture was added to 4 ml of RNAprotect Bacteria Reagent (Qiagen).  The mixture was incubated at room temperature for 5 min and then centrifuged at 5000 g for 10 min.  The supernatant was removed and the pellets were stored at -80C.  RNA was isolated using the Norgen Total RNA Purification Kit (Product #17200) according to the manufacturer’s directions except in the last step the RNA was eluted in 35 uL.
GSE30345	wild-type in ala media_1
GSE30345	wild-type in ala media_2
GSE30345	wild-type in gln media_1
GSE30345	wild-type in gln media_2
GSE30424	E. coli O157:H7 EDL933 in LB at 37oC for 7 hrs incubation with DMSO
GSE30424	E. coli O157:H7 EDL933 in LB at 37oC for 7 hrs incubation with indole-3-acetaldehyde
GSE30424	E. coli O157:H7 EDL933 was inoculated in 100 ml of LB in 250 ml shake flasks with overnight cultures that were diluted 1:100. Cells were shaken with 4 g of glass wool at 250 rpm and 37°C for 7 hrs.  Cells were immediately chilled with dry ice and 95% ethanol (to prevent RNA degradation) for 30 sec before centrifugation in 50 ml centrifuge tubes at 13,000 g for 2 min; cell pellets were frozen immediately with dry ice and stored -80°C.  RNA was isolated using Qiagen RNeasy mini Kit (Cat# 74104) with Qiagen RNase-free DNase I (Cat# 79254).
GSE30424	Escherichia coli
GSE30424	MAS 5.0 Expression Analysis Default Setting
GSE30424	RNA extracted from e. coli o157: H7 EDL933 cells grown (7 hrs incubation) in LB at 37ºC with 0.1 mg
GSE30424	RNA extracted from e. coli o157: H7 EDL933 cells grown (7 hrs incubation) in LB at 37ºC with DMSO
GSE30424	serotype: O157:H7
GSE30424	strain: EDL933
GSE30441	Cells in log phase under ethanol stress
GSE30441	Cells were grown at 37°C in Luria-Bertani (LB) medium containing 50 μg
GSE30441	Data were analyzed using GeneChip Operating Software Version 1.4 (Affymetrix)
GSE30441	Escherichia coli
GSE30441	genotype: ethanol-tolerant mutant E1 of IrrE
GSE30441	genotype: wild type IrrE
GSE30441	mutant E1, biological rep1
GSE30441	mutant E1, biological rep2
GSE30441	mutant E1, biological rep3
GSE30441	strain: DH5a
GSE30441	The cells were centrifuged when they reached the log phase, and then rapidly chilled and stored in liquid nitrogen until used for the DNA microarray assay
GSE30441	Total RNA was isolated from the cells stored in liquid nitrogen using TRIzol Reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) and RNeasy MinElute Cleanup Kits (Qiagen, Valencia, CA, USA)
GSE30441	wild type E0, biological rep1
GSE30441	wild type E0, biological rep2
GSE30441	wild type E0, biological rep3
GSE30679	E. coli cultutures were grown in M9 media using standard protocol, to log phase (OD600 of 0.7-0.8)
GSE30679	Escherichia coli
GSE30679	genotype: gss mutant
GSE30679	genotype: wild type
GSE30679	gss-1
GSE30679	gss-2
GSE30679	gss-3
GSE30679	MAS 5.0
GSE30679	No treatment, just comparison of RNAs from wild type and mutant.
GSE30679	Trizol extraction of total RNA was performed according to the manufacturer's instructions.
GSE30679	WT-1
GSE30679	WT-2
GSE30679	WT-3
GSE30838	Affymetrix GeneChip Operating Software (GCOS) Version 1.4  Details: Intra-chip normalizations were performed using Affymetrix Gene Chip Operating Software (GCOS). Default statistical parameters were used to normalize each chip to the same target intensity (1500) as described in the Affymetrix GeneChip Expression Analysis manual. All nine possible inter-chip comparisons were performed in GCOS. The data were subsequently exported to a Microsoft Excel spreadsheet for manipulation. Consensus “detection p-value”, “change p-value”, and “signal log ratios” were calculated, and the default E. coli array p-value cutoff parameters were applied to these consensus values to estimate the transcript change between two conditions and the transcript presence under each condition. Background-subtracted data sets were used to calculate up-regulated and down-regulated genes based on fold changes of greater than 2.
GSE30838	E.coli cells  grown with aeration in LB media at 37º C until early log phase (0.4) and were treated with
GSE30838	E. coli K12 strain JM109
GSE30838	Escherichia coli
GSE30838	JM109-1, biological rep1
GSE30838	JM109-2, biological rep2
GSE30838	JM109-3, biological rep3
GSE30838	JM109 GLY-1, biological rep1
GSE30838	JM109 GLY-2, biological rep2
GSE30838	JM109 GLY-3, biological rep3
GSE30838	Total RNA was extracted using the commercial product TRIzol Reagent (Invitrogen, Carlsbad, CA).Disrupt about 107cells with a homogenizer with 1ml TRIzol Reafent on ice. Store the homogenate for 5 minutes at room temperature to permit the complete dissociation of nucleoprotein complexes. Next, supplement the homogenate with 0.2 ml chloroform per 1 ml of TRI Reagent, cover the samples tightly and shake vigorously for 15 seconds. Store the resulting mixture at room temperature for 2-15 minutes and centrifuge at 12,000 g for 15 minutes at 4 C. Following centrifugation, the mixture separates into a lower red phenol-chloroform phase, interphase and the colorless upper aqueous phase. Transfer the aqueous phase to a fresh tube. Precipitate RNA from the aqueous phase by mixing with isopropanol. Use 0.5 ml of isopropanol per 1 ml of TRI Reagent used for the initial homogenization. Store samples at room temperature for 5-10 minutes and centrifuge at 12,000 g for 8 minutes at 4 - 25 C. Remove the supernatant and wash the RNA pellet ( by vortexing) with 75% ethanol and subsequent centrifugation at 7,500 g for 5 minutes at 4 - 25 C. Add at least 1 ml of 75% ethanol per 1 ml TRI Reagent used for the initial homogenization. Remove the ethanol wash and briefly air-dry the RNA pellet for 3 - 5 min. Dissolve RNA in DEPC-treated water by passing solution a few times through a pipette tip. Using an on-column DNase digestion with RNase-free DNase I (Qiagen) to purify the total RNA.
GSE30838	treatment: 200 mM glyphosate shock for 1 h
GSE30838	Treatment protocol- E.coli cells grown in LB media with  at 37C until early log phase (0.4), then were treated with 200 mM glyphosate for 1 h,after that the cells were harvested to extract RNA.
GSE30838	treatment: without salt shock
GSE31054	BW25113 mqsR
GSE31054	cell type: Planktonic cells harvested at a turbidity of 0.5 at 600 nm, adjusted to the turbidity at 1, and then exposed to 20 μg
GSE31054	Escherichia coli K-12
GSE31054	genotype
GSE31054	MAS 5.0 Expression Analysis Default Setting
GSE31054	medium: LB
GSE31054	strains: K-12 BW25113
GSE31054	temp: 37ºC
GSE31054	The overnight culture (0.25 ml) was used to inoculate 25 ml of fresh LB medium. Planktonic cells were grown to a turbidity of 0.5 at 600 nm in LB medium with 1 mM IPTG at 37 °C, adjusted the turbidity to 1, and exposed to 20 μg
GSE31054	The overnight culture (0.25 mL) was used to inoculate 25 mL of fresh LB medium. Planktonic cells were grown to a turbidity of 0.5 at 600 nm in LB medium with 1 mM IPTG at 37 °C, adjusted the turbidity to 1, and exposed to 20 μg
GSE31054	time: 1 h with 20 μg
GSE3105	EM1456 wild-type pNM12#1 +arabinose
GSE3105	Escherichia coli
GSE3105	experiment #115
GSE3105	experiment #116
GSE3105	experiment #203
GSE3105	experiment #204
GSE3105	experiment #205
GSE3105	experiment #206
GSE3105	experiment #303
GSE3105	experiment #305
GSE3105	experiment #306
GSE3105	fur mutant pBAD-ryhB#1 + arabinose
GSE3105	fur mutant pBAD-ryhB#2 + arabinose
GSE3105	fur mutant pNM12#1 + arabinose
GSE3105	fur mutant pNM12#2 + arabinose
GSE3105	Microarray suite 5.0
GSE3105	Strain EM1453 wild-type pBAD-ryhB#1 + arabinose
GSE3105	wild-type pBAD-ryhB#1 + arabinose
GSE3105	wild-type pBAD-ryhB#1 +FeSO4 + arabinose
GSE3105	wild-type pBAD-ryhB #2 + arabinose
GSE3105	wild-type pBAD-ryhB#2 +FeSO4 + arabinose
GSE3105	wild-type pNM12#1 +arabinose
GSE3105	wild-type pNM12#1 +FeSO4 + arabinose
GSE3105	wild-type pNM12#2 + arabinose
GSE3105	wild-type pNM12#2 +FeSO4 + arabinose
GSE3123	Escherichia coli
GSE3123	N3433 (rne deletion) pBADRNE in LB at 30 degrees C
GSE3123	N3433 (rne deletion) pBAD-RNE w
GSE3123	N3433 (rne deletion) pNRNE5 at 30 degrees C
GSE3123	N3433 (rne deletion) pRNG3 at 30 degrees C
GSE3123	N3433 (rng deletion) in LB at 30 degrees C
GSE3123	N3433 (rng deletion) LB at 30 C
GSE3123	N3433 (wt) in LB at 30 degrees C
GSE3123	N3433 (wt) pPM30 in LB at 30 degrees C
GSE3123	N3433 (wt) pRNG3 in LB at 30 degrees
GSE3123	N3433 (wt) vs N3433 (rne deletion) pBADRNE in LB at 30 degrees C Trial B *
GSE3123	N3433 (wt) vs N3433 (rne deletion) pBAD-RNE w
GSE3123	N3433 (wt) vs N3433 (rne deletion) pNRNE5 at 30 degrees C Trial A *
GSE3123	N3433 (wt) vs N3433 (rne deletion) pNRNE5 at 30 degrees C Trial B *
GSE3123	N3433 (wt) vs N3433 (rne deletion) pRNG3 at 30 degrees C Trial A *
GSE3123	N3433 (wt) vs N3433 (rne deletion) pRNG3 at 30 degrees C Trial B *
GSE3123	N3433 (wt) vs N3433 (rng deletion) in LB at 30 degrees C Trial B
GSE3123	N3433 (wt)  vs N3433 (rng deletion) LB at 30 C Trial A *
GSE3123	N3433 (wt) vs N3433 (wt) pRNG3 in LB at 30 degrees Trial A *
GSE3123	N3433 (wt) vs N3433 (wt) pRNG3 in LB at 30 degrees Trial B *
GSE3123	VALUE is Log (base 2) of the ratio of the median of Channel 2 (usually 635 nm) to Channel 1 (usually 532 nm)
GSE31333	A10:LJ110 del pdhr MMAcetat
GSE31333	A11:LJ110 pTM30 MMAcetat
GSE31333	A12:LJ110 pTM30pdhr MMAcetat
GSE31333	A1:LJ110 LBo
GSE31333	A2:LJ110 del pdhr LBo
GSE31333	A3:LJ110 pTM30 LBo
GSE31333	A4:LJ110 pTM30pdhr LBo
GSE31333	A5:LJ110 MMPyruvat
GSE31333	A6:LJ110 del pdhr MMPyruvat
GSE31333	A7:LJ110 pTM30 MMPyruvat
GSE31333	A8:LJ110 pTM30pdhr MMPyruvat
GSE31333	A9:LJ110 MMAcetat
GSE31333	B10:LJ110 del pdhr MMAcetat
GSE31333	B11:LJ110 pTM30 MMAcetat
GSE31333	B12:LJ110 pTM30pdhr MMAcetat
GSE31333	B1:LJ110 LBo
GSE31333	B2:LJ110 del pdhr LBo
GSE31333	B3:LJ110 pTM30 LBo
GSE31333	B4:LJ110 pTM30pdhr LBo
GSE31333	B5:LJ110 MMPyruvat
GSE31333	B6:LJ110 del pdhr MMPyruvat
GSE31333	B7:LJ110 pTM30 MMPyruvat
GSE31333	B8:LJ110 pTM30pdhr MMPyruvat
GSE31333	B9:LJ110 MMAcetat
GSE31333	background strain: LJ110
GSE31333	Escherichia coli
GSE31333	Expression values were calculated by the software package Feature Extraction 10.5.1.1 using protocol GE1_105_Dec08 (Agilent Technologies; Waldbronn, Germany)
GSE31333	genetic modification: empty plasmid (LJ110
GSE31333	genetic modification: PdhR knockout mutant (LJ110deltapdhR)
GSE31333	genetic modification: PdhR overexpression strain (LJ110
GSE31333	genetic modification: wild type LJ110
GSE31333	LJ110 del pdhr LBo
GSE31333	LJ110 del pdhr MMAcetat
GSE31333	LJ110 del pdhr MMPyruvat
GSE31333	LJ110 LBo
GSE31333	LJ110 MMAcetat
GSE31333	LJ110 MMPyruvat
GSE31333	LJ110 pTM30 LBo
GSE31333	LJ110 pTM30 MMAcetat
GSE31333	LJ110 pTM30 MMPyruvat
GSE31333	LJ110 pTM30pdhr LBo
GSE31333	LJ110 pTM30pdhr MMAcetat
GSE31333	LJ110 pTM30pdhr MMPyruvat
GSE31333	MMAcetat
GSE31333	MMPyruvat
GSE31333	RNAeasy
GSE31982	CRE Multi 0uM Rep1 Plasmid
GSE31982	CRE Multi 0uM Rep2 Plasmid
GSE31982	CRE Multi 100uM Rep1 Plasmid
GSE31982	CRE Multi 100uM Rep2 Plasmid
GSE31982	CRE Single 100uM Rep1 Plasmid
GSE31982	CRE Single 100uM Rep2 Plasmid
GSE31982	Escherichia coli
GSE31982	HEK293T
GSE31982	IFNB Multi SeV0 Rep1 Plasmid
GSE31982	IFNB Multi SeV10 Rep1 Plasmid
GSE31982	IFNB Single SeV10 Rep1 Plasmid
GSE31982	Plasmid pool
GSE31982	reporter: CRE multi-hit
GSE31982	reporter: CRE single-hit
GSE31982	reporter: IFNB multi-hit
GSE31982	reporter: IFNB single-hit
GSE31982	RNA-Seq
GSE31982	sample type: plasmid pool
GSE31982	To infer the tag copy numbers in each Tag-Seq library, all sequence reads were examined, regardless of their quality scores. If the first ten nucleotides of a read perfectly matched one of the 13,000 or 27,000 designed tags and the remaining nucleotides matched the expected upstream MPRA construct sequence, this was counted as one occurrence of that tag. All reads that did not meet this criterion were discarded.
GSE31982	Total RNA was isolated from cell lysates using RNeasy kits (Qiagen). mRNA was extracted from total RNA using MicroPoly(A)Purist™ kits (Ambion) and treated with DNase I using the Turbo DNA-free™ kit (Ambion). First-strand cDNA was synthesized from 400-700 ng mRNA using High Capacity RNA-to-cDNA kits (Applied Biosystems).  Tag-Seq sequencing libraries were generated directly from 12% of a cDNA reaction or 50 ng plasmid DNA by 26 cycle PCR using Pfu Ultra HS DNA polymerase 2x master mix (Agilent) and primers AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGAGGTGCCTAAAGG (where XXXXXXXX is a library-specific index sequence). The resultant PCR products were size-selected using 2% agarose E-Gel EX (Invitrogen).
GSE31982	treatment: N
GSE32131	0 min
GSE32131	10 min
GSE32131	30 min
GSE32131	60 min
GSE32131	Agilent Feature Extraction Software v. 9.5.3.1 was used for background subtraction and LOWESS normalization.
GSE32131	Escherichia coli 0 min vs 10 min Rep1
GSE32131	Escherichia coli 10 min vs 0 min Rep2
GSE32131	Escherichia coli 30 min vs 60 min Rep1
GSE32131	Escherichia coli 60 min vs 30 min Rep2
GSE32131	Escherichia coli K-12
GSE32131	One conditions: 5% (v
GSE32131	Overnight culture of E. coli BW25113 in LB was diluted in M9 minimal medium with supplements to OD600=0.02 and was incubated at 37 Ceilsus degree with shaking at 250rpm until its OD600 reached 0.1.
GSE32131	strain: K-12
GSE32131	time: 0 min
GSE32131	time: 10 min
GSE32131	time: 30 min
GSE32131	time: 60 min
GSE32131	Total RNA was extracted from 5ml cell culture at 0, 10, 30 and 60 min incubation after addition of 5% isooctane using RNeasy mini kit (Qiagen, Inc., Valencia, CA) according to the manufacturer’s protocol
GSE32131	treatment: 5 percent isooctane
GSE3250	Escherichia coli
GSE3250	normalized using lcDNA
GSE3250	ppsA mutant 15 min (1) slide 1
GSE3250	ppsA mutant 15 min (1) slide 2
GSE3250	ppsA mutant 1 hour (1) slide 1
GSE3250	ppsA mutant 1 hour (1) slide 2
GSE3250	ppsA mutant 1 hour (2) slide 1
GSE3250	ppsA mutant 1 hour (2) slide 2
GSE3250	ppsA mutant 1 hour (3) slide 1
GSE3250	ppsA mutant 1 hour (3) slide 2
GSE3250	ppsA mutant 2 hour (1) slide 1
GSE3250	ppsA mutant 2 hour (1) slide 2
GSE3250	ppsA mutant 2 hour (2) slide 1
GSE3250	ppsA mutant 2 hour (2) slide 2
GSE3250	ppsA mutant 2 hour (3) slide 1
GSE3250	ppsA mutant 2 hour (3) slide 2
GSE3250	ppsA mutant 30 min (1) slide 1
GSE3250	ppsA mutant 30 min (1) slide 2
GSE3250	ppsA mutant 3 hour (1) slide 1
GSE3250	ppsA mutant 3 hour (1) slide 2
GSE3250	ppsA mutant 3 hour (2) slide 1
GSE3250	ppsA mutant 3 hour (2) slide 2
GSE3250	ppsA mutant 3 hour (3) slide 1
GSE3250	ppsA mutant 3 hour (3) slide 2
GSE3250	ppsA mutant 4 hour (1) slide 1
GSE3250	ppsA mutant 4 hour (1) slide 2
GSE3250	ppsA mutant 4 hour (2) slide 1
GSE3250	ppsA mutant 4 hour (2) slide 2
GSE3250	ppsA mutant 4 hour (3) slide 1
GSE3250	ppsA mutant 4 hour (3) slide 2
GSE3250	ppsA mutant 5 hour (1) slide 1
GSE3250	ppsA mutant 5 hour (1) slide 2
GSE3250	ppsA mutant 5 hour (2) slide 1
GSE3250	ppsA mutant 5 hour (2) slide 2
GSE3250	ppsA mutant 5 min (1) slide 1
GSE3250	ppsA mutant 5 min (1) slide 2
GSE3250	ppsA mutant 6 hour (1) slide 1
GSE3250	ppsA mutant 6 hour (1) slide 2
GSE3250	ppsA mutant 6 hour (2) slide 1
GSE3250	ppsA mutant 6 hour (2) slide 2
GSE3250	reference sample harvested immediately prior to glucose to acetate shift
GSE3250	strain BW25113
GSE3250	Strain BW25113
GSE3250	Strain BW25113 
GSE3250	strain BW25113 ppsA deletion
GSE3250	time course sample harvested after 15 min of glucose to acetate shift
GSE3250	time course sample harvested after 1 hour of glucose to acetate shift
GSE3250	time course sample harvested after 2 hour of glucose to acetate shift
GSE3250	time course sample harvested after 30 min of glucose to acetate shift
GSE3250	time course sample harvested after 3 hour of glucose to acetate shift
GSE3250	time course sample harvested after 4 hour of glucose to acetate shift
GSE3250	time course sample harvested after 5 hour of glucose to acetate shift
GSE3250	time course sample harvested after 5 min of glucose to acetate shift
GSE3250	time course sample harvested after 6 hour of glucose to acetate shift
GSE3250	wild-type 15 min (1) slide 1
GSE3250	wild-type 15 min (1) slide 2
GSE3250	wild-type 15 min (2) slide 1
GSE3250	wild-type 15 min (2) slide 2
GSE3250	wild-type 1 hour (1) slide 1
GSE3250	wild-type 1 hour (1) slide 2
GSE3250	wild-type 1 hour (2) slide 2
GSE3250	wild-type 1 hour (3) slide 1
GSE3250	wild-type 1 hour (3) slide 2
GSE3250	wild-type 2 hour (1) slide 1
GSE3250	wild-type 2 hour (1) slide 2
GSE3250	wild-type 2 hour (2) slide 1
GSE3250	wild-type 2 hour (2) slide 2
GSE3250	wild-type 2 hour (3) slide 1
GSE3250	wild-type 2 hour (3) slide 2
GSE3250	wild-type 30 min (1) slide 1
GSE3250	wild-type 30 min (1) slide 2
GSE3250	wild-type 30 min (2) slide 1
GSE3250	wild-type 30 min (2) slide 2
GSE3250	wild-type 3 hour (1) slide 1
GSE3250	wild-type 3 hour (1) slide 2
GSE3250	wild-type 3 hour (2) slide 1
GSE3250	wild-type 3 hour (2) slide 2
GSE3250	wild-type 3 hour (3) slide 1
GSE3250	wild-type 3 hour (3) slide 2
GSE3250	wild-type 4 hour (1) slide 1
GSE3250	wild-type 4 hour (1) slide 2
GSE3250	wild-type 4 hour (2) slide 1
GSE3250	wild-type 4 hour (2) slide 2
GSE3250	wild-type 4 hour (3) slide 1
GSE3250	wild-type 4 hour (3) slide 2
GSE3250	wild-type 5 hour (1) slide 1
GSE3250	wild-type 5 hour (1) slide 2
GSE3250	wild-type 5 hour (2) slide 1
GSE3250	wild-type 5 hour (2) slide 2
GSE3250	wild-type 5min (1) slide 1
GSE3250	wild-type 5min (1) slide 2
GSE3250	wild-type 5min (2) slide 1
GSE3250	wild-type 5min (2) slide 2
GSE3250	wild-type 6 hour (1) slide 1
GSE3250	wild-type 6 hour (1) slide 2
GSE3250	wild-type 6 hour (2) slide 1
GSE3250	wild-type 6 hour (2) slide 2
GSE32561	After 6 hours of growth both control and test strains were induced with 0.5mM IPTG and harvested 2 hours post-induction.
GSE32561	EGS084
GSE32561	EGS084_control_rep_1
GSE32561	EGS084_control_rep_2
GSE32561	EGS084_control_rep_3
GSE32561	EGS084_control_rep_4
GSE32561	EGS084_control_rep_5
GSE32561	EGS084_control_rep_6
GSE32561	EGS212
GSE32561	EGS212_MlfabH_rep_1
GSE32561	EGS212_MlfabH_rep_2
GSE32561	EGS212_MlfabH_rep_3
GSE32561	EGS212_MlfabH_rep_4
GSE32561	EGS212_MlfabH_rep_5
GSE32561	Escherichia coli DH1 ∆fadE control and test strains were seeded with OD600nm 0.03 overnight cultures into 15ml tryptic soy broth media and grown at 37°C with 200rpm agitation.
GSE32561	Escherichia coli K-12
GSE32561	genotype: ∆fadE with overexpression of 'tesA and MlfabH via an IPTG-inudcible promoter
GSE32561	genotype: ∆fadE with overexpression of 'tesA via an IPTG-inudcible promoter
GSE32561	phenotype: normal
GSE32561	phenotype: small improvement in methyl ketone production
GSE32561	substrain: DH1
GSE32561	The raw data (.pair file) was subjected to RMA (Robust Multi-Array Analysis; Irizarry et al. Biostatistics 4(2):249), quantile normalization (Bolstad et al. Bioinformatics 19(2):185), and background correction as implemented in the NimbleScan software package, version 2.4.27 (Roche NimbleGen, Inc.).
GSE32561	Total RNA was extracted using the RNeasy Mini kit (Qiagen Inc., Valencia, CA, USA) and the RNAprotect reagent (Qiagen) and DNA was removed by on-column DNase digestion with the RNase-Free DNase set (Qiagen). RNA concentration was determined on a Nanodrop ND-1000 (Thermo Scientific) and RNA quality was determined by analysis with an Agilent 2100 bioanalyzer.
GSE32562	E. coli MG1655 10 min after TMP+adenine+glycine+methionine treatment in M9 media
GSE32562	E. coli MG1655 10 min after TMP+adenine treatment in M9 media
GSE32562	E. coli MG1655 10 min after TMP+glycine+methionine treatment in M9 media
GSE32562	E. coli MG1655 10 min after TMP+thymine+adenine+glycine+methionine treatment in M9 media
GSE32562	E. coli MG1655 10 min after TMP treatment in LB media
GSE32562	E. coli MG1655 10 min after TMP treatment in M9 media
GSE32562	E. coli MG1655 120 min after TMP+adenine+glycine+methionine treatment in M9 media
GSE32562	E. coli MG1655 120 min after TMP+adenine treatment in M9 media
GSE32562	E. coli MG1655 120 min after TMP+glycine+methionine treatment in M9 media
GSE32562	E. coli MG1655 120 min after TMP+thymine+adenine+glycine+methionine treatment in M9 media
GSE32562	E. coli MG1655 120 min after TMP treatment in LB media
GSE32562	E. coli MG1655 120 min after TMP treatment in M9 media
GSE32562	E. coli MG1655 30 min after TMP+adenine+glycine+methionine treatment in M9 media
GSE32562	E. coli MG1655 30 min after TMP+adenine treatment in M9 media
GSE32562	E. coli MG1655 30 min after TMP+glycine+methionine treatment in M9 media
GSE32562	E. coli MG1655 30 min after TMP+thymine+adenine+glycine+methionine treatment in M9 media
GSE32562	E. coli MG1655 30 min after TMP treatment in LB media
GSE32562	E. coli MG1655 30 min after TMP treatment in M9 media
GSE32562	E. coli MG1655 60 min after TMP+adenine+glycine+methionine treatment in M9 media
GSE32562	E. coli MG1655 60 min after TMP+adenine treatment in M9 media
GSE32562	E. coli MG1655 60 min after TMP+glycine+methionine treatment in M9 media
GSE32562	E. coli MG1655 60 min after TMP+thymine+adenine+glycine+methionine treatment in M9 media
GSE32562	E. coli MG1655 60 min after TMP treatment in LB media
GSE32562	E. coli MG1655 60 min after TMP treatment in M9 media
GSE32562	E. coli MG1655 90 min after TMP+adenine+glycine+methionine treatment in M9 media
GSE32562	E. coli MG1655 90 min after TMP treatment in M9 media
GSE32562	E. coli MG1655 mid-log phase in LB media
GSE32562	E. coli MG1655 mid-log phase in M9 media
GSE32562	Escherichia coli
GSE32562	LBTMP50_10min
GSE32562	LBTMP50_120min
GSE32562	LBTMP50_30min
GSE32562	LBTMP50_60min
GSE32562	M9TMP5_10min
GSE32562	M9TMP5_120min
GSE32562	M9TMP5_30min
GSE32562	M9TMP5_60min
GSE32562	M9TMP5_90min
GSE32562	M9TMP5_AdAA_10min
GSE32562	M9TMP5_AdAA_120min
GSE32562	M9TMP5_AdAA_30min
GSE32562	M9TMP5_AdAA_60min
GSE32562	M9TMP5_AdAA_90min
GSE32562	M9_TMP5_THY_Ad_AA_10min
GSE32562	M9_TMP5_THY_Ad_AA_120min
GSE32562	M9_TMP5_THY_Ad_AA_30min
GSE32562	M9_TMP5_THY_Ad_AA_60min
GSE32562	M9TMP_AA_10min
GSE32562	M9TMP_AA_120min
GSE32562	M9TMP_AA_30min
GSE32562	M9TMP_AA_60min
GSE32562	M9TMP_Ad_10min
GSE32562	M9TMP_Ad_120min
GSE32562	M9TMP_Ad_30min
GSE32562	M9TMP_Ad_60min
GSE32562	Overnight cultures were resuspended in fresh medium and TMP was added when the optical density (O.D. 600 nm) of the culture reached 0.3-0.4.
GSE32562	Raw fluorescence intensity data were normalized in R (http:
GSE32562	strain: MG1655
GSE32562	Time-point samples were taken every 15-30 minutes from 15 minutes to 2 hours post treatment.
GSE32562	Total RNA samples were purified using the Qiagen RNeasy kit (Chatsworth, CA) according to the manufacturer’s protocol.
GSE3265	20 ug of Total RNA from MG1655 (Repaired NCM 3416) in LB at 30 degrees OD 600=0.8
GSE3265	20 ug of Total RNA from MG1655 (Repaired NCM 3416) in M9 at 30 degrees OD 600=0.8
GSE3265	2 ug of Genomic MG 1655 (Repaired NCM 3416) DNA
GSE3265	2 ug of MG1655 (Repaired NCM 3416) Genomic DNA
GSE3265	Escherichia coli
GSE3265	Transcript Abundance in LB at 30 degrees OD600=0.8 Trial A
GSE3265	Transcript Abundance in LB at 30 degrees OD600=0.8 Trial B
GSE3265	Transcript Abundance in M9 at 30 degrees OD600=0.8 Trial A
GSE3265	Transcript Abundance in M9 at 30 degrees OD600=0.8 Trial B
GSE3265	VALUE is Log (base 2) of the ratio of the median of Channel 2 (usually 635 nm) to Channel 1 (usually 532 nm)
GSE3267	2' RNA Decay of MG1655 (Repaired NCM 3416) in LB at 30 C
GSE3267	2' RNA Decay of MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose Trial A
GSE3267	2' RNA Decay of MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose Trial B
GSE3267	4' RNA Decay of MG1655 (Repaired NCM 3416) in LB at 30 C
GSE3267	4' RNA Decay of MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose Trial A
GSE3267	4' RNA Decay of MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose Trial B
GSE3267	6' RNA Decay of MG1655 (Repaired NCM 3416) in LB at 30 C
GSE3267	6' RNA Decay of MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose Trial A
GSE3267	6' RNA Decay of MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose Trial B
GSE3267	8' RNA Decay of MG1655 (Repaired MCM 3416) in M9 + 0.2% Glucose Trial A
GSE3267	8' RNA Decay of MG1655 (Repaired NCM 3416) in LB at 30 C
GSE3267	8' RNA Decay of MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose Trial B
GSE3267	Escherichia coli
GSE3267	MG1655 2' post rif
GSE3267	MG1655 4' post rif
GSE3267	MG1655 6' post rif
GSE3267	MG1655 8' post rif
GSE3267	MG1655 at 30 Degrees
GSE3267	MG1655 (Repaired MCM 3416) in M9 + 0.2% Glucose
GSE3267	MG1655 (Repaired MCM 3416) in M9 + 0.2% Glucose 8' post rif
GSE3267	MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose
GSE3267	MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose 2' post rif
GSE3267	MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose 4' post rif
GSE3267	MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose 6' post rif
GSE3267	MG1655 (Repaired NCM 3416) in M9 + 0.2% Glucose 8' post rif
GSE3267	VALUE is Log (base 2) of the ratio of the mean of Channel 2 (usually 635 nm) to Channel 1 (usually 532 nm)
GSE3283	Escherichia coli
GSE3283	lrp- + Leu vs. lrp-  - Leu
GSE3283	lrp- - Leu vs. wt - Leu
GSE3283	lrp- + Leu vs. wt - Leu
GSE3283	VALUE is Log (base 2) of the ratio of the median of Channel 2 (usually 635 nm) to Channel 1 (usually 532 nm)
GSE3283	\W3110 lrp- at OD420~0.3 in MOPS  (ile, val, thi), 20 ug total, 10 ug pdN6 \
GSE3283	\W3110 lrp- at OD420~0.3 in MOPS  (ile, val, thi) + Leu, 20 ug total RNA ,10 ug pdN6 \
GSE3283	\W3110 lrp- at OD420~0.3 in MOPS  (ile, val, thi) plus Leu, 20 ug total RNA, 10 ug pdN6 \
GSE3283	\W3110 lrp- in MOPS (ile, val, thi) to OD420~0.3, 20 ug total RNA, 10 ug pdN6\
GSE3283	\W3110 wt in MOPS (ile, val, thi) at OD420~0.3, 20 ug total,10 ug pdN6\
GSE3283	\W3110 wt OD420~0.3 in MOPS  (ile, val, thi) + Leu, 20 ug total RNA, 10 ug pdN6 \
GSE3283	wt + Leu vs. wt - Leu
GSE33021	accession: U00006
GSE33021	Eco 50ng - 0%
GSE33021	Eco 50ng - 10%
GSE33021	Eco 50ng - 15%
GSE33021	Eco 50ng - 20%
GSE33021	Eco 50ng - 25%
GSE33021	Eco 50ng - 32.5%
GSE33021	Eco 50ng - 45%
GSE33021	Eco 50ng - 5%
GSE33021	Eco 5ng - 0%
GSE33021	Eco 5ng - 10%
GSE33021	Eco 5ng - 15%
GSE33021	Eco 5ng - 20%
GSE33021	Eco 5ng - 25%
GSE33021	Eco 5ng - 32.5%
GSE33021	Eco 5ng - 45%
GSE33021	Eco 5ng - 5%
GSE33021	E. coli was grown to mid-log phase (O.D.600nm 0.3-0.4) in Lennox LB broth (Becton Dickinson, Franklin Lakes, NJ) at 37°C.
GSE33021	Escherichia coli K-12
GSE33021	Escherichia coli K12 wild-type
GSE33021	Genomic DNA was extracted using Ultra Clean Soil DNA (MoBio Laboratories, Solana Beach, CA).
GSE33021	genotype: Wild Type
GSE33021	hybridization buffer (formamide content): 0% formamide
GSE33021	hybridization buffer (formamide content): 10% formamide
GSE33021	hybridization buffer (formamide content): 15% formamide
GSE33021	hybridization buffer (formamide content): 20% formamide
GSE33021	hybridization buffer (formamide content): 25% formamide
GSE33021	hybridization buffer (formamide content): 32.5% formamide
GSE33021	hybridization buffer (formamide content): 45% formamide
GSE33021	hybridization buffer (formamide content): 5% formamide
GSE33021	hybridization buffer (total rna): 50 ng
GSE33021	hybridization buffer (total rna): 5 ng
GSE33021	phenotype: normal
GSE33021	Raw data (.pair files) was analyzed using Matlab (The MathWorks, Natick, MA).  For each probe, the average intensity of three replicates were calculated after the elimination of outliers based on a standard deviation test. The average of control (Nonsense) probes was subtracted from all averages to obtain background-corrected results.
GSE33021	R. sphaeroides was phototrophically grown to mid-log phase (100-150 kletts) in Sistrom's minimal medium (Sistrom, W. 1960. Journal of General Microbiology. 22:778-785) amended with 33.9 mM succinate .
GSE33212	Cells were grown in the minimal media, M63. The final cell concentrations were controlled ~ 108 cells
GSE33212	Escherichia coli
GSE33212	growth protocol: heat shock
GSE33212	growth protocol: steady growth
GSE33212	heat shock response in the minimal medium
GSE33212	MDS42, biological rep 1
GSE33212	MDS42, biological rep 2
GSE33212	MDS42, biological rep 3
GSE33212	MDS42, biological rep 4
GSE33212	MDS42, biological rep 5
GSE33212	MDS42, biological rep 6
GSE33212	MDS42, biological rep 7
GSE33212	MDS42 exponentially grown in the minimal medium
GSE33212	MDS42, heat shock, biological rep 1
GSE33212	MDS42, heat shock, biological rep 2
GSE33212	MDS42, heat shock, biological rep 3
GSE33212	MG1655, biological rep 1
GSE33212	MG1655, biological rep 2
GSE33212	MG1655, biological rep 3
GSE33212	MG1655, biological rep 4
GSE33212	MG1655, biological rep 5
GSE33212	MG1655, biological rep 6
GSE33212	MG1655, biological rep 7
GSE33212	MG1655 exponentially grown in the minimal medium
GSE33212	MG1655, heat shock, biological rep 1
GSE33212	MG1655, heat shock, biological rep 2
GSE33212	MG1655, heat shock, biological rep 3
GSE33212	Microarray data were processed using custom scripts written in R based on the finite hybridisation (FH) model (Ono et al, 2008) and the thermodynamic model of non-specific binding (NSB) on short nucleotide microarrays (Furusawa et al, 2009).
GSE33212	strain: MDS42 (genome reduced)
GSE33212	strain: MG1655 (parent)
GSE33212	The cell culture was put into cold phenol-ethanol solution (1 g of phenol in 10 mL of ethanol) prepared in advance. The cells were collected by centrifugation at 16,000 × g for 5 min at 4°C, and the pelleted cells were stored at –80°C prior to use.
GSE33212	The log10 mRNA concentration (pM) data are provided as a supplementary file on the SERIES record.
GSE33212	Total RNAs were extracted using an RNeasy mini kit (Qiagen) in accordance with the manufacturer’s instructions.
GSE33671	An overnight culture was diluted to an OD600 of 0.02 in LB media supplemented with 100 µg
GSE33671	Cells were flash frozen in liquid nitrogen after the media was rapidly filtered. Frozen cells were pulverized by mixer milling and thawed in 20 mM EDC, pH 5.8. The crosslinking reaction was quenched with 250 mM glycine, 100 mM Tris Cl 8.0, and 4 mM NaHCO3.
GSE33671	Cells were flash frozen in liquid nitrogen after the media was rapidly filtered. Frozen cells were pulverized by mixer milling and thawed in 2.5 mM DSP. The crosslinking reaction was quenched with 100 mM Tris Cl 8.3.
GSE33671	Clarified extracts were treated with microccocal nuclease (45 enzyme units per absorbance unit of lysate at 260 nm), purified through a sucrose cushion, and affinity purified via TF. Ribosome-protected footprints were size selected and converted into a cDNA library for sequencing.
GSE33671	Clarified extracts were treated with microccocal nuclease (45 enzyme units per absorbance unit of lysate at 260 nm), purified through a sucrose gradient. Ribosome-protected footprints were size selected and converted into a cDNA library for sequencing.
GSE33671	DSP1_AP
GSE33671	DSP1_Total
GSE33671	DSP2_AP
GSE33671	DSP2_Total
GSE33671	DSP3_AP
GSE33671	DSP3_Total
GSE33671	EDC1_AP
GSE33671	EDC1_Total
GSE33671	Escherichia coli
GSE33671	genotype
GSE33671	growth stage: mid-log phase
GSE33671	Harvested by chloramphenicol pre-treatment and centrifugation; DSP treated ex vivo; Affinity purified TF crosslinked RNC footprints
GSE33671	Harvested by chloramphenicol pre-treatment and centrifugation; DSP treated ex vivo; Total footprints
GSE33671	Harvested by rapid filtration; DSP treated ex vivo; Affinity purified TF crosslinked RNC footprints
GSE33671	Harvested by rapid filtration; DSP treated ex vivo; Total footprints
GSE33671	Harvested by rapid filtration; EDC treated ex vivo; Affinity purified TF crosslinked RNC footprints
GSE33671	Harvested by rapid filtration; EDC treated ex vivo; Total footprints
GSE33671	library strategy: Ribosome profiling
GSE33671	library strategy: Selective ribosome profiling
GSE33671	RNA-Seq
GSE33671	strain: MC4100
GSE33671	The .align files have been processed using tagalign. Reads were aligned to the reference genome (Bowtie v.0.12.0) by the first 25 nt and extended to account for the linker.
GSE33671	The culture was incubated with 100 µg
GSE33735	E. coli K12 interacted with lettuce rhizosphere rep1
GSE33735	E. coli K12 interacted with lettuce rhizosphere rep2
GSE33735	E. coli K12 interacted with lettuce rhizosphere rep3
GSE33735	E. coli K12 interacted with lettuce rhizosphere rep4
GSE33735	E. coli K12 interacted with lettuce rhizosphere rep5
GSE33735	E. coli K12 interacted with lettuce rhizosphere rep6
GSE33735	Escherichia coli MG1655 cells grown in the hydroponic system without interacting with the lettuce rhizosphere for 3 days
GSE33735	Escherichia coli MG1655 cells interacted with the lettuce rhizosphere for 3 days
GSE33735	Escherichia coli MG1655 were grown in 10 ml of LB medium until stationary phase, collected by centrifugation at 8,000 ×g for 10 min, and washed twice with sterilized, plant growth medium (Caspersen et al. 1999). The resultant cells were re-suspended in 10 ml of the same plant growth medium to a final concentration of approximately 10E9 cells
GSE33735	Escherichia coli str. K-12 substr. MG1655
GSE33735	Following incubation, roots had been gently rinsed to remove loosely attached bacteria and roots were cut directly into 100 ml ice cold stop solution (5 % H2O-saturated phenol, pH 4.3, in 95% ethanol).  Root extracts were filtered using 0.5 µm filters to separate bacteria cells from plant cells in order to prevent interference of the cDNA labeling. Qiagen RNA protect solution was used to stabilize RNA during extraction. Bacteria had been collected by shaking and washing and stored in -80°C until using for RNA isolation.
GSE33735	Signal intensities were normalized for spot and slide abnormalities with the spatial Lowess algorithm and analyzed by mixed-effect ANOVA (MAANOVA) (Kerr et al. 2000). Both Lowess and MAANOVA are part of the R
GSE33735	Standard hot-phenol method
GSE33735	treatment: control
GSE33735	treatment: exposed to the lettuce rhizosphere for 3 days
GSE34023	Cells were harvested using RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) for stabilization of RNA. Stabilized cultures were used for RNA isolation using the RNeasy MiniKit system (Qiagen, Hilden, Germany). In brief, 1 ml of each culture was used and processed according to the manufacturer's instructions including an on-column DNaseI treatment. RNA quality was assayed by denaturing urea-PAGE and by measuring the ratio of absorption at 260
GSE34023	Data were processed using Affymetrix apt-probeset-summarize software version 1.10 and RMA algorithm. Samples were normalized using the standard normalization probes present on the Affymetrix GeneChip.
GSE34023	Escherichia coli K-12
GSE34023	Exponential cultures of transformants were inoculated from fresh overnight cultures in LB medium supplemented with 25 µg
GSE34023	genotype: Δ(yjjP-yjjQ-bglJ)
GSE34023	genotype: Δ(yjjP-yjjQ-bglJ) ΔleuO
GSE34023	genotype: Δ(yjjP-yjjQ-bglJ) ΔrcsB
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) + ctrl
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) + ctrl, biological replicate 1
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) + ctrl, biological replicate 2
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) + ctrl, biological replicate 3
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) + ctrl, biological replicate 4
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) + pBglJ
GSE34023	K12Δ(yjjP-yjjQ-bglJ) + pBglJ
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) + pBglJ, biological replicate 1
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) + pBglJ, biological replicate 2
GSE34023	K12Δ(yjjP-yjjQ-bglJ) + pBglJ, biological replicate 3
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) + pBglJ, biological replicate 4
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) + pLeuO
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) + pLeuO, biological replicate 1
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) + pLeuO, biological replicate 2
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) + pLeuO, biological replicate 3
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) + pLeuO, biological replicate 4
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) ΔleuO + ctrl
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) ΔleuO + ctrl, biological replicate 1
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) ΔleuO + ctrl, biological replicate 2
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) ΔleuO + ctrl, biological replicate 3
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) ΔleuO + ctrl, biological replicate 4
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) ΔleuO + pBglJ
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) ΔleuO + pBglJ, biological replicate 1
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) ΔleuO + pBglJ, biological replicate 2
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) ΔleuO + pBglJ, biological replicate 3
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) ΔleuO + pBglJ, biological replicate 4
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) ΔrcsB + ctrl
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) ΔrcsB + ctrl, biological replicate 1
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) ΔrcsB + ctrl, biological replicate 2
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) ΔrcsB + ctrl, biological replicate 3
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) ΔrcsB + ctrl, biological replicate 4
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) ΔrcsB + pBglJ
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) ΔrcsB + pBglJ, biological replicate 1
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) ΔrcsB + pBglJ, biological replicate 2
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) ΔrcsB + pBglJ, biological replicate 3
GSE34023	K12 Δ(yjjP-yjjQ-bglJ) ΔrcsB + pBglJ, biological replicate 4
GSE34023	overexpression: -
GSE34023	overexpression: BglJ
GSE34023	overexpression: LeuO
GSE34023	plasmid: pKEDR13
GSE34023	plasmid: pKESK22
GSE34023	plasmid: pKETS1
GSE34023	sample id: 1a
GSE34023	sample id: 1b
GSE34023	sample id: 1c
GSE34023	sample id: 1d
GSE34023	sample id: 2a
GSE34023	sample id: 2b
GSE34023	sample id: 2c
GSE34023	sample id: 2d
GSE34023	sample id: 3a
GSE34023	sample id: 3b
GSE34023	sample id: 3c
GSE34023	sample id: 3d
GSE34023	sample id: 4a
GSE34023	sample id: 4b
GSE34023	sample id: 4c
GSE34023	sample id: 4d
GSE34023	sample id: 5a
GSE34023	sample id: 5b
GSE34023	sample id: 5c
GSE34023	sample id: 5d
GSE34023	sample id: 6a
GSE34023	sample id: 6b
GSE34023	sample id: 6c
GSE34023	sample id: 6d
GSE34023	sample id: 7a
GSE34023	sample id: 7b
GSE34023	sample id: 7c
GSE34023	sample id: 7d
GSE34023	strain: T175
GSE34023	strain: T177
GSE34023	strain: T75
GSE34275	control, biological rep1 C1
GSE34275	control, biological rep1 C2
GSE34275	control, biological rep1 C3
GSE34275	control, biological rep2 C4
GSE34275	control, biological rep2 C5
GSE34275	control, biological rep2 C6
GSE34275	E.coli, grown in LB+ glycerol to0.8OD
GSE34275	E.coli, grown in LB to0.8OD
GSE34275	Escherichia coli
GSE34275	Escherichia coli was grown aerobically in Luria-Bertani (LB) broth at 30°C in an incubator shaker at 150 r.p.m.
GSE34275	Experimental,biological rep1 G1
GSE34275	Experimental,biological rep1 G2
GSE34275	Experimental,biological rep1 G3
GSE34275	Experimental,biological rep2 G4
GSE34275	Experimental,biological rep2 G5
GSE34275	Experimental,biological rep2 G6
GSE34275	growth medium: LB+glycerol medium
GSE34275	growth medium: LB medium
GSE34275	RNA was isolated from the culture by using the Qiagen RNeasy mini-prep kit.cDNA was synthesized using 5-10 µg
GSE34275	strain: Escherichia coli
GSE34275	The intensity cell files were then imported, normalized for background correction using PLIER and data analysed using Gene Spring 11.5 software.
GSE34275	To study gene expression in the presence and absence of glycerol, LB was supplemented with 10% (v
GSE3437	At OD450 = 0.3, cultures induced with 1 mM IPTG. Cells harvested 0 min after induction
GSE3437	At OD450 = 0.3, cultures induced with 1 mM IPTG. Cells harvested 10 min after induction
GSE3437	At OD450 = 0.3, cultures induced with 1 mM IPTG. Cells harvested 15 min after induction
GSE3437	At OD450 = 0.3, cultures induced with 1 mM IPTG. Cells harvested 20 min after induction
GSE3437	At OD450 = 0.3, cultures induced with 1 mM IPTG. Cells harvested 2.5 min after induction
GSE3437	At OD450 = 0.3, cultures induced with 1 mM IPTG. Cells harvested 30 min after induction
GSE3437	At OD450 = 0.3, cultures induced with 1 mM IPTG. Cells harvested 5 min after induction
GSE3437	At OD450 = 0.3, cultures induced with 1 mM IPTG. Cells harvested 60 min after induction
GSE3437	Culture samples for microarray analysis were added to ice-cold 5% water-saturated phenol in ethanol solution, centrifuged at 6,600 g and the cell pellets flash frozen in liquid N2 before storing at -80 degrees C until required. Total RNA was isolated from the stored cell pellets using the hot phenol method, and labeled Cy3 and Cy5 cDNA was prepared from 16 ug total RNA with 10 ug random hexamer (Integrated DNA Technologies, Inc., Coralville, IA, USA).
GSE3437	Data filtered for PCR success, >3x local background and spot quality (GenePix Flag). Normalized using Lowess smoothing from MA plot
GSE3437	EC12n090 RpoE 2.5 min Time course 4
GSE3437	EC12n091 RpoE 5 min Time course 4
GSE3437	EC12n092a RpoE 10 min Time course 4
GSE3437	EC12n093 RpoE 20 min Time course 4
GSE3437	EC12n094 RpoE 30 min Time course 4
GSE3437	EC12n095 RpoE 60 min Time course 4
GSE3437	EC12n096 RpoE 0 min Time course 4
GSE3437	EC12n101 RpoE 0 min Time course 3
GSE3437	EC7n018 RpoE 5 min Time course 1
GSE3437	EC7n019 RpoE 15 min Time course 1
GSE3437	EC7n065 RpoE 5 min Time course 2
GSE3437	EC7n066 RpoE 15 min Time course 2
GSE3437	EC7n067 RpoE 30 min Time course 2
GSE3437	EC7n068 RpoE 60 min Time course 2
GSE3437	EC7n071 RpoE 60 min Time course 1
GSE3437	EC8n021 RpoE 2.5 min Time course 3
GSE3437	EC8n022 RpoE 5 min Time course 3
GSE3437	EC8n050 RpoE 10min Time course 3
GSE3437	EC8n051 RpoE 20 min Time course 3
GSE3437	EC8n052 RpoE 30 min Time course 3
GSE3437	EC8n053 RpoE 60 min Time course 3
GSE3437	Escherichia coli
GSE3437	M9 minimal complete media, cultures grown aerobically at 30 degrees C in a gyratory water bath shaking at 240 rpm
GSE3437	MG1655 rpoHp3::lacZ delta lacX74
GSE3437	RpoE induced (0 min)
GSE3437	RpoE induced (10 min)
GSE3437	RpoE induced (15 min)
GSE3437	RpoE induced (15min)
GSE3437	RpoE induced (20 min)
GSE3437	RpoE induced (2.5 min)
GSE3437	RpoE induced (30 min)
GSE3437	RpoE induced (5 min)
GSE3437	RpoE induced (5min)
GSE3437	RpoE induced (60 min)
GSE3437	Wild type control (0 min)
GSE3437	Wild type control (10 min)
GSE3437	Wild type control (15 min)
GSE3437	Wild type control (20 min)
GSE3437	Wild type control (2.5 min)
GSE3437	Wild type control (30 min)
GSE3437	Wild type control (5 min)
GSE3437	Wild type control (60 min)
GSE34449	E. coli [K-12 MG1655 strain (U00096.2)] was grown overnight at 30 °C in LB medium.  The resulting culture was diluted 500-fold in fresh LB medium and grown at 30 °C for 3.5 hours such that O.D. at 600 nm became 0.30-0.35.
GSE34449	E_coli_transcriptome_1
GSE34449	E_coli_transcriptome_2
GSE34449	Escherichia coli str. K-12 substr. MG1655
GSE34449	Genome build: E. coli [K-12 MG1655 strain (U00096.2)
GSE34449	genotype: F-, lambda-, rph-1
GSE34449	reference genome: U00096.2
GSE34449	RNA from Escherichia coli
GSE34449	RNA-Seq
GSE34449	RNA was purified by a standard protocol using Phenol Chloroform.  Ribosomal RNA was removed using Ribo-Zero rRNA Removal Kit (Gram-Negative Bacteria) (Epicentre, Illumina).  Then, the conventional Illumina protocol for mRNA Sequencing Sample Preparation was applied with a few modifications (see original paper).
GSE34449	Standard Paired-End Illumina Library Construction Protocol was used with modified adapters containing optimized 20 bp barcode sequences (see original paper).  Samples with barcoded adapters were sequenced on an Illumina HiSeq 2000 with a 2x101 (for the first sequencing run) and 2x51 (for the second) base paired-end reads in one lane.
GSE34449	strain: K-12
GSE34449	Using a combination of python (3.2.1) and bowtie(0.12.7), from the raw sequencing data, we isolated reads which contained barcode sequences that corresponded to our original list of single molecule barcodes in both forward and reverse reads for each sequence pair that had at most one mismatch. We then aligned the first 28 bases (26 bases for the second sequencing run) of the targeted sequence of both the forward and reverse reads of each cluster to the E. coli genome and kept the sequences that uniquely align fewer than three mismatches and where the two reads did not map to the same sense or antisense strand of the genome.  We used a detailed filtering process to determine the identity of closely-mapped reads. Mapped sequence fragments with a length of at least 1,000 bases were discarded.  All sequences within the same transcription unit that had the same unique tag were analyzed further. We determined that more than one sequence with the same unique tag were identical if the distance between their center positions was less than four base-pairs and if the difference in length was less than 9 base-pairs. Then for each unique sequence, we counted the number of unique barcode tags that appeared to determine the copy number of each sequence and mapped each of them to genes. We include indexed genome viewer files (.sam and .sai) for both experiments using both the conventional method and the digital method.
GSE35100	Cells in log phase under furfural stress
GSE35100	Cells were grown at 37°C in Luria-Bertani (LB) medium supplemented with 50 μg
GSE35100	Data were analyzed using GeneChip Operating Software Version 1.4 (Affymetrix)
GSE35100	Escherichia coli
GSE35100	Furfural-tolerant IrrE mutant F1-37, biological rep1
GSE35100	Furfural-tolerant IrrE mutant F1-37, biological rep2
GSE35100	Furfural-tolerant IrrE mutant F1-37, biological rep3
GSE35100	genotype: furfural-tolerant mutant F1-37 of IrrE
GSE35100	genotype: wild type IrrE
GSE35100	strain: DH5a
GSE35100	The cells were centrifuged when they reached the log phase, and then rapidly chilled and stored in liquid nitrogen until used for the DNA microarray assay
GSE35100	Total RNA was isolated from the cells stored in liquid nitrogen using TRIzol Reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) and RNeasy MinElute Cleanup Kits (Qiagen, Valencia, CA, USA)
GSE35100	Wild-type IrrE, biological rep1
GSE35100	Wild-type IrrE, biological rep2
GSE35100	Wild-type IrrE, biological rep3
GSE35371	E_coli_negativ_control_left_chamber_rep1
GSE35371	E_coli_negativ_control_left_chamber_rep2
GSE35371	E_coli_negativ_control_left_chamber_rep3
GSE35371	E_coli_negativ_control_right_chamber_rep1
GSE35371	E_coli_negativ_control_right_chamber_rep2
GSE35371	E_coli_negativ_control_right_chamber_rep3
GSE35371	E_coli_response_control_1mM_H2O2_added_rep1
GSE35371	E_coli_response_control_1mM_H2O2_added_rep2
GSE35371	E_coli_response_control_1mM_H2O2_added_rep3
GSE35371	E_coli_response_control_water_added_rep1
GSE35371	E_coli_response_control_water_added_rep2
GSE35371	E_coli_response_control_water_added_rep3
GSE35371	E_coli_sham_powerline_interm_15h_rep1
GSE35371	E_coli_sham_powerline_interm_15h_rep2
GSE35371	E_coli_sham_powerline_interm_15h_rep3
GSE35371	E_coli_sham_powerline_interm_2.5h_rep1
GSE35371	E_coli_sham_powerline_interm_2.5h_rep2
GSE35371	E_coli_sham_powerline_interm_2.5h_rep3
GSE35371	E_coli_sham_powerline_interm_8min_rep1
GSE35371	E_coli_sham_powerline_interm_8min_rep2
GSE35371	E_coli_sham_powerline_interm_8min_rep3
GSE35371	E_coli_sham_sinusoidal_cont_15h_rep1
GSE35371	E_coli_sham_sinusoidal_cont_15h_rep2
GSE35371	E_coli_sham_sinusoidal_cont_15h_rep3
GSE35371	E_coli_sham_sinusoidal_cont_2.5h_rep1
GSE35371	E_coli_sham_sinusoidal_cont_2.5h_rep2
GSE35371	E_coli_sham_sinusoidal_cont_2.5h_rep3
GSE35371	E_coli_sham_sinusoidal_cont_8min_rep1
GSE35371	E_coli_sham_sinusoidal_cont_8min_rep2
GSE35371	E_coli_sham_sinusoidal_cont_8min_rep3
GSE35371	E_coli_sham_sinusoidal_interm_15h_rep1
GSE35371	E_coli_sham_sinusoidal_interm_15h_rep2
GSE35371	E_coli_sham_sinusoidal_interm_15h_rep3
GSE35371	E_coli_sham_sinusoidal_interm_2.5h_rep1
GSE35371	E_coli_sham_sinusoidal_interm_2.5h_rep2
GSE35371	E_coli_sham_sinusoidal_interm_2.5h_rep3
GSE35371	E_coli_treated_powerline_interm_15h_rep1
GSE35371	E_coli_treated_powerline_interm_15h_rep2
GSE35371	E_coli_treated_powerline_interm_15h_rep3
GSE35371	E_coli_treated_powerline_interm_2.5h_rep1
GSE35371	E_coli_treated_powerline_interm_2.5h_rep2
GSE35371	E_coli_treated_powerline_interm_2.5h_rep3
GSE35371	E_coli_treated_powerline_interm_8min_rep1
GSE35371	E_coli_treated_powerline_interm_8min_rep2
GSE35371	E_coli_treated_powerline_interm_8min_rep3
GSE35371	E_coli_treated_sinusoidal_cont_15h_rep1
GSE35371	E_coli_treated_sinusoidal_cont_15h_rep2
GSE35371	E_coli_treated_sinusoidal_cont_15h_rep3
GSE35371	E_coli_treated_sinusoidal_cont_2.5h_rep1
GSE35371	E_coli_treated_sinusoidal_cont_2.5h_rep2
GSE35371	E_coli_treated_sinusoidal_cont_2.5h_rep3
GSE35371	E_coli_treated_sinusoidal_cont_8min_rep1
GSE35371	E_coli_treated_sinusoidal_cont_8min_rep2
GSE35371	E_coli_treated_sinusoidal_cont_8min_rep3
GSE35371	E_coli_treated_sinusoidal_interm_15h_rep1
GSE35371	E_coli_treated_sinusoidal_interm_15h_rep2
GSE35371	E_coli_treated_sinusoidal_interm_15h_rep3
GSE35371	E_coli_treated_sinusoidal_interm_2.5h_rep1
GSE35371	E_coli_treated_sinusoidal_interm_2.5h_rep2
GSE35371	E_coli_treated_sinusoidal_interm_2.5h_rep3
GSE35371	Escherichia coli K-12 strain MG1655 was cultivated aerobically (~0.5 l
GSE35371	Escherichia coli str. K-12 substr. MG1655
GSE35371	growth condition: steady-state continuous cultivation (dilution rate of 0.4 h-1), aerobic
GSE35371	medium: defined mineral medium with 1 g
GSE35371	Quality control and microarray data analysis of all 60 chips was done using R
GSE35371	Samples of ~7.2 ml bacterial culture were mixed with 0.8 ml stop solution, pelleted and total RNA was purified using RNeasy Mini Kit (Qiagen). DNase treatment was done twice with RQ1 DNase (Promega) to remove genomic DNA. cDNA synthesis was done according to the GeneChip® Expression Analysis Technical Manual of Affymetrix using M-MLV reverse transcriptase (Promega), without DTT addition. 13 µl of EB buffer were used for elution of cDNA after its clean-up with the MiniElute CR purification Kit (Qiagen). cDNA fragmentation was done in a 20-µl reaction containing 3.5 µg cDNA, 2 µl 10x One Phor-All buffer, 2 µl DNase I (diluted to 0.2 U
GSE35371	Samples of magnetic field-treated or sham-treated cells were withdrawn as fast as possible from the bioreactor (not later than 3 min) after the specified treatement period. Samples taken during intermittent exposure were withdrawn in the 4 min exposure break. Unexposed samples were withdrawn as fast as possible during steady-state conditions in the chemostat. In the response control experiment, samples were withdrawn 10 min after addition of 1 mM H2O2 (treated culture) or the equivalent water volume (reference culture).
GSE35371	treatment duration: 10 min
GSE35371	treatment duration: 15 h
GSE35371	treatment duration: 2.5 h
GSE35371	treatment duration: 8 min
GSE35371	treatment duration: none
GSE35371	treatment: sham-treated power line intermittent (2 min on, 4 min off) magnetic field
GSE35371	treatment: sham-treated sinusoidal continous magnetic field
GSE35371	treatment: sham-treated sinusoidal intermittent (2 min on, 4 min off) magnetic field
GSE35371	treatment: treated power line intermittent (2 min on, 4 min off) magnetic field
GSE35371	treatment: treated sinusoidal continous magnetic field
GSE35371	treatment: treated sinusoidal intermittent (2 min on, 4 min off) magnetic field
GSE35371	treatment: unexposed, left chamber
GSE35371	treatment: unexposed, right chamber
GSE35371	treatment: unexposed, treated with 1mM H2O2
GSE35371	treatment: unexposed, treated with water
GSE35641	After each sequenced fragments were aligned to the reference genome using Bowtie, the position of each alignment is distributed into several nucleotides in the center of the footprint. For each footprint read, the center residues that are at least 12 nucleotides away from either ends were given the same score, which is weighted by the length of the fragment [Oh et al,. Cell 147, 1295 (2011)]. More at G.W. Li, E. Oh, and J.S. Weissman, Nature (in press)
GSE35641	E. coli recoded ompF
GSE35641	E. coli recoded ompF (recoded ompF gene)
GSE35641	Escherichia coli
GSE35641	Genome Build:
GSE35641	medium: MOPS
GSE35641	OmpFrecode_f.wig: NC_000913.2
GSE35641	OmpFrecode_r.wig: NC_000913.2
GSE35641	Ribosome protected mRNA fragments were size selected via gel purification, and ligated to 5' adenylated DNA oligo. After reverse transcription, the single stranded DNA was circularized, and PCR amplified [Oh et al,. Cell 147, 1295 (2011)]. More at G.W. Li, E. Oh, and J.S. Weissman, Nature (in press)
GSE35641	RNA-Seq
GSE35641	strain: BJW9 w
GSE35641	treatment: Ribosome-protected mRNA, Ribosome footprint sample digested with 60 units of micrococcal nuclease per A260 absorbance
GSE3591	aerobic reference
GSE3591	anaerobic reference
GSE3591	Escherichia coli
GSE3591	fnr- aerobic
GSE3591	fnr- aerobic  AN rep 1
GSE3591	fnr- aerobic  AN rep 2
GSE3591	fnr- aerobic  AN rep 3
GSE3591	fnr- aerobic rep 1
GSE3591	fnr- aerobic rep 2
GSE3591	fnr- aerobic rep 3
GSE3591	fnr- anaerobic
GSE3591	fnr- anaerobic  AN rep 1
GSE3591	fnr- anaerobic  AN rep 2
GSE3591	fnr- anaerobic  AN rep 3
GSE3591	fnr- anaerobic plus NO2
GSE3591	fnr- anaerobic plus NO2 
GSE3591	fnr- anaerobic plus NO2  AN rep 1
GSE3591	fnr- anaerobic plus NO2  AN rep 2
GSE3591	fnr- anaerobic plus NO2  AN rep 3
GSE3591	fnr- anaerobic plus NO2 rep 1
GSE3591	fnr- anaerobic plus NO2 rep 2
GSE3591	fnr- anaerobic plus NO2 rep 3
GSE3591	fnr- anaerobic plus NO3
GSE3591	fnr- anaerobic plus NO3  AN rep 1
GSE3591	fnr- anaerobic plus NO3  AN rep 2
GSE3591	fnr- anaerobic plus NO3  AN rep 3
GSE3591	fnr- anaerobic plus NO3 rep 1
GSE3591	fnr- anaerobic plus NO3 rep 2
GSE3591	fnr- anaerobic plus NO3 rep 3
GSE3591	fnr- anaerobic rep 1
GSE3591	fnr- anaerobic rep 2
GSE3591	fnr- anaerobic rep 3
GSE3591	Genetic background: fnr-
GSE3591	Genetic background:wt
GSE3591	Genetic background: wt
GSE3591	Genetic background: wtGrowth conditions: aerobic
GSE3591	Growth conditions: aaerobic
GSE3591	Growth conditions: aerobic
GSE3591	Growth conditions: anaerobic
GSE3591	Growth conditions: anaerobic plus NO2
GSE3591	Growth conditions: anaerobic plus NO3
GSE3591	narXL anaerobic plus NO2
GSE3591	narXLP anaerobic plus NO2
GSE3591	narXLP rep 1
GSE3591	narXLP rep 2
GSE3591	narXLP rep 3
GSE3591	narXL rep 1
GSE3591	narXL rep 2
GSE3591	narXL rep 3
GSE3591	narXL rep 4
GSE3591	Raw, not normalised
GSE3591	Strain:E.coli K-12 MG1655
GSE3591	Strain:E.coli K-12 MG1655, Genetic background: fnr-, Growth conditions: aerobic
GSE3591	Strain:E.coli K-12 MG1655, Genetic background: fnr-, Growth conditions: anaerobic
GSE3591	Strain:E.coli K-12 MG1655, Genetic background: fnr-, Growth conditions: anaerobic plus NO2
GSE3591	Strain:E.coli K-12 MG1655, Genetic background: fnr-, Growth conditions: anaerobic plus NO3
GSE3591	Strain:E.coli K-12 MG1655, Genetic background: narXL, Growth conditions: anaerobic plus NO2
GSE3591	Strain:E.coli K-12 MG1655, Genetic background: narXLP, Growth conditions: anaerobic plus NO2
GSE3591	Strain:E.coli K-12 MG1655, Genetic background: wt, Growth conditions: aerobic
GSE3591	Strain:E.coli K-12 MG1655, Genetic background: wt, Growth conditions: anaerobic
GSE3591	Strain:E.coli K-12 MG1655, Genetic background: wt, Growth conditions: anaerobic plus NO2
GSE3591	Strain:E.coli K-12 MG1655, Genetic background: wt, Growth conditions: anaerobic plus NO3
GSE3591	wt aerobic
GSE3591	wt aerobic  AN rep 1
GSE3591	wt aerobic  AN rep 2
GSE3591	wt aerobic  AN rep 3
GSE3591	wt aerobic rep 1
GSE3591	wt aerobic rep 2
GSE3591	wt aerobic rep 3
GSE3591	wt anaerobic
GSE3591	wt anaerobic 
GSE3591	wt anaerobic  AN rep 1
GSE3591	wt anaerobic  AN rep 2
GSE3591	wt anaerobic  AN rep 3
GSE3591	wt anaerobic plus NO2
GSE3591	wt anaerobic plus NO2  AN rep 1
GSE3591	wt anaerobic plus NO2  AN rep 2
GSE3591	wt anaerobic plus NO2  AN rep 3
GSE3591	wt anaerobic plus NO2 rep 1
GSE3591	wt anaerobic plus NO2 rep 2
GSE3591	wt anaerobic plus NO2 rep 3
GSE3591	wt anaerobic plus NO3
GSE3591	wt anaerobic plus NO3  AN rep 1
GSE3591	wt anaerobic plus NO3  AN rep 2
GSE3591	wt anaerobic plus NO3  AN rep 3
GSE3591	wt anaerobic plus NO3 rep 1
GSE3591	wt anaerobic plus NO3 rep 2
GSE3591	wt anaerobic plus NO3 rep 3
GSE3591	wt anaerobic rep 1
GSE3591	wt anaerobic rep 2
GSE3591	wt anaerobic rep 3
GSE36130	A 5ml overnight culture of E. coli O157:H7 (Sakai) was grown in Neidhardt's EZ Rich Defined Medium for 18 h at 37C. The culture was diluted 1:100 into 50 ml of fresh, prewarmed Neidhardt's EZ Rich Defined Medium in a 125 ml Ehrlenmeyer flask and shaken at 37C, 150 rpm in a New Brunswick Shaking water bath until the culture density reached 0.4. Half of the culture was transferred to a second identical flask containing menadione bisulphite to a final concentration of 0.5 mg
GSE36130	A 5ml overnight culture of E. coli O157:H7 was grown in Neidhardt's EZ Rich Defined Medium for 18 h at 37C. The culture was diluted 1:100 into 50 ml of fresh, prewarmed Neidhardt's EZ Rich Defined Medium in a 125 ml Ehrlenmeyer flask and shaken at 37C, 150 rpm in a New Brunswick Shaking water bath until the culture density reached 0.4. Half of the culture was transferred to a second identical flask containing menadione bisulphite to a final concentration of 0.5 mg
GSE36130	A 5ml overnight culture of MG1655 was grown in Neidhardt's EZ Rich Defined Medium for 18 h at 37C. The culture was diluted 1:100 into 50 ml of fresh, prewarmed Neidhardt's EZ Rich Defined Medium in a 125 ml Ehrlenmeyer flask and shaken at 37C, 150 rpm in a New Brunswick Shaking water bath until the culture density reached 0.4. Half of the culture was transferred to a second identical flask containing menadione bisulphite to a final concentration of 0.5 mg
GSE36130	A 5ml overnight culture of MG1655 was grown in Neidhardt's EZ Rich Defined Medium for 18 h at 37C. The culture was diluted 1:100 into 50 ml of fresh, prewarmed Neidhardt's EZ Rich Defined Medium in a 125 ml Ehrlenmeyer flask and shaken at 37C, 150 rpm in a New Bruswick Shaking water bath until the culture density reached 0.4. Half of the culture was transferred to a second identical flask containing menadione bisulphite to a final concentration of 0.5 mg
GSE36130	An RNeasy kit (Qiagen Ltd) was used to extract the total RNA according to manufacturers’ instructions. Contaminating DNA was removed by using on-column DNase I digestion (Qiagen Ltd). The quality and quantity of the RNA preparations were determined with an Agilent 2100 Bioanalyzer by using the RNA 6000 nano assay Labchip (Agilent, Stockport, United Kingdom).
GSE36130	E. coli K-12 untreated (reference sample)_rep #1
GSE36130	E. coli K-12 untreated (reference sample)_rep #2
GSE36130	E. coli K-12 untreated (reference sample)_rep #3
GSE36130	E. coli O157 (Sakai) untreated (reference sample)_rep #1
GSE36130	E. coli O157 (Sakai) untreated (reference sample)_rep #2
GSE36130	E. coli O157 (Sakai) untreated (reference sample)_rep #3
GSE36130	Escherichia coli
GSE36130	Escherichia coli K-12 treated with menadione_rep#1
GSE36130	Escherichia coli K-12 treated with menadione_rep #2
GSE36130	Escherichia coli K-12 treated with menadione_rep #3
GSE36130	Escherichia coli O157 (Sakai) treated with menadione_rep#1
GSE36130	Escherichia coli O157 (Sakai) treated with menadione_rep#2
GSE36130	Escherichia coli O157 (Sakai) treated with menadione_rep#3
GSE36130	GenePix software (Axon Instruments, Union City, CA) version 5.1 was used to process the scanned data and generate the gpr files.
GSE36130	medium: Neidhardt's EZ Rich Defined Medium (Teknova, USA)
GSE36130	od600: 0.4
GSE36130	Oxidative stress in E. coli K-12 #1
GSE36130	Oxidative stress in E. coli K-12 #2
GSE36130	Oxidative stress in E. coli K-12 #3
GSE36130	Oxidative stress in E. coli O157 (Sakai) #1
GSE36130	Oxidative stress in E. coli O157 (Sakai) #2
GSE36130	Oxidative stress in E. coli O157 (Sakai) #3
GSE36130	strain: k-12 MG1655 wild-type
GSE36130	strain: o157: H7 (Sakai) wild-type
GSE36130	treatment: 0.5 mg
GSE36248	ampicilin treatment
GSE36248	Ampicilin_treatment_plasmidmappedreads_statistical_output.txt: NC_012692.1
GSE36248	Amp_Treatment_genomemappedreads_statistical_output.txt: NC_000913.2
GSE36248	bacteria grown at 37° C with shaking until log phase
GSE36248	bacteria grown at 37° C with shaking until log phase with ampicilin treatment
GSE36248	bacteria grown at 37° C with shaking until log phase with florfenicol treatment
GSE36248	bacteria grown at 37° C with shaking until log phase with streptomycin treatment
GSE36248	cDNA reads were trimmed so that the quality at each base position was above 30 (~15-20 bp) and then mapped either to the E. coli K-12 MG1655 published genome sequence (Genbank accession no. NC_000913) or to the pAR060302 published sequence (Genbank accession no. NC_092692) using BOWTIE.  The E. coli strain DH5α has an incomplete annotation and for this reason the E. coli K-12 annotation was used, representing an estimation of differentially expressed genes due to exposure of antimicrobials.  Mapped reads for 3 seperate sequencing runs were combined because some sequencing runs were not fully completed due to technical difficulties.  For each condition, graphs representing the number of mapped reads per nucleotide were generated and visualized using the Integrated Genome Viewer (IGV).  Images were created using XplasMap (http:
GSE36248	Cells were pelleted and RNA was purified using a commercially available RNA extraction kit (Qiagen).  RNA preparations were then subjected to a DNase treatment to eliminate DNA contamination from the sample (Qiagen).  A treatment was also included to deplete ribosomal RNA using a commercially available kit (MicrobExpress, Ambion).  The two biological replicates for each growth condition were pooled for sequencing.
GSE36248	E. coli strain DH5α harboring pAR060302 was grown in 10 mL DifcoTM Luria-Bertani (LB) broth aliquots at 37º C with shaking until an OD600 of 0.5.
GSE36248	Escherichia coli
GSE36248	florfenicol treatment
GSE36248	Florfenicol_treatment_plasmidmappedreads_statistical_output.txt: NC_012692.1
GSE36248	Flor_treatment_genomemappedreads_statistical_output.txt: NC_000913.2
GSE36248	Genome Build:
GSE36248	no treatment
GSE36248	RNA-Seq
GSE36248	strain: DH5α(pAR060302)
GSE36248	streptomycin treatment
GSE36248	Streptomycin_treatment_plasmidmappedreads_statistical_output.txt: NC_012692.1
GSE36248	Strep_treatment_genomemappedreads_statistical_output.txt: NC_000913.2
GSE36248	treatment: ampicillin (50 µg
GSE36248	treatment: florfenicol (30 µg
GSE36248	treatment: none
GSE36248	treatment: streptomycin (50 µg
GSE36885	E. coli O157:H7 interacted with lettuce rhizosphere biological rep 1 slide 1
GSE36885	E. coli O157:H7 interacted with lettuce rhizosphere biological rep 1 slide 2
GSE36885	E. coli O157:H7 interacted with lettuce rhizosphere biological rep 2 slide 3
GSE36885	E. coli O157:H7 interacted with lettuce rhizosphere biological rep 2 slide 4
GSE36885	E. coli O157:H7 interacted with lettuce rhizosphere biological rep 3 slide 5
GSE36885	E. coli O157:H7 interacted with lettuce rhizosphere biological rep 3 slide 6
GSE36885	Escherichia coli
GSE36885	Escherichia coli EDL 933 cells grown in the hydroponic system without interacting with the lettuce rhizosphere for 3 days
GSE36885	Escherichia coli EDL 933 cells interacted with the lettuce rhizosphere for 3 days
GSE36885	Escherichia coli EDL 933 were grown in 10 ml of LB medium until stationary phase, collected by centrifugation at 8,000 ×g for 10 min, and washed twice with sterilized, plant growth medium (Caspersen et al. 1999). The resultant cells were re-suspended in 10 ml of the same plant growth medium to a final concentration of approximately 10E9 cells
GSE36885	Following incubation, roots had been gently rinsed to remove loosely attached bacteria and roots were cut directly into 100 ml ice cold stop solution (5 % H2O-saturated phenol, pH 4.3, in 95% ethanol).  Root extracts were filtered using 0.5 µm filters to separate bacteria cells from plant cells in order to prevent interference of the cDNA labeling. Qiagen RNA protect solution was used to stabilize RNA during extraction. Bacteria had been collected by shaking and washing and stored in -80°C until using for RNA isolation.
GSE36885	genotype
GSE36885	Signal intensities were normalized for spot and slide abnormalities with the spatial Lowess algorithm and analyzed by mixed-effect ANOVA (MAANOVA) (Kerr et al. 2000). Both Lowess and MAANOVA are part of the R
GSE36885	Standard hot-phenol method
GSE36885	strain: O157: H7
GSE36885	treatment: grown in lettuce rhizosphere
GSE36885	treatment: grown without lettuce rhizosphere
GSE37026	control sample at 30 min, biological rep1
GSE37026	control sample at 30 min, biological rep2
GSE37026	control sample at 60 min, biological rep1
GSE37026	control sample at 60 min, biological rep2
GSE37026	Data were normalized using RMA algorithm from R
GSE37026	Escherichia coli MG1655 after 30 min incubation
GSE37026	Escherichia coli MG1655 after 30 min incubation following colicin M treatment
GSE37026	Escherichia coli MG1655 after 60 min incubation
GSE37026	Escherichia coli MG1655 after 60 min incubation following colicin M treatment
GSE37026	Escherichia coli str. K-12 substr. MG1655
GSE37026	Overnight cultures of E. coli MG1655  grown at 37°C with shaking at 200 rpm were diluted 1:625 into 50 ml of LB broth (Roth), and incubated at 37°C with shaking at 200 rpm.
GSE37026	Total RNA was extracted using RNeasy Mini Kit (Qiagen) according to the manufacturer's protocol.
GSE37026	treated sample at 30 min, biological rep1
GSE37026	treated sample at 30 min, biological rep2
GSE37026	treated sample at 60 min, biological rep1
GSE37026	treated sample at 60 min, biological rep2
GSE37026	treatment: treated culture
GSE37026	treatment: untreated culture
GSE37026	When the cultures reached an OD600 0.6 they were split into two flasks, each containing 20 ml of the culture. One was treated with a subinhibitory concentration of purified colicin M, while the untreated served as a control. 2-ml culture aliquotes were harvested from each flask after 30 min and 60 min incubation at 37°C  and were mixed with 4 ml RNAProtect Bacteria Reagent (Qiagen).
GSE37095	Bacterial pellets were resuspended in 350µl RNAwiz  (Ambion, Austin, TX) and kept at -80 °C.
GSE37095	Data were processed using the robust multiarray average algorithm (RMA) for normalization, background correction and expression value calculation. The EB (Wright and Simon) test was used for the fold change and the p­value calculation,
GSE37095	E. coli O157:H7 was grown in 15mL falcon tubes containing 8mL of filtered rat's caecal content. Growth were performed in static condition at 37 °C for 6 hours.
GSE37095	Escherichia coli O157:H7 cultivated for 6 hours in the caecal content of rats
GSE37095	Escherichia coli O157:H7 str. EDL933
GSE37095	Germfree rat's caecum, biological rep1
GSE37095	Germfree rat's caecum, biological rep2
GSE37095	Germfree rat's caecum, biological rep3
GSE37095	growth protocol: control
GSE37095	growth protocol: in the caecal content of rats associated with the human microbiota
GSE37095	Human intestinal microbiota associated rat's caecum, biological rep1
GSE37095	Human intestinal microbiota associated rat's caecum, biological rep2
GSE37095	Human intestinal microbiota associated rat's caecum, biological rep3
GSE37095	RNA extractions were performed using RiboPure™­Bacteria Kit (Ambion, Austin, TX), according to the manufacturer's recommendations
GSE38185	Agilent Feature Extraction Software v. 9.5.3.1  was used for background subtraction and LOWESS normalization.
GSE38185	control
GSE38185	Escherichia coli
GSE38185	Escherichia coli control vs H2O2 Rep1
GSE38185	Escherichia coli control vs H2O2 Rep2
GSE38185	H2O2
GSE38185	One conditions: 1% (v
GSE38185	Overnight culture of E. coli W3110 in LB was diluted in M9 minimal medium with supplements to OD600=0.01 and was incubated at 37 Ceilsus degree witouth shaking until its OD600 reached 0.1.
GSE38185	strain: K-12 W3110
GSE38185	Total RNA was extracted from 5ml cell culture at 10min incubation with or without 1% Hydrogen peroxide using RNeasy Mini kit (Qiagen, Inc., Valencia, CA) according to the manufacturer’s protocol
GSE38185	treatment: 1% H202, anaerobic
GSE38185	treatment: 1% H2O2, anaerobic
GSE38185	treatment: control, anaerobic
GSE38186	Agilent Feature Extraction Software v. 9.5.3.1  was used for background subtraction and LOWESS normalization.
GSE38186	Escherichia coli
GSE38186	Escherichia coli wild type vs luxS mutants with 10% H2O2 Rep1
GSE38186	Escherichia coli wild type vs luxS mutants with 10% H2O2 Rep2
GSE38186	Escherichia coli wild type vs luxS mutants with 30% H2O2 Rep1
GSE38186	Escherichia coli wild type vs luxS mutants with 30% H2O2 Rep2
GSE38186	Escherichia coli wild type vs luxS mutants without H2O2 Rep1
GSE38186	Escherichia coli wild type vs luxS mutants without H2O2 Rep2
GSE38186	genotype: luxS
GSE38186	genotype: wild type
GSE38186	luxS mutants, 10% H2O2
GSE38186	luxS mutants, 30% H2O2
GSE38186	luxS mutants, without H2O2
GSE38186	Overnight culture of E. coli in LB was diluted in LB supplemented with 0.8% glucose to OD600=0.02 and was continuously incubated at 30 degree celcius with shaking until its OD600 reached 1.0
GSE38186	strain: K-12 W3110
GSE38186	three different concentrations, without H2O2, 10% (v
GSE38186	Total RNA was extracted from 5ml cell culture after 30min incubation with or without H2O2 treatment using RNeasy Mini kit (Qiagen, Inc., Valencia, CA) according to the manufacturer’s protocol
GSE38186	treatment: 10% H202
GSE38186	treatment: 30% H202
GSE38186	treatment: none
GSE38186	wild type, 10% H2O2
GSE38186	wild type, 30% H2O2
GSE38186	wild type, without H2O2
GSE3869	Escherichia coli
GSE3869	JCB570
GSE3869	JQ004 (rraA)
GSE3869	rraA deletion, OD600=0.3
GSE3869	rraA deletion, OD600=0.5
GSE3869	rraA deletion, OD600=1.0
GSE3869	VALUE is Log (base 2) of the ratio of the median of Channel 2 (usually 635 nm) to Channel 1 (usually 532 nm)
GSE3870	Escherichia coli
GSE3870	KSL2000, 0.1 % arabinose
GSE3870	KSL2000, no arabinose
GSE3870	KSL2000 plus pTrc99A
GSE3870	KSL2000 plus pTrc99A-RraA
GSE3870	KSL2000-Rne depletion
GSE3870	KSL2000-RraA overexpression
GSE3870	KSL2009, 0.1% arabinose
GSE3870	KSL2009, no arabinose
GSE3870	KSL2009-N-Rne depletion
GSE3870	KSL2009 plus pTrc99A
GSE3870	KSL2009 plus pTrc99A-RraA
GSE3870	KSL2009-RraA overexpression
GSE3870	VALUE is Log (base 2) of the ratio of the median of Channel 2 (usually 635 nm) to Channel 1 (usually 532 nm)
GSE39343	Escherichia coli O157
GSE39343	genetic background: O157 H19
GSE39343	genotype: triclosan tolerant mutant
GSE39343	genotype: wild type
GSE39343	Microarray analysis including pre-processing, normalisation anmd statistical analysis were performed using R (R, 2007) version 2.6 and Bioconductor (Gentleman et al. 2004, Genome Biol. 5:R80) version 2.1 as previously described by Morris et al.(2009, Physiol. Genomics 39:28-37). Propagating uncertainty in microarray analysis (puma) method was used to estimate fold changes and P-like values of differential gene expression analysis (Pearson et al. 2009, BMC Bioinformatics 10:211).
GSE39343	Mutant E. coli O157 treated with 6 ug
GSE39343	Mutant E. coli O157 untreated, biological rep 1
GSE39343	Mutant E. coli O157 untreated, biological rep 2
GSE39343	Mutant E. coli O157 untreated, biological rep 3
GSE39343	strain: T3 5H5
GSE39343	strain: T3 5H5 M
GSE39343	The subculture was split into two 10 ml portions, one of which was treated with 6ug
GSE39343	The wildtype and mutant E. coli O157:H19 strains were grown on LB agar incubated at 37c x 24h. A single isolated colony for each strain was selected and inoculated into 20 ml LB broth and incubated at 37c until growth reached an optical density of 0.6 at 600nm.
GSE39343	Total RNA was stabilised and subsequently purified from a 500 ul portion of each bacterial culture using a RNAprotect Bacterial Reagent Mini Kit (Qiagen, Crawley, UK)
GSE39343	treatment: triclosan
GSE39343	treatment: untreated
GSE39343	Triclosan tolerant mutant triclosan treated biological rep 1
GSE39343	Triclosan tolerant mutant triclosan treated biological rep 2
GSE39343	Triclosan tolerant mutant triclosan treated biological rep 3
GSE39343	Triclosan tolerant mutant untreated biological rep 1
GSE39343	Triclosan tolerant mutant untreated biological rep 2
GSE39343	Triclosan tolerant mutant untreated biological rep 3
GSE39343	Wildtype E. coli O157 treated with 6 ug
GSE39343	Wildtype E. coli O157 untreated, biological rep 1
GSE39343	Wildtype E. coli O157 untreated, biological rep 2
GSE39343	Wildtype E. coli O157 untreated, biological rep 3
GSE39343	Wildtype triclosan treated biological rep 1
GSE39343	Wildtype triclosan treated biological rep 2
GSE39343	Wildtype triclosan treated biological rep 3
GSE39343	Wildtype untreated biological rep 1
GSE39343	Wildtype untreated biological rep 2
GSE39343	Wildtype untreated biological rep 3
GSE39607	0.5MIC of CYA, biological rep1
GSE39607	0.5MIC of CYA, biological rep2
GSE39607	0.5MIC of CYA, biological rep3
GSE39607	Cells were grown in  anaerobic incubator for 1h at 37℃ and drugs were added according to the different concentrations. The cultures were incubated for 30min.
GSE39607	Escherichia coli
GSE39607	Escherichia coli treated with 0.5MIC of cyadox
GSE39607	Escherichia coli treated with 1%DMSO
GSE39607	Escherichia coli treated with MBC of cyadox
GSE39607	Escherichia coli treated with MBC of olaquindox
GSE39607	Escherichia coli treated with MIC of olaquindox
GSE39607	MBC of CYA, biological rep1
GSE39607	MBC of CYA, biological rep2
GSE39607	MBC of CYA, biological rep3
GSE39607	MBC of OLA, biological rep1
GSE39607	MBC of OLA, biological rep2
GSE39607	MBC of OLA, biological rep3
GSE39607	MIC of OLA, biological rep1
GSE39607	MIC of OLA, biological rep2
GSE39607	MIC of OLA, biological rep3
GSE39607	Solvent control, biological rep1
GSE39607	Solvent control, biological rep2
GSE39607	Solvent control, biological rep3
GSE39607	strain: CVCC2943
GSE39607	The cells were centrifuged at 8000 rpm for 5min at 4°C. The cell pellets were snap-frozen in liquid nitrogen and kept at -80°C
GSE39607	The data were analyzed with Partek Genomics Suite using Affymetrix default analysis settings and global scaling as normalization method.
GSE39607	Trizol extraction of total RNA was performed according to the manufacturer's instructions.
GSE3977	Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone 40mM Suc. at 30 C Mid Log
GSE3977	Eno- (DF261) in M9 + 0.2% Glycerol, 0.2% Tryptone, 40mM Suc. at 30 C Mid Log
GSE3977	Escherichia coli
GSE3977	N-RNaseE (BZ453)  in   M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3977	Pnp- (YHC012)  in  M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3977	Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3977	Pnp- (YHC012)) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3977	RhlB- (SU02)  in  M9  0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3977	RhlB- (SU02)  in  M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3977	RhlB- (SU02)  in  M9 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3977	RhlB- (SU02) in   M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3977	VALUE is Log (base 2) of the ratio of the median of Channel 2 (usually 635 nm) to Channel 1 (usually 532 nm)
GSE3977	Wild Type (K10)  M9 + 0.2% Glycerol, 0.2% Tryptone, 40 mM Suc. at 30 C Mid Log
GSE3977	Wild Type (K10)  M9 + 0.2% Glycerol, 0.2% Tryptone, 40 mM Suc. at 30 CMid Log
GSE3977	Wild Type (K10)  M9 0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log
GSE3977	Wild Type (N3433)  in M9  0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3977	Wild Type (N3433)  M9  0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3977	Wild Type (N3433)  M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3977	WT (K10) vs Eno- (DF261) in M9 + 0.2% Glycerol, 0.2% Tryptone, 40 mM Suc. at 30 C Mid Log Trial A
GSE3977	WT (K10) vs Eno- (DF261) in M9  0.2% Glycerol, 0.2% Tryptone, 40 mM Suc. at 30 C Mid Log Trial B
GSE3977	WT (K10) vs Eno- (DF261)  M9 + 0.2% Glycerol,  0.2% Tryptone, 40 mM Suc. at 30 C Mid Log Trial A1
GSE3977	WT (K10) vs Eno- (DF261)  M9 + 0.2% Glycerol, 0.2% Tryptone, 40 mM Suc. at 30 C Mid Log Trial B1
GSE3977	WT (N3433) vs Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial A2
GSE3977	WT (N3433) vs Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial B2
GSE3977	WT (N3433) vs Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial C2
GSE3977	WT (N3433) vs RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial A
GSE3977	WT (N3433) vs RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial A1
GSE3977	WT (N3433) vs RhlB- (SU02) in M9 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial B
GSE3977	WT (N3433) vs RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial B1
GSE3977	WT (N3433) vs RhlB- (SU02) in M9  0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial C
GSE3977	WT (N3433) vs RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial C1
GSE3977	WT (SH3208)  M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3977	WT (SH3208) vs N-RNaseE (BZ453)  in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3977	WT (SH3208) vs N-RNaseE (BZ453)  in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial A
GSE3977	WT (SH3208) vs N-RNaseE (BZ453)  in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial B
GSE3977	WT (SH3208) vs N-RNaseE (BZ453)  in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Trial C
GSE3978	1.5' RNA Decay N-RNaseE (BZ453) in M9  0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. A
GSE3978	1.5' RNA Decay N-RNaseE (BZ453)  in M9  0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. A1
GSE3978	1.5' RNA Decay N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. B
GSE3978	1.5' RNA Decay N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. B1
GSE3978	1.5' RNA Decay of Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone, 40 mM Suc.at 30 C Mid Log Rep A
GSE3978	1.5' RNA Decay of Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log Rep B
GSE3978	1.5' RNA Decay of Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. A2
GSE3978	1.5' RNA Decay of Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. B2
GSE3978	1.5' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Replicate A
GSE3978	1.5' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Replicate A1
GSE3978	1.5' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Replicate B
GSE3978	1.5' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Replicate B1
GSE3978	1.5' RNA Decay of WT (K10) in M9  0.2% Glycerol 0.2% Tryptone, 40 mM Suc. at 30 C Mid Log Rep A
GSE3978	1.5' RNA Decay of WT (K10) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc.at 30 C Mid Log Rep B
GSE3978	1.5' RNA Decay of WT (N3433) in M9  0.2% Glycerol 0.2% Tryptone at 30 C Mid Log Rep. A2
GSE3978	1.5' RNA Decay of WT (N3433) in M9  0.2% Glycerol 0.2% Tryptone at 30 C Mid Log Rep. B2
GSE3978	1.5' RNA Decay of WT (N3433) in M9  0.2% Glycerol 0.2% Tryptone at 30 C Mid Log Replicate A1
GSE3978	1.5' RNA Decay of WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Replicate B1
GSE3978	1.5' RNA Decay of WT (SH3208) in M9  0.2% Glycerol 0.2% Tryptone at 30 C Mid Log Rep. A1
GSE3978	1.5' RNA Decay of WT (SH3208) in M9  0.2% Glycerol 0.2% Tryptone at 30 C Mid Log Rep. B1
GSE3978	3' RNA Decay N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3978	3' RNA Decay N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 1
GSE3978	3' RNA Decay of Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log Rep A
GSE3978	3' RNA Decay of Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone at 40 mM Suc. 30  C Mid Log Rep B
GSE3978	3' RNA Decay of Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 2
GSE3978	3' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3978	3' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log1
GSE3978	3' RNA Decay of WT (K10) in M9 0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log
GSE3978	3' RNA Decay of WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log1
GSE3978	3' RNA Decay of WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 2
GSE3978	3' RNA Decay of WT (SH3208) in M9  0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 1
GSE3978	4.5' RNA Decay N-RNaseE (BZ453)  in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3978	4.5' RNA Decay N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 1
GSE3978	4.5' RNA Decay of Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30  C Mid Log
GSE3978	4.5' RNA Decay of Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 2
GSE3978	4.5' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3978	4.5' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log1
GSE3978	4.5' RNA Decay of WT (K10) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log
GSE3978	4.5' RNA Decay of WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log1
GSE3978	4.5' RNA Decay of WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 2
GSE3978	4.5' RNA Decay of WT (SH3208) in M9  0.2% Glycerol, .2% Tryptone at 30 C Mid Log 1
GSE3978	6' RNA Decay N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. A
GSE3978	6' RNA Decay N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. A1
GSE3978	6' RNA Decay N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. B
GSE3978	6' RNA Decay N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. B1
GSE3978	6' RNA Decay of Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30  C Mid Log Rep A
GSE3978	6' RNA Decay of Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30  C Mid Log Rep B
GSE3978	6' RNA Decay of Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. A2
GSE3978	6' RNA Decay of Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep. B2
GSE3978	6' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Replicate A
GSE3978	6' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Replicate A1
GSE3978	6' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Replicate B
GSE3978	6' RNA Decay of RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Replicate B1
GSE3978	6' RNA Decay of WT (K10) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30  C Mid Log Rep A
GSE3978	6' RNA Decay of WT (K10) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30  C Mid Log Rep B
GSE3978	6' RNA Decay of WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep A2
GSE3978	6' RNA Decay of WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Replicate A1
GSE3978	6' RNA Decay of WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Replicate B1
GSE3978	6' RNA Decay of WT (N3433) in M9 + 0.2% Glycerol, .2% Tryptone at 30 C Mid Log Rep B2
GSE3978	6' RNA Decay of WT (SH3208) in M9  0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep A1
GSE3978	6' RNA Decay of WT (SH3208) in M9  0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log Rep B1
GSE3978	Eno- (DF261)  in  M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log
GSE3978	Eno- (DF261) in  M9  0.2% Glycerol  0.2% Tryptone 40 mM Suc. at 30 C Mid Log
GSE3978	Eno- (DF261) in  M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log
GSE3978	Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone 40mM Suc. at 30 C Mid Log 1.5' post rif
GSE3978	Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone 40mM Suc. at 30 C Mid Log 3.0' post rif
GSE3978	Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone 40mM Suc. at 30 C Mid Log 4.5' post rif
GSE3978	Eno- (DF261) in M9  0.2% Glycerol 0.2% Tryptone 40mM Suc. at 30 C Mid Log 6.0' post rif
GSE3978	Escherichia coli
GSE3978	N-RNaseE (BZ453)  in   M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3978	N-RNaseE (BZ453)  in  M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3978	N-RNaseE (BZ453) in   M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3978	N-RNaseE (BZ453) in  M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3978	N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3978	N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 1.5' post rif
GSE3978	N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 3' post rif
GSE3978	N-RNaseE (BZ453)  in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 4.5' post rif
GSE3978	N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 4.5' post rif
GSE3978	N-RNaseE (BZ453) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 6' post rif
GSE3978	Pnp- (YHC012) in   M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3978	Pnp- (YHC012) in  M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3978	Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3978	Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 1.5' post rif
GSE3978	Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 3' post rif
GSE3978	Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 4.5' post rif
GSE3978	Pnp- (YHC012) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 6' post rif
GSE3978	RhlB- (SU02) in  M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3978	RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 1.5' post rif
GSE3978	RhlB- (SU02)  in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 3' post rif
GSE3978	RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 3' post rif
GSE3978	RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 4.5' post rif
GSE3978	RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 6' post rif
GSE3978	RhlB- (SU02) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 Mid Log 6' post rif
GSE3978	VALUE is Log (base 2) of the ratio of the median of Channel 2 (usually 635 nm) to Channel 1 (usually 532 nm)
GSE3978	WT (K10) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 0C Mid Log 6.0' post rif
GSE3978	WT (K10) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log 1.5' post rif
GSE3978	WT (K10) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log 3' post rif
GSE3978	WT (K10) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log 4.5' post rif
GSE3978	WT (K10) in M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log 6.0' post rif
GSE3978	WT (K10)  M9  0.2% Glycerol 0.2% Tryptone 40 mM Suc. at 30 C Mid Log
GSE3978	WT (K10)  M9  0.2% Glycerol 0.2% Tryptone 40 mM Succinate at 30 C Mid Log
GSE3978	WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 1.5' post rif
GSE3978	WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 3.0' post rif
GSE3978	WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 3' post rif
GSE3978	WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 4.5' post rif
GSE3978	WT (N3433) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 6' post rif
GSE3978	WT (N3433)  M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3978	WT (N3433) M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 6' post rif
GSE3978	WT (SH3208) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE3978	WT (SH3208) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 1.5' post rif
GSE3978	WT (SH3208) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 3' post rif
GSE3978	WT (SH3208) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 4.5' post rif
GSE3978	WT (SH3208) in M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log 6' post rif
GSE3978	WT (SH3208)  M9 + 0.2% Glycerol, 0.2% Tryptone at 30 C Mid Log
GSE39926	1mL aliquots were harvested and mixed with 0.5mL Phenol
GSE39926	B500_1
GSE39926	Bacterial cell
GSE39926	biological replicate: 1
GSE39926	biological replicate: 2
GSE39926	Clones were grown in M9 with 0.4% (w
GSE39926	Differentially expressed (DE) genes in all stress evolved strains were found relative to the expression levels in the reference G500 strain using the edgeR R package.
GSE39926	Differentially expressed genes were identified by processing raw counts of mapped reads with edgeR R library version 2.6.9. Normalized counts for each biological replicate were averaged between two technical replicates.
GSE39926	Escherichia coli
GSE39926	G500_1
GSE39926	Genes from the amplified regions in O500 (12-fold) and P500 (two-fold) strains are significantly over-expressed relative to the reference: average log Fold Change for concentrations is +3.6 and +0.8 (both with p-values<10-20), respectively.
GSE39926	Genes with BH (Benjamini and Hochberg) adjusted p-values below 0.05 threshold were selected as DE genes.
GSE39926	Genome_build: Escherichia coli strain K12 sub-strain MG1655 genome (GenBank accession no. U00096.2)
GSE39926	H500_1
GSE39926	Illumina GAII reads were filtered by SGA version 0.9.9 with the following options: sga preprocess -q 10 -f 10 -m 25 (quality trim 10, quality filter 10, minimal length 25)
GSE39926	O500_1
GSE39926	O500_2
GSE39926	P500_1
GSE39926	preprocessed RNA-Seq reads were mapped to the reference Escherichia coli strain K12 sub-strain MG1655 genome (GenBank accession no. U00096.2) by BWA toolkit version 0.5.9-r16 with the following options: bwa aln -q 20
GSE39926	RNA-Seq
GSE39926	RNA was extracted using an RNeasy kit (Qiagen) and after 1st and 2nd strand cDNA synthesis, linker ligation and size selection subjected to shotgun sequencing using single read 40bp read length runs on an Illumina Genome Analyzer GAII.
GSE39926	strain: MG 1655
GSE39926	stress: acidic
GSE39926	stress: Minimal medium
GSE39926	stress: n-butanol
GSE39926	stress: osmotic
GSE39926	stress: oxidative
GSE39926	Supplementary_files_format_and_content: Tab delimited text file; includes: gene differential expression levels relative to the G500 strain with corresponding p-values and processed counts for each biological replicate (each normolized and averaged between 2 technical replicates).  Linked as supplementary file on Series record.
GSE39926	technical replicates: 2
GSE40557	After reaching an OD600nm of 0.9, cell cultures were placed immediately in a shaking water bath along with another BHI flask carrying a type T thermocouple connected to a MultiPaq 21 datalogger (Datapaq Inc.) for temperature profile and the process lethality values monitoring in real time. Bacteria suspension were heated at 58°C to process lethality values of 2 and 3, at 60°C to a process lethality value of 3, or until a temperature of 71°C was reached. Just after heating, cell suspension was cooled in an iced water bath under constant agitation (150 rpm) until the temperature dropped back to no less than 37°C in order to avoid cold stress. Cell suspensions were then centrifuged and the remaining cell pellets were treated with RNA protect bacteria reagent (Qiagen Inc.) prior to freezing at -80°C.
GSE40557	Bacteria at 58°C F = 2
GSE40557	Bacteria at 58°C F = 3
GSE40557	Bacteria at 60°C F = 3
GSE40557	Bacteria at 71°C
GSE40557	Bacteria suspension heated at 58°C to a process lethality value of 2 - Replicate 1
GSE40557	Bacteria suspension heated at 58°C to a process lethality value of 2 - Replicate 2
GSE40557	Bacteria suspension heated at 58°C to a process lethality value of 2 - Replicate 3
GSE40557	Bacteria suspension heated at 58°C to a process lethality value of 2 - Replicate 4
GSE40557	Bacteria suspension heated at 58°C to a process lethality value of 2 - Replicate 5
GSE40557	Bacteria suspension heated at 58°C to a process lethality value of 3 - Replicate 1
GSE40557	Bacteria suspension heated at 58°C to a process lethality value of 3 - Replicate 2
GSE40557	Bacteria suspension heated at 58°C to a process lethality value of 3 - Replicate 3
GSE40557	Bacteria suspension heated at 58°C to a process lethality value of 3 - Replicate 4
GSE40557	Bacteria suspension heated at 60°C to a process lethality value of 3 - Replicate 1
GSE40557	Bacteria suspension heated at 60°C to a process lethality value of 3 - Replicate 2
GSE40557	Bacteria suspension heated at 60°C to a process lethality value of 3 - Replicate 3
GSE40557	Bacteria suspension heated at 60°C to a process lethality value of 3 - Replicate 4
GSE40557	Bacteria suspension heated to a core temperature of 71°C                - Replicate 1
GSE40557	Bacteria suspension heated to a core temperature of 71°C                - Replicate 2
GSE40557	Bacteria suspension heated to a core temperature of 71°C                - Replicate 3
GSE40557	Bacteria suspension heated to a core temperature of 71°C                - Replicate 4
GSE40557	Bacteria suspension heated to a core temperature of 71°C                - Replicate 5
GSE40557	Control bacteria at 37°C (common reference).  Total RNA isolated from 5 indepedent cultures (pooled after cDNA labeling).
GSE40557	Escherichia coli str. K-12 substr. MG1655
GSE40557	For each biological replicate, frozen aliquots (500μl) of E. coli K12 stock cultures were subcultured in 10 ml of Brain Heart Infusion (BHI) and incubated overnight at 37°C. Cells were then sub-cultured (1% v
GSE40557	Frozen cell pellets were lyzed with lysozyme (Sigma Aldrich) and proteinase K (Qiagen Inc.) at room temperature. Total RNA was isolated from cell lysates using RNeasy Midi Kit according to the manufacturer's instructions (Qiagen Inc.). All RNA samples were then treated with DNase I (Ambion, Life technologies) before a phenol
GSE40557	growth phase: stationary phase (grown to an OD600nm of 0.9)
GSE40557	growth protocol: Controls grown to an optimal temperature of 37°C
GSE40557	growth protocol: Treatment 1 (58°C F = 2)
GSE40557	growth protocol: Treatment 2 (58°C F = 3)
GSE40557	growth protocol: Treatment 3 (60°C F = 3)
GSE40557	growth protocol: Treatment 4 (core temperature of 71°C)
GSE40557	LOWESS normalized data obtained from log2 of processed Red signal (treated)
GSE40557	strain: strain K12 substrain MG1655
GSE40811	Agilent Feature Extraction Software (v 10.10.1.1) was used for background subtraction and LOWESS normalization.
GSE40811	Continuous aerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 10min
GSE40811	Continuous aerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 20min
GSE40811	Continuous aerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 2.5min
GSE40811	Continuous aerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 40min
GSE40811	Continuous aerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 5min
GSE40811	Continuous aerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 80min
GSE40811	Continuous aerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 10min
GSE40811	Continuous aerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 20min
GSE40811	Continuous aerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 2.5min
GSE40811	Continuous aerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 40min
GSE40811	Continuous aerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 5min
GSE40811	Continuous aerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 80min
GSE40811	Continuous aerobically grown cultures in Evans medium, prior to CORM-3 addition
GSE40811	Continuous anaerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 10min
GSE40811	Continuous anaerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 20min
GSE40811	Continuous anaerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 2.5min
GSE40811	Continuous anaerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 40min
GSE40811	Continuous anaerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 5min
GSE40811	Continuous anaerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 80min
GSE40811	Continuous anaerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 10min
GSE40811	Continuous anaerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 20min
GSE40811	Continuous anaerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 2.5min
GSE40811	Continuous anaerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 40min
GSE40811	Continuous anaerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 5min
GSE40811	Continuous anaerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 80min
GSE40811	Continuous anaerobically grown cultures in Evans medium, prior to CORM-3 addition
GSE40811	Escherichia coli
GSE40811	Slide 10_Anaerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 10
GSE40811	Slide 10_Anaerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 5
GSE40811	Slide 10_Anaerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 10
GSE40811	Slide 10_Anaerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 20
GSE40811	Slide 10_Anaerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 2.5
GSE40811	Slide 10_Anaerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 40
GSE40811	Slide 10_Anaerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 5
GSE40811	Slide 10_Anaerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 80
GSE40811	Slide 11_Anaerobic culture_CORM-3_biol rep 1_Cy3 20 Cy5 0
GSE40811	Slide 11_Anaerobic culture_CORM-3_biol rep 1_Cy3 5 Cy5 0
GSE40811	Slide 11_Anaerobic culture_CORM-3_biol rep 2_Cy3 10 Cy5 0
GSE40811	Slide 11_Anaerobic culture_CORM-3_biol rep 2_Cy3 20 Cy5 0
GSE40811	Slide 11_Anaerobic culture_CORM-3_biol rep 2_Cy3 2.5 Cy5 0
GSE40811	Slide 11_Anaerobic culture_CORM-3_biol rep 2_Cy3 40 Cy5 0
GSE40811	Slide 11_Anaerobic culture_CORM-3_biol rep 2_Cy3 5 Cy5 0
GSE40811	Slide 11_Anaerobic culture_CORM-3_biol rep 2_Cy3 80 Cy5 0
GSE40811	Slide 12_Anaerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 20
GSE40811	Slide 12_Anaerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 2.5
GSE40811	Slide 12_Anaerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 40
GSE40811	Slide 12_Anaerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 80
GSE40811	Slide 12_Anaerobic culture_CORM-3_biol rep 1_Cy3 10 Cy5 0
GSE40811	Slide 12_Anaerobic culture_CORM-3_biol rep 1_Cy3 2.5 Cy5 0
GSE40811	Slide 12_Anaerobic culture_CORM-3_biol rep 1_Cy3 40 Cy5 0
GSE40811	Slide 12_Anaerobic culture_CORM-3_biol rep 1_Cy3 80 Cy5 0
GSE40811	Slide 18_Aerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 10
GSE40811	Slide 18_Aerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 20
GSE40811	Slide 18_Aerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 2.5
GSE40811	Slide 18_Aerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 40
GSE40811	Slide 18_Aerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 5
GSE40811	Slide 18_Aerobic culture_CORM-3_biol rep 1_Cy3 0 Cy5 80
GSE40811	Slide 18_Aerobic culture_CORM-3_biol rep 1_Cy3 2.5 Cy5 0
GSE40811	Slide 18_Aerobic culture_CORM-3_biol rep 1_Cy3 5 Cy5 0
GSE40811	Slide 19_Aerobic culture_CORM-3_biol rep 1_Cy3 10 Cy5 0
GSE40811	Slide 19_Aerobic culture_CORM-3_biol rep 1_Cy3 20 Cy5 0
GSE40811	Slide 19_Aerobic culture_CORM-3_biol rep 1_Cy3 40 Cy5 0
GSE40811	Slide 19_Aerobic culture_CORM-3_biol rep 1_Cy3 80 Cy5 0
GSE40811	Slide 19_Aerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 10
GSE40811	Slide 19_Aerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 20
GSE40811	Slide 19_Aerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 2.5
GSE40811	Slide 19_Aerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 5
GSE40811	Slide 20_Aerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 40
GSE40811	Slide 20_Aerobic culture_CORM-3_biol rep 2_Cy3 0 Cy5 80
GSE40811	Slide 20_Aerobic culture_CORM-3_biol rep 2_Cy3 10 Cy5 0
GSE40811	Slide 20_Aerobic culture_CORM-3_biol rep 2_Cy3 20 Cy5 0
GSE40811	Slide 20_Aerobic culture_CORM-3_biol rep 2_Cy3 2.5 Cy5 0
GSE40811	Slide 20_Aerobic culture_CORM-3_biol rep 2_Cy3 40 Cy5 0
GSE40811	Slide 20_Aerobic culture_CORM-3_biol rep 2_Cy3 5 Cy5 0
GSE40811	Slide 20_Aerobic culture_CORM-3_biol rep 2_Cy3 80 Cy5 0
GSE40811	Slide 25_Aerobic culture_iCORM-3_biol rep 1_Cy3 0 Cy5 10
GSE40811	Slide 25_Aerobic culture_iCORM-3_biol rep 1_Cy3 0 Cy5 20
GSE40811	Slide 25_Aerobic culture_iCORM-3_biol rep 1_Cy3 0 Cy5 2.5
GSE40811	Slide 25_Aerobic culture_iCORM-3_biol rep 1_Cy3 0 Cy5 40
GSE40811	Slide 25_Aerobic culture_iCORM-3_biol rep 1_Cy3 0 Cy5 5
GSE40811	Slide 25_Aerobic culture_iCORM-3_biol rep 1_Cy3 0 Cy5 80
GSE40811	Slide 25_Aerobic culture_iCORM-3_biol rep 1_Cy3 2.5 Cy5 0
GSE40811	Slide 25_Aerobic culture_iCORM-3_biol rep 1_Cy3 5 Cy5 0
GSE40811	Slide 26_Aerobic culture_iCORM-3_biol rep 1_Cy3 10 Cy5 0
GSE40811	Slide 26_Aerobic culture_iCORM-3_biol rep 1_Cy3 20 Cy5 0
GSE40811	Slide 26_Aerobic culture_iCORM-3_biol rep 1_Cy3 40 Cy5 0
GSE40811	Slide 26_Aerobic culture_iCORM-3_biol rep 1_Cy3 80 Cy5 0
GSE40811	Slide 26_Aerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 10
GSE40811	Slide 26_Aerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 20
GSE40811	Slide 26_Aerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 2.5
GSE40811	Slide 26_Aerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 5
GSE40811	Slide 27_Aerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 40
GSE40811	Slide 27_Aerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 80
GSE40811	Slide 27_Aerobic culture_iCORM-3_biol rep 2_Cy3 10 Cy5 0
GSE40811	Slide 27_Aerobic culture_iCORM-3_biol rep 2_Cy3 20 Cy5 0
GSE40811	Slide 27_Aerobic culture_iCORM-3_biol rep 2_Cy3 2.5 Cy5 0
GSE40811	Slide 27_Aerobic culture_iCORM-3_biol rep 2_Cy3 40 Cy5 0
GSE40811	Slide 27_Aerobic culture_iCORM-3_biol rep 2_Cy3 5 Cy5 0
GSE40811	Slide 27_Aerobic culture_iCORM-3_biol rep 2_Cy3 80 Cy5 0
GSE40811	Slide 28_Anaerobic culture_iCORM-3_biol rep 1_Cy3 0 Cy5 2.5
GSE40811	Slide 28_Anaerobic culture_iCORM-3_biol rep 1_Cy3 0 Cy5 5
GSE40811	Slide 28_Anaerobic culture_iCORM-3_biol rep 1_Cy3 10 Cy5 0
GSE40811	Slide 28_Anaerobic culture_iCORM-3_biol rep 1_Cy3 20 Cy5 0
GSE40811	Slide 28_Anaerobic culture_iCORM-3_biol rep 1_Cy3 2.5 Cy5 0
GSE40811	Slide 28_Anaerobic culture_iCORM-3_biol rep 1_Cy3 40 Cy5 0
GSE40811	Slide 28_Anaerobic culture_iCORM-3_biol rep 1_Cy3 5 Cy5 0
GSE40811	Slide 28_Anaerobic culture_iCORM-3_biol rep 1_Cy3 80 Cy5 0
GSE40811	Slide 29_Anaerobic culture_iCORM-3_biol rep 1_Cy3 10 Cy5 0
GSE40811	Slide 29_Anaerobic culture_iCORM-3_biol rep 1_Cy3 20 Cy5 0
GSE40811	Slide 29_Anaerobic culture_iCORM-3_biol rep 1_Cy3 40 Cy5 0
GSE40811	Slide 29_Anaerobic culture_iCORM-3_biol rep 1_Cy3 80 Cy5 0
GSE40811	Slide 29_Anaerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 10
GSE40811	Slide 29_Anaerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 20
GSE40811	Slide 29_Anaerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 2.5
GSE40811	Slide 29_Anaerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 5
GSE40811	Slide 30_Anaerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 40
GSE40811	Slide 30_Anaerobic culture_iCORM-3_biol rep 2_Cy3 0 Cy5 80
GSE40811	Slide 30_Anaerobic culture_iCORM-3_biol rep 2_Cy3 10 Cy5 0
GSE40811	Slide 30_Anaerobic culture_iCORM-3_biol rep 2_Cy3 20 Cy5 0
GSE40811	Slide 30_Anaerobic culture_iCORM-3_biol rep 2_Cy3 2.5 Cy5 0
GSE40811	Slide 30_Anaerobic culture_iCORM-3_biol rep 2_Cy3 40 Cy5 0
GSE40811	Slide 30_Anaerobic culture_iCORM-3_biol rep 2_Cy3 5 Cy5 0
GSE40811	Slide 30_Anaerobic culture_iCORM-3_biol rep 2_Cy3 80 Cy5 0
GSE40811	strain: Wild type strain MG1655
GSE40811	Total RNA extracted using Trizol following manufacturer's instructions
GSE4112	dpiA 2x Overexpression pHI1429 in LB at 37 Mid Log Phase
GSE4112	dpiAoverexpressor
GSE4112	ecd3-c-0081429 wt vs dpiAoverexpressor
GSE4112	ecd3-c-0101429 wt vs dpiAoverexpressor
GSE4112	Escherichia coli
GSE4112	VALUE is Log (base 2) of the ratio of the median of Channel 2 (usually 635 nm) to Channel 1 (usually 532 nm)
GSE4112	WT1088 in LB at 37 Mid Log Phase
GSE4112	WT1088 vs. dpiA 2x Overexpression pHI1429 in LB at 37 Mid Log Phase Trial A
GSE4112	WT1088 vs. dpiA 2x Overexpression pHI1429 in LB at 37 Mid Log Phase Trial B
GSE41186	antibody: Affinity Purified FNR antibody
GSE41186	antibody: Pre-cleared FNR antibody
GSE41186	antibody: Pre-cleared H-NS polyclonal antibody
GSE41186	antibody: Pre-cleared IHF polyclonal antibody
GSE41186	antibody: RNA Polymerase ß monoclonal antibody from NeoClone (W0002)
GSE41186	Arrays were processed using Nimblegen's standard protocol for Nimblescan 2.4 ChIP data extraction.
GSE41186	Cell pellets (from initial 50 ml of culture) were thawed and resuspended in 250ul of IP buffer (100 mM Tris pH 8, 300 mM NaCl, 2% TritonX-100) and sonicated using a microtip sonicator set at 10% output for 20 second intervals with periods of cooling in between. Cells were then treated for one hour at 4 °C with RNase A (2 ng
GSE41186	Cells were grown aerobically (25% O2, 70% N2 and 5% CO2) until mid-log phase (OD600 of 0.35) and treated with 1% final volumen formaldehyde for ten minutes. Sodium phosphate (1
GSE41186	Cells were grown anaerobically (95% N2 and 5% CO2) until mid-log phase (OD600 of 0.3) and treated with 1% final volumen formaldehyde for ten minutes. Sodium phosphate (1
GSE41186	Cells were grown with 16 µM IPTG and 300 µL Cm20 anaerobically (95% N2 and 5% CO2) until mid-log phase (OD600 of 0.3) and treated with 1% final volumen formaldehyde for ten minutes. Sodium phosphate (1
GSE41186	Cells were grown with 4 µM IPTG and 300 µL Cm20 anaerobically (95% N2 and 5% CO2) until mid-log phase (OD600 of 0.3) and treated with 1% final volumen formaldehyde for ten minutes. Sodium phosphate (1
GSE41186	Cells were grown with 8 µM IPTG and 300 µL Cm20 anaerobically (95% N2 and 5% CO2) until mid-log phase (OD600 of 0.3) and treated with 1% final volumen formaldehyde for ten minutes. Sodium phosphate (1
GSE41186	Escherichia coli str. K-12 substr. MG1655
GSE41186	Escherichia coli str. K-12 substr. MG1655star
GSE41186	FNR - Anaerobic - A
GSE41186	FNR - Anaerobic - Affinity Purified - A
GSE41186	FNR - Anaerobic - Affinity Purified - B
GSE41186	FNR - Anaerobic - B
GSE41186	FNR - Anaerobic - C
GSE41186	∆fnr - Anaeroibc
GSE41186	FNR ChIP DNA from ∆hns
GSE41186	∆fnr ChIP DNA from PK4854
GSE41186	FNR ChIP DNA from WT Escherchia coli MG1655 K-12
GSE41186	FNR - ∆hns∆stpA A
GSE41186	FNR - ∆hns∆stpA B
GSE41186	FNR INPUT from PK8263 with 16 µM INPUTTG
GSE41186	FNR INPUT from PK8263 with 4 µM INPUTTG
GSE41186	FNR INPUT from PK8263 with 8 µM INPUTTG
GSE41186	FNR INPUT from WT Escherichia coli MG1655 K-12
GSE41186	FNR IP from PK8263 with 16 µM IPTG
GSE41186	FNR IP from PK8263 with 4 µM IPTG
GSE41186	FNR IP from PK8263 with 8 µM IPTG
GSE41186	FNR IP from WT Escherichia coli MG1655 K-12
GSE41186	growth condition: 16 µM IPTG
GSE41186	growth condition: 4 µM IPTG
GSE41186	growth condition: 8 µM IPTG
GSE41186	growth condition: Aerobic
GSE41186	growth condition: anaerobic
GSE41186	growth condition: Anaerobic
GSE41186	HNS - Aerobic A
GSE41186	HNS - Aerobic B
GSE41186	HNS - Anaerobic A
GSE41186	HNS - Anaerobic B
GSE41186	HNS ChIP DNA from WT Escherichia coli MG1655 K-12
GSE41186	HNS ChIP DNA from WT Escherichia coli MG1655 K-12 Replicate B
GSE41186	IHF - Anaerobic A
GSE41186	IHF - Anaerobic B
GSE41186	IHF ChIP DNA from WT Escherichia coli MG1655 K-12
GSE41186	IHF ChIP DNA from WT Escherichia coli MG1655 K-12 Replicate B
GSE41186	INPUT ChIP DNA from ∆hns
GSE41186	INPUT ChIP DNA from WT Escherchia coli MG1655 K-12, no antibody control
GSE41186	INPUT ChIP DNA from WT Escherchia coli MG1655 K-12, no antibody control, Replicate B
GSE41186	INPUT ChIP DNA from WTPK4854, no antibody control
GSE41186	Ptac::fnr - A - 16 µM IPTG
GSE41186	Ptac::fnr - A - 4 µM IPTG
GSE41186	Ptac::fnr - A - 8 µM IPTG
GSE41186	Ptac::fnr - B - 16 µM IPTG
GSE41186	Ptac::fnr - B - 4 µM IPTG
GSE41186	Ptac::fnr - B - 8 µM IPTG
GSE41186	Ptac::fnr - C - 16 µM IPTG
GSE41186	ß - Aerobic - A
GSE41186	ß - Aerobic - B
GSE41186	ß - Anaerobic - A
GSE41186	ß - Anaerobic - B
GSE41186	ß ChIP DNA from WT Escherichia coli MG1655 K-12
GSE41186	strain: ∆hns
GSE41186	strain: MG1655 K-12 WT
GSE41186	strain: PK4854
GSE41186	strain: PK8263
GSE41186	tag: MG1655 K-12 WT
GSE41187	10 ng of DNA were submitted to the University of Wisconsin-Madison DNA Sequencing Facility for ChIP-seq library preparation.  Samples were sheared to 200-500 nt during the IP process to facilitate library preparation.  All libraries were generated using reagents from the Illumina Paired End Sample Preparation Kit (Illumina) and the Illumina protocol “Preparing Samples for ChIP Sequencing of DNA” (Illumina part # 11257047 RevA) as per the manufacturer’s instructions, except products of the ligation reaction were purified by gel electrophoresis using 2% SizeSelect agarose gels (Invitrogen) targeting either 275 bp fragments (s70 libraries) or 400 bp fragments (FNR libraries).  After library construction and amplification, quality and quantity were assessed using an Agilent DNA 1000 series chip assay (Agilent) and QuantIT PicoGreen dsDNA Kit (Invitrogen), respectively, and libraries were standardized to 10μM.  Cluster generation was performed using a cBot Single Read Cluster Generation Kit (v4) and placed on the Illumina cBot.  A single read, 36 bp run was performed, using standard SBS kits (v4) and SCS 2.6 on an Illumina Genome Analyzer IIx.  A paired read, 100 bp runs were used for one replicate of each s70 aerobic and anaerobic growth conditions, using standard SBS kits (v4) and SCS 2.6 on an Illumina HiSeq.  Basecalling was performed using the standard Illumina Pipeline version 1.6.
GSE41187	Aerobic Cultures
GSE41187	aerobic INPUT DNA
GSE41187	Anaerobic Cultures
GSE41187	anaerobic INPUT DNA
GSE41187	Antibodies for beta of RNAP - NeoClone, Cat Number: W0002, Lot Number: 2008L10-001  Antibodies for sigma70 of RNAP - NeoClone, Cat Number: W0004, Lot Number: 2008K12-001  All other antibodies (FNR, H-NS, IHF) were produced in this study and are not commercially available.
GSE41187	antibody: Affinity purified FNR polyclonal antibody
GSE41187	antibody: INPUT
GSE41187	antibody: RNA Polymerase σ70 monoclonal antibody from NeoClone (W0004)
GSE41187	Cell pellets (from initial 50 ml of culture) were thawed and resuspended in 250ul of IP buffer (100 mM Tris pH 8, 300 mM NaCl, 2% TritonX-100) and sonicated using a microtip sonicator set at 10% output for 20 second intervals with periods of cooling in between. Cells were then treated for one hour at 4 °C with RNase A (2 ng
GSE41187	Cells were grown anaerobically (95% N2 and 5% CO2) until mid-log phase (OD600 of 0.3) and treated with 1% final volumen formaldehyde for ten minutes. Sodium phosphate (1
GSE41187	ChIP-Seq
GSE41187	DNA were submitted to the Joint Genome Institute for ChIP-seq library preparation.  Samples were sheared to 200-500 nt during the IP process to facilitate library preparation.  All libraries were generated using reagents from the Illumina Paired End Sample Preparation Kit (Illumina) and the Illumina protocol “Preparing Samples for ChIP Sequencing of DNA” (Illumina part # 11257047 RevA) as per the manufacturer’s instructions, except products of the ligation reaction were purified by gel electrophoresis using 2% SizeSelect agarose gels (Invitrogen) targeting either 275 bp fragments (s70 libraries).  After library construction and amplification, quality and quantity were assessed using an Agilent DNA 1000 series chip assay (Agilent) and QuantIT PicoGreen dsDNA Kit (Invitrogen), respectively, and libraries were standardized to 10μM.  Cluster generation was performed using a cBot Single Read Cluster Generation Kit (v4) and placed on the Illumina cBot.  A single read, 36 bp run was performed, using standard SBS kits (v4) and SCS 2.6 on an Illumina Genome Analyzer IIx. Basecalling was performed using the standard Illumina Pipeline version 1.6.
GSE41187	Escherichia coli str. K-12 substr. MG1655star
GSE41187	FNR IP ChIP-seq Anaerobic A
GSE41187	FNR_IP_ChIP-seq_Anaerobic_A_WIG.wig: U00096.2
GSE41187	FNR IP ChIP-seq Anaerobic B
GSE41187	FNR_IP_ChIP-seq_Anaerobic_B_WIG.wig: U00096.2
GSE41187	Genome Build:
GSE41187	Genome_build: U00096.2
GSE41187	growth condition: Aerobic Cultures
GSE41187	growth condition: Anaerobic Cultures
GSE41187	INPUT_ChIP-seq_Aerobic_WIG.wig: U00096.2
GSE41187	INPUT_ChIP-seq_Anaerobic_WIG.wig: U00096.2
GSE41187	INPUT DNA B
GSE41187	Sequence reads were aligned to the published E. coli K-12 MG1655 genome (U00096.2) using the software packages SOAP (Li et al, 2009) and ELAND (within the Illumina Genome Analyzer Pipeline Software), allowing at most two mismatches.  Sequence reads with sequences that did not align to the genome, aligned to multiple locations on the genome, or contained more than two mismatches were discarded from further analysis (<10% of reads) (Supplemental Files).  For visualization the raw tag density at each position was calculated using QuEST (Valouev et al, 2008) and normalized as tag density per million uniquely mapped reads.
GSE41187	Sigma70_IP_ChIP-seq_Aerobic_A_SET_WIG.wig: U00096.2
GSE41187	Sigma70_IP_ChIP-seq_Anaerobic_A_SET_WIG.wig: U00096.2
GSE41187	strain: Wild Type K-12
GSE41187	σ70 IP ChIP-seq Aerobic A
GSE41187	σ70 IP ChIP-seq Aerobic B
GSE41187	σ70 IP ChIP-seq Anaerobic A
GSE41187	σ70 IP ChIP-seq Anaerobic B
GSE41190	Cells were treated with a stop solution of Phenol and Ethanol, spun down and flash frozen and stored at -80°C (ref). Total RNA was extracted using a hot phenol method (ref). RNA quality was determined by analysis with an Agilent 2100 bioanalyzer and quantity was determined using a NanoDrop. To enrich for mRNA, the 23S and 16S rRNA were removed using the Ambion MICROBExpress kit (Ambion) following manufacturer’s guidelines, except the total RNA was incubated with the rRNA oligonucleotides for one hour instead of 15 minutes.
GSE41190	Ecoli_dFNR_rep1_anaerobic
GSE41190	Ecoli_dFNR_rep2_anaerobic
GSE41190	Ecoli_wild-type_rep1_anaerobic
GSE41190	Ecoli_wild-type_rep2_anaerobic
GSE41190	Escherichia coli MG1655 K-12 dFNR (PK4854)
GSE41190	Escherichia coli MG1655 K-12 WT
GSE41190	Escherichia coli MG1655 K-12 WT and ∆fnr were grown to mid-log phase (O.D.600nm 0.3) anerobically (95% N2, 5% CO2) at 37°C in MOPS +0.2% glucose media (Ref).
GSE41190	Escherichia coli str. K-12 substr. MG1655star
GSE41190	FNR-_Anaerobic_RNAseq_A_Tag_Count.txt: U00096.2
GSE41190	FNR-_Anaerobic_RNAseq_A_WIG.wig: U00096.2
GSE41190	FNR-_Anaerobic_RNAseq_B_Tag_Count.txt: U00096.2
GSE41190	FNR-_Anaerobic_RNAseq_B_WIG.wig: U00096.2
GSE41190	Genome Build:
GSE41190	genoype: dFNR
GSE41190	genoype: Wild-Type
GSE41190	growth condition: anaerobic
GSE41190	phenotype: lacking FNR protein
GSE41190	phenotype: normal
GSE41190	Resulting reads were aligned to the published E. coli K-12 MG1655 genome (U00096.2) using the software package SOAP (Li et al, 2009), allowing no more than two mismatches (Supplemental File).  Reads aligning to repeated elements in the genome (e.g. rRNA) were removed from analysis.  For reads that had no mapping locations for the first 36 bp, the 3-30 bp subsequences were used in the subsequent mapping to the reference genome.  Reads that had unique mapping locations and did not match annotated rRNA genes were used for further analysis.  For each gene, the tag density was estimated as the number of aligned sequencing tags divided by gene size in kb.  Per-gene tag density was normalized using quantile normalization (Supplemental Files).  The tag density data were analyzed for statistically significant differential expression using BaySeq (Hardcastle & Kelly, 2010) with a FDR of 0.01, and genes were organized into operons using data from EcoCyc (Keseler et al, 2011).
GSE41190	RNA-Seq
GSE41190	strain: K-12
GSE41190	The RNAs were chemically fragmented using RNA Fragmentation Reagents (Ambion) to the size range of 200-250 bp using 1x fragmentation solution for 5 minutes at 70°C (Ambion).  Double stranded cDNA was generated using the SuperScript Double-Stranded cDNA Synthesis Kit (Invitrogen) following the manufacturer’s protocol.  The Illumina Paired End Sample Prep kit was used for Illumina RNA-seq library creation using the manufacturer’s instructions.  Briefly, the fragmented cDNA was end repaired, ligated to Illumina specific adapters and amplified with 10 cycles of PCR using the TruSeq SR Cluster Kit (v2).  Single-end 36 bp reads were generated by sequencing on the Illumina Genome Analyzer IIx, using the TruSeq SBS Kit (v5) following the manufacturer’s protocol.
GSE41190	WT_Anaerobic_RNAseq_A_Tag_Count.txt: U00096.2
GSE41190	WT_Anaerobic_RNAseq_A_WIG.wig: U00096.2
GSE41190	WT_Anaerobic_RNAseq_B_Tag_Count.txt: U00096.2
GSE41190	WT_Anaerobic_RNAseq_B_WIG.wig: U00096.2
GSE41936	Cell pellets (from initial 50 ml of culture) were thawed and resuspended in 250ul of IP buffer (100 mM Tris pH 8, 300 mM NaCl, 2% TritonX-100) and sonicated using a microtip sonicator set at 10% output for 20 second intervals with periods of cooling in between. Cells were then treated for one hour at 4 °C with RNase A (2 ng
GSE41936	Cells were cross-linked by the addition of formaldehyde at 1% final concentration with continued shaking at 37 °C for 5 min before quenching with glycine (100 mM final).
GSE41936	Cells were grown in MOPS minimal medium with 0.2% glucose at 37 oC  in gas-sparged Roux bottles or shaking flasks to mid-log phase (OD600 ~ 0.3-0.4).
GSE41936	cell type: bacterial cells
GSE41936	chip antibody: anti-b(RNAP) NT63
GSE41936	chip antibody: anti-H-NS
GSE41936	chip antibody cat. #: W0002
GSE41936	chip antibody vendor: Neoclone
GSE41936	Datasets were normalized using locally weighted linear regression (LOWESS) normalization on raw Cy3 and Cy5 signals to correct for intensity-dependent dye effects within each array using the “normalizeWithinArrays” function in the limma package for the statistical program R (v.2.14.2).
GSE41936	Escherichia coli K-12
GSE41936	genotype
GSE41936	H-NS ChIP DNA from MG1655 cells
GSE41936	Input DNA from MDS42 cells
GSE41936	Input DNA from MDS42 ΔnusA* cells
GSE41936	Input DNA from MDS42 ΔnusG cells
GSE41936	Input DNA from MG1655 cells
GSE41936	Input DNA from MG1655 Δhns cells
GSE41936	MDS42 RNAP 1
GSE41936	MDS42 RNAP 2
GSE41936	MDS42 ΔnusA* RNAP 1
GSE41936	MDS42 ΔnusA* RNAP 2
GSE41936	MDS42 ΔnusG RNAP 1
GSE41936	MDS42 ΔnusG RNAP 2
GSE41936	MG1655 H-NS 1
GSE41936	MG1655 H-NS 2
GSE41936	MG1655 RNAP 1
GSE41936	MG1655 RNAP 2
GSE41936	MG1655 Δhns RNAP 1
GSE41936	MG1655 Δhns RNAP 2
GSE41936	RNAP ChIP DNA from MDS42 cells
GSE41936	RNAP ChIP DNA from MDS42 ΔnusA* cells
GSE41936	RNAP ChIP DNA from MDS42 ΔnusG cells
GSE41936	RNAP ChIP DNA from MG1655 cells
GSE41936	RNAP ChIP DNA from MG1655 Δhns cells
GSE41936	sample type: input DNA
GSE41936	strain: MDS42 (RL1961)
GSE41936	strain: MG1655 (RL1655)
GSE41936	strain: RL2673
GSE41936	strain: RSW421 (RL1962)
GSE41936	strain: RSW422 (RL1963)
GSE41938	Cells were grown in MOPS minimal medium with 0.2% glucose at 37 oC  in gas-sparged Roux bottles or shaking flasks to mid-log phase (OD600 ~ 0.3-0.4).
GSE41938	Cultures were transferred directly into an ice-cold ethanol
GSE41938	Escherichia coli K-12
GSE41938	genotype
GSE41938	MDS42
GSE41938	MDS42 1
GSE41938	MDS42 2
GSE41938	MDS42 + 20 ug
GSE41938	MDS42 ΔnusA*
GSE41938	MDS42 ΔnusA* 1
GSE41938	MDS42 ΔnusA* 2
GSE41938	MDS42 ΔnusG
GSE41938	MDS42 ΔnusG 1
GSE41938	MDS42 ΔnusG 2
GSE41938	Raw probe intensities were normalized across samples using RMA analysis implemented in the NimbleScan software package (v.2.4).
GSE41938	strain: MDS42 (RL1961)
GSE41938	strain: RSW421 (RL1962)
GSE41938	strain: RSW421 (RL1967)
GSE41938	strain: RSW422 (RL1963)
GSE41938	strain: RSW472 (RL1966)
GSE41938	Total RNA was extracted from cell pellets by hot phenol extraction. The integrity of total RNA was determined from agarose gel or microchannel electrophoretograms.
GSE41938	treated with: 20 ug
GSE41938	Δrac
GSE41938	Δrac 1
GSE41938	Δrac 2
GSE41938	Δrac + 20 ug
GSE41938	Δrac ΔnusG
GSE41938	Δrac ΔnusG 1
GSE41938	Δrac ΔnusG 2
GSE41939	Base calling was performed by the DOE Joint Genome Institute using Illumina software.
GSE41939	Cells were grown in MOPS minimal medium with 0.2% glucose at 37 oC  in gas-sparged Roux bottles or shaking flasks to mid-log phase (OD600 ~ 0.3-0.4).
GSE41939	Counts per million unique reads were calculated for each gene.
GSE41939	Cultures were transferred directly into an ice-cold ethanol
GSE41939	Escherichia coli K-12
GSE41939	Genome_build: U00096.2
GSE41939	genotype
GSE41939	MG1655
GSE41939	MG1655 1
GSE41939	MG1655 2
GSE41939	MG1655 + 20 ug
GSE41939	molecule subtype: ribosome-depeleted RNA
GSE41939	RNA-Seq
GSE41939	RNA-Seq was performed by the DOE Joint Genome Institute using the dUTP method. Briefly, ribosome-depleted RNA was fragmented in a buffered zinc solution, then purified using AMPure SPRI beads. First-strand cDNAs were then synthesized from the fragmented RNA using Superscript II reverse transcriptase, followed by a second bead purification. dUTP was included in the second strand synthesis reaction in addition to dTTP to chemically mark the second strand.  Two further bead purification steps using different ratios of beads to cDNA (85
GSE41939	Sequenced reads were trimmed, the mapped to the Escherichia coli K-12 MG1655 genome (U00096.2) using SOAP.
GSE41939	strain: MG1655
GSE41939	Supplementary_files_format_and_content: tab-delimited text files include CPM values for each Sample
GSE41939	Total RNA was extracted from cell pellets by hot phenol extraction. The integrity of total RNA was determined from agarose gel or microchannel electrophoretograms. 16S and 23S Ribosomal RNA was depleted prior to construction of RNAseq libraries using MICROBExpress reagents.
GSE42205	1 ml of VWPE extract (1 mg
GSE42205	agent: control (1 ml of LB broth added)
GSE42205	agent: ethanol (1 ml of ethanol 20% added)
GSE42205	agent: polyphenols (1 ml of OVWPE diluted in ethanol 20% added)
GSE42205	Data processed with FeatureExtraction v9.5.1 and quantile normalized using R2.6.1 statistical software
GSE42205	E.coli, control culture, 20 minutes (t2) after treatment, replicate A
GSE42205	E.coli, control culture, 20 minutes (t2) after treatment, replicate B
GSE42205	E.coli, control culture, 20 minutes (t2) after treatment, replicate C
GSE42205	E.coli, control culture, 40 minutes (t3) after treatment, replicate A
GSE42205	E.coli, control culture, 40 minutes (t3) after treatment, replicate B
GSE42205	E.coli, control culture, 40 minutes (t3) after treatment, replicate C
GSE42205	E.coli, control culture, at the time of treatment (t1), replicate A
GSE42205	E.coli, control culture, at the time of treatment (t1), replicate B
GSE42205	E.coli, control culture, at the time of treatment (t1), replicate C
GSE42205	E.coli_control_repA_t1
GSE42205	E.coli_control_repA_t2
GSE42205	E.coli_control_repA_t3
GSE42205	E.coli_control_repB_t1
GSE42205	E.coli_control_repB_t2
GSE42205	E.coli_control_repB_t3
GSE42205	E.coli_control_repC_t1
GSE42205	E.coli_control_repC_t2
GSE42205	E.coli_control_repC_t3
GSE42205	E.coli, culture with ethanol 20%, 20 minutes (t2) after treatment, replicate A
GSE42205	E.coli, culture with ethanol 20%, 20 minutes (t2) after treatment, replicate B
GSE42205	E.coli, culture with ethanol 20%, 20 minutes (t2) after treatment, replicate C
GSE42205	E.coli, culture with ethanol 20%, 40 minutes (t3) after treatment, replicate A
GSE42205	E.coli, culture with ethanol 20%, 40 minutes (t3) after treatment, replicate B
GSE42205	E.coli, culture with ethanol 20%, 40 minutes (t3) after treatment, replicate C
GSE42205	E.coli, culture with ethanol 20%, at the time of treatment (t1), replicate A
GSE42205	E.coli, culture with ethanol 20%, at the time of treatment (t1), replicate B
GSE42205	E.coli, culture with ethanol 20%, at the time of treatment (t1), replicate C
GSE42205	E.coli, culture with VWPE extract diluted in ethanol 20%, 20 minutes (t2) after treatment, replicate A
GSE42205	E.coli, culture with VWPE extract diluted in ethanol 20%, 20 minutes (t2) after treatment, replicate B
GSE42205	E.coli, culture with VWPE extract diluted in ethanol 20%, 20 minutes (t2) after treatment, replicate C
GSE42205	E.coli, culture with VWPE extract diluted in ethanol 20%, 40 minutes (t3) after treatment, replicate A
GSE42205	E.coli, culture with VWPE extract diluted in ethanol 20%, 40 minutes (t3) after treatment, replicate B
GSE42205	E.coli, culture with VWPE extract diluted in ethanol 20%, 40 minutes (t3) after treatment, replicate C
GSE42205	E.coli, culture with VWPE extract diluted in ethanol 20%, at the time of treatment (t1), replicate A
GSE42205	E.coli, culture with VWPE extract diluted in ethanol 20%, at the time of treatment (t1), replicate B
GSE42205	E.coli, culture with VWPE extract diluted in ethanol 20%, at the time of treatment (t1), replicate C
GSE42205	E.coli_ethanol_repA_t1
GSE42205	E.coli_ethanol_repA_t2
GSE42205	E.coli_ethanol_repA_t3
GSE42205	E.coli_ethanol_repB_t1
GSE42205	E.coli_ethanol_repB_t2
GSE42205	E.coli_ethanol_repB_t3
GSE42205	E.coli_ethanol_repC_t1
GSE42205	E.coli_ethanol_repC_t2
GSE42205	E.coli_ethanol_repC_t3
GSE42205	E.coli K12 was cultured in LB and grown at 37°C
GSE42205	E.coli_polyphenols_repA_t1
GSE42205	E.coli_polyphenols_repA_t2
GSE42205	E.coli_polyphenols_repA_t3
GSE42205	E.coli_polyphenols_repB_t1
GSE42205	E.coli_polyphenols_repB_t2
GSE42205	E.coli_polyphenols_repB_t3
GSE42205	E.coli_polyphenols_repC_t1
GSE42205	E.coli_polyphenols_repC_t2
GSE42205	E.coli_polyphenols_repC_t3
GSE42205	Escherichia coli K-12
GSE42205	RNA extracted according to QiAgen RNeasy MiniKit protocol for bacterial samples
GSE42205	time: 20 minutes (t2) after treatment
GSE42205	time: 40 minutes (t3) after treatment
GSE42205	time: at time of treatment (t1)
GSE42702	Escherichia coli
GSE42702	genotype: wild type
GSE42702	genotype: yajL mutant
GSE42702	growth phase: exponential
GSE42702	Intensity measures in wild type strain, replicate 1
GSE42702	Intensity measures in wild type strain, replicate 2
GSE42702	Intensity measures in yajL mutant strain, replicate 1
GSE42702	Intensity measures in yajL mutant strain, replicate 2
GSE42702	Luria broth (LB) medium under aeration, exponential phase OD600 = 0.3.
GSE42702	RNA extraction was performed using phenol treatment.
GSE42702	strain
GSE42702	The CEL files generated for each array were analyzed using Affymetrix Expression Console software.
GSE42702	treatment: none
GSE42702	Untreated wild type versus untreated yajL mutant.
GSE42702	wild type MG1655
GSE42702	yajL mutant (genetic background MG1655)
GSE42821	At OD600 of 0.5, cell cultures were separated into two flasks. D-galactose (final 0.3%) was added to one and cells were grown for 1.5 h further.
GSE42821	Cells were then placed on ice and RNAprotect™ bacteria reagent (Qiagen) was added to stabilize the RNA. Total RNAs of cells were purified by RNeasy mini kit (Qiagen). Isolated RNA (10 ug) was used for random primer cDNA synthesis using SuperScript II reverse transcriptase, 18064–071 (Invitrogen). The reaction mixture was then subsequently treated with 1 N NaOH to degrade any remaining RNA and treated with 1 N HCl to neutralize the NaOH. Synthesized cDNA was then purified using MiniElute PCR purification columns, 28004 (Qiagen). Purified cDNA (3 ug) was fragmented to between 50 and 200 bps by 0.6 U
GSE42821	Computation of genomic intervals based on computed signal and p-values
GSE42821	Computation of summary statistics
GSE42821	E. coli galT mutant cells were cultivated in 125-mL corning flasks containing 30 mL of M63 minimal medium plus glycerol (final 0.3%) at 37 °C.
GSE42821	E. coli galT mutant with galactose
GSE42821	E. coli galT mutant without galactose
GSE42821	Escherichia coli
GSE42821	genotype
GSE42821	Signal and p-values for each genomic position interrogated.
GSE42821	The program used to generate the bed
GSE42821	The TAS software provides analysis capabilities specifically for the GeneChip® Tiling Arrays. TAS analyzes feature intensity data stored in GCOS output .CEL files and produces:
GSE42821	Visualizations for assessing the quality of the array data
GSE42821	with D-galactose
GSE42821	without D-galactose
GSE4321	At OD450 = 0.3, cultures induced with 1 mM IPTG. Cells harvested 0 min after induction
GSE4321	At OD450 = 0.3, cultures induced with 1 mM IPTG. Cells harvested 10 min after induction
GSE4321	At OD450 = 0.3, cultures induced with 1 mM IPTG. Cells harvested 20 min after induction
GSE4321	At OD450 = 0.3, cultures induced with 1 mM IPTG. Cells harvested 2.5 min after induction
GSE4321	At OD450 = 0.3, cultures induced with 1 mM IPTG. Cells harvested 5 min after induction
GSE4321	Culture samples for microarray analysis were added to ice-cold 5% water-saturated phenol in ethanol solution, centrifuged at 6,600 g and the cell pellets flash frozen in liquid N2 before storing at -80 degrees C until required. Total RNA was isolated from the stored cell pellets using the hot phenol method, and labeled Cy3 and Cy5 cDNA was prepared from 16 ug total RNA with 10 ug random hexamer (Integrated DNA Technologies, Inc., Coralville, IA, USA).
GSE4321	Data filtered for PCR success, >3x local background and spot quality (GenePix Flag). Normalized using Lowess smoothing from MA plot
GSE4321	EC18n122 RpoH 10 min Time course 4
GSE4321	EC18n167 RpoH 0 min Time course 2
GSE4321	EC18n168 RpoH 2.5 min Time course 2
GSE4321	EC18n169 RpoH 5 min Time course 2
GSE4321	EC18n170 RpoH 10 min Time course 2
GSE4321	EC18n171 RpoH 20 min Time course 2
GSE4321	EC18n177 RpoH 0 min Time course 1
GSE4321	EC18n178 RpoH 2.5 min Time course 1
GSE4321	EC18n179 RpoH 5 min Time course 1
GSE4321	EC18n180 RpoH 10 min Time course 1
GSE4321	EC18n181 RpoH 20 min Time course 1
GSE4321	EC18n182 RpoH 0 min Time course 3
GSE4321	EC18n183 RpoH 2.5 min Time course 3
GSE4321	EC18n184 RpoH 5 min Time course 3
GSE4321	EC18n185 RpoH 10 min Time course 3
GSE4321	EC18n186 RpoH 20 min Time course 3
GSE4321	Escherichia coli
GSE4321	M9 minimal complete media, cultures grown aerobically at 30 degrees C in a gyratory water bath shaking at 240 rpm
GSE4321	MG1655 PhtpG::lacZ delta lacX74
GSE4321	RpoH induced (0 min)
GSE4321	RpoH induced (10 min)
GSE4321	RpoH induced (20 min)
GSE4321	RpoH induced (2.5 min)
GSE4321	RpoH induced (5 min)
GSE4321	Wild type control (0 min)
GSE4321	Wild type control (10 min)
GSE4321	Wild type control (20 min)
GSE4321	Wild type control (2.5 min)
GSE4321	Wild type control (5 min)
GSE4357	Ecoli_Ampicillin treatment T1
GSE4357	Ecoli_Ampicillin treatment T2
GSE4357	Ecoli_Ampicillin treatment T3
GSE4357	Ecoli_Ampicillin treatment T4
GSE4357	Ecoli_Ampicillin treatment T5
GSE4357	Ecoli_Ampicillin treatment T6
GSE4357	Escherichia coli
GSE4357	Escherichia coli MG1655, 0 min after Ampicillin (100 ug
GSE4357	Escherichia coli MG1655, 10 min after Ampicillin (100 ug
GSE4357	Escherichia coli MG1655, 15 min after Ampicillin (100 ug
GSE4357	Escherichia coli MG1655, 20 min after Ampicillin (100 ug
GSE4357	Escherichia coli MG1655, 30 min after Ampicillin (100 ug
GSE4357	Escherichia coli MG1655, 40 min after Ampicillin (100 ug
GSE4357	Escherichia coli MG1655, 45min after Ampicillin (100 ug
GSE4357	Escherichia coli MG1655, 50 min after Ampicillin (100 ug
GSE4357	Escherichia coli MG1655, 5 min after Ampicillin (100 ug
GSE4357	Escherichia coli MG1655, 60 min after Ampicillin (100 ug
GSE4357	Escherichia coli MG1655, 75 min after Ampicillin (100 ug
GSE4357	Escherichia coli MG1655, M9 + glucose
GSE4357	Escherichia coli MG1655, M9 + glucose, 0 min before treatment
GSE4357	Normalized log (2) ratio of Cy5
GSE4358	Ecoli_CaCl2 wash T1
GSE4358	Ecoli_CaCl2 wash T2
GSE4358	Ecoli_CaCl2 wash T3
GSE4358	Ecoli_CaCl2 wash T4
GSE4358	Ecoli_CaCl2 wash T5
GSE4358	Ecoli_CaCl2 wash T6
GSE4358	Escherichia coli
GSE4358	Escherichia coli MG1655, OD 0.43 LB
GSE4358	Escherichia coli MG1655,Sample washed in 0.1 M CaCl2 + 15 % glycerol vs before washing OD 0.43 in LB, 10 min timepoint
GSE4358	Escherichia coli MG1655,Sample washed in 0.1 M CaCl2 + 15 % glycerol vs before washing OD 0.43 in LB, 20 min timepoint
GSE4358	Escherichia coli MG1655,Sample washed in 0.1 M CaCl2 + 15 % glycerol vs before washing OD 0.43 in LB, 2 min timepoint
GSE4358	Escherichia coli MG1655,Sample washed in 0.1 M CaCl2 + 15 % glycerol vs before washing OD 0.43 in LB, 40 min timepoint
GSE4358	Escherichia coli MG1655,Sample washed in 0.1 M CaCl2 + 15 % glycerol vs before washing OD 0.43 in LB, 5 min timepoint
GSE4358	Escherichia coli MG1655,Sample washed in 0.1 M CaCl2 + 15 % glycerol vs before washing OD 0.43 in LB, 60 min timepoint
GSE4358	Normalized log (2) ratio of Cy5
GSE4359	Ecoli_Early Recovery in LB T1
GSE4359	Ecoli_Early Recovery in LB T2
GSE4359	Ecoli_Early Recovery in LB T3
GSE4359	Ecoli_Early Recovery in LB T4
GSE4359	Ecoli_Early Recovery in LB T5
GSE4359	Ecoli_Early Recovery in LB T6
GSE4359	Ecoli_Early Recovery in LB T7
GSE4359	Escherichia coli
GSE4359	Escherichia coli MG1655, 0 min recovery in LB + glucose at OD 0.4
GSE4359	Escherichia coli MG1655, 15 min recovery in LB + glucose at OD 0.4
GSE4359	Escherichia coli MG1655, 30 min recovery in LB + glucose at OD 0.4
GSE4359	Escherichia coli MG1655, 45min recovery in LB + glucose at OD 0.4
GSE4359	Escherichia coli MG1655, 60 min recovery in LB + glucose at OD 0.4
GSE4359	Escherichia coli MG1655, 75 min recovery in LB + glucose at OD 0.4
GSE4359	Escherichia coli MG1655, 90 min recovery in LB + glucose at OD 0.4
GSE4359	Escherichia coli MG1655, Bonner-Vogel OD~0.5
GSE4359	Normalized log (2) ratio of Cy5
GSE4360	Ecoli_Indol-acrylate (10 ug
GSE4360	Escherichia coli
GSE4360	Escherichia coli MG1655, 15 min after Indol-acrylate (10 ug
GSE4360	Escherichia coli MG1655, 30 min after Indol-acrylate (10 ug
GSE4360	Escherichia coli MG1655, 5 min after Indol-acrylate (10 ug
GSE4360	Escherichia coli MG1655, 60 min after Indol-acrylate (10 ug
GSE4360	Escherichia coli MG1655, Bonner-Vogel
GSE4360	Escherichia coli MG1655, Bonner-Vogel, 0 min before treatment
GSE4360	Normalized log (2) ratio of Cy5
GSE4361	Ecoli_Indol-acrylate (15 ug
GSE4361	Escherichia coli
GSE4361	Escherichia coli MG1655, 15 min after Indol-acrylate (15 ug
GSE4361	Escherichia coli MG1655, 30 min after Indol-acrylate (15 ug
GSE4361	Escherichia coli MG1655, 5 min after Indol-acrylate (15 ug
GSE4361	Escherichia coli MG1655, 60 min after Indol-acrylate (15 ug
GSE4361	Escherichia coli MG1655, Bonner-Vogel
GSE4361	Escherichia coli MG1655, Bonner-Vogel, 0 min before treatment
GSE4361	Normalized log (2) ratio of Cy5
GSE4362	Ecoli_Kanamycin treatment T1
GSE4362	Ecoli_Kanamycin treatment T2
GSE4362	Ecoli_Kanamycin treatment T3
GSE4362	Ecoli_Kanamycin treatment T4
GSE4362	Ecoli_Kanamycin treatment T5
GSE4362	Ecoli_Kanamycin treatment T6
GSE4362	Escherichia coli
GSE4362	Escherichia coli MG1655, 0 min after Kanamycin (100 ug
GSE4362	Escherichia coli MG1655, 10 min after Kanamycin (100 ug
GSE4362	Escherichia coli MG1655, 15 min after Kanamycin (100 ug
GSE4362	Escherichia coli MG1655, 20 min after Kanamycin (100 ug
GSE4362	Escherichia coli MG1655, 30 min after Kanamycin (100 ug
GSE4362	Escherichia coli MG1655, 40 min after Kanamycin (100 ug
GSE4362	Escherichia coli MG1655, 45min after Kanamycin (100 ug
GSE4362	Escherichia coli MG1655, 50 min after Kanamycin (100 ug
GSE4362	Escherichia coli MG1655, 5 min after Kanamycin (100 ug
GSE4362	Escherichia coli MG1655, 60 min after Kanamycin (100 ug
GSE4362	Escherichia coli MG1655, 75 min after Kanamycin (100 ug
GSE4362	Escherichia coli MG1655, M9 + glucose
GSE4362	Escherichia coli MG1655, M9 + glucose, 0 min before treatment
GSE4362	Normalized log (2) ratio of Cy5
GSE4363	Ecoli_LB growth T1
GSE4363	Ecoli_LB growth T10
GSE4363	Ecoli_LB growth T11
GSE4363	Ecoli_LB growth T2
GSE4363	Ecoli_LB growth T3
GSE4363	Ecoli_LB growth T4
GSE4363	Ecoli_LB growth T5
GSE4363	Ecoli_LB growth T6
GSE4363	Ecoli_LB growth T7
GSE4363	Ecoli_LB growth T8
GSE4363	Ecoli_LB growth T9
GSE4363	Escherichia coli
GSE4363	Escherichia coli MG1655, 0 min recovery in LB+0.2% glc
GSE4363	Escherichia coli MG1655, 105 min recovery in LB+0.2% glc
GSE4363	Escherichia coli MG1655, 133 min recovery in LB+0.2% glc
GSE4363	Escherichia coli MG1655, 1440 min recovery in LB+0.2% glc
GSE4363	Escherichia coli MG1655, 163 min recovery in LB+0.2% glc
GSE4363	Escherichia coli MG1655, 191 min recovery in LB+0.2% glc
GSE4363	Escherichia coli MG1655, 218 min recovery in LB+0.2% glc
GSE4363	Escherichia coli MG1655, 261 min recovery in LB+0.2% glc
GSE4363	Escherichia coli MG1655, 313 min recovery in LB+0.2% glc
GSE4363	Escherichia coli MG1655, 443 min recovery in LB+0.2% glc
GSE4363	Escherichia coli MG1655, 78 min recovery in LB+0.2% glc
GSE4363	Escherichia coli MG1655, Bonner-Vogel OD~0.5
GSE4363	Normalized log (2) ratio of Cy5
GSE4364	Ecoli_Late Recovery in LB T1
GSE4364	Ecoli_Late Recovery in LB T2
GSE4364	Ecoli_Late Recovery in LB T3
GSE4364	Ecoli_Late Recovery in LB T4
GSE4364	Ecoli_Late Recovery in LB T5
GSE4364	Ecoli_Late Recovery in LB T6
GSE4364	Ecoli_Late Recovery in LB T7
GSE4364	Escherichia coli
GSE4364	Escherichia coli MG1655, 0 min recovery in LB + glucose at OD 1.0
GSE4364	Escherichia coli MG1655, 15 min recovery in LB + glucose at OD 1.0
GSE4364	Escherichia coli MG1655, 30 min recovery in LB + glucose at OD 1.0
GSE4364	Escherichia coli MG1655, 45min recovery in LB + glucose at OD 1.0
GSE4364	Escherichia coli MG1655, 60 min recovery in LB + glucose at OD 1.0
GSE4364	Escherichia coli MG1655, 75 min recovery in LB + glucose at OD 1.0
GSE4364	Escherichia coli MG1655, 90 min recovery in LB + glucose at OD 1.0
GSE4364	Escherichia coli MG1655, Bonner-Vogel OD~0.5
GSE4364	Normalized log (2) ratio of Cy5
GSE4365	Ecoli_NOX+_balanced growth at OD 0.13
GSE4365	Ecoli_NOX+_balanced growth at OD 0.21
GSE4365	Ecoli_NOX+_balanced growth at OD 0.28
GSE4365	Ecoli_NOX+_balanced growth at OD 0.34
GSE4365	Ecoli_NOX+_balanced growth at OD 0.4
GSE4365	Escherichia coli
GSE4365	Escherichia coli MG1655
GSE4365	Normalized log (2) ratio of Cy5
GSE4366	Ecoli_NOX-_balanced groNOX-h at OD 0.19
GSE4366	Ecoli_NOX-_balanced groNOX-h at OD 0.3
GSE4366	Ecoli_NOX-_balanced groNOX-h at OD 0.41
GSE4366	Ecoli_NOX-_balanced groNOX-h at OD 0.49
GSE4366	Ecoli_NOX-_balanced groNOX-h at OD 0.6
GSE4366	Escherichia coli
GSE4366	Escherichia coli MG1655
GSE4366	Normalized log (2) ratio of Cy5
GSE4367	Ecoli_Norfloxacin (50 ug
GSE4367	Escherichia coli
GSE4367	Escherichia coli C600 , 10 min after Norfloxacin (50 ug
GSE4367	Escherichia coli C600 , 20min after Norfloxacin (50 ug
GSE4367	Escherichia coli C600 , 2 min after Norfloxacin (50 ug
GSE4367	Escherichia coli C600 , 30 min after Norfloxacin (50 ug
GSE4367	Escherichia coli C600 , 5 min after Norfloxacin (50 ug
GSE4367	Escherichia coli C600 , LB
GSE4367	Escherichia coli C600 , LB, 0 min before treatment
GSE4367	Normalized log (2) ratio of Cy5
GSE4368	Ecoli_gyrArparCr_Norfloxacin (15 ug
GSE4368	Escherichia coli
GSE4368	Escherichia coli C600 (gyrArparCr), 10 min after Norfloxacin (15 ug
GSE4368	Escherichia coli C600 (gyrArparCr), 20min after Norfloxacin (15 ug
GSE4368	Escherichia coli C600 (gyrArparCr), 2 min after Norfloxacin (15 ug
GSE4368	Escherichia coli C600 (gyrArparCr), 30 min after Norfloxacin (15 ug
GSE4368	Escherichia coli C600 (gyrArparCr), 5 min after Norfloxacin (15 ug
GSE4368	Escherichia coli C600 (gyrArparCr), LB
GSE4368	Escherichia coli C600 (gyrArparCr), LB, 0 min before treatment
GSE4368	Normalized log (2) ratio of Cy5
GSE4369	Ecoli_gyrArparCr_Norfloxacin (50 ug
GSE4369	Escherichia coli
GSE4369	Escherichia coli C600 (gyrArparCr), 10 min after Norfloxacin (50 ug
GSE4369	Escherichia coli C600 (gyrArparCr), 20min after Norfloxacin (50 ug
GSE4369	Escherichia coli C600 (gyrArparCr), 2 min after Norfloxacin (50 ug
GSE4369	Escherichia coli C600 (gyrArparCr), 30 min after Norfloxacin (50 ug
GSE4369	Escherichia coli C600 (gyrArparCr), 5 min after Norfloxacin (50 ug
GSE4369	Escherichia coli C600 (gyrArparCr), LB
GSE4369	Escherichia coli C600 (gyrArparCr), LB, 0 min before treatment
GSE4369	Normalized log (2) ratio of Cy5
GSE4370	Ecoli_Recovery in 10mM Na-P T1
GSE4370	Ecoli_Recovery in 10mM Na-P T2
GSE4370	Ecoli_Recovery in 10mM Na-P T3
GSE4370	Ecoli_Recovery in 10mM Na-P T4
GSE4370	Ecoli_Recovery in 10mM Na-P T5
GSE4370	Ecoli_Recovery in 10mM Na-P T6
GSE4370	Ecoli_Recovery in 10mM Na-P T7
GSE4370	Escherichia coli
GSE4370	Escherichia coli MG1655, 0 min recovery in 10mM Na-P
GSE4370	Escherichia coli MG1655, 0 min recovery in 10 mM Na-P (pH 7.5)
GSE4370	Escherichia coli MG1655, 15 min recovery in 10mM Na-P
GSE4370	Escherichia coli MG1655, 15 min recovery in 10 mM Na-P (pH 7.5)
GSE4370	Escherichia coli MG1655, 30 min recovery in 10mM Na-P
GSE4370	Escherichia coli MG1655, 30 min recovery in 10 mM Na-P (pH 7.5)
GSE4370	Escherichia coli MG1655, 45min recovery in 10mM Na-P
GSE4370	Escherichia coli MG1655, 45min recovery in 10 mM Na-P (pH 7.5)
GSE4370	Escherichia coli MG1655, 60 min recovery in 10mM Na-P
GSE4370	Escherichia coli MG1655, 60 min recovery in 10 mM Na-P (pH 7.5)
GSE4370	Escherichia coli MG1655, 75 min recovery in 10mM Na-P
GSE4370	Escherichia coli MG1655, 75 min recovery in 10 mM Na-P (pH 7.5)
GSE4370	Escherichia coli MG1655, 90 min recovery in 10mM Na-P
GSE4370	Escherichia coli MG1655, 90 min recovery in 10 mM Na-P (pH 7.5)
GSE4370	Escherichia coli MG1655, Bonner-Vogel OD~0.5
GSE4370	Normalized log (2) ratio of Cy5
GSE4371	Ecoli_Recovery in 10mM Na-P + 0.2 % glucose T1
GSE4371	Ecoli_Recovery in 10mM Na-P + 0.2 % glucose T2
GSE4371	Ecoli_Recovery in 10mM Na-P + 0.2 % glucose T3
GSE4371	Ecoli_Recovery in 10mM Na-P + 0.2 % glucose T4
GSE4371	Ecoli_Recovery in 10mM Na-P + 0.2 % glucose T5
GSE4371	Ecoli_Recovery in 10mM Na-P + 0.2 % glucose T6
GSE4371	Ecoli_Recovery in 10mM Na-P + 0.2 % glucose T7
GSE4371	Escherichia coli
GSE4371	Escherichia coli MG1655, 0 min recovery in 10mM Na-P + 0.2 % glucose
GSE4371	Escherichia coli MG1655, 0 min recovery in 10 mM Na-P + 0.2 % glucose (pH 7.5) at OD 0.4
GSE4371	Escherichia coli MG1655, 15 min recovery in 10mM Na-P + 0.2 % glucose
GSE4371	Escherichia coli MG1655, 15 min recovery in 10 mM Na-P + 0.2 % glucose (pH 7.5) at OD 0.4
GSE4371	Escherichia coli MG1655, 30 min recovery in 10mM Na-P + 0.2 % glucose
GSE4371	Escherichia coli MG1655, 30 min recovery in 10 mM Na-P + 0.2 % glucose (pH 7.5) at OD 0.4
GSE4371	Escherichia coli MG1655, 45min recovery in 10mM Na-P + 0.2 % glucose
GSE4371	Escherichia coli MG1655, 45min recovery in 10 mM Na-P + 0.2 % glucose (pH 7.5) at OD 0.4
GSE4371	Escherichia coli MG1655, 60 min recovery in 10mM Na-P + 0.2 % glucose
GSE4371	Escherichia coli MG1655, 60 min recovery in 10 mM Na-P + 0.2 % glucose (pH 7.5) at OD 0.4
GSE4371	Escherichia coli MG1655, 75 min recovery in 10mM Na-P + 0.2 % glucose
GSE4371	Escherichia coli MG1655, 75 min recovery in 10 mM Na-P + 0.2 % glucose (pH 7.5) at OD 0.4
GSE4371	Escherichia coli MG1655, 90 min recovery in 10mM Na-P + 0.2 % glucose
GSE4371	Escherichia coli MG1655, 90 min recovery in 10 mM Na-P + 0.2 % glucose (pH 7.5) at OD 0.4
GSE4371	Escherichia coli MG1655, Bonner-Vogel OD~0.5
GSE4371	Normalized log (2) ratio of Cy5
GSE4372	Ecoli_Sodium Azide treatment T1
GSE4372	Ecoli_Sodium Azide treatment T2
GSE4372	Ecoli_Sodium Azide treatment T3
GSE4372	Ecoli_Sodium Azide treatment T4
GSE4372	Escherichia coli
GSE4372	Escherichia coli W3110, 0  min before treatment, Bonner-Vogel + 50 ug
GSE4372	Escherichia coli W3110, 0 min before treatment in Bonner-Vogel + 50 ug
GSE4372	Escherichia coli W3110,5 min 0.01 M Sodium Azide treatment vs 0 min before treatment in Bonner-Vogel + 50 ug
GSE4372	Normalized log (2) ratio of Cy5
GSE4373	Ecoli_Anaerobic growth in M9 + glucose, reference Genomic DNA T1
GSE4373	Ecoli_Anaerobic growth in M9 + glucose, reference Genomic DNA T2
GSE4373	Ecoli_Anaerobic growth in M9 + glucose, reference Genomic DNA T3
GSE4373	Ecoli_Anaerobic growth in M9 + glucose, reference Genomic DNA T4
GSE4373	Ecoli_Anaerobic growth in M9 + glucose, reference Genomic DNA T5
GSE4373	Ecoli_Anaerobic growth in M9 + glucose, reference Genomic DNA T6
GSE4373	Escherichia coli
GSE4373	Escherichia coli MG1655 genomic DNA
GSE4373	Escherichia coli MG1655, OD 0.03, anaerobic growth in M9 + glucose
GSE4373	Escherichia coli MG1655, OD 0.2, anaerobic growth in M9 + glucose
GSE4373	Escherichia coli MG1655,  OD 0.35, anaerobic growth in M9 + glucose
GSE4373	Escherichia coli MG1655, OD 0.6, anaerobic growth in M9 + glucose
GSE4373	Escherichia coli MG1655,  OD 0.9, anaerobic growth in M9 + glucose
GSE4373	Escherichia coli MG1655,  stationary phase anaerobic growth in M9 + glucose
GSE4373	Normalized log (2) ratio of Cy5
GSE4374	Ecoli_Anaerobic growth in M9 + glucose + fumarate,reference Genomic DNA T1
GSE4374	Ecoli_Anaerobic growth in M9 + glucose + fumarate,reference Genomic DNA T2
GSE4374	Ecoli_Anaerobic growth in M9 + glucose + fumarate,reference Genomic DNA T3
GSE4374	Ecoli_Anaerobic growth in M9 + glucose + fumarate,reference Genomic DNA T4
GSE4374	Ecoli_Anaerobic growth in M9 + glucose + fumarate,reference Genomic DNA T5
GSE4374	Ecoli_Anaerobic growth in M9 + glucose + fumarate,reference Genomic DNA T6
GSE4374	Escherichia coli
GSE4374	Escherichia coli MG1655 genomic DNA
GSE4374	Escherichia coli MG1655, OD 0.05, anaerobic growth in M9 + glucose + fumarate,
GSE4374	Escherichia coli MG1655, OD 0.21, anaerobic growth in M9 + glucose + fumarate,
GSE4374	Escherichia coli MG1655,  OD 0.43, anaerobic growth in M9 + glucose + fumarate,
GSE4374	Escherichia coli MG1655, OD 0.7, anaerobic growth in M9 + glucose + fumarate,
GSE4374	Escherichia coli MG1655,  OD 1.2, anaerobic growth in M9 + glucose + fumarate,
GSE4374	Escherichia coli MG1655,  stationary phase anaerobic growth in M9 + glucose + fumarate,
GSE4374	Normalized log (2) ratio of Cy5
GSE4375	Ecoli_Anaerobic growth in M9 + glucose vs Aerobic OD 0.4 T1
GSE4375	Ecoli_Anaerobic growth in M9 + glucose vs Aerobic OD 0.4 T2
GSE4375	Ecoli_Anaerobic growth in M9 + glucose vs Aerobic OD 0.4 T3
GSE4375	Ecoli_Anaerobic growth in M9 + glucose vs Aerobic OD 0.4 T4
GSE4375	Ecoli_Anaerobic growth in M9 + glucose vs Aerobic OD 0.4 T5
GSE4375	Ecoli_Anaerobic growth in M9 + glucose vs Aerobic OD 0.4 T6
GSE4375	Escherichia coli
GSE4375	Escherichia coli MG1655
GSE4375	Escherichia coli MG1655 Aerobic growth OD 0.4
GSE4375	Escherichia coli MG1655 Aerobic growth on M9 +glucose, OD 0.4
GSE4375	Escherichia coli MG1655, OD 0.08, anaerobic growth in M9 + glucose ,
GSE4375	Escherichia coli MG1655, OD 0.15, anaerobic growth in M9 + glucose ,
GSE4375	Escherichia coli MG1655,  OD 0.34, anaerobic growth in M9 + glucose ,
GSE4375	Escherichia coli MG1655, OD 0.73, anaerobic growth in M9 + glucose ,
GSE4375	Escherichia coli MG1655,  OD 1.02, anaerobic growth in M9 + glucose ,
GSE4375	Escherichia coli MG1655,  OD 1.27 anaerobic growth in M9 + glucose ,
GSE4375	Normalized log (2) ratio of Cy5
GSE4376	Ecoli_Anaerobic growth in M9 + glucose + fumarate vs Aerobic OD 0.4 T1
GSE4376	Ecoli_Anaerobic growth in M9 + glucose + fumarate vs Aerobic OD 0.4 T2
GSE4376	Ecoli_Anaerobic growth in M9 + glucose + fumarate vs Aerobic OD 0.4 T3
GSE4376	Ecoli_Anaerobic growth in M9 + glucose + fumarate vs Aerobic OD 0.4 T4
GSE4376	Ecoli_Anaerobic growth in M9 + glucose + fumarate vs Aerobic OD 0.4 T5
GSE4376	Ecoli_Anaerobic growth in M9 + glucose + fumarate vs Aerobic OD 0.4 T6
GSE4376	Escherichia coli
GSE4376	Escherichia coli MG1655
GSE4376	Escherichia coli MG1655 Aerobic growth on M9 + glucose + fumarate,OD 0.4
GSE4376	Escherichia coli MG1655, OD 0.15, anaerobic growth in M9 + glucose + fumarate ,
GSE4376	Escherichia coli MG1655, OD 0.30, anaerobic growth in M9 + glucose + fumarate ,
GSE4376	Escherichia coli MG1655,  OD 0.63, anaerobic growth in M9 + glucose + fumarate ,
GSE4376	Escherichia coli MG1655, OD 0.85, anaerobic growth in M9 + glucose + fumarate ,
GSE4376	Escherichia coli MG1655,  OD 1.07, anaerobic growth in M9 + glucose + fumarate ,
GSE4376	Escherichia coli MG1655,  OD 1.29 anaerobic growth in M9 + glucose + fumarate ,
GSE4376	Normalized log (2) ratio of Cy5
GSE4377	Ecoli_Gamma treatment T1
GSE4377	Ecoli_Gamma treatment T2
GSE4377	Ecoli_Gamma treatment T3
GSE4377	Ecoli_Gamma treatment T4
GSE4377	Ecoli_Gamma treatment T5
GSE4377	Escherichia coli
GSE4377	Escherichia coli MG1655, 0 min before treatment, Davis
GSE4377	Escherichia coli MG1655, 10 min after Gamma treatment in Davis
GSE4377	Escherichia coli MG1655, 20 min after Gamma treatment in Davis
GSE4377	Escherichia coli MG1655, 40min after Gamma treatment in Davis
GSE4377	Escherichia coli MG1655, 5 min after Gamma treatment in Davis
GSE4377	Escherichia coli MG1655, 60 min after Gamma treatment in Davis
GSE4377	Escherichia coli MG1655, Davis, 0 min before treatment
GSE4377	Normalized log (2) ratio of Cy5
GSE4378	Ecoli_Novobiocin treatment (200 ug
GSE4378	Ecoli_Novobiocin treatment (20 ug
GSE4378	Ecoli_Novobiocin treatment (50 ug
GSE4378	Ecoli_Novobiocin treatment (5 ug
GSE4378	Escherichia coli
GSE4378	Escherichia coli LE234 acrD-, 0 min before treatment in LB
GSE4378	Escherichia coli LE234 acrD-, 5 min after Novobiocin (200 ug
GSE4378	Escherichia coli LE234 acrD-, 5 min after Novobiocin (20 ug
GSE4378	Escherichia coli LE234 acrD-, 5 min after Novobiocin (50 ug
GSE4378	Escherichia coli LE234 acrD-, 5 min after Novobiocin (5 ug
GSE4378	Escherichia coli LE234 acrD-, LB, 0 min before treatment
GSE4378	Normalized log (2) ratio of Cy5
GSE4379	Ecoli_pUC expression OD 0.2
GSE4379	Ecoli_pUC expression OD 0.5
GSE4379	Ecoli_pUC expression OD 0.9
GSE4379	Escherichia coli
GSE4379	Escherichia coli DH5alpha (NEB), OD 0.2 in LB + Amp,  pUC expression
GSE4379	Escherichia coli DH5alpha (NEB), OD 0.2 in LB, no pUC
GSE4379	Escherichia coli DH5alpha (NEB), OD 0.5 in LB + Amp,  pUC expression
GSE4379	Escherichia coli DH5alpha (NEB), OD 0.5 in LB, no pUC
GSE4379	Escherichia coli DH5alpha (NEB), OD 0.9 in LB + Amp,  pUC expression
GSE4379	Escherichia coli DH5alpha (NEB), OD 0.9 in LB, no pUC
GSE4379	Normalized log (2) ratio of Cy5
GSE4380	Ecoli_Stationary phase in LB T1
GSE4380	Ecoli_Stationary phase in LB T2
GSE4380	Ecoli_Stationary phase in LB T3
GSE4380	Ecoli_Stationary phase in LB T4
GSE4380	Ecoli_Stationary phase in LB T5
GSE4380	Ecoli_Stationary phase in LB T6
GSE4380	Escherichia coli
GSE4380	Escherichia coli MG1655 genomic DNA
GSE4380	Escherichia coli MG1655, Stationary phase in LB OD 2.4
GSE4380	Escherichia coli MG1655, Stationary phase in LB OD 2.8
GSE4380	Escherichia coli MG1655,  Stationary phase in LB OD 3.1
GSE4380	Escherichia coli MG1655, Stationary phase in LB OD 3.1 for 20 min
GSE4380	Escherichia coli MG1655,  Stationary phase in LB OD 3.1 for 40 min
GSE4380	Escherichia coli MG1655,  stationary phase in LB, OD 3.1 for 60 min
GSE4380	Normalized log (2) ratio of Cy5
GSE4417	Ecoli_Temperature upshift in gyrBT mutant T1
GSE4417	Ecoli_Temperature upshift in gyrBT mutant T2
GSE4417	Ecoli_Temperature upshift in gyrBT mutant T3
GSE4417	Ecoli_Temperature upshift in gyrBT mutant T4
GSE4417	Escherichia coli
GSE4417	Escherichia coli W3110gyrb234, LB
GSE4417	Escherichia coli W3110gyrb234, LB, 10 min after upshift to 42 C
GSE4417	Escherichia coli W3110gyrb234, LB, 20 min after upshift to 42 C
GSE4417	Escherichia coli W3110gyrb234, LB, 2 min after upshift to 42 C
GSE4417	Escherichia coli W3110gyrb234, LB, 5 min after upshift to 42 C
GSE4417	Normalized log (2) ratio of Cy5
GSE44211	CCCP-1, biological rep1
GSE44211	CCCP-2, biological rep2
GSE44211	CCCP-3, biological rep3
GSE44211	Control-1, biological rep1
GSE44211	Control-2, biological rep2
GSE44211	Control-3, biological rep3
GSE44211	E. coli_CCCP_15 min
GSE44211	E. coli_control_30 min
GSE44211	E. coli_gentamicin_30 min
GSE44211	E. coli (OD660 nm = 0.3) was incubated with control protein or antibacterial preparations in 5 mM TRIS (pH 7.6) with 150 mM NaCl, 10 µM ZnSO4, and 2% LB, at 37oC aerobically with shaking.
GSE44211	E. coli_PGRP_30 min
GSE44211	E. coli was treated at 37C aerobically with shaking with BSA (control, 100 µg
GSE44211	Escherichia coli
GSE44211	Gentamicin-1, biological rep1
GSE44211	Gentamicin-2, biological rep2
GSE44211	Gentamicin-3, biological rep3
GSE44211	growth phase: logarithmic growth
GSE44211	PGRP-1, biological rep1
GSE44211	PGRP-2, biological rep2
GSE44211	PGRP-3, biological rep3
GSE44211	RNA was obtained from each culture using Ambion RiboPureTM-bacteria RNA extraction kit according to the manufacturer’s instructions.
GSE44211	Signal intensities with all probes are shown in Sample data table. The 'expressed_present_probes.txt (available on Series records) contains Signal intensities with present probes.  Average signal intensities from 3 experiments were used to calculate fold increases in gene expression between treated and control groups, with signal intensity of 39 used as a minimum intensity, using the formula: average intensity in treated group
GSE44211	strain: K-12 substrain MG1655
GSE44211	The hybridization intensity data signals were analyzed, normalized, and corrected for batch effect using Affymetrix GeneChip® Command Console® Software (AGCC v.3.0). Signal average, noise average, scaling factor, % present, and % absent were calculated for each probe, from which the signal intensity of >39 was calculated as reliable expression. Using this cutoff, 5531 probes were classified as present out of total 10208 probes on the array (full_expressed_data.txt).
GSE44211	tissue: entire bacterial cell
GSE44211	treated with: 100 µg
GSE44211	treated with: 5 µg
GSE44211	treated with: 800 µM CCCP for 15min
GSE44258	BWG_butanol_3passages
GSE44258	BWG_replicated
GSE44258	BWY_butanol_3passages
GSE44258	BWY_replicated
GSE44258	Data were extracted in GenePix 4100A scanning software and normalized using the lowess method implemented in TM4 MIDAS
GSE44258	Donor was transformed with a random genomic library made from E. coli and stored as glycerol stocks. The library was revived and transferred to four recipient strains using conjugation; the donor was miniprepped at this time, and the recipients were miniprepped after outgrowth under dual selection. Two recipient libraries in BWG and BWY were propagated under n-butanol stress for three days, and then miniprepped as well.
GSE44258	Escherichia coli
GSE44258	Escherichia coli BW25113
GSE44258	Library minipreps were performed with the Zyppy Miniprep kit (Zymo Technologies) and quantified using the Qubit dsDNA BR kit (Invitrogen) and the Nanodrop spectrophotometer (Thermo Scientific)
GSE44258	MG6_replicated
GSE44258	MY4_replicated
GSE44258	Plasmid DNA, after n-butanol selection
GSE44258	Plasmid DNA, BWG post conjugation
GSE44258	Plasmid DNA, BWY post conjugation
GSE44258	Plasmid DNA, donor, XL1-Blue
GSE44258	Plasmid DNA, post conjugation
GSE44258	plasmid: Donor Library
GSE44258	plasmid: Initial Recipient Library (BWG)
GSE44258	plasmid: Initial Recipient Library (BWY)
GSE44258	plasmid source: Initial Recipient Library
GSE44258	plasmid source: Post Selection Library
GSE44273	cell type: Persister cells
GSE44273	Escherichia coli
GSE44273	furanone-free control
GSE44273	GeneChip Operating Software (MAS 5.0) using Affymetrix default analysis settings and global scaling as normalization method, genes with a p-value of less than 0.0025 or greater than 0.9975 were considered statistically significant based on Wilcoxon signed rank test and Tukey Byweight, labeled as I and D in the attached txt file. To ensure the significance of microarray data, an additional criterion was applied to only select the genes with an expression ratio of 2 or high from this group as induced and repressed genes.
GSE44273	RNeasy Mini Kit (Qiagen, Austin, TX, USA) with on-column DNase treatment (RNase-Free DNase Set, Qiagen).
GSE44273	RP437 persisters treated with BF8 at 5 µg
GSE44273	RP437 was inoculated in 100 mL LB and grown for 18 h (200 rpm, 37oC). Persister cells were isolated by lysing the normal cells with 5 µg
GSE44273	strain: E. coli RP437
GSE44273	The isolated persisters were incubated in 0.85% NaCl solution for 1 h (200 rpm, 37oC) with or without 5 µg
GSE44614	Cells of each evolved colony type were collected by centrifugation at 13,000 × g for 1 min at 4°C and were immediately used for total RNA isolation with NucleoSpin RNA II isolation kit (Macherey – Nagel, Biokè, Leiden, the Netherlands).
GSE44614	culture type: Ancestor
GSE44614	culture type: evolved
GSE44614	Escherichia coli
GSE44614	Growth curves of all selected evolved colony types and the ancestor were obtained by growing them under their evolved environmental conditions in LB medium until Log-phase. For this, optical density was recorded at 600nm at a value of 0.6 to 0.7.
GSE44614	morphology: a
GSE44614	morphology: b
GSE44614	morphology: c
GSE44614	oxygen regime: daily shift between shaking and static (no shaking) conditions
GSE44614	oxygen regime: transfers in constant static conditions
GSE44614	oxygen regime: transfers under constant shaking (200rpm)
GSE44614	population: 1
GSE44614	population: 2
GSE44614	population: 3
GSE44614	population: 4
GSE44614	population: 5
GSE44614	population: 6
GSE44614	population: 7
GSE44614	Pure culture in LB
GSE44614	Statistical analysis was performed using R Limma package (Linear Models for Microarrays Data)  (Smyth 2004), where the two microarrays per sample were normalized using lowess normalization method. Multiple-gene probes results were merged and normalized using the MA table conversion tool available on the MOLGEN Bioinformatics Server (http:
GSE44614	strain: MC1000
GSE44614	Treatment A Population 1 Colony a replica 1
GSE44614	Treatment A Population 1 Colony a replica 2
GSE44614	Treatment A Population 1 Colony b replica 1
GSE44614	Treatment A Population 1 Colony b replica 2
GSE44614	Treatment A Population 1 Colony c replica 1
GSE44614	Treatment A Population 1 Colony c replica 2
GSE44614	Treatment A Population 2 Colony a replica 1
GSE44614	Treatment A Population 2 Colony a replica 2
GSE44614	Treatment A Population 2 Colony b replica 1
GSE44614	Treatment A Population 2 Colony b replica 2
GSE44614	Treatment A Population 2 Colony c replica 1
GSE44614	Treatment A Population 2 Colony c replica 2
GSE44614	Treatment B Population 3 Colony a replica 1
GSE44614	Treatment B Population 3 Colony a replica 2
GSE44614	Treatment B Population 3 Colony b replica 1
GSE44614	Treatment B Population 3 Colony b replica 2
GSE44614	Treatment B Population 3 Colony c replica 1
GSE44614	Treatment B Population 3 Colony c replica 2
GSE44614	Treatment B Population 4 Colony a replica 1
GSE44614	Treatment B Population 4 Colony a replica 2
GSE44614	Treatment B Population 4 Colony b replica 1
GSE44614	Treatment B Population 4 Colony b replica 2
GSE44614	Treatment B Population 4 Colony c replica 1
GSE44614	Treatment B Population 4 Colony c replica 2
GSE44614	Treatment B Population 5 Colony a replica 1
GSE44614	Treatment B Population 5 Colony a replica 2
GSE44614	Treatment B Population 5 Colony b replica 1
GSE44614	Treatment B Population 5 Colony b replica 2
GSE44614	Treatment B Population 5 Colony c replica 1
GSE44614	Treatment B Population 5 Colony c replica 2
GSE44614	Treatment C Population 6 Colony b replica 1
GSE44614	Treatment C Population 6 Colony b replica 2
GSE44614	Treatment C Population 6 Colony c replica 1
GSE44614	Treatment C Population 6 Colony c replica 2
GSE44614	Treatment C Population 7 Colony b replica 1
GSE44614	Treatment C Population 7 Colony b replica 2
GSE44614	Treatment C Population 7 Colony c replica 1
GSE44614	Treatment C Population 7 Colony c replica 2
GSE44752	100ng 16S rRNA gene amplicon of a mock community
GSE44752	Bacteroides fragilis
GSE44752	Blautia coccoides
GSE44752	[Clostridium] leptum
GSE44752	Escherichia coli
GSE44752	Faecal samples were collected by the Department of Microbiology and Alimentary Pharmabiotic Centre (Cork, Ireland) from three elderly patients (176, 204 and 205). The mock community was performed after culture of each individual bacterial strain in their reference medium at their optimal temperature for several days.
GSE44752	Lactobacillus acidophilus
GSE44752	Mock community
GSE44752	No treatment were studied in this experience
GSE44752	Pixel intensities were extracted using the “Feature Extraction” software (Agilent Technologies, Palo Alto, CA). No normalization step was performed and the retained intensity value for each probe was the ratio between the spot’s median intensity signals and the median of background signals.
GSE44752	sample type: mock community [artificial bacterial DNA mix]
GSE44752	Total DNA was extracted from three human faecal samples using  Qiagen’s DNA Stool Kit (Qiagen, West Sussex, UK). Total genomic DNA was extracted from pure bacterial cultures using DNeasy Blood and Tissue Kit (Qiagen, West Sussex, UK). 10ng of sample was then used for PCR amplification. 16S rRNA genes were amplified using universal primers 27F (AGAGTTTGATCMTGGCTCAG) and 1492R (TACGGYTACCTTGTTACGACT). PCR reactions were performed in a 50µl volume, using DreamTaq DNA polymerase (Fermentas, St. Leon-Rot, Germany). The PCR reaction consisted of an initial denaturation step at 95°C for 5min followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 40 s and elongation at 72°C for 2 min. A final extension step was performed at 72°C for 5 min. PCR product size was verified by electrophoresis with 1% (w
GSE44846	All RNA data were mapped to the reference genome Xuzhou21 using SOAP2.
GSE44846	Escherichia coli O157:H7
GSE44846	For total RNA isolation, the bacteria were inoculated in 5 ml LB broth at 37℃with shaking for 16 h. 50 µl of the above culture was inoculated in 5 ml fresh LB broth and the culture was shaken at 37°C for about 2.5 h until the OD600 reached 0.6. 500 µl of the culture were mixed with 1 ml RNA protect bacterial reagent (Qiagen, Hilden, Germany) to stabilize RNA according to the manufacturer’s instructions.
GSE44846	genotype: plasmid cured strain
GSE44846	genotype: wild type
GSE44846	Isolated from feces of a HUS patient from an outbreak in China in 1999
GSE44846	plasmid cured rep1
GSE44846	plasmid cured rep2
GSE44846	RNA-Seq
GSE44846	strain: Xuzhou21
GSE44846	strain: Xuzhou21m
GSE44846	Supplementary_files_format_and_content: tab-delimited text files include RPKM values for each Sample
GSE44846	The bacteria were routinely grown in Luria-Bertani (LB) broth or on LB agar plates (pH 7.2).
GSE44846	The distribution of reads was plotted by its location in the reference genome, and then divided into gene region and intergenic region. Genome and gene coverage was calculated by counting the number of reads mapped to the genome and individual genes respectively.
GSE44846	The gene expression was calculated using the RPKM method
GSE44846	The total RNA extracted from Xuzhou21 and Xuzhou21m were first treated with Ribo-Zero™ rRNA Removal kit to remove rRNA. The mRNA was fragmented and produced cDNA libraries primed with random hexamers. cDNA was selected by size, amplificated using PCR and and then sent to sequencing using Illumina HiseqTM 2000 commercially.
GSE44846	Total RNA were then isolated according to the standard protocol using an RNeasy mini kit (Qiagen). Genomic DNA were extracted from both Xuzhou21 and Xuzhou21m using Wizard Genomic DNA purification kit (Promega, Madison, WI, USA) according to the manufacturer’s protocols.
GSE44846	WT rep1
GSE44846	WT rep2
GSE44846	Xuzhou21 cured of the pO157_Sal plasmid
GSE44928	bacterial cells
GSE44928	BL21_1
GSE44928	BL21_2
GSE44928	Cells were grown in a 250 ml fermenter containing 100 ml LB medium supplemented  with 3 g
GSE44928	condition: LB+3g
GSE44928	Escherichia coli BL21(DE3)
GSE44928	First and second strand cDNA synthesis was carried out using the Ovation® Prokaryotic RNA-Seq System (NuGEN Technologies Inc., San Carlos, CA, USA), and NuGEN’s Encore NGS Library System was applied to construct the cDNA library for the IlluminaHiSeq platform.
GSE44928	Genome_build: gi|387825439
GSE44928	genotype: Pck over-expressed
GSE44928	genotype: wild-type
GSE44928	PCK over
GSE44928	Raw sequencing reads (FASTQ)were processed by Xpression and only the uniquely mapped reads were subjected to further analysis.
GSE44928	Reference files for the genome sequence being queried, Escherichia coli BL21(DE3) genome (NC_012971) were uploaded.
GSE44928	RNA-Seq
GSE44928	strain: BL21(DE3)
GSE44928	The number of reads overlapping each gene was recorded and normalized based on reads per kilobase per million (RPKM) uniquely mapped reads.
GSE44928	Total RNA was harvested from C. glutamicum cells using TRIzol® reagent (Invitrogen, Carlsbad, CA, USA) and NucleoSpin® (Macherey-Nagel, Düren, Germany) according to the manufacturer’s instructions with the following modifications. Cells were harvested by centrifugation, resuspended in TRIzol® reagent, and transferred to a vial containing Lysing Matrix B® (MP Biomedicals, Solon, OH, USA) for lysis. The suspension was centrifuged, and the supernatant was applied to a NucleoSpin® RNA II kit for purification.
GSE44928	Xpression (https:
GSE44928	Xpression was used for filtering and trimming reads.
GSE45228	control 12h
GSE45228	control 24h
GSE45228	control 6h
GSE45228	Cy3 and Cy5 intensities were normalized by scaling so that the 75th percentile in the Cy3 and Cy5 channels were equal.
GSE45228	Escherichia coli str. K-12 substr. MG1655
GSE45228	expose Bacillus VOC 12h
GSE45228	Expose Bacillus VOC-12h rep1
GSE45228	Expose Bacillus VOC-12h rep2
GSE45228	Expose Bacillus VOC-12h rep3
GSE45228	Expose Bacillus VOC-12h rep4
GSE45228	expose Bacillus VOC24h
GSE45228	Expose Bacillus VOC-24h rep1
GSE45228	Expose Bacillus VOC-24h rep2
GSE45228	Expose Bacillus VOC-24h rep3
GSE45228	Expose Bacillus VOC-24h rep4
GSE45228	expose Bacillus VOC 6h
GSE45228	Expose Bacillus VOC-6h rep1
GSE45228	Expose Bacillus VOC-6h rep2
GSE45228	Expose Bacillus VOC-6h rep3
GSE45228	Expose Bacillus VOC-6h rep4
GSE45228	strain: MG1655
GSE45228	time: 12 h
GSE45228	time: 24 h
GSE45228	time: 6 h
GSE45228	Total RNAs were extracted using RNeasy mini kit (Qiagen, #74104) following manufacture's instruction
GSE45228	treatment: Bacillus volatile organic compounds (VOCs)
GSE45228	treatment: control
GSE45443	Aerobic growth at 37°C  in specified media
GSE45443	Cells treated during mid-exponential growth phase
GSE45443	CV108_minus_aMG_1
GSE45443	CV108_minus_aMG_2
GSE45443	CV108_minus_aMG_3
GSE45443	CV108_plus_aMG_1
GSE45443	CV108_plus_aMG_2
GSE45443	CV108_plus_aMG_3
GSE45443	Escherichia coli str. K-12 substr. MG1655
GSE45443	Galaxy1-[CV104_pHDB3_5.txt]
GSE45443	Galaxy2-[CV104_pLCV1_5.txt]
GSE45443	Galaxy3-[CV104_pLCV1_10.txt]
GSE45443	Galaxy4-[CV104_pHDB3_20.txt]
GSE45443	Galaxy5-[CV104_pLCV1_20.txt]
GSE45443	Galaxy6-[CV104_pHDB3_10.txt]
GSE45443	Genome_build: K-12 substr. MG1655 genome (NC_000913.3)
GSE45443	genotype: CV108
GSE45443	genotype: Galaxy1-[CV104_pHDB3_5]
GSE45443	genotype: Galaxy2-[CV104_pLCV1_5]
GSE45443	genotype: Galaxy3-[CV104_pLCV1_10]
GSE45443	genotype: Galaxy4-[CV104_pHDB3_20]
GSE45443	genotype: Galaxy5-[CV104_pLCV1_20]
GSE45443	genotype: Galaxy6-[CV104_pHDB3_10]
GSE45443	genotype: MG1655
GSE45443	genotype: pHDB3
GSE45443	genotype: pLCV1
GSE45443	genotype: SgrR
GSE45443	genotype: sgrS
GSE45443	genotype: WT
GSE45443	Hot phenol RNA extraction as described in Aiba. Adhya and Crombrugghe. J. Bio Chem. 1981, 256: p. 11905-11910.
GSE45443	media: Defined MOPS Minimal + 0.4% Glycerol
GSE45443	media: Defined MOPS Minimal + 0.4% Glycerol +0.5% 2-DG
GSE45443	media: Defined MOPS Minimal + 0.4% Glycerol +0.5% aMG
GSE45443	media: Defined MOPS Rich + 0.2% Glucose
GSE45443	media: Defined MOPS Rich+ 0.4% Glycerol
GSE45443	media: Defined MOPS Rich + 0.4% Glycerol +0.5% aMG
GSE45443	media: LB
GSE45443	media: LB + 0.5% aMG
GSE45443	MG1655-aMG_1
GSE45443	MG1655+aMG_1
GSE45443	MG1655-aMG_2
GSE45443	MG1655+aMG_2
GSE45443	MG1655-aMG_3
GSE45443	MG1655+aMG_3
GSE45443	MG1655_minus_aMG_1
GSE45443	MG1655_minus_aMG_2
GSE45443	MG1655_minus_aMG_3
GSE45443	MG1655_plus_aMG_1
GSE45443	MG1655_plus_aMG_2
GSE45443	MG1655_plus_aMG_3
GSE45443	pHDB3_1
GSE45443	pHDB3_2
GSE45443	pHDB3_3
GSE45443	pLCV1_1
GSE45443	pLCV1_2
GSE45443	pLCV1_3
GSE45443	Ribosomal RNA was first removed using the Ribozero rRNA Removal Meta-Bacteria kit. Enriched mRNAs were then converted into  indexed libraries using the into ScriptSeqTM v2 RNA-Seq Library Preparation Kit
GSE45443	RNA-Seq
GSE45443	Rockhopper version 1.20 (manuscript submitted) was used for alignment, normalization, and quantification. Rockhopper is available for download from http:
GSE45443	SgrR_1
GSE45443	SgrR_2
GSE45443	SgrR_3
GSE45443	sgrS_T_1
GSE45443	sgrS_T_2
GSE45443	sgrS_T_3
GSE45443	sgrS_un_1
GSE45443	sgrS_un_2
GSE45443	sgrS_un_3
GSE45443	strain: K-12
GSE45443	Supplementary_files_format_and_content: Tab delimited text files containing transcription coordinates and abundance estimates.
GSE45443	Total RNA from bacterial culture
GSE45443	WT_1
GSE45443	WT_2
GSE45443	WT_3
GSE45443	WT_minus_2DG_1
GSE45443	WT_minus_2DG_2
GSE45443	WT_minus_2DG_3
GSE45443	WT_plus_2DG_1
GSE45443	WT_plus_2DG_2
GSE45443	WT_plus_2DG_3
GSE45443	wt_T_1
GSE45443	wt_T_2
GSE45443	wt_T_3
GSE45443	wt_un_1
GSE45443	wt_un_2
GSE45443	wt_un_3
GSE4569	Chemostat 1 h irradiated
GSE4569	Chemostat 1h irradiated
GSE4569	Chemostat 50 h irradiated
GSE4569	Control chemostat 1 h not irradiated
GSE4569	Control chemostat 1h not irradiated
GSE4569	Control chemostat 50 h not irradiated
GSE4569	E. coli K12 MG1655
GSE4569	Escherichia coli
GSE4569	Jaguar
GSE4569	UVA irradiated chemostat for 1 h, run 1
GSE4569	UVA irradiated chemostat for 1 h, run 2
GSE4569	UVA irradiated chemostat for 1 h, run 2 dye swap
GSE4569	UVA irradiated chemostat for 1 h, run 3
GSE4569	UVA irradiated chemostat for 50 h, run 1
GSE4569	UVA irradiated chemostat for 50 h, run 2
GSE4569	UVA irradiated chemostat for 50 h, run 3
GSE45979	e.coli culture protocol: conditioned Caco-2 cell medium
GSE45979	e.coli culture protocol: fresh medium
GSE45979	Escherichia coli
GSE45979	STEC EC472
GSE45979	STEC EC472 after 3 hrs incubation in conditioned medium, replicate 1 [COND]
GSE45979	STEC EC472 after 3 hrs incubation in conditioned medium, replicate 2 [COND]
GSE45979	STEC EC472 after 3 hrs incubation in conditioned medium, replicate 3 [COND]
GSE45979	STEC EC472 after 3 hrs incubation in conditioned medium, replicate 4 [COND]
GSE45979	STEC EC472 after 3 hrs incubation in fresh medium, replicate 1 [FRESH]
GSE45979	STEC EC472 after 3 hrs incubation in fresh medium, replicate 2 [FRESH]
GSE45979	STEC EC472 after 3 hrs incubation in fresh medium, replicate 3 [FRESH]
GSE45979	STEC EC472 after 3 hrs incubation in fresh medium, replicate 4 [FRESH]
GSE45979	STEC EH41 after 3 hrs incubation in conditioned medium, replicate 1 [COND]
GSE45979	STEC EH41 after 3 hrs incubation in conditioned medium, replicate 2 [COND]
GSE45979	STEC EH41 after 3 hrs incubation in conditioned medium, replicate 3 [COND]
GSE45979	STEC EH41 after 3 hrs incubation in conditioned medium, replicate 4 [COND]
GSE45979	STEC EH41 after 3 hrs incubation in fresh medium, replicate 1 [FRESH]
GSE45979	STEC EH41 after 3 hrs incubation in fresh medium, replicate 2 [FRESH]
GSE45979	STEC EH41 after 3 hrs incubation in fresh medium, replicate 3 [FRESH]
GSE45979	STEC EH41 after 3 hrs incubation in fresh medium, replicate 4 [FRESH]
GSE45979	STEC EH41, conditioned medium
GSE45979	STEC EH41, fresh medium
GSE45979	STEC strains were lysate using lysozyme (1 mg
GSE45979	strain: EC472
GSE45979	strain: EH41 (isolated from patient with HUS)
GSE45979	The conditioned medium (C) was the DMEM medium containing 10% FBS without antibiotics recovered after 24 hrs incubation with differentiated Caco-2 cells. 400 µL of STEC culture were inoculated in 4 mL of C medium and incubated for 3 hrs at 37°C. After this period the bacteria were recovered by centrifugation for 10 min at 5000 xg and the pellet was ressuspended in 600 µL of RNAprotect Bacteria Reagent (Qiagen cat. no. 76506, Valencia, CA) for RNA extraction.
GSE45979	The fresh medium (F) was the DMEM medium containing 10% FBS without antibiotics. 400 µL of STEC culture were inoculated in 4 mL of F medium and incubated for 3 hrs at 37°C. After this period the bacteria were recovered by centrifugation for 10 min at 5000 xg and the pellet was ressuspended in 600 µL of RNAprotect Bacteria Reagent (Qiagen cat. no. 76506, Valencia, CA) for RNA extraction.
GSE45979	The scanned images were analyzed with Feature Extraction Software version 9.5.3.1 (Agilent) using default parameters (protocol GE1-v5_95 and Grid: 020097_D_F_20080627) to obtain background subtracted and spatially detrended Processed Signal intensities but not included the normalization process.  Features flagged in Feature Extraction as Feature Non-uniform outliers were excluded.
GSE46413	antibody: polycolonal antiserum was raised against His6-ArcA then Affinity Purified against ArcA to yield the polyclonal antibodies used for ChIP
GSE46413	ArcA - Aerobic - Affinity Purified - A
GSE46413	ArcA - Anaerobic - Affinity Purified - biological rep A
GSE46413	ArcA - Anaerobic - Affinity Purified -biological rep B
GSE46413	∆ArcA - Anaerobic - Affinity Purified - technical rep A
GSE46413	∆ArcA - Anaerobic - Affinity Purified - technical rep B
GSE46413	ArcA INPUT DNA from WT Escherchia coli MG1655 K-12, no antibody control
GSE46413	ArcA INPUT from WT Escherichia coli MG1655 K-12
GSE46413	∆arcA IP DNA from PK9416
GSE46413	ArcA IP DNA from WT Escherichia coli MG1655 K-12
GSE46413	ArcA IP from WT Escherichia coli MG1655 K-12
GSE46413	Arrays were processed using Nimblegen's standard protocol for Nimblescan 2.4 ChIP data extraction.
GSE46413	Cell pellets (from initial 50 ml of culture) were thawed and resuspended in 250ul of IP buffer (100 mM Tris pH 8, 300 mM NaCl, 2% TritonX-100) and sonicated using a microtip sonicator set at 10% output for 20 second intervals with periods of cooling in between. Cells were then treated for one hour at 4 °C with RNase A (2 ng
GSE46413	Cells were grown aerobically (25% O2, 70% N2 and 5% CO2) until mid-log phase (OD600 of 0.35) and treated with 1% final volumen formaldehyde for ten minutes. Sodium phosphate (1
GSE46413	Cells were grown anaerobically (95% N2 and 5% CO2) until mid-log phase (OD600 of 0.3) and treated with 1% final volumen formaldehyde for ten minutes. Sodium phosphate (1
GSE46413	Escherichia coli str. K-12 substr. MG1655
GSE46413	INPUT ChIP DNA from PK9416, no ArcA control
GSE46413	strain: MG1655 K-12 WT
GSE46413	strain: PK9416
GSE46414	10 ng of DNA were submitted to the University of Wisconsin-Madison DNA Sequencing Facility for ChIP-seq library preparation.  Samples were sheared to 200-500 nt during the IP process to facilitate library preparation.  All libraries were generated using reagents from the Illumina Paired End Sample Preparation Kit (Illumina) and the Illumina protocol “Preparing Samples for ChIP Sequencing of DNA” (Illumina part # 11257047 RevA) as per the manufacturer’s instructions, except products of the ligation reaction were purified by gel electrophoresis using 2% SizeSelect agarose gels (Invitrogen) targeting 400 bp fragments.  After library construction and amplification, quality and quantity were assessed using an Agilent DNA 1000 series chip assay (Agilent) and QuantIT PicoGreen dsDNA Kit (Invitrogen), respectively, and libraries were standardized to 10μM.  Cluster generation was performed using a cBot Single Read Cluster Generation Kit (v4) and placed on the Illumina cBot.  Single read, 75 bp (rep A) or 36 bp (rep B) runs were performed, using standard SBS kits (v4) and SCS 2.6 on an Illumina Genome Analyzer IIx.   Basecalling was performed using the standard Illumina Pipeline version 1.6.
GSE46414	Anaerobic Cultures
GSE46414	antibody: polyclonal antiserum was raised against His6-ArcA then Affinity Purified using purified ArcA to yield the polyclonal antibodies used for ChIP
GSE46414	ArcA_anaerobic_ChIP-seq_IP_A.wig: U00096.2
GSE46414	ArcA_anaerobic_ChIP-seq_IP_B.wig: U00096.2
GSE46414	ArcA IP ChIP-seq Anaerobic Biological replicate 1
GSE46414	ArcA IP ChIP-seq Anaerobic Biological replicate 2
GSE46414	Cell pellets (from initial 50 ml of culture) were thawed and resuspended in 250ul of IP buffer (100 mM Tris pH 8, 300 mM NaCl, 2% TritonX-100) and sonicated using a microtip sonicator set at 10% output for 20 second intervals with periods of cooling in between. Cells were then treated for one hour at 4 °C with RNase A (2 ng
GSE46414	Cells were grown anaerobically (95% N2 and 5% CO2) until mid-log phase (OD600 of 0.3) and treated with 1% final volumen formaldehyde for ten minutes. Sodium phosphate (1
GSE46414	ChIP-Seq
GSE46414	culture condition: Anaerobic Cultures
GSE46414	Escherichia coli str. K-12 substr. MG1655
GSE46414	Genome Build:
GSE46414	genome build: U00096.2
GSE46414	Sequence reads were aligned to the published E. coli K-12 MG1655 genome (U00096.2) using the software packages SOAP (Li et al, 2009) and ELAND (within the Illumina Genome Analyzer Pipeline Software), allowing at most two mismatches.  Sequence reads with sequences that did not align to the genome, aligned to multiple locations on the genome, or contained more than two mismatches were discarded from further analysis (<10% of reads) (Supplemental Files).  For visualization the raw tag density at each position was calculated using QuEST (Valouev et al, 2008) and normalized as tag density per million uniquely mapped reads.
GSE46414	strain: Wild Type K-12
GSE46455	BL21(DE3)_adhE mutant
GSE46455	BL21(DE3), adhE mutant
GSE46455	B strain_wild type
GSE46455	B strain, wild type
GSE46455	BW25113_adhE mutant
GSE46455	BW25113, adhE mutant
GSE46455	Data quantification was performed using Agilent Feature Extraction software 9.3.2.1 (Agilent Technology, USA). The average fluorescence intensity for each spot was calculated and local background was subtracted. All data normalization and selection of fold-changed genes were performed using GeneSpringGX 7.3.1 (Agilent Technology, USA). Normalization for Agilent one-color method was performed, which is Data transformation. Set measurements less than 5.0 to 5.0 and Per Chip : Normalize to 50th percentage. Reliable genes were filtered by flag as following the Agilent manual.
GSE46455	Escherichia coli BL21(DE3)
GSE46455	Escherichia coli BW25113
GSE46455	For control and test RNAs, the synthesis of target cRNA probes and hybridization were performed using Agilent’s Low Input Quick Amp WT Labeling Kit, one color (Agilent Technology, USA) according to the manufacturer’s instructions. Briefly, each 0.2ug total RNA was mixed with WT primer mix and incubated at 65ºC for 10min. cDNA master mix (5X First strand buffer, 0.1M DTT, 10mM dNTP mix, RNase-Out, and MMLV-RT) was prepared and added to the reaction mixer. The samples were incubated at 40ºC for 2 hours and then the RT and dsDNA synthesis was terminated by incubating at 70ºC for 15min.
GSE46455	genotype
GSE46455	K-12 strain_wild type
GSE46455	K-12 strain, wild type
GSE46455	strain background: B
GSE46455	strain background: K-12
GSE46455	The E. coli strains were grown for six hours under anaerobic growth condition in glucose-containing complex medium.
GSE46455	The microarray experiment was performed with two serotypes of wild type E. coli and their adhE mutants: (1) K-12 strain, wild type; (2) B strain, wild type; (3) BW25113, adhE mutants; (4) BL21(DE3), adhE mutants.
GSE46479	A single large fastq  format file of high quality reads (Q ≥ 30) was split into about 10 smaller files by using a shell script splitReads.sh
GSE46479	CASAVA version 1.4
GSE46479	Cells were cultured in LB medium containing ampicillin at 28˚C. The overnight cell culture was inoculated into the fresh  medium at 1
GSE46479	Each type of error rates per position was determined as  the number of sequence reads with a particular type of base-substitution  divided by the number of the reads with the reference base in each DNA  position.
GSE46479	E.coli strain MG1655
GSE46479	error-prone in vitro (Mn2+)
GSE46479	error-prone in vitro MnCl2
GSE46479	error-proof in vitro 1 (GreAB
GSE46479	error-proof in vitro 2 (GreAB
GSE46479	error-proof in vitro MgCl2 +GreAB
GSE46479	error-proof in vitro MnCl2 +GreAB
GSE46479	Escherichia coli
GSE46479	Genome_build: pPR9 plasmid (ref is Kashlec et al., 1989, PMID: 2547695)
GSE46479	In vitro RNA preparation: The 5.7 kb RNA was purified from the digested DNA, NTPs, abortive oligo-RNA products, and proteins by Acidic phenol extraction, G50 spin column, followed by EtOH precipitation.
GSE46479	in vivo
GSE46479	In vivo RNA preparation: The cells in 200 ml culture were harvested and resuspended with a solution containing 0.5% SDS, 20 mM sodium acetate (pH 5.5), and 10 mM EDTA. The suspended cells were mixed with an equal volume of pre-warmed saturated phenol (20 mM sodium acetate, 10 mM EDTA pH 5.5) and incubated for 5 min at 60  C. The mixture was centrifuged, and RNA and DNA were precipitated with ethanol from the supernatant. The pellet was dissolved in DNase I buffer with 10U of DNaseI and incubated for 30 min. RNA was separated from the digested DNA by acidic phenol extraction followed by G-50 Micro column (GE Healthcare) purification, and then precipitated with ethanol. The pellet was dissolved in diethylpyrocarbonate-treated water and used for cDNA synthesis.
GSE46479	mRNA-seq with barcode (Illumina  TruSeq Index 1-5)
GSE46479	mrna synthesis: in vitro MgCl2
GSE46479	mrna synthesis: in vitro MgCl2 +GreAB
GSE46479	mrna synthesis: in vitro MnCl2
GSE46479	mrna synthesis: in vitro MnCl2 +GreAB
GSE46479	mrna synthesis: in vivo
GSE46479	RNA-Seq
GSE46479	standard in vitro (Mg2+)
GSE46479	standard in vitro MgCl2
GSE46479	strain: MG1655
GSE46479	Supplementary_files_format_and_content: tab-delimited text file of transition error rate per position. The position is corresponding to the position of \Sequenced region of pPR9 plasmid\ (one of the attached txt file).
GSE46479	The cells culture were harvested and resuspended with a  solution containing 0.5% SDS, 20 mM sodium acetate (pH 5.5), and 10 mM  EDTA. The suspended cells were mixed with an equal volume of pre-warmed  saturated phenol (20 mM sodium acetate, 10 mM EDTA pH 5.5) and incubated  for 5 min at 60˚C.
GSE46479	The numbers of 4 bases A, T, G, C, and N were counted in each position of the mapped reads by using the program  SAMtools 0.1.18 with supplemental use of a Perl script.
GSE46479	The obtained reads were aligned  and mapped to the pPR9 plasmid DNA sequences using   Bowtie 0.12.7.
GSE46479	We established a method for preparing five different cDNA  libraries each with its own barcode for Illumina sequencing. Each 6-nt barcode allows multiplexing all five in vitro and  in vivo preparations in a single sequencing analysis. our method introduces internal control sequences to the library  that are subjected to the artifact errors, but are not for RNAP  errors. The 5’ fragment of the 5.7 kb RNA  transcripts was reverse transcribed to make the cDNA.  The cDNA was subjected to PCR reactions that generated  six  200 bp segments. The primers contained a specific barcode  for each of the five starting preparations and the inner Illuminasequencing  adapters. The 2nd-step of PCR generated  the final cDNA libraries for the Illumina sequencing by using  the 1st-step PCR product as a template and primers containing  the outer sequencing adapters in the 5’ tails.
GSE46507	At the appropriate phase of growth, a one-eighth volume of stop solution (95% [v
GSE46507	E. coli batch culture without TAP
GSE46507	E. coli batch culture with TAP
GSE46507	E. coli - TAP
GSE46507	E. coli + TAP
GSE46507	Escherichia coli BW25113
GSE46507	Escherichia coli K12 strain BW25113 (Datsenko & Wanner 2000. PNAS 97: 6640) was cultivated in 100 mL of LB broth ( Miller 1972. In: Experiments in molecular genetics. Cold Spring Harbor Laboratory, NY) in a 250 mL Erlenmeyer flask at 37°C with shaking (250 rpm) to an O.D.600nm of 0.6. S. coelicolor A3(2) strain M145 (Kieser et al. 2000. Practical Streptomyces Genetics. The John Innes Foundation, Norwich.) was incubated in YEME broth (Kieser et al. 2000) at 30°C with shaking until the mycelia became pigmented.
GSE46507	For each of the 4 libraries (2 bacterial samples x 2 treatments), we counted the number of times each nucleotide position was the first in a sequence read using a simple script (unpubl. resource). The forward and reverse strands were then processed separately.
GSE46507	Genome_build: The reference genomes used for E. coli K12 strain BW25113 and S. coelicolor A3(2) strain M145 were U00096.2 and AL645882, respectively.
GSE46507	genotype: wild-type
GSE46507	Libraries were constructed by vertis Biotechnologie AG, Germany (www.vertis-biotech.com) as a service that included treating an aliquot of each RNA sample with TAP. The 5'-sequencing adaptor was ligated to transcripts prior to fragmentation, thereby allowing the 5' ends of both long and short transcripts to be detected. Each of the 4 libraries was constructed using a different barcode.
GSE46507	RNA-Seq
GSE46507	RNA sequences from each of the two differential analyses were processed and mapped to the corresponding genomes as a service provided by vertis Biotechnologie AG, Germany (www.vertis-biotech.com). This involved trimming adaptor sequence and masking for low-quality sequence.
GSE46507	RNA was isolated from the pellet of E. coli cells using a well-established, published protocol (Kime et al. 2008. In RNA Turnover in Bacteria, Archaea and Organelles, Vol 447 (ed. LE Maquat, CM Arraiano), pp. 215). The cell pellet of S. coelicolor was resuspended in Kirby mix (Kieser et al. 2000. Practical Streptomyces Genetics. The John Innes Foundation, Norwich.), 100 µL per 1 O.D.600nm unit, and transferred to Lysing Matrix B tubes containing fine silica beads (MP Biomedical). Tubes were then placed in a high-speed benchtop homogenizer (Fastprep-24, MP Biomedical; set at 6.5 M
GSE46507	strain: BW25113
GSE46507	Supplementary_files_format_and_content: BedGraphs of the reads before and after TAP treatment for each of the samples. Separate files are provided for the forward and reverse strands.
GSE46507	The sample sources of individual reads were determined by the barcoding. The barcodes for the minus and plus TAP treatments were ACTTGA and CGATGT, respectively, for the E. coli RNA, and CAGATC and ATCACG, respectively, for the S. coelicolor RNA.
GSE46507	treatment: none
GSE46507	treatment: tobacco acid pyrophosphatase (TAP)
GSE46541	Cells at appropriate cell density were cross-linked by 1% formaldehyde at room temperature for 25 min. Following quenching the unused formaldehyde with a final concentration of 125 mM glycine at room temperature for 5 min. The cross-linked cells were harvested and washed three times with 50 mL of ice-cold TBS (Tris Buffered Saline). The washed cells were re-suspended in 0.5 mL lysis buffer composed of 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM EDTA, 1 ug
GSE46541	chip antibody: anti-c-myc antibody
GSE46541	chip antibody: anti-FecI antibody
GSE46541	chip antibody: anti-RpoB antibody
GSE46541	chip antibody: anti-RpoD antibody
GSE46541	chip antibody: anti-RpoF antibody
GSE46541	chip antibody: anti-RpoN antibody
GSE46541	chip antibody: anti-RpoS antibody
GSE46541	chip antibody manufacturer: Upstate
GSE46541	chip antibody: normal mouse IgG (Upstate)
GSE46541	Cross-linked and sonicated chromatin complex of RNAP and DNA was immunoprecipitated by anti-RpoB antibody.
GSE46541	Cross-linked and sonicated chromatin complex of RNAP and DNA was immunoprecipitated by using normal mouse IgG for the control.
GSE46541	E. Coli Exponential FecI ChIP DNA 1
GSE46541	E. Coli Exponential FecI ChIP DNA 2
GSE46541	E. Coli Exponential FecI ChIP DNA 3
GSE46541	E. Coli Exponential FecI ChIP DNA Mock 1
GSE46541	E. Coli Exponential FecI ChIP DNA Mock 2
GSE46541	E. Coli Exponential FecI ChIP DNA Mock 3
GSE46541	E. Coli Exponential RpoB ChIP DNA 1
GSE46541	E. Coli Exponential RpoB ChIP DNA 2
GSE46541	E. Coli Exponential RpoB ChIP DNA 3
GSE46541	E. Coli Exponential RpoB ChIP DNA Mock 1
GSE46541	E. Coli Exponential RpoB ChIP DNA Mock 2
GSE46541	E. Coli Exponential RpoB ChIP DNA Mock 3
GSE46541	E. Coli Exponential RpoD ChIP DNA 1
GSE46541	E. Coli Exponential RpoD ChIP DNA 2
GSE46541	E. Coli Exponential RpoD ChIP DNA 3
GSE46541	E. Coli Exponential RpoD ChIP DNA Mock 1
GSE46541	E. Coli Exponential RpoD ChIP DNA Mock 2
GSE46541	E. Coli Exponential RpoD ChIP DNA Mock 3
GSE46541	E. Coli Exponential RpoD DelN ChIP DNA 1
GSE46541	E. Coli Exponential RpoD DelN ChIP DNA 2
GSE46541	E. Coli Exponential RpoD DelN ChIP DNA Mock 1
GSE46541	E. Coli Exponential RpoD DelN ChIP DNA Mock 2
GSE46541	E. Coli Exponential RpoF ChIP DNA 1
GSE46541	E. Coli Exponential RpoF ChIP DNA 2
GSE46541	E. Coli Exponential RpoF ChIP DNA 3
GSE46541	E. Coli Exponential RpoF ChIP DNA Mock 1
GSE46541	E. Coli Exponential RpoF ChIP DNA Mock 2
GSE46541	E. Coli Exponential RpoF ChIP DNA Mock 3
GSE46541	E. Coli Exponential RpoH ChIP DNA 1
GSE46541	E. Coli Exponential RpoH ChIP DNA 2
GSE46541	E. Coli Exponential RpoH ChIP DNA Mock 1
GSE46541	E. Coli Exponential RpoH ChIP DNA Mock 2
GSE46541	E. Coli Exponential RpoN ChIP DNA 1
GSE46541	E. Coli Exponential RpoN ChIP DNA 2
GSE46541	E. Coli Exponential RpoN ChIP DNA 3
GSE46541	E. Coli Exponential RpoN ChIP DNA Mock 1
GSE46541	E. Coli Exponential RpoN ChIP DNA Mock 2
GSE46541	E. Coli Exponential RpoN ChIP DNA Mock 3
GSE46541	E. Coli Exponential RpoS ChIP DNA 1
GSE46541	E. Coli Exponential RpoS ChIP DNA 2
GSE46541	E. Coli Exponential RpoS ChIP DNA Mock 1
GSE46541	E. Coli Exponential RpoS ChIP DNA Mock 2
GSE46541	E. Coli Glutamine RpoB ChIP DNA 1
GSE46541	E. Coli Glutamine RpoB ChIP DNA 2
GSE46541	E. Coli Glutamine RpoB ChIP DNA Mock 1
GSE46541	E. Coli Glutamine RpoB ChIP DNA Mock 2
GSE46541	E. Coli Glutamine RpoD ChIP DNA 1
GSE46541	E. Coli Glutamine RpoD ChIP DNA 2
GSE46541	E. Coli Glutamine RpoD ChIP DNA Mock 1
GSE46541	E. Coli Glutamine RpoD ChIP DNA Mock 2
GSE46541	E. Coli Glutamine RpoN ChIP DNA 1
GSE46541	E. Coli Glutamine RpoN ChIP DNA 2
GSE46541	E. Coli Glutamine RpoN ChIP DNA Mock 1
GSE46541	E. Coli Glutamine RpoN ChIP DNA Mock 2
GSE46541	E. Coli Heatshock RpoB ChIP DNA 1
GSE46541	E. Coli Heatshock RpoB ChIP DNA 2
GSE46541	E. Coli Heatshock RpoB ChIP DNA Mock 1
GSE46541	E. Coli Heatshock RpoB ChIP DNA Mock 2
GSE46541	E. Coli Heatshock RpoD ChIP DNA 1
GSE46541	E. Coli Heatshock RpoD ChIP DNA 2
GSE46541	E. Coli Heatshock RpoD ChIP DNA Mock 1
GSE46541	E. Coli Heatshock RpoD ChIP DNA Mock 2
GSE46541	E. Coli Heatshock RpoH ChIP DNA 1
GSE46541	E. Coli Heatshock RpoH ChIP DNA 2
GSE46541	E. Coli Heatshock RpoH ChIP DNA 3
GSE46541	E. Coli Heatshock RpoH ChIP DNA Mock 1
GSE46541	E. Coli Heatshock RpoH ChIP DNA Mock 2
GSE46541	E. Coli Heatshock RpoH ChIP DNA Mock 3
GSE46541	E. Coli Iron RpoD ChIP DNA 1
GSE46541	E. Coli Iron RpoD ChIP DNA 2
GSE46541	E. Coli Iron RpoD ChIP DNA Mock 1
GSE46541	E. Coli Iron RpoD ChIP DNA Mock 2
GSE46541	E. Coli Stationary RpoB ChIP DNA 1
GSE46541	E. Coli Stationary RpoB ChIP DNA 2
GSE46541	E. Coli Stationary RpoB ChIP DNA Mock 1
GSE46541	E. Coli Stationary RpoB ChIP DNA Mock 2
GSE46541	E. Coli Stationary RpoD ChIP DNA 1
GSE46541	E. Coli Stationary RpoD ChIP DNA 2
GSE46541	E. Coli Stationary RpoD ChIP DNA Mock 1
GSE46541	E. Coli Stationary RpoD ChIP DNA Mock 2
GSE46541	E. Coli Stationary RpoD DelS ChIP DNA 1
GSE46541	E. Coli Stationary RpoD DelS ChIP DNA 2
GSE46541	E. Coli Stationary RpoD DelS ChIP DNA Mock 1
GSE46541	E. Coli Stationary RpoD DelS ChIP DNA Mock 2
GSE46541	E. Coli Stationary RpoS ChIP DNA 1
GSE46541	E. Coli Stationary RpoS ChIP DNA 2
GSE46541	E. Coli Stationary RpoS ChIP DNA 3
GSE46541	E. Coli Stationary RpoS ChIP DNA Mock 1
GSE46541	E. Coli Stationary RpoS ChIP DNA Mock 2
GSE46541	E. Coli Stationary RpoS ChIP DNA Mock 3
GSE46541	E. coli strains  were grown in minimal M9 medium supplemented with glucose (2 g
GSE46541	E. coli strains  were grown in minimal W2 medium supplemented with glucose (2 g
GSE46541	Escherichia coli str. K-12 substr. MG1655
GSE46541	genotype: rpoH-8myc
GSE46541	genotype: wild type
GSE46541	genotype: ΔrpoN
GSE46541	genotype: ΔrpoS
GSE46541	The raw pair data (.txt file) was subjected to per channel quantile normalization (Bolstad et al. Bioinformatics 19(2):185), IP
GSE46737	Among potential TSSs, only TSSs with the strongest signal within 10 bp window were kept to remove possible noise signals, and TSSs with greater than or equal to 40% of the strongest signal upstream of an annotated gene were considered as multiple TSSs.
GSE46737	Cells at mid-log phase (OD600nm 0.5) in M9 glucose (0.2%) media, with 42oC heatshock for 10 min.
GSE46737	Cells at mid-log phase (OD600nm 0.5) in W2 media supplemented with 0.2% glucose and 0.2% glutamine
GSE46737	Cells at stationary phase (OD600nm 1.5) in M9 glucose media
GSE46737	E. coli glutamine 1
GSE46737	E. coli glutamine 2
GSE46737	E. coli heatshock 1
GSE46737	E. coli heatshock 2
GSE46737	E. coli K12 MG1655 was grown to mid-log phase (O.D.600nm 0.5) or to stationary phase (O.D.600nm 1.5) aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose or W2 minimal media supplemented with 0.2% glucose and 0.2% glutamine. For heatshock conditions, cells were grown to mid-log phase and incubated at 42oC for 10 min.
GSE46737	E. coli stationary 1
GSE46737	E. coli stationary 2
GSE46737	Escherichia coli str. K-12 substr. MG1655
GSE46737	Genome_build: NC_000913
GSE46737	RNA-Seq
GSE46737	Sequence reads for cDNA libraries were aligned onto E. coli K12 MG1655 genome, using Mosaik with following arguments: hash size=10, mismatch=0. Only reads that aligned to the unique genomic location were retained.
GSE46737	strain: MG1655
GSE46737	Supplementary_files_format_and_content: counts
GSE46737	The amplified cDNA libraries from two biological replicates for each E. coli were sequenced on an Illumina Genome Analyzer. Sequence reads for cDNA libraries were aligned onto E. coli K12 MG1655 genome, using Mosaik with following arguments: hash size=10, mismatch=0. Only reads that aligned to the unique genomic location were retained. Two biological replicates were processed seperatedly, and only sequence reads presented in both biological replciates were considered for further process. The genomic coordinates of the 5'-end of these uniquely aligned reads were defined as potential TSSs. Among potential TSSs, only TSSs with the strongest signal within 10 bp window were kept to remove possible noise signals, and TSSs with greater than or equal to 40% of the strongest signal upstream of an annotated gene were considered as multiple TSSs.
GSE46737	The cell culture was treated with the RNAprotect reagent (Qiagen).
GSE46737	Total mRNA isolated from each cell culture was treated with Terminator 5' Phosphate Dependent Exonuclease (Epicentre) to enrich 5' tri-phosphorylated mRNAs. Intact tri-phosphorylated RNAs were then treated with RNA 5'-Polyphosphatase (Epicentre) to generate 5'-end monophosphorylated RNA for ligation to RNA adaptors. cDNAs were synthesized using the adaptor-ligated mRNAs as template using a modified small RNA RT primer from Illumina and Superscript II Reverse Transcriptase (Invitrogen). The cDNA samples were amplified, and size fractionated from 100 to 300 bp.
GSE46737	treatment: glutamine
GSE46737	treatment: heat shock
GSE46737	treatment: stationary phase
GSE46737	Two biological replicates were processed seperatedly, and only sequence reads presented in both biological replciates were considered for further process. The genomic coordinates of the 5'-end of these uniquely aligned reads were defined as potential TSSs.
GSE4690	35381_1
GSE4690	35382_2
GSE4690	DNA were extracted and purified as described by Muniesa et al. (2003). Shiga toxin 2-converting bacteriophages associated with clonal variability in Escherichia coli O157:H7 strains of human origin isolated from a single outbreak. Infect Immun 71, 4554-4562.
GSE4690	E. coli 3538 #1
GSE4690	E. coli 3538 #2
GSE4690	ecoli_3538_2x_v2
GSE4690	E. coli 3538 #3
GSE4690	ecoli_3538_3x_v2
GSE4690	ecoli_3538_4x_v2
GSE4690	E. coli D1 #1
GSE4690	E. coli D1 #2
GSE4690	ecoli_D1_2x_v2
GSE4690	E. coli D1 #3
GSE4690	ecoli_D1_3x_v2
GSE4690	ecoli_D1_4x_v2
GSE4690	E. coli EDL933 #1 
GSE4690	E. coli EDL933 #2
GSE4690	ecoli_EDL933_2x_v2
GSE4690	E. coli EDL933 #3
GSE4690	ecoli_EDL933_3x_v2
GSE4690	ecoli_EDL933_4x_v2
GSE4690	E. coli K-12 W3110 #1
GSE4690	E. coli K-12 W3110 #2
GSE4690	E. coli K-12 W3110 #3
GSE4690	E. coli phage 3538 #1
GSE4690	E. coli phage 3538 #2
GSE4690	ecoli_W3110_2x_v2
GSE4690	ecoli_W3110_3x_v2
GSE4690	ecoli_W3110_4x_v2
GSE4690	Escherichia coli
GSE4690	Induced from E. coli strain 3538 with mitomycin C
GSE4690	Isolate W3110 of K-12 strain
GSE4690	overnight in Luria-Bertani (LB) broth with continuous agitation
GSE4690	phage DNA
GSE4690	Qiagen Genomic Tip 500
GSE4690	serotype O157:H7
GSE4690	serotype O157:H7 
GSE4690	serotype O175:H16
GSE4690	Standard Affymetrix procedure
GSE4706	40 hours 1
GSE4706	40 hours 2
GSE4706	40 hours 3
GSE4706	40 hours cultivation in continuous culture (mineral medium with 100 mg
GSE4706	40 hours of cultivation in continuous colture (mineral medium with 100 mg
GSE4706	500 hours 1
GSE4706	500 hours 2
GSE4706	500 hours 3
GSE4706	500 hours of cultivation in continuous colture (mineral medium with 100 mg
GSE4706	Batch growth in mineral medium supplied with 4 g
GSE4706	control
GSE4706	Control
GSE4706	Escherichia coli
GSE4706	Sample
GSE4706	The data provided are the original data generated with the Jaguar software from the microarray images. The VALUEs reported represent log10 (Cy5
GSE4724	Cells used for expression analysis were grown in minimal medium (Glansdorff, 1965) supplemented with 0.5% glucose (w
GSE4724	E.Coli, strain P4XB2 mutant, grown in presence of arginine(100 ug
GSE4724	E.Coli, strain P4X, grown in presence of arginine(100 ug
GSE4724	E.Coli, strain P4X, grown on minimal medium, reference sample
GSE4724	Escherichia coli
GSE4724	Initial data analysis was performed using the GeneChip® Operating Software. Microarray quality control parameters were as follow: noise (RawQ) less than 5, background signal less than 40 (100 target intensity for array scaling), consistent numbers of genes detected as present across arrays.
GSE4724	P4XB2 Mutant (1992) in Arginine
GSE4724	P4XB2 Mutant (1993) in Arginine
GSE4724	P4XB2 Mutant (1994) in Arginine
GSE4724	P4X Wild Type (1753) Reference
GSE4724	P4X Wild Type (1754) in Arginine
GSE4724	P4X Wild Type (1765) Reference
GSE4724	P4X Wild Type (1766) in Arginine
GSE4724	P4X Wild Type (1989) Reference
GSE4724	P4X Wild Type (1990) in Arginine
GSE4724	Strain P4X, grown on minimal medium, reference sample
GSE4724	Total RNA was isolated using a RNeasy® RNA isolation kit, according to the manufacturer’s specifications (QIAGEN, Germany) and stored in RNase-free water at –80°C. RNA concentration was determined by UV-spectrometry and its quality controlled by agarose gel electrophoresis.
GSE47427	BW25113-pCA24N
GSE47427	BW25113-pCA24N_dosP
GSE47427	Cells were lysed using a bead beater (Biospec) and mRNA was isolated using a Qiagen RNeasy mini kit (Cat# 74104).
GSE47427	Cells were pelleted in the presence of RNALater (Applied Biosystems) and flash frozen in ethanol-dry ice.
GSE47427	Data was analyzed in the Affymetrix GenomeChipOperating Software (GCOS).
GSE47427	Escherichia coli K-12
GSE47427	genotype
GSE47427	overexpression of dosP (pCA24N_dosP)
GSE47427	overexpression of empty vector (pCA24N)
GSE47427	strain: BW25113
GSE47427	Strains were grown in LBCm30 at 37°C with shaking at 250 rpm.  16 h overnight cultures were diluted at 1:1000 into fresh LBCm30, grown to OD600 ~ 1.0, and induced with 1 mM IPTG for 90 min.
GSE47589	1-butanol was added at a final concentration of 0.9% (vol
GSE47589	A0-A1_rep1_a
GSE47589	A0-A1_rep1_b
GSE47589	A0-A1_rep2_a
GSE47589	A0-A1_rep2_b
GSE47589	A0-A1_rep3_a
GSE47589	A0-A1_rep3_b
GSE47589	A0-E0_rep1_a
GSE47589	A0-E0_rep1_b
GSE47589	A0-E0_rep2_a
GSE47589	A0-E0_rep2_b
GSE47589	A0-E0_rep3_a
GSE47589	A0-E0_rep3_b
GSE47589	Background correction and normalization (print-tip loess and quantile) were performed using the limma R package.
GSE47589	Cells were grown aerobically in 50 ml LB medium until OD600 reached ~1 (late log phase).
GSE47589	E0-E1_rep1_a
GSE47589	E0-E1_rep1_b
GSE47589	E0-E1_rep2_a
GSE47589	E0-E1_rep2_b
GSE47589	E0-E1_rep3_a
GSE47589	E0-E1_rep3_b
GSE47589	Escherichia coli
GSE47589	mutant E. coli, after butanol treatment
GSE47589	mutant E. coli, before butanol treatment
GSE47589	protocol: late log phase, LB
GSE47589	protocol: late log phase, LB, 30 min after butanol treatment
GSE47589	Qiagen Rneasy column
GSE47589	strain: KCTC 2571
GSE47589	strain: PKH5000
GSE47589	wt E. coli, after butanol treatment
GSE47589	wt E. coli, before butanol treatment
GSE48015	Algorithm: ExpressionStat 5.0 (Affymetrix Microarray Suite Version 5.0)
GSE48015	APEC strain O08
GSE48015	APEC strain SCI-07
GSE48015	Escherichia coli O08
GSE48015	Escherichia coli SCI-07
GSE48015	growth media: DMEM growth media
GSE48015	RNA was extracted using RNAeasy mini-Kit Qiagen and hybridizated on Affymatrix microarrays.
GSE48015	strain: APEC SCI-07 (O nontypeable:H31) isolated from lesions (gelatinous edema) on the skin of the head and periorbital tissues from a laying hen showing clinical signs of swollen head syndrome
GSE48015	strain: O08 (O38:H10) obtained from the yolk of the abdomen of a diseased 1-day-old chick
GSE48015	Two Avian Pathogenic Escherichia coli strains (APEC) were grown at 37°C in Dulbecco´s Modified Eagle´s Media (DMEM) media until reach O.D 600 = 0.8.
GSE48151	culture
GSE48151	E. coli cells_HS15min
GSE48151	E. coli cells_HS30min
GSE48151	E. coli cells_HS60min
GSE48151	E. coli cells_LB(OD=0.87)
GSE48151	E. coli cells_M-P0h
GSE48151	E. coli cells_M-P2h
GSE48151	E. coli cells_M-P4h
GSE48151	Escherichia coli
GSE48151	For the Illumina GAII platform, the directional RNA-seq libraries were constructed by following an Illumina’s instruction using their Small RNA Sample Prep Kit with some modifications. For the HiSeq 2000 platform, the directional RNA-seq libraries were constructed using Illumina’s TruSeq Small RNA Sample Prep Kit.
GSE48151	Genome_build: Escherichia coli K12 str MG1655
GSE48151	HS15min_r1_HiSeq
GSE48151	HS15min_r2_HiSeq
GSE48151	HS15min_r3_GAII
GSE48151	HS30min_r1_HiSeq
GSE48151	HS30min_r2_HiSeq
GSE48151	HS60min_r1_HiSeq
GSE48151	HS60min_r2_HiSeq
GSE48151	LB(OD=0.87)
GSE48151	Merge the replicates for each sample. For example, for sample HS15min, merge HS15min_r1.HiSeq.fastq.gz, HS15min_r2.HiSeq.fastq.gz and HS15min_r3.HiSeq.fastq.gz to one fastq file
GSE48151	M-P0h_r1_HiSeq
GSE48151	M-P0h_r2_HiSeq
GSE48151	M-P2h_r1_HiSeq
GSE48151	M-P2h_r2_HiSeq
GSE48151	M-P4h_r1_HiSeq
GSE48151	M-P4h_r2_HiSeq
GSE48151	M-P4h_r3_HiSeq
GSE48151	RNA-Seq
GSE48151	Sequenced reads were trimmed for adaptor sequence, then mapped to E. coli K12 genome using bowtie v0.12.7 with parameters bowtie -t -v 3 -m 1 --best -S -p 2
GSE48151	strain: K12
GSE48151	substrain: MG1655
GSE48151	Supplementary_files_format_and_content: BigWig files for whole-genome reads coverage (including number of mapped reads) for each sample. Each sample has two files, one for plus strand, and the other for minus strand. Therefore, there are 14 BigWig files for 7 samples.
GSE48151	To enrich mRNAs and other transcripts, majority of rRNAs were removed from the DNase-treated total RNA using a MICROBExpress kit (Ambion) following the manufacturer’s instructions.
GSE48151	Total RNA was isolated using a RiboPureTM -Bacteria Kit (Ambion) following the manufacturer’s instructions. Once isolated, ~10μg total RNA was treated with 8 units DNase (Invitrogen) twice to remove genomic DNA.
GSE48151	Transform the mapped file format from sam to sorted bam which are later tranfered to bigWig, and separated by the strand (plus and minus).
GSE48324	basal media: M9 + 4 g
GSE48324	cra KO
GSE48324	cra KO + L-trp
GSE48324	Differential expression analysis was carried out using cuffdiff v.2.0.2 with upper-quartile normalization and fr-firststrand for library type
GSE48324	E. coli cultures were grown at  37 °C in M9 minimal media with glucose as the primary carbon source and harvested at mid exponetial phase. Aerobic E. coli conditions were grown in shake flasks and anaerobic conditions were grown in anoxic serum bottles.  Condition specific media supplementation was added as described else where.
GSE48324	Escherichia coli K-12
GSE48324	FPKM were calculated using Cufflinks v.2.0.2 with upper-quartile normalization and fr-firststrand for library type
GSE48324	Genome_build: NC_000913
GSE48324	genotype
GSE48324	growth stage: mid exponetial phase
GSE48324	Illumina read were aligned to NC_000913 using Bowtie 1 with 2 mismatches allowed per read alignment
GSE48324	Mid log_cra KO_glc minimal media_aerobic
GSE48324	Mid log_cra KO_glc minimal media + L-tryptophan_aerobic
GSE48324	Mid log cultures were treated with Qiagen RNA Protect reagent following the vendor's protocol. Cells were centrifuged and stored at -80 °C for <30 days prior to use.
GSE48324	Mid log_mntR KO_glc minimal media_aerobic
GSE48324	Mid log_mntR KO_glc minimal media_anaerobic
GSE48324	Mid log_nac KO_glc minimal media + adenine_aerobic
GSE48324	Mid log_nac KO_glc minimal media_aerobic
GSE48324	Mid log_wildtype_glc minimal media + adenine_aerobic
GSE48324	Mid log_wildtype_glc minimal media_aerobic rep1
GSE48324	Mid log_wildtype_glc minimal media_aerobic rep2
GSE48324	Mid log_wildtype_glc minimal media_aerobic rep3
GSE48324	Mid log_wildtype_glc minimal media_anaerobic rep1
GSE48324	Mid log_wildtype_glc minimal media_anaerobic rep2
GSE48324	Mid log_wildtype_glc minimal media_anaerobic rep3
GSE48324	Mid log_wildtype_glc minimal media + L-tryptophan_aerobic
GSE48324	mntR KO
GSE48324	mntR KO -O2
GSE48324	nac KO
GSE48324	nac KO + ade
GSE48324	oxygen condition: aerobic
GSE48324	oxygen condition: anaerobic
GSE48324	Paired-end, strand-specific RNAseq libraries were generated using the dUTP method {Levin JZ et al. 2010, Nat Methods} with the following modifications. rRNA was removed with Epicentre’s Ribo-Zero rRNA Removal Kit. Subtracted RNA was fragmented for 3 min using Ambion’s RNA Fragmentation Reagents. cDNA was generated using Invitrogen’s SuperScript III First-Strand Synthesis protocol with random hexamer priming.
GSE48324	RNA-Seq
GSE48324	strain: K-12
GSE48324	Supplementary_files_format_and_content: csv files, FPKM values from pairwise comparisons
GSE48324	supplementation: adenine (10 mM)
GSE48324	supplementation: L-tryptophan (20 mg
GSE48324	supplementation: None
GSE48324	Total RNA was isolated using the Rneasy Mini Kit procedure with on column Dnase treatment (Qiagen).
GSE48324	WT + ade
GSE48324	WT + L-trp
GSE48324	WT -O2
GSE48829	23A1
GSE48829	23B1
GSE48829	23C3
GSE48829	39A1
GSE48829	39B1
GSE48829	39C1
GSE48829	DNA was extracted in the same manner as described by McNulty et al. (PMID: 22030749).
GSE48829	ecoli NC_000913.2
GSE48829	Escherichia coli str. K-12 substr. MG1655
GSE48829	Genome_build: ASM584v1
GSE48829	genotype
GSE48829	Illumina Casava software used for basecalling.
GSE48829	RNA libraries were prepared for sequencing using standard Illumina protocols
GSE48829	RNA-Seq
GSE48829	Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to Escherichia coli str. K-12 substr. MG1655, complete genome using bowtie2 version 2.0.5 with default parameters.
GSE48829	strain: K-12
GSE48829	Supplementary_files_format_and_content: tab-delimited text files include count values for each Sample.
GSE48829	WTA1
GSE48829	WTB1
GSE48829	WTC3
GSE49296	Cells were grown in the minimal media, M63. The final cell concentrations were controlled ~ 10^8 cells
GSE49296	condition: osmotic pressure
GSE49296	condition: regular
GSE49296	condition: starvation
GSE49296	condition: temperature change
GSE49296	E. coli MDS42, osmotic pressure NaCl 0.20 M
GSE49296	E. coli MDS42, osmotic pressure, NaCl 0.20 M
GSE49296	E. coli MDS42, osmotic pressure NaCl 0.20 M, rep 1
GSE49296	E. coli MDS42, osmotic pressure, NaCl 0.20 M, rep 2
GSE49296	E. coli MDS42, osmotic pressure, NaCl 0.20 M, rep 3
GSE49296	E. coli MDS42, osmotic pressure, NaCl 0.45 M
GSE49296	E. coli MDS42, osmotic pressure, NaCl 0.45 M, rep 1
GSE49296	E. coli MDS42, osmotic pressure, NaCl 0.45 M, rep 2
GSE49296	E. coli MDS42, osmotic pressure, NaCl 0.45 M, rep 3
GSE49296	E. coli MDS42, osmotic pressure, NaCl 0.55 M
GSE49296	E. coli MDS42, osmotic pressure, NaCl 0.55 M, rep 1
GSE49296	E. coli MDS42, osmotic pressure, NaCl 0.55 M, rep 2
GSE49296	E. coli MDS42, osmotic pressure, NaCl 0.55 M, rep 3
GSE49296	E. coli MDS42, regular
GSE49296	E. coli MDS42, regular, rep 1
GSE49296	E. coli MDS42, regular, rep 2
GSE49296	E. coli MDS42, regular, rep 3
GSE49296	E. coli MDS42, starvation, SHX 100 ng
GSE49296	E. coli MDS42, starvation, SHX 150 ng
GSE49296	E. coli MDS42, starvation, SHX 50 ng
GSE49296	E. coli MDS42, temperature change, 40.0 deg C
GSE49296	E. coli MDS42, temperature change, 40.0 deg C, rep 1
GSE49296	E. coli MDS42, temperature change, 40.0 deg C, rep 2
GSE49296	E. coli MDS42, temperature change, 40.0 deg C, rep 3
GSE49296	E. coli MDS42, temperature change, 41.5 deg C
GSE49296	E. coli MDS42, temperature change, 41.5 deg C, rep 1
GSE49296	E. coli MDS42, temperature change, 41.5 deg C, rep 2
GSE49296	E. coli MDS42, temperature change, 41.5 deg C, rep 3
GSE49296	E. coli MDS42, temperature change, 41.8 deg C
GSE49296	E. coli MDS42, temperature change, 41.8 deg C, rep 1
GSE49296	E. coli MDS42, temperature change, 41.8 deg C, rep 2
GSE49296	E. coli MDS42, temperature change, 41.8 deg C, rep 3
GSE49296	Escherichia coli
GSE49296	Microarray data were processed using custom scripts written in R based on the finite hybridisation (FH) model (Ono et al, 2008) and the thermodynamic model of non-specific binding (NSB) on short nucleotide microarrays (Furusawa et al, 2009).
GSE49296	strain: MDS42
GSE49296	The cell culture was put into cold phenol-ethanol solution (1 g of phenol in 10 mL of ethanol) prepared in advance. The cells were collected by centrifugation at 16,000 × g for 5 min at 4°C, and the pelleted cells were stored at –80°C prior to use.
GSE49296	Total RNAs were extracted using an RNeasy mini kit (Qiagen) in accordance with the manufacturer’s instructions.
GSE49474	Control Wild type E.coli SE15 vs. LuxS mutant E.coli SE15
GSE49474	E.coli SE15 is cultured in LB broth and LuxS E.coli SE15 is cultured in LB broth with kanamycine at 37℃and in 150rpm shaking incubator
GSE49474	E.coli SE15 is isolated from indwelling catheter of patient and deleted LuxS gene (related to quorum sensing)
GSE49474	E.coli SE15 isolated from indwelling catheter of patient
GSE49474	Escherichia coli SE15
GSE49474	genotype
GSE49474	Genowiz 4.0.5.6 normalized, background subtracted data obtained from log2 of processed Red signal
GSE49474	strain: SE15
GSE49474	Total RNA extracted using Trizol following manufacturer's instructions
GSE49474	Wild type E.coli SE15 vs. LuxS mutant E.coli SE15
GSE49914	Agilent Feature Extraction Software version 10.5.1.1.
GSE49914	chip antibody: Anti-FLAG (sigma-aldrich cat no F3165)
GSE49914	chip antibody: none, input
GSE49914	chip antibody: normal rabbit IgG (Upstate Biotechnology, Cat. no. 12-370)
GSE49914	CSH50 control E-minimal medium 90 min
GSE49914	CSH50 control (mock igG) E-minimal medium replicate 1
GSE49914	CSH50 control (mock igG) E-minimal medium replicate 2
GSE49914	CSH50 E-minimal medium pH 4.5 90 min
GSE49914	CSH50 E-minimal medium pH 4.5 90 min replicate 1
GSE49914	CSH50 E-minimal medium pH 4.5 90 min replicate 2
GSE49914	CSH50 E-minimal medium pH 4.5 90 min replicate 3
GSE49914	CSH50 E-minimal medium pH 7 90 min
GSE49914	CSH50 E-minimal medium pH 7 90 min replicate 1
GSE49914	CSH50 E-minimal medium pH 7 90 min replicate 2
GSE49914	CSH50 E-minimal medium pH 7 90 min replicate 3
GSE49914	Escherichia coli K-12
GSE49914	OD600 15 units of cells were harvested for each ChIP procedure. Cells were harvested by centrifugation at 4,000 rpm for 8 min at room temperature and resuspended in 50 ml of pre-warmed PBS (37°C) in a 250 ml flask. DNA-protein and protein-protein interactions were cross-linked by adding 1,351 µl of formaldehyde drop-wise to a final concentration of 1%. Samples were cross-linked at room temperature with stirring for 30 min. Glycine was added to a final concentration of 0.125 M with stirring for 5 min at room temperature. Cells were centrifuged at 4,000 rpm for 8 min at 4°C and the supernatant removed. The pellet was re-suspended in 0.6 ml of lysis buffer containing 50 mM Tris-HCl, 10 mM EDTA, 1% SDS and incubated on ice for 10 min. 1.4 ml of IP dilution buffer (20 mM Tris-HCl pH 8.1, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.01% SDS, Roche protease inhibitor cocktail) was added and the chromatin was sonicated on ice in a 5ml tube to reduce the DNA length to an average size of approximately 500 bp using the Sanyo
GSE49914	strain: CSH50
GSE49914	Strains were grown overnight in LB broth and then equalised to 0.15 optical density (OD600nm) units. Cells were collected and washed in EG minimal medium (pH 7.2). This wash step was repeated twice more with centrifugation to collect the cells. The final pellet was resuspended in 1 ml of 1X EG minimal (pH 7.2). Cells were grown to OD600 ~0.5-0.6 in a 40 ml volume in a 250 ml flask at 37°C and 200 rpm.
GSE49914	The culture was divided into two 20-ml volumes and the cells collected by centrifugation. The supernatant was removed and the two pellets were subjected to different treatments. One was resuspended in 1 ml of pre-warmed 1X EG-minimal medium pH 7.2. The second was resuspended in 1 ml of pre-warmed 1X EG-minimal medium pH 4.5. Each suspension was added to a final volume of 20 ml 1X EG minimal medium of the same pH in a 250 ml flask. Cells were grown at 37°C and 200 rpm shaking for 90 min before harvesting for analysis.
GSE50556	5 ml bacterial cultures with a known inoculum of E. coli cells (1.0 × 109 cfu
GSE50556	cells
GSE50556	E. coli treated with bicontinious microemulsion
GSE50556	E. coli treated with o
GSE50556	E. coli treated with w
GSE50556	E. coli without microemulsion treatment
GSE50556	Escherichia coli
GSE50556	Raw microarray intensity data were normalized per chip to the same mean value, which is recommended by the manufacturer.
GSE50556	strain: CMCC(B) 44102
GSE50556	The strain E. coli CMCC(B) 44102, was provided by Institute of Microbiology, Chinese Academy of Sciences and preserved at the Department of Food Science and Nutrition, Zhejiang University. The strain was maintained in nutrient agar medium (NA, Hangzhou Microbiological Agents Co., Ltd., China) at 37 °C, and cultured in tryptic soy broth (TSB, Qingdao Hope Biotechnology Co., Ltd., China) at pH 7.0 and transferred every 20-24 h with incubation at 37 °C.
GSE50556	Total RNA from cells of the microemulsion-treated E. coli was extracted in duplicate using an RNAiso Plus (Cat. # 908, Takara, Japan) according to the manufacturer’s instructions,
GSE50556	treatment: bicontinious microemulsion
GSE50556	treatment: control
GSE50556	treatment: oil in water
GSE50556	treatment: water in oil
GSE50713	Agilent Feature Extraction Software (v 10.10.1.1) was used for background subtraction and LOWESS normalization.
GSE50713	Continuous aerobically grown cultures in Evans medium, exposed to 0.1L
GSE50713	Continuous aerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 10min
GSE50713	Continuous aerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 20min
GSE50713	Continuous aerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 2.5min
GSE50713	Continuous aerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 40min
GSE50713	Continuous aerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 5min
GSE50713	Continuous aerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 80min
GSE50713	Continuous aerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 10min
GSE50713	Continuous aerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 20min
GSE50713	Continuous aerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 2.5min
GSE50713	Continuous aerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 40min
GSE50713	Continuous aerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 5min
GSE50713	Continuous aerobically grown cultures in Evans medium, exposed to 40uM iCORM-3 for 80min
GSE50713	Continuous anaerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 10min
GSE50713	Continuous anaerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 20min
GSE50713	Continuous anaerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 2.5min
GSE50713	Continuous anaerobically grown cultures in Evans medium, exposed to 40uM CORM-3 for 5min
GSE50713	Continuous anaerobically grown cultures in Evans medium, exposed to CO gas at 0.1L
GSE50713	Escherichia coli
GSE50713	Slide 31_Aerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 80
GSE50713	Slide 31_Aerobic culture_CO gas_biol rep 1_Cy3 10 Cy5 0
GSE50713	Slide 31_Aerobic culture_CO gas_biol rep 1_Cy3 20 Cy5 0
GSE50713	Slide 31_Aerobic culture_CO gas_biol rep 1_Cy3 40 Cy5 0
GSE50713	Slide 31_Aerobic culture_CO gas_biol rep 2_Cy3 0 Cy5 10
GSE50713	Slide 31_Aerobic culture_CO gas_biol rep 2_Cy3 0 Cy5 20
GSE50713	Slide 31_Aerobic culture_CO gas_biol rep 2_Cy3 0 Cy5 2.5
GSE50713	Slide 31_Aerobic culture_CO gas_biol rep 2_Cy3 0 Cy5 5
GSE50713	Slide 33_Aerobic culture_CO gas_biol rep 2_Cy3 0 Cy5 40
GSE50713	Slide 33_Aerobic culture_CO gas_biol rep 2_Cy3 0 Cy5 80
GSE50713	Slide 33_Aerobic culture_CO gas_biol rep 2_Cy3 10 Cy5 0
GSE50713	Slide 33_Aerobic culture_CO gas_biol rep 2_Cy3 20 Cy5 0
GSE50713	Slide 33_Aerobic culture_CO gas_biol rep 2_Cy3 2.5 Cy5 0
GSE50713	Slide 33_Aerobic culture_CO gas_biol rep 2_Cy3 40 Cy5 0
GSE50713	Slide 33_Aerobic culture_CO gas_biol rep 2_Cy3 5 Cy5 0
GSE50713	Slide 33_Aerobic culture_CO gas_biol rep 2_Cy3 80 Cy5 0
GSE50713	Slide 37_Aerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 10
GSE50713	Slide 37_Aerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 20
GSE50713	Slide 37_Aerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 2.5
GSE50713	Slide 37_Aerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 40
GSE50713	Slide 37_Aerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 5
GSE50713	Slide 37_Aerobic culture_CO gas_biol rep 1_Cy3 2.5 Cy5 0
GSE50713	Slide 37_Aerobic culture_CO gas_biol rep 1_Cy3 5 Cy5 0
GSE50713	Slide 37_Aerobic culture_CO gas_biol rep 1_Cy3 80 Cy5 0
GSE50713	Slide 39_Anaerobic culture_CO gas_biol rep 1_Cy3 10 Cy5 0
GSE50713	Slide 39_Anaerobic culture_CO gas_biol rep 1_Cy3 20 Cy5 0
GSE50713	Slide 39_Anaerobic culture_CO gas_biol rep 1_Cy3 40 Cy5 0
GSE50713	Slide 39_Anaerobic culture_CO gas_biol rep 1_Cy3 80 Cy5 0
GSE50713	Slide 39_Anaerobic culture_CO gas_biol rep 2_Cy3 10 Cy5 0
GSE50713	Slide 39_Anaerobic culture_CO gas_biol rep 2_Cy3 20 Cy5 0
GSE50713	Slide 39_Anaerobic culture_CO gas_biol rep 2_Cy3 40 Cy5 0
GSE50713	Slide 39_Anaerobic culture_CO gas_biol rep 2_Cy3 80 Cy5 0
GSE50713	Slide 53_Anaerobic culture_CO gas_biol rep 3_Cy3 0 Cy5 2.5
GSE50713	Slide 53_Anaerobic culture_CO gas_biol rep 3_Cy3 0 Cy5 5
GSE50713	Slide 53_Anaerobic culture_CO gas_biol rep 3_Cy3 40 Cy5 0
GSE50713	Slide 53_Anaerobic culture_CO gas_biol rep 3_Cy3 80 Cy5 0
GSE50713	Slide 55_Anaerobic culture_CO gas_biol rep 3_Cy3 0 Cy5 10
GSE50713	Slide 55_Anaerobic culture_CO gas_biol rep 3_Cy3 0 Cy5 10 2
GSE50713	Slide 55_Anaerobic culture_CO gas_biol rep 3_Cy3 0 Cy5 20
GSE50713	Slide 55_Anaerobic culture_CO gas_biol rep 3_Cy3 0 Cy5 2.5
GSE50713	Slide 55_Anaerobic culture_CO gas_biol rep 3_Cy3 0 Cy5 40
GSE50713	Slide 55_Anaerobic culture_CO gas_biol rep 3_Cy3 0 Cy5 5
GSE50713	Slide 55_Anaerobic culture_CO gas_biol rep 3_Cy3 2.5 Cy5 0
GSE50713	Slide 55_Anaerobic culture_CO gas_biol rep 3_Cy3 5 Cy5 0
GSE50713	Slide 56_Anaerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 10
GSE50713	Slide 56_Anaerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 20
GSE50713	Slide 56_Anaerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 2.5
GSE50713	Slide 56_Anaerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 40
GSE50713	Slide 56_Anaerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 5
GSE50713	Slide 56_Anaerobic culture_CO gas_biol rep 1_Cy3 0 Cy5 80
GSE50713	Slide 56_Anaerobic culture_CO gas_biol rep 1_Cy3 2.5 Cy5 0
GSE50713	Slide 56_Anaerobic culture_CO gas_biol rep 1_Cy3 5 Cy5 0
GSE50713	strain: Wild type strain MG1655
GSE50713	time: 10min
GSE50713	time: 10 min
GSE50713	time: 20min
GSE50713	time: 2.5min
GSE50713	time: 40min
GSE50713	time: 5min
GSE50713	time: 80min
GSE50713	Total RNA extracted using Trizol following manufacturer's instructions
GSE50713	treatment: Continuous aerobically grown cultures in Evans medium, exposed to 0.1L
GSE50713	treatment: Continuous aerobically grown cultures in Evans medium, exposed to 40uM CORM-3
GSE50713	treatment: Continuous aerobically grown cultures in Evans medium, exposed to 40uM iCORM-3
GSE50713	treatment: Continuous anaerobically grown cultures in Evans medium, exposed to 40uM CORM-3
GSE50713	treatment: Continuous anaerobically grown cultures in Evans medium, exposed to CO gas at 0.1L
GSE50828	E.coli, grown in LB+glycerol to 0.8OD
GSE50828	E.coli, grown in LB to 0.8OD
GSE50828	Escherichia coli
GSE50828	Escherichia coli was grown aerobically in Luria-Bertani (LB) broth and LB + glycerol at 30°C in an incubator shaker at 150 r.p.m.
GSE50828	growth protocol: grown in LB+glycerol to 0.8OD
GSE50828	growth protocol: grown in LB to 0.8OD
GSE50828	LB, biological rep1
GSE50828	LB, biological rep2
GSE50828	LB, biological rep3
GSE50828	LB+glycerol, biological rep1
GSE50828	LB+glycerol, biological rep2
GSE50828	LB+glycerol, biological rep3
GSE50828	RNA was isolated from the culture by using the Qiagen RNeasy mini-prep kit.cDNA was synthesized using 5-10 µg
GSE50828	The  intensity cell files were then imported, normalized for background correction (used RMA for normalization)and data analysed using Gene Spring 11.5 software.
GSE50828	To study gene expression,  28 days old E.coli cells were grown in the presence of LB broth and LB broth supplemented with 10% v
GSE51582	chip antibody: anti-FLAG antibody (Sigma Cat #: F3165-1MG)
GSE51582	chip antibody: none
GSE51582	ChIP_hns-F_bcm-#1
GSE51582	ChIP_hns-F_bcm+#1
GSE51582	ChIP_hns-F_bcm-#2
GSE51582	ChIP_hns-F_bcm+#2
GSE51582	ChIP-Seq
GSE51582	consensus binding regions were obtained as the portion which was covered by replicate samples
GSE51582	Escherichia coli str. K-12 substr. MG1655
GSE51582	For each co-ordinate coverage was calculated as the number of reads which was aligned againist the position. The coverage was normalized and converted into a z score. Z score threshold of 12 was selected to identify H-NS binding regions.
GSE51582	genome build: ASM584v1
GSE51582	H-NS flag tagged cells with bcm treatment
GSE51582	H-NS flag tagged cells without bcm treatment
GSE51582	Input_hns-F_bcm-#1
GSE51582	Input_hns-F_bcm+#1
GSE51582	Input_hns-F_bcm-#2
GSE51582	Input_hns-F_bcm+#2
GSE51582	MG1655 hns-FLAG cells were grown in liquid LB medium with and without bicyclomycin (BCM) at 37 degree with shaking at 200rpm
GSE51582	reads aligned to the reference genome of E. coli K-12 Mg1655 using BWA, with quality threshold of 20
GSE51582	Reads mapped to more than one locus were discarded. The mapped position obtained from the SAM output file from BWA lists was taken and the position was extended to 280 bp which is the average length of DNA fragments submitted for sequencing.
GSE51582	Standard illumina library construction protocol for ChIP
GSE51582	strain: K-12
GSE51582	Supplementary_files_format_and_content: contents : reference seq,co-ordinate start position,co-ordinate end position,counts for the position, mapping quality, strand position
GSE51582	Supplementary_files_format_and_content: format:bed format
GSE51582	The binding regions were considered by taking into account base position with z-score greater than threshold and merging adjacent binding regions seperated by a distance of less than 200bo into the single binding regions
GSE51582	Two biological replicates were performed for samples with and without treatment with bicyclomycin. For samples without BCM treatment, cells were grown OD600 ≈ 0.8 at 370 with shaking at 200 rpm.  For samples with BCM treatment, cells were grown to early log phase (O.D. 600=0.1) ≈ 1h at 370 with shaking at 200 rpm. BCM was added to a final concentration of 25ug mL-1
GSE51611	2xOriT
GSE51611	A2, osmotolerant mutant
GSE51611	A2 Replicate 1
GSE51611	A2 Replicate 2
GSE51611	A4, osmotolerant mutant
GSE51611	A4 Replicate 1
GSE51611	A4 Replicate 2
GSE51611	average fitness: 0.196851676684606
GSE51611	average fitness: 0.296737932583603
GSE51611	average fitness: 0.344592279464807
GSE51611	average fitness: 0.353076289611459
GSE51611	average fitness: 0.434286415079969
GSE51611	average fitness: 0.502711019240335
GSE51611	Data were normalized using the LOWESS algorithm and analyzed for statistical significance using the MeV package
GSE51611	Escherichia coli
GSE51611	Escherichia coli BW25113
GSE51611	G2, osmotolerant mutant
GSE51611	G2 Replicate 1
GSE51611	G2 Replicate 2
GSE51611	G3, osmotolerant mutant
GSE51611	G3 Replicate 1
GSE51611	G3 Replicate 2
GSE51611	G5, osmotolerant mutant
GSE51611	G5 Replicate 1
GSE51611	G5 Replicate 2
GSE51611	G6, osmotolerant mutant
GSE51611	G6 Replicate 1
GSE51611	G6 Replicate 2
GSE51611	genotype
GSE51611	Grown in glucose M9 media supplemented with 0.55 M NaCl
GSE51611	Hfr-2xSFX-
GSE51611	population: A2
GSE51611	population: A4
GSE51611	population: G2
GSE51611	population: G3
GSE51611	population: G5
GSE51611	population: G6
GSE51611	Samples were grown to mid exponential phase (OD approx 0.5). Cultures were then harvested with rapid filtration and resuspended in RNALater to stop RNA degradation. The Zymo Quick-RNA miniprep kit was used to extract pure RNA for subsequent analysis
GSE51611	strain description: E. coli BW25113 with an integrated F tra operon at the trp locus, plus additional F oriT sequences integrated at mbhA and hyfC
GSE51611	strain description: E. coli BW25113 with F oriTs integrated at mbhA and hyfC
GSE51611	strain: unevolved parent strain
GSE52059	All samples were extracted using the Qiagen Rnasey Mini Kit, following standard protocol
GSE52059	cDNA libraries were constructed at Purdue using an adapted SOLiD Total RNA-Seq Kit. Total RNA (DNase I digested) was fragmented by RNase III. RNA samples labeled as TEX were also subsequently digested with Terminator Exonuclease (TEX). Pyrophosphate groups were removed from the 5′ terminus using tobacco acid pyrophosphatase (TAP), and an RNA adapter was ligated to the 5′ end of the RNA. First-strand synthesis was performed using standard SOLiD 4 Total RNA-Seq protocol. RNA-seq via SOLiD 4 sequencing of libraries prepared by ligation based chemistry to provide strand-specific datasets.
GSE52059	Escherichia coli K-12
GSE52059	For alignment of the SAET reads to the E. coli MG1655 reference genome (RefSeq NC_000913), the short read alignment tool Bowtie ver. 1.8 (Langmead, et al., PMID 19261174) was utilized in three consecutive passes for each sample dataset. For the first pass, we use paired end color space mapping with a distance cutoff of 350 bases between read mates. Bowtie parameters were set to include only perfect matches and suppress reads that map to more than one genome location, i.e., uniquely mapped reads are retained. In practice we found the efficiency of paired end mapping was between 3 and 10%. To improve the overall alignment we mapped the orphan 5’ and 3’ end reads in two additional passes with Bowtie. The output of the three passes through Bowtie was three SAM files for each sample. Overall, we achieved 40-60% mapping efficiency with this three-pass strategy.
GSE52059	Genome_build: ASM584v1; Reference genome for E. coli MG1655 (RefSeq NC_000913). Paper title:Escherichia coli K-12: a cooperatively developed annotation snapshot--2005
GSE52059	phase of growth: 15 min post stationary
GSE52059	phase of growth: 180 min post stationary
GSE52059	phase of growth: 30 min post stationary
GSE52059	phase of growth: Late log phase OD 1.6
GSE52059	phase of growth: Log phase OD 0.1
GSE52059	phase of growth: Log phase OD 0.2
GSE52059	phase of growth: Log phase OD 0.3
GSE52059	phase of growth: Log phase OD 0.4
GSE52059	phase of growth: Log phase OD 0.8
GSE52059	phase of growth: Log phase OD 1.4
GSE52059	Prior to total RNA extraction harvested bacterial cells were stored at -80.0°C in an equal volume of RNAlater.
GSE52059	RNA-Seq
GSE52059	rna treatment: no RNA treatment
GSE52059	rna treatment: rRNA depleted
GSE52059	rna treatment: rRNA depleted; Terminal Exonuclease
GSE52059	rpoS_04_rep1
GSE52059	rpoS_04_rep2
GSE52059	rpoS_04_TEX
GSE52059	rpoS_15min_rep1
GSE52059	rpoS_16_rep1
GSE52059	rpoS_180min_rep1
GSE52059	rpoS_30min_rep1
GSE52059	rpoS_30min_rep2
GSE52059	rpoS_30min_TEX
GSE52059	Sequence data was processed by conversion of the sample alignment (BAM) files to strand-specific base count (WIG) files. To accomplish this an in-house script was created to extract strand-specific base count data from BAM files (outputs are positive and negative strand WIG files). First, the script reads in the paired-end BAM file and counts the nucleotides spanning inserts between the mated 5’ and 3’ reads. Next, the script pulls in the orphan 5’ and 3’ reads from the respective BAM files and increments the base counts at each base location without duplicating the reads already incremented from the paired ends.
GSE52059	strain: K-12
GSE52059	sub strain: BW38028
GSE52059	sub strain: BW39452
GSE52059	Supplementary_files_format_and_content: WIG files are provided showing uniquely mapped sequence reads (normalized).
GSE52059	The raw data output (XSEQ files) from the SOLiD 4 Genetic Analyzer System are passed through the ABI Sequence Accuracy Enhancement Tool (SAET)
GSE52059	Used SAMTOOLS (Li, et al., PMID 1950593) to sort and index the SAM files obtained from Bowtie and convert them to BAM format.
GSE52059	WIG files were normalized by using an in-house script that reads in the raw WIG files while excluding counts from all 22 rRNA genes. A simple global normalization approach was utilized that multiplied the count at each base location by 1 billion and divides that value by the sum of base counts at all base locations in the file. This normalization strategy is anlogous to the Total Count approach used for normalizing gene-specific read alignments. In this way, the base counts are expressed as parts per billion.
GSE52059	WIG files were viewed and annotated using Jbrowse and Integrated Genome Viewer.
GSE52059	Wild type E. coli K-12 (strain BW38038) and BW39452(ΔrpoS) cultures were grown on MOPS glucose minimal medium with 0.2% glucose as sole carbon source in a 2L B. Braun Biostat® B fermenter with working volume of 1 L MOPS minimal medium with 0.2% glucose, at 37°C, pH was kept constant at 7.4 by the addition of 1 M NaOH, and dissolved oxygen was maintained above 40% of saturation by adjusting the agitation speeds in the range of 270–500 rpm with fixed 1.5 liter
GSE52059	WT_01_rep1
GSE52059	WT_02_rep1
GSE52059	WT_03_rep1
GSE52059	WT_04_rep1
GSE52059	WT_04_rep2
GSE52059	WT_04-R_rep1
GSE52059	WT_04_TEX
GSE52059	WT_08_rep1
GSE52059	WT_14_rep1
GSE52059	WT_15min_rep1
GSE52059	WT_16_rep1
GSE52059	WT_16-R_rep1
GSE52059	WT_180min_rep1
GSE52059	WT_30min_rep1
GSE52059	WT_30min_rep2
GSE52059	WT_30min-R_rep1
GSE52059	WT_30min_TEX
GSE5212	Escherichia coli
GSE5212	genomic dna
GSE5212	genomic DNA
GSE5212	MG1655, SD197,SB227,SF301 and SS046
GSE5212	MG1655,SD197,SB227,SF301 and SS046
GSE5212	ration of median(635
GSE5212	Ratio of median
GSE5212	reference DNA
GSE5212	SB10_1
GSE5212	SB10_2
GSE5212	SB10_3
GSE5212	SB1_1
GSE5212	SB11_1
GSE5212	SB11_2
GSE5212	SB11_3
GSE5212	SB1_2
GSE5212	SB12_1
GSE5212	SB12_2
GSE5212	SB12_3
GSE5212	SB1_3
GSE5212	SB13_1
GSE5212	SB13_2
GSE5212	SB13_3
GSE5212	SB14_1
GSE5212	SB14_2
GSE5212	SB14_3
GSE5212	SB15_1
GSE5212	SB15_2
GSE5212	SB15_3
GSE5212	SB16_1
GSE5212	SB16_2
GSE5212	SB16_3
GSE5212	SB17_1
GSE5212	SB17_2
GSE5212	SB17_3
GSE5212	SB18_1
GSE5212	SB18_2
GSE5212	SB18_3
GSE5212	SB1 genomic DNA
GSE5212	SB2_1
GSE5212	SB2_2
GSE5212	SB2_3
GSE5212	SB3_1
GSE5212	SB3_2
GSE5212	SB3_3
GSE5212	SB5_1
GSE5212	SB5_2
GSE5212	SB5_3
GSE5212	SB6_1
GSE5212	SB6_2
GSE5212	SB6_3
GSE5212	SB7_1
GSE5212	SB7_2
GSE5212	SB7_3
GSE5212	SB8_1
GSE5212	SB8_2
GSE5212	SB8_3
GSE5212	SB9_1
GSE5212	SB9_2
GSE5212	SB9_3
GSE5212	SD10_1
GSE5212	SD10_2
GSE5212	SD10_3
GSE5212	SD11_1
GSE5212	SD11_2
GSE5212	SD11_3
GSE5212	SD12_1
GSE5212	SD12_2
GSE5212	SD12_3
GSE5212	SD13_1
GSE5212	SD13_2
GSE5212	SD13_3
GSE5212	SD2_1
GSE5212	SD2_2
GSE5212	SD2_3
GSE5212	SD3_1
GSE5212	SD3_2
GSE5212	SD3_3
GSE5212	SD4_1
GSE5212	SD4_2
GSE5212	SD4_3
GSE5212	SD5_1
GSE5212	SD5_2
GSE5212	SD5_3
GSE5212	SD6_1
GSE5212	SD6_2
GSE5212	SD6_3
GSE5212	SD7_1
GSE5212	SD7_2
GSE5212	SD7_3
GSE5212	SD8_1
GSE5212	SD8_2
GSE5212	SD8_3
GSE5212	SD9_1
GSE5212	SD9_2
GSE5212	SD9_3
GSE5212	SF1a_1
GSE5212	SF1a_2
GSE5212	SF1a_3
GSE5212	SF1b_1
GSE5212	SF1b_2
GSE5212	SF1b_3
GSE5212	SF2b_1
GSE5212	SF2b_2
GSE5212	SF2b_3
GSE5212	SF3_1
GSE5212	SF3_2
GSE5212	SF3_3
GSE5212	SF4a_1
GSE5212	SF4a_2
GSE5212	SF4a_3
GSE5212	SF4b_1
GSE5212	SF4b_2
GSE5212	SF4b_3
GSE5212	SF5_2
GSE5212	SF5_3
GSE5212	SF6_1
GSE5212	SF6_2
GSE5212	SF6_3
GSE5212	SFx_2
GSE5212	SFx_3
GSE5212	SFy_1
GSE5212	SFy_2
GSE5212	SFy_3
GSE5212	Shigella boydii
GSE5212	Shigella boydii 13
GSE5212	Shigella boydii 14
GSE5212	Shigella boydii 15
GSE5212	Shigella boydii  15
GSE5212	Shigella boydii 16
GSE5212	Shigella boydii 17
GSE5212	Shigella boydii 18
GSE5212	Shigella boydii serogroup 1
GSE5212	Shigella boydii serogroup 2
GSE5212	Shigella boydii serotype 1
GSE5212	Shigella boydii serotype 10
GSE5212	Shigella boydii serotype 11
GSE5212	Shigella boydii serotype 12
GSE5212	Shigella boydii serotype 13
GSE5212	Shigella boydii serotype2
GSE5212	Shigella boydii serotype 2
GSE5212	Shigella boydii serotype3
GSE5212	Shigella boydii serotype 3
GSE5212	Shigella boydii serotype 5
GSE5212	Shigella boydii serotype 6
GSE5212	Shigella boydii  serotype 7
GSE5212	Shigella boydii serotype 7
GSE5212	Shigella boydii serotype 8
GSE5212	Shigella boydii serotype 9
GSE5212	Shigella dysenteriae
GSE5212	Shigella dysenteriae 10
GSE5212	Shigella dysenteriae 11
GSE5212	Shigella dysenteriae 12
GSE5212	Shigella dysenteriae 13
GSE5212	Shigella dysenteriae 2
GSE5212	Shigella dysenteriae 3
GSE5212	Shigella dysenteriae 4
GSE5212	Shigella dysenteriae 5
GSE5212	Shigella dysenteriae 6
GSE5212	Shigella dysenteriae 7
GSE5212	Shigella dysenteriae 8
GSE5212	Shigella dysenteriae 9
GSE5212	Shigella flexneri
GSE5212	Shigella flexneri 1a
GSE5212	Shigella flexneri 1b
GSE5212	Shigella flexneri 2b
GSE5212	Shigella flexneri 3
GSE5212	Shigella flexneri 4a
GSE5212	Shigella flexneri 4b
GSE5212	Shigella flexneri 5
GSE5212	Shigella flexneri 6
GSE5212	Shigella flexneri variant x
GSE5212	Shigella flexneri variant y
GSE5239	All cultures were carried out in a 5 l fermentor BIOSTAT B-DCU (Sartorius BBI Systems Inc. Melsungen) at controlled temperature 37°C, pH 7.0, and dissolved oxygen tension 30%. The culture volume was 2 l. All reagents were purchased from Sigma-Aldrich, Inc. The synthetic culture medium had the following composition (g l-1): 8, glucose; 14.6, K2HPO4; 3.6, NaH2PO4·H2O; 2.68, (NH4)2SO4; 2, Na2SO4; 1, MgSO4; 1, Na-citrate; 0.5, NH4Cl; 2 ml of 10 mg l-1 of thiamine; 3 ml of trace element solution (g l-1 20.0, Na-EDTA; 15.0, FeCl3·6H2O; 0.5, CaCl2·2H2O; 0.2, ZnSO4·7H2O; 0.2, CoCl2·6H2O; 0.2, CuSO4·5H2O; 0.2, MnSO4·4H2O). The chemostat culture was performed with adding feed medium
GSE5239	BL21
GSE5239	BL21 (mu=0.20) (1)
GSE5239	BL21 (mu=0.20) (2)
GSE5239	BL21 (mu=0.20) (3)
GSE5239	BL21 (mu=0.20) (4)
GSE5239	BL21(mu=0.46) (1)
GSE5239	BL21(mu=0.46) (2)
GSE5239	BL21(mu=0.46) (3)
GSE5239	BL21(mu=0.46) (4)
GSE5239	E. coli samples for RNA extraction were taken during fermentation. Cells were harvested by centrifugation at the cultivation temperature (37°C, 10,000 g, 1 min), separated from the supernatant, and rapidly frozen in dry ice. The samples were stored at -70°C until analysis
GSE5239	Escherichia coli
GSE5239	Escherichia coli BL21
GSE5239	Escherichia coli BL21 (mu=0.20)
GSE5239	Escherichia coli BL21 (mu=0.46)
GSE5239	Expression data were analyzed with the Microarray Analysis Suite, version 5.0  (Affymetrix). Global scaling was performed to compare genes between chips. Each chip was normalized to a target intensity value of 2,500. Expression analysis files created by Microarray Suite, version 5.0, were exported to Microsoft Excel for data formatting.
GSE5239	Genotype: F- ompT hsdSB(rB-mB-) gal dcm (DE3)
GSE5239	Trizol extraction of total RNA was performed according to the manufacturer's instructions
GSE52770	Cells were grown in the minimal media, M63. The final cell concentrations were controlled ~ 10^8 cells
GSE52770	condition: 37ºC
GSE52770	condition: 45ºC
GSE52770	E. coli Type_II genotype strain, under 37ºC, rep 1
GSE52770	E. coli Type_II genotype strain, under 37ºC, rep 2
GSE52770	E. coli Type_II genotype strain, under 37ºC, rep 3
GSE52770	E. coli Type_II genotype strain, under 45ºC, rep 1
GSE52770	E. coli Type_II genotype strain, under 45ºC, rep 2
GSE52770	E. coli Type_II genotype strain, under 45ºC, rep 3
GSE52770	E. coli Type_III genotype strain, under 37ºC, rep 1
GSE52770	E. coli Type_III genotype strain, under 37ºC, rep 2
GSE52770	E. coli Type_III genotype strain, under 37ºC, rep 3
GSE52770	E. coli Type_III genotype strain, under 45ºC, rep 1
GSE52770	E. coli Type_III genotype strain, under 45ºC, rep 2
GSE52770	E. coli Type_III genotype strain, under 45ºC, rep 3
GSE52770	Escherichia coli
GSE52770	Microarray data were processed using custom scripts written in R based on the finite hybridisation (FH) model (Ono et al, 2008) and the thermodynamic model of non-specific binding (NSB) on short nucleotide microarrays (Furusawa et al, 2009).
GSE52770	strain: DH1ΔleuB::gfpuv5-kmr
GSE52770	The cell culture was put into cold phenol-ethanol solution (1 g of phenol in 10 mL of ethanol) prepared in advance. The cells were collected by centrifugation at 7,000 × g for 3 min at 4°C, and the pelleted cells were stored at –80°C prior to use.
GSE52770	Total RNAs were extracted using an RNeasy mini kit (Qiagen) in accordance with the manufacturer’s instructions.
GSE53140	Cells were centrifuged and the cell pellets were stored in RNA Later solution at -80ºC. The RNeasy Mini Kit (Qiagen, Venlo, Netherlands) was used to isolate total RNA. The samples were then incubated at 37ºC with RNaseOut (New England Biolabs) and DNaseI (New England Biolabs) according to the manufacture’s protocol for 1 hour. The samples were mixed with saturated phenol
GSE53140	E. coli MG1655-C8-1
GSE53140	E. coli MG1655-C8-3
GSE53140	E. coli MG1655-control-1
GSE53140	E. coli MG1655-control-2
GSE53140	E. coli MG1655-control-3
GSE53140	E. coli MG1655-MOPS+2%Dextrose
GSE53140	E. coli MG1655-MOPS+2%Dextrose+10mM C8
GSE53140	E. coli MG1655 was grown in MOPS + 2 % Dextrose minimal media +- 10 mM octanoic acid (pH=7.0) from OD550 0.05 to ~0.8 and harvested at Midlog.
GSE53140	Escherichia coli str. K-12 substr. MG1655
GSE53140	MATLAB v. R2012b program using GCRMA algorithm
GSE53140	strain: MG1655
GSE53140	The treatment condition includes adding 10 mM octanoic acid during logarithmic growth.
GSE5356	As described in description
GSE5356	As described in the description
GSE5356	E. coli K12 grown in minimal medium with added 5 μM TPEN
GSE5356	E. coli K12 grown in minimal medium without added TPEN
GSE5356	Escherichia coli
GSE5356	mRNA
GSE5356	Transcriptional response of E. coli to TPEN (m1)
GSE5356	Transcriptional response of E. coli to TPEN (m2)
GSE5356	Transcriptional response of E. coli to TPEN (m3)
GSE5356	Transcriptional response of E. coli to TPEN (t1)
GSE5356	Transcriptional response of E. coli to TPEN (t2)
GSE5356	Transcriptional response of E. coli to TPEN (t3)
GSE53767	All cultures were based on MOPS media with 0.2% glucose (Teknova), with either full supplement (Neidhardt et al., 1974). An overnight liquid culture was diluted 400-fold into 200 ml fresh media. The culture was kept in a 2.8-liter flask at 37C with aeration (180 rpm) until OD600 reached 0.3.
GSE53767	bacteria
GSE53767	Basecalls performed using Casava versions 1.6 or 1.7.
GSE53767	Bowtie alignments against the E coli genome were converted to wiggle files. The position of each alignment is distributed into several nucleotides in the center of the footprint. For each footprint read, the center residues that are at least 10 nucleotides away from either ends were given the same score, which is weighted by the length of the fragment [Oh et al,. Cell 147, 1295 (2011)]. Scores therefore represent the number of read alignments attributed to each genomic position under each scoring scheme.
GSE53767	Escherichia coli
GSE53767	Extraction was performed as described in detail previously (Li et al., 2012; Oh et al., 2011). 200 ml of cell culture was rapidly filtered at 37C by passing through a nitrocellulose filter. Cell pellets was were rapidly collected using a pre-warmed metal table crumber, flash frozen in liquid nitrogen, and combined with frozen droplets of lysis buffer. Cells and lysis buffer were pulverized in 10 ml canisters (Retsch) pre-chilled in liquid nitrogen using Qiagen TissueLyser II. Pulverized lysate was thawed on ice and clarified by centrifugation at 4C.
GSE53767	Genome_build: NC000913.2
GSE53767	media: fully supplemented MOPS glucose media
GSE53767	mRNA-seq in rich defined media
GSE53767	Ribosome protected mRNA fragments were size selected via gel purification, and ligated to 5' adenylated DNA oligo. After reverse transcription, the single stranded DNA was circularized, and PCR amplified [Oh et al,. Cell 147, 1295 (2011)]. More at G.W. Li, D. Burkhardt, C.A. Gross, J. S. Weissman (Cell).
GSE53767	RNA-Seq
GSE53767	Sequenced reads were trimmed for adaptor sequence.
GSE53767	strain: MG1655
GSE53767	Supplementary_files_format_and_content: wiggle files with two columns: first column containing chromosome positions and second column containing the number of reads mapped to the position (see publication for details).
GSE53767	The remaining reads were aligned using Bowtie v0.12.7 against E. coli MG1655 genome using parameters -v1 -m2 -k1.
GSE53767	Trimmed reads were sequentially aligned using Bowtie v0.12.7 to E coli rRNA and noncoding RNA allowing one mismatch. Reads aligning to any of these indices were discarded.
GSE54199	EC_Cont1_DNA
GSE54199	EC_Cont1_RNA
GSE54199	EC_Cont2_DNA
GSE54199	EC_Cont2_RNA
GSE54199	EC_Trim1_DNA
GSE54199	EC_Trim1_RNA
GSE54199	EC_Trim2_DNA
GSE54199	EC_Trim2_RNA
GSE54199	Escherichia coli
GSE54199	For all the samples; when 1
GSE54199	Genome_build: Escherichia coli K-12, substr. MG1655 (assembly ASM584v2)
GSE54199	Genome_build: Streptococcus pneumoniae D39 (assembly ASM1436v1)
GSE54199	genotype
GSE54199	Illumina Casava 1.8 software was used for basecalling.
GSE54199	Library preparation was performed by vertis Biotechnologie AG, according to the following protocol: RNA samples were first treated with rDNase. From the total RNA samples, ribosomal RNA molecules were depleted using the Ribo-Zero rRNA Removal Kit (Bacteria, Epicentre). the rRNA depleted RNA samples were fragmented with ultrasound (2 pulses of 30 sec at 4°C). Firststrand cDNA synthesis was primed with a N6 randomized primer. Then, Illumina TruSeq sequencing adapters were ligated to the 5' and 3' ends of the cDNA. The cDNA was finally amplified with PCR (16-18 cycles, depending on sample) using a proof reading enzyme. Aliquots of each library were analyzed by capillary electrophoresis.
GSE54199	Library preparation was performed by vertis Biotechnologie AG, according to the following protocol: the DNA samples were treated with ultrasound (3-5 pulses of 30 sec at 4°C). After end-repair, TruSeq sequencing adapters were ligated to the DNA fragments. Finally, the DNA was PCR-amplified to about 20-30 ng
GSE54199	molecule subtype: total RNA, rRNA depleted
GSE54199	OTHER
GSE54199	Overnight cultures of strain JM83 were diluted 1
GSE54199	Reads Per Kilobase of exon per Megabase of library size (RPKM) were calculated using a protocol from Chepelev et al., Nucleic Acids Research, 2009. In short, exons from all isoforms of a gene were merged to create one meta-transcript. The number of reads falling in the exons of this meta-transcript were counted and normalized by the size of the meta-transcript and by the size of the library. For the S. pneumoniae samples this was done internally by Rockhopper version 1.21 after aligning reads.
GSE54199	RNA-Seq
GSE54199	S. pneumoniae reads were mapped to the D39 whole genome with Rockhopper version 1.21, using default parameters. E. coli reads were mapped to the K-12, substr. MG1655 whole genome with Bowtie 2, using parameters --mixed --discordant -D 10 -R 2 -N 0 -L 22 -i S,0,2.50.
GSE54199	strain: JM83
GSE54199	Supplementary_files_format_and_content: tab-delimited text files include RPKM values for each Sample.
GSE54199	treated with: 0.5 μg
GSE54199	treated with: none (untreated control)
GSE54199	Trimethoprim-treated E. coli cells
GSE54199	Untreated E. coli cells
GSE54271	BW25113-pCA24N_arT LB 90 min 1 mM IPTG
GSE54271	BW25113-pCA24N LB 90 min 1 mM IPTG
GSE54271	Cells were lysed using a bead beater (Biospec) and mRNA was isolated using a Qiagen RNeasy mini kit (Cat# 74104).
GSE54271	Cells were pelleted in the presence of RNALater (Applied Biosystems) and flash frozen in ethanol-dry ice.
GSE54271	Data was analyzed in the Affymetrix GenomeChipOperating Software (GCOS).
GSE54271	Escherichia coli BW25113
GSE54271	genotype
GSE54271	overexpression of arT (pCA24N_arT)
GSE54271	overexpression of empty vector (pCA24N)
GSE54271	Strains were grown in LBCm30 at 37°C with shaking at 250 rpm.  Overnight cultures were diluted into fresh LBCm30, grown for 2.5 h, and induced with 1 mM IPTG for 90 min (final OD600 = 1.6).
GSE54512	E. coli 2% NaCl
GSE54512	E. coli 3.5% NaCl, replicate 1
GSE54512	E. coli 3.5% NaCl, replicate 2
GSE54512	E. coli 4.5% NaCl
GSE54512	E. coli 5.5% NaCl
GSE54512	E. coli 5% NaCl
GSE54512	E. coli, stressed by NaCl, in presence of glycine betaine
GSE54512	E. coli was grown to exponential phase in glucose minimal medium in the presence of the osmoprotectant glycine beatine with a range of salt concentrations at 2, 3.5 (2 repeats), 4.5, 5 and 5.5% NaCl.  E. coli were inoculated at 104 cfu
GSE54512	Escherichia coli K-12
GSE54512	Genomic DNA was purified from exponentially growing cells by lysis in lysozyme
GSE54512	growth phase: exponential
GSE54512	growth phase: Exponential
GSE54512	strain: K12
GSE54512	The analysis of the data is based on cross validation with datasets generated by Monte-Carlo simulation. The null hypothesis was that the gene expression changes monotonously as a function of NaCl concentration. The existence of a deviation from monotony was tested by F-tests for each gene probe. By comparing the number of probes with the lowest p(F) values for each NaCl concentrations with analogous results generated from Monte-Carlo sampling of the null hypothesis, we show that it is very unlikely that a switch between 4.5 and 5% NaCl could have happened by chance (in fact p<<0.01).
GSE54512	The data were normalised manually in Excel. For each spot, the median of the spot intensity minus the background were considered. Because we wanted to compare different environmental conditions, the cDNA signal in each condition was normalised to that of gDNA with M=ln(cDNA
GSE54669	0.5mg
GSE54669	antibody: anti-DksA rabbit polyclonal antisera
GSE54669	antibody: anti-RNAP b subunit NT63 monoclonal antibodies
GSE54669	antibody: anti-s70 monoclonal antibodies
GSE54669	antibody: None, input DNA
GSE54669	Cells were fixed with 1% formaldehyde for 5min before quenching with ice-cold glycine (100mM). Cells were harvested, washed with ice-cold PBS and flash-frozen in liquid nitrogen. Cell pellets were resuspended in 500 ml of IP buffer (100 mM Tris pH 8, 300mM NaCl, 2% TritonX-100) and sonicated using a Misonix sonicator (S-4000) with a cup horn (431C) set at 60% output, 10 sec ON and 10 sec OFF, for a total sonication time of 16 min. Cells were then treated for one hour at 4 °C with RNase A (2 ng
GSE54669	DdksA cells were grown in MOPS medium with 0.2% glucose, leucine, isoleucine, valine, glycine, phenylalanine, threonine (40 mg
GSE54669	DksA ChIP DNA from DdksA cells
GSE54669	DksA ChIP DNA from wt cells
GSE54669	DksA_DdksA_untreated
GSE54669	DksA_wt_untreated_rep1
GSE54669	DksA_wt_untreated_rep2
GSE54669	Escherichia coli
GSE54669	genotype: MG1655
GSE54669	genotype: MG1655 DdksA
GSE54669	Input DNA from DdksA cells
GSE54669	Input DNA from starved DdksA cells
GSE54669	Input DNA from starved wt cells
GSE54669	Input DNA from wt cells
GSE54669	None
GSE54669	RNAP ChIP DNA from DdksA cells
GSE54669	RNAP ChIP DNA from starved DdksA cells
GSE54669	RNAP ChIP DNA from starved wt cells
GSE54669	RNAP ChIP DNA from wt cells
GSE54669	RNAP_DdksA_SHX_rep1
GSE54669	RNAP_DdksA_SHX_rep2
GSE54669	RNAP_DdksA_untreated_rep1
GSE54669	RNAP_DdksA_untreated_rep2
GSE54669	RNAP_wt_SHX_rep1
GSE54669	RNAP_wt_SHX_rep2
GSE54669	RNAP_wt_untreated_rep1
GSE54669	RNAP_wt_untreated_rep2
GSE54669	s70 ChIP DNA from DdksA cells
GSE54669	s70 ChIP DNA from starved DdksA cells
GSE54669	s70 ChIP DNA from starved wt cells
GSE54669	s70 ChIP DNA from wt cells
GSE54669	s70_DdksA_SHX_rep1
GSE54669	s70_DdksA_SHX_rep2
GSE54669	s70_DdksA_untreated_rep1
GSE54669	s70_DdksA_untreated_rep2
GSE54669	s70_wt_SHX_rep1
GSE54669	s70_wt_SHX_rep2
GSE54669	s70_wt_untreated_rep1
GSE54669	s70_wt_untreated_rep2
GSE54669	The log2-ratio is computed and scaled to center the ratio data around zero. Scaling is performed by subtracting the bi-weight mean for the log2-ratio values for all features on the array from each log2-ratio value.
GSE54669	treatment: 0.5mg
GSE54669	treatment: None
GSE54669	Wild-types cells were grown in MOPS medium with 0.2% glucose, leucine, isoleucine, valine, glycine, phenylalanine, threonine (40 mg
GSE54899	agent: DPD
GSE54899	agent: DPD and rifampicin
GSE54899	agent: Fe
GSE54899	agent: Fe and rifampicin
GSE54899	chip antibody: anti-myc (Santa Cruz Biotech, sc-28207)
GSE54899	chip antibody: anti-RpoB (Neoclone, WP002)
GSE54899	ChIP-exo reads were aligned to the NC_000913 genome reference sequence using using bowtie v1.0.0 with parameters  -S
GSE54899	ChIP-Seq
GSE54899	ChIP-seq libraries were prepared for sequencing using standard Illumina protocols
GSE54899	E. coli K-12 MG1655 WT and Fur-8-myc tagged strains were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. For iron treated cells, 0.1mM of FeCl2 were treated from the beginning of culture, and for DPD treated cells, 0.2mM of DPD were added at early-log phase and continued to culture for additional 2h. For the rifampicin-treated cultures, the rifampicin dissolved in methanol was added to a final concentration of 150 mg
GSE54899	Escherichia coli str. K-12 substr. MG1655
GSE54899	Fur with DPD 1 (ChIP-exo)
GSE54899	Fur with DPD 2 (ChIP-exo)
GSE54899	Fur with Fe 1 (ChIP-exo)
GSE54899	Fur with Fe 2 (ChIP-exo)
GSE54899	Genome_build: ASM584v2
GSE54899	genotype
GSE54899	Immunoprecipitated DNA
GSE54899	library strategy: ChIP-exo
GSE54899	RpoB with DPD 1 (ChIP-exo)
GSE54899	RpoB with DPD 2 (ChIP-exo)
GSE54899	RpoB with DPD and rifampicin 1 (ChIP-exo)
GSE54899	RpoB with DPD and rifampicin 2 (ChIP-exo)
GSE54899	RpoB with Fe 1 (ChIP-exo)
GSE54899	RpoB with Fe 2 (ChIP-exo)
GSE54899	RpoB with Fe and rifampicin 1 (ChIP-exo)
GSE54899	RpoB with Fe and rifampicin 2 (ChIP-exo)
GSE54899	Supplementary_files_format_and_content: Tab-delimited text files in gff format which has 8 columns: sequence id, source(empty), feature (+
GSE54900	agent: DPD
GSE54900	agent: Fe
GSE54900	E. coli K-12 MG1655 WT and Δfur were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. For iron treated cells, 0.1mM of FeCl2 were treated from the beginning of culture, and for DPD treated cells, 0.2mM of DPD were added at early-log phase and continued to culture for additional 2h.
GSE54900	Escherichia coli str. K-12 substr. MG1655
GSE54900	Genome_build: ASM584v2
GSE54900	genotype
GSE54900	Reads Per Kilobase of exon per Megabase of library size (RPKM) were calculated using cufflinks v.1.3.0
GSE54900	RNA libraries were prepared for sequencing using standard Illumina protocols
GSE54900	RNA-Seq
GSE54900	Sequenced reads were mapped onto NC_000913 reference genome sequence using bowtie v1.0.0 with parameters -X 1000 -n 2 -3 3 -S
GSE54900	Supplementary_files_format_and_content: Comma-delimited text file includes RPKM values for each Sample.
GSE54900	The cell culture was treated with the RNAprotect reagent (Qiagen).
GSE54900	Total RNA isolated from E. coli
GSE54900	Total RNA was extracted using the RNeasy Plus Mini kit (Qiagen Inc., Valencia, CA, USA) and genomic DNA was removed by gDNA Eliminator spin column in the RNeasy Plus Mini Kit. RNA quality and concentration was determined by analysis with a NanoDrop 1000 (Thermo Scientific Inc., Wilmington, DE, USA).
GSE54900	WT with DPD 1 (RNA-seq)
GSE54900	WT with DPD 2 (RNA-seq)
GSE54900	WT with Fe 1 (RNA-seq)
GSE54900	WT with Fe 2 (RNA-seq)
GSE54900	Δfur with DPD 1 (RNA-seq)
GSE54900	Δfur with DPD 2 (RNA-seq)
GSE54900	Δfur with Fe 1 (RNA-seq)
GSE54900	Δfur with Fe 2 (RNA-seq)
GSE55097	Agilent Feature Extraction Software (v 10.10.1.1) was used for background subtraction and LOWESS normalization.
GSE55097	Batch anaerobically grown cultures in hemA defined medium, exposed to 100uM CORM-3 for 10min
GSE55097	Batch anaerobically grown cultures in hemA defined medium, exposed to 100uM CORM-3 for 120min
GSE55097	Batch anaerobically grown cultures in hemA defined medium, exposed to 100uM CORM-3 for 20min
GSE55097	Batch anaerobically grown cultures in hemA defined medium, exposed to 100uM CORM-3 for 40min
GSE55097	Batch anaerobically grown cultures in hemA defined medium, exposed to 100uM CORM-3 for 60min
GSE55097	Batch anaerobically grown cultures in hemA defined medium, exposed to 100uM iCORM-3 for 10min
GSE55097	Batch anaerobically grown cultures in hemA defined medium, exposed to 100uM iCORM-3 for 120min
GSE55097	Batch anaerobically grown cultures in hemA defined medium, exposed to 100uM iCORM-3 for 20min
GSE55097	Batch anaerobically grown cultures in hemA defined medium, exposed to 100uM iCORM-3 for 40min
GSE55097	Batch anaerobically grown cultures in hemA defined medium, exposed to 100uM iCORM-3 for 60min
GSE55097	Batch anaerobically grown cultures in hemA defined medium, prior to CORM-3 addition
GSE55097	Batch anaerobically grown cultures in hemA defined medium, prior to CORM-3 addition (t=0)
GSE55097	Batch anaerobically grown cultures in hemA defined medium, prior to iCORM-3 addition
GSE55097	Cells were harvested directly into phenol:ethanol to stabilize RNA and total RNA was purified using Qiagen’s RNeasy Mini Kit, according to the manufacturer's instructions.
GSE55097	Escherichia coli
GSE55097	Slide 13_Wild type_CORM-3_biol rep 1_Cy3 0 Cy5 120
GSE55097	Slide 13_Wild type_CORM-3_biol rep 1_Cy3 10 Cy5 0
GSE55097	Slide 13_Wild type_CORM-3_biol rep 1_Cy3 120 Cy5 0
GSE55097	Slide 13_Wild type_CORM-3_biol rep 1_Cy3 20 Cy5 0
GSE55097	Slide 13_Wild type_CORM-3_biol rep 1_Cy3 40 Cy5 0
GSE55097	Slide 13_Wild type_CORM-3_biol rep 1_Cy3 60 Cy5 0
GSE55097	Slide 13_Wild type_CORM-3_biol rep 2_Cy3 0 Cy5 10
GSE55097	Slide 13_Wild type_CORM-3_biol rep 2_Cy3 0 Cy5 20
GSE55097	Slide 14_Wild type_CORM-3_biol rep 2_Cy3 0 Cy5 120
GSE55097	Slide 14_Wild type_CORM-3_biol rep 2_Cy3 0 Cy5 40
GSE55097	Slide 14_Wild type_CORM-3_biol rep 2_Cy3 0 Cy5 60
GSE55097	Slide 14_Wild type_CORM-3_biol rep 2_Cy3 10 Cy5 0
GSE55097	Slide 14_Wild type_CORM-3_biol rep 2_Cy3 120 Cy5 0
GSE55097	Slide 14_Wild type_CORM-3_biol rep 2_Cy3 20 Cy5 0
GSE55097	Slide 14_Wild type_CORM-3_biol rep 2_Cy3 40 Cy5 0
GSE55097	Slide 14_Wild type_CORM-3_biol rep 2_Cy3 60 Cy5 0
GSE55097	Slide 15_hemA_CORM-3_biol rep 2_Cy3 120 Cy5 0
GSE55097	Slide 15_hemA_CORM-3_biol rep 2_Cy3 20 Cy5 0
GSE55097	Slide 15_hemA_CORM-3_biol rep 2_Cy3 40 Cy5 0
GSE55097	Slide 15_hemA_CORM-3_biol rep 2_Cy3 60 Cy5 0
GSE55097	Slide 15_Wild type_CORM-3_biol rep 1_Cy3 0 Cy5 10
GSE55097	Slide 15_Wild type_CORM-3_biol rep 1_Cy3 0 Cy5 20
GSE55097	Slide 15_Wild type_CORM-3_biol rep 1_Cy3 0 Cy5 40
GSE55097	Slide 15_Wild type_CORM-3_biol rep 1_Cy3 0 Cy5 60
GSE55097	Slide 16_hemA_CORM-3_biol rep 1_Cy3 120 Cy5 0
GSE55097	Slide 16_hemA_CORM-3_biol rep 1_Cy3 60 Cy5 0
GSE55097	Slide 16_hemA_CORM-3_biol rep 2_Cy3 0 Cy5 10
GSE55097	Slide 16_hemA_CORM-3_biol rep 2_Cy3 0 Cy5 120
GSE55097	Slide 16_hemA_CORM-3_biol rep 2_Cy3 0 Cy5 20
GSE55097	Slide 16_hemA_CORM-3_biol rep 2_Cy3 0 Cy5 40
GSE55097	Slide 16_hemA_CORM-3_biol rep 2_Cy3 0 Cy5 60
GSE55097	Slide 16_hemA_CORM-3_biol rep 2_Cy3 10 Cy5 0
GSE55097	Slide 17_hemA_CORM-3_biol rep 1_Cy3 0 Cy5 10
GSE55097	Slide 17_hemA_CORM-3_biol rep 1_Cy3 0 Cy5 120
GSE55097	Slide 17_hemA_CORM-3_biol rep 1_Cy3 0 Cy5 20
GSE55097	Slide 17_hemA_CORM-3_biol rep 1_Cy3 0 Cy5 40
GSE55097	Slide 17_hemA_CORM-3_biol rep 1_Cy3 0 Cy5 60
GSE55097	Slide 17_hemA_CORM-3_biol rep 1_Cy3 10 Cy5 0
GSE55097	Slide 17_hemA_CORM-3_biol rep 1_Cy3 20 Cy5 0
GSE55097	Slide 17_hemA_CORM-3_biol rep 1_Cy3 40 Cy5 0
GSE55097	Slide 34_hemA_iCORM-3_biol rep 1_Cy3 0 Cy5 10
GSE55097	Slide 34_hemA_iCORM-3_biol rep 1_Cy3 0 Cy5 120
GSE55097	Slide 34_hemA_iCORM-3_biol rep 1_Cy3 0 Cy5 20
GSE55097	Slide 34_hemA_iCORM-3_biol rep 1_Cy3 0 Cy5 40
GSE55097	Slide 34_hemA_iCORM-3_biol rep 1_Cy3 0 Cy5 60
GSE55097	Slide 34_hemA_iCORM-3_biol rep 1_Cy3 10 Cy5 0
GSE55097	Slide 34_hemA_iCORM-3_biol rep 1_Cy3 20 Cy5 0
GSE55097	Slide 34_hemA_iCORM-3_biol rep 1_Cy3 40 Cy5 0
GSE55097	Slide 35_hemA_iCORM-3_biol rep 1_Cy3 120 Cy5 0
GSE55097	Slide 35_hemA_iCORM-3_biol rep 1_Cy3 60 Cy5 0
GSE55097	Slide 35_hemA_iCORM-3_biol rep 2_Cy3 0 Cy5 10
GSE55097	Slide 35_hemA_iCORM-3_biol rep 2_Cy3 0 Cy5 120
GSE55097	Slide 35_hemA_iCORM-3_biol rep 2_Cy3 0 Cy5 20
GSE55097	Slide 35_hemA_iCORM-3_biol rep 2_Cy3 0 Cy5 40
GSE55097	Slide 35_hemA_iCORM-3_biol rep 2_Cy3 0 Cy5 60
GSE55097	Slide 35_hemA_iCORM-3_biol rep 2_Cy3 10 Cy5 0
GSE55097	Slide 36_hemA_iCORM-3_biol rep 2_Cy3 120 Cy5 0
GSE55097	Slide 36_hemA_iCORM-3_biol rep 2_Cy3 20 Cy5 0
GSE55097	Slide 36_hemA_iCORM-3_biol rep 2_Cy3 40 Cy5 0
GSE55097	Slide 36_hemA_iCORM-3_biol rep 2_Cy3 60 Cy5 0
GSE55097	Slide 36_hemA vs. WT t=0_biol rep 1_Cy3 hemA Cy5 WT
GSE55097	Slide 36_hemA vs. WT t=0_biol rep 2_Cy3 hemA Cy5 WT
GSE55097	Slide 36_WT vs. hemA t=0_biol rep 1_Cy3 WT Cy5 hemA
GSE55097	Slide 36_WT vs. hemA t=0_biol rep 2_Cy3 WT Cy5 hemA
GSE55097	strain: hemA strain MG1655
GSE55097	strain: Wild type strain MG1655
GSE55097	treatment: exposed to 100uM CORM-3 for 10min
GSE55097	treatment: exposed to 100uM CORM-3 for 120min
GSE55097	treatment: exposed to 100uM CORM-3 for 20min
GSE55097	treatment: exposed to 100uM CORM-3 for 40min
GSE55097	treatment: exposed to 100uM CORM-3 for 60min
GSE55097	treatment: exposed to 100uM iCORM-3 for 10min
GSE55097	treatment: exposed to 100uM iCORM-3 for 120min
GSE55097	treatment: exposed to 100uM iCORM-3 for 20min
GSE55097	treatment: exposed to 100uM iCORM-3 for 40min
GSE55097	treatment: exposed to 100uM iCORM-3 for 60min
GSE55097	treatment: prior to CORM-3 addition (t=0)
GSE55097	treatment: prior to iCORM-3 addition (t=0)
GSE55199	Coverage calculation and normalisation (TRAPL)
GSE55199	Demultiplexing
GSE55199	Escherichia coli MG1655 cells
GSE55199	Escherichia coli str. K-12 substr. MG1655
GSE55199	Fastq quality trimming using FastX and a cut-off value of 20
GSE55199	Fastq to fasta conversion using FastX
GSE55199	Genome_build: NC_000913.2
GSE55199	growth phase: exponential
GSE55199	growth phase: stationary
GSE55199	Hot phenol (Sharma et al. 2010, Bloomberg 1990, EMBO J)
GSE55199	LB 0.4 B1 TEX neg L1 GA
GSE55199	LB 0.4 B1 TEX pos L1 GA
GSE55199	LB 0.4 B2 TEX neg L1 HS1
GSE55199	LB 0.4 B2 TEX neg L1 HS2
GSE55199	LB 0.4 B2 TEX pos L1 HS1
GSE55199	LB 0.4 B2 TEX pos L1 HS2
GSE55199	LB 2.0 B1 TEX neg L1 GA
GSE55199	LB 2.0 B1 TEX neg L2 HS2
GSE55199	LB 2.0 B1 TEX pos L1 GA
GSE55199	LB 2.0 B1 TEX pos L2 HS2
GSE55199	LB 2.0 B2 TEX neg L1 HS1
GSE55199	LB 2.0 B2 TEX neg L1 HS2
GSE55199	LB 2.0 B2 TEX neg L2 HS2
GSE55199	LB 2.0 B2 TEX pos L1 HS1
GSE55199	LB 2.0 B2 TEX pos L1 HS2
GSE55199	LB 2.0 B2 TEX pos L2 HS2
GSE55199	M63 0.4 B1 TEX neg L1 GA
GSE55199	M63 0.4 B1 TEX pos L1 GA
GSE55199	M63 0.4 B2 TEX neg L1 HS1
GSE55199	M63 0.4 B2 TEX neg L1 HS2
GSE55199	M63 0.4 B2 TEX pos L1 HS1
GSE55199	M63 0.4 B2 TEX pos L1 HS2
GSE55199	medium: LB
GSE55199	medium: M63
GSE55199	Read mapping using segemehl version 0.13 (TRAPL)
GSE55199	RNA-Seq
GSE55199	Samples were mixed, incubated on ice for 10 min after which cells were collected by centrifugation at 4150 rpm at 4˚C for 10 min.  Cell pellets were snap frozen in an ethanol
GSE55199	Size filtering: discarding reads shorter than 12 nt (TRAPL)
GSE55199	strain: MG1655
GSE55199	Supplementary_files_format_and_content: wiggle
GSE55199	The libraries were generated by Vertis Biotechnologie AG (Munich, Germany). The samples were poly(A)-tailed by using poly(A) polymerase. The 5'-PPP were removed using tobacco acid pyrophosphatase (TAP) followed by the ligation of the RNA adapter to the 5'-monophosphate of the RNA. First-strand cDNA synthesis was performed with an oligo(dT)-adapter primer and the M-MLV reverse transcriptase. The resulting cDNA was PCR-amplified to reach a concentration of 20-30 ng
GSE55199	To harvest total RNA samples, overnight cultures of wild type MG1655 grown in LB at 37˚C were diluted back 1:500 in either fresh LB or M63 minimal glucose medium and allowed to grow until the cultures reached an OD600 of ~ 0.4 and 2.0 for cultures grown in LB and an OD600 of ~0.4 for cultures grown in M63. For samples grown to OD600 of ~0.4 a total volume of 25 ml of cells were harvested and combined with 5 ml of stop solution (95% Ethanol, 5% acid phenol). For samples grown to OD600 of 2.0 a total volume of 5 ml of cells were harvested and combined with 1 ml of stop solution.
GSE55365	affyexp_delta-arcA_glucose_NH4CL_anaerobic
GSE55365	affyexp_delta-arcA_glucose_NH4CL_anaerobic_1.CEL
GSE55365	affyexp_delta-arcA_glucose_NH4CL_anaerobic_2.CEL
GSE55365	affyexp_delta-arcA_glucose_NH4CL_anaerobic_3.CEL
GSE55365	affyexp_delta-arcA_glucose_NH4Cl_NO3
GSE55365	affyexp_delta-arcA_glucose_NH4Cl_NO3_1.CEL
GSE55365	affyexp_delta-arcA_glucose_NH4Cl_NO3_2.CEL
GSE55365	affyexp_delta-arcA_glucose_NH4Cl_NO3_3.CEL
GSE55365	affyexp_delta-fnr_glucose_NH4CL_anaerobic
GSE55365	affyexp_delta-fnr_glucose_NH4CL_anaerobic_1.CEL
GSE55365	affyexp_delta-fnr_glucose_NH4CL_anaerobic_2.CEL
GSE55365	affyexp_delta-fnr_glucose_NH4CL_anaerobic_3.CEL
GSE55365	affyexp_delta-fnr_glucose_NH4Cl_NO3
GSE55365	affyexp_delta-fnr_glucose_NH4Cl_NO3_1.CEL
GSE55365	affyexp_delta-fnr_glucose_NH4Cl_NO3_2.CEL
GSE55365	affyexp_delta-fnr_glucose_NH4Cl_NO3_3.CEL
GSE55365	affyexp_wt_glucose_NH4CL_anaerobic
GSE55365	affyexp_wt_glucose_NH4CL_anaerobic_1.CEL
GSE55365	affyexp_wt_glucose_NH4CL_anaerobic_2.CEL
GSE55365	affyexp_wt_glucose_NH4CL_anaerobic_3.CEL
GSE55365	affyexp_wt_glucose_NH4Cl_NO3
GSE55365	affyexp_wt_glucose_NH4Cl_NO3_1.CEL
GSE55365	affyexp_wt_glucose_NH4Cl_NO3_2.CEL
GSE55365	affyexp_wt_glucose_NH4Cl_NO3_3.CEL
GSE55365	All strains used in this study were E. coli K-12 MG1655 and its derivatives. The deletion mutants (Δfnr and ΔarcA) were constructed by a λ red and FLP-mediated site-specific recombination method. Glycerol stocks of E. coli strains were inoculated into M9 minimal medium containing 0.2% (w
GSE55365	culture condition: anaerobic fermentive condition
GSE55365	culture condition: nitrate respiratory condition
GSE55365	Escherichia coli str. K-12 substr. MG1655
GSE55365	genotype
GSE55365	Raw CEL files were analyzed using robust multi-array average for normalization and calculation of probe intensities. The processed probe signals derived from each microarray were averaged for both the wild type and deletion mutant strains. This was done using the GCRMA package (version 2.13) from Bioconductor in R.
GSE55365	Samples for transcriptome analysis were taken from exponentially growing cells. From the cells treated by RNAprotect Bacteria Reagent (Qiagen), total RNA samples were isolated using RNeasy columns (Qiagen) in accordance with manufacturer’s instruction.
GSE55366	Cells at appropriate cell density were cross-linked by 1% formaldehyde at room temperature for 25 min. Following quenching the unused formaldehyde with a final concentration of 125 mM glycine at room temperature for 5 min. The cross-linked cells were harvested and washed three times with 50 mL of ice-cold TBS (Tris Buffered Saline). The washed cells were re-suspended in 0.5 mL lysis buffer composed of 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM EDTA, 1 ug
GSE55366	chip antibody: biotin conjugated anti-c-myc antibody
GSE55366	chip antibody: HRP-conjugated sheep anti-mouse IgG
GSE55366	chip antibody vendor: Amersham Biosciences
GSE55366	chip antibody vendor: Santa Cruz Biotechnology
GSE55366	chip-ArcA_ArcA8myc_glucose_NH4CL_anaerobic_1
GSE55366	chip-ArcA_ArcA8myc_glucose_NH4CL_anaerobic_2
GSE55366	chip-ArcA_ArcA8myc_glucose_NH4CL_anaerobic_3
GSE55366	chip-ArcA_ArcA8myc_glucose_NH4CL_NO3_1
GSE55366	chip-ArcA_ArcA8myc_glucose_NH4CL_NO3_2
GSE55366	chip-ArcA_ArcA8myc_glucose_NH4CL_NO3_3
GSE55366	chip-Fnr_Fnr8myc_glucose_NH4CL_anaerobic_1
GSE55366	chip-Fnr_Fnr8myc_glucose_NH4CL_anaerobic_2
GSE55366	chip-Fnr_Fnr8myc_glucose_NH4CL_anaerobic_3
GSE55366	chip-Fnr_Fnr8myc_glucose_NH4CL_NO3_1
GSE55366	chip-Fnr_Fnr8myc_glucose_NH4CL_NO3_2
GSE55366	chip-Fnr_Fnr8myc_glucose_NH4CL_NO3_3
GSE55366	Cross-linked and sonicated chromatin complex of ArcA-8myc and DNA was immunoprecipitated by rabbit serum containing myc antibody.
GSE55366	Cross-linked and sonicated chromatin complex of ArgR-8myc and DNA was immunoprecipitated by rabbit serum containing myc antibody.
GSE55366	Cross-linked and sonicated chromatin complex of Fnr-8myc and DNA was immunoprecipitated by rabbit serum containing myc antibody.
GSE55366	E. Coli ArcA-8myc ChIP DNA Mock antibody anaerobic
GSE55366	E. Coli ArcA-8myc ChIP DNA Mock antibody NO3
GSE55366	E. Coli ArcA ChIP DNA anaerobic
GSE55366	E. Coli ArcA ChIP DNA NO3
GSE55366	E. Coli Fnr-8myc ChIP DNA Mock antibody anaerobic
GSE55366	E. Coli Fnr-8myc ChIP DNA Mock antibody NO3
GSE55366	E. Coli Fnr ChIP DNA anaerobic
GSE55366	E. Coli Fnr ChIP DNA NO3
GSE55366	Escherichia coli str. K-12 substr. MG1655
GSE55366	genotype
GSE55366	The raw data (.pair file) was subjected to per channel quantile normalization (Bolstad et al. Bioinformatics 19(2):185), IP
GSE55662	background strain: BW25113
GSE55662	CHP files were generated using Affymetrix Expression Control.  Downstream data analysis was performed in GeneSpring GX 12,  CEL files were imported using RMA algorithm and median normalization was performed.
GSE55662	Cirpofloxacin treated fur mutant sample at T1h, biological rep 1
GSE55662	Cirpofloxacin treated fur mutant sample at T1h, biological rep 2
GSE55662	Cirpofloxacin treated WT sample at T1h, biological rep 1
GSE55662	Cirpofloxacin treated WT sample at T1h, biological rep 2
GSE55662	Escherichia coli BW25113 and fur mutant strains were cultivated at 37Co in 25 ml of LB medium using Erlenmeyer flasks. 1 ml of OVN culture was transferred to 20 ml of fresh LB medium and cells were incubated in the presence or absence of ciprofloxacin (100 ng
GSE55662	Escherichia coli K-12
GSE55662	FUR_CPR_1
GSE55662	FUR_CPR_2
GSE55662	FUR_noCPR_1
GSE55662	FUR_noCPR_2
GSE55662	genotype
GSE55662	Non-treated, fur mutant sample at T0, biological rep 1
GSE55662	Non-treated, fur mutant sample at T0, biological rep 2
GSE55662	Non-treated, WT control at T0, biological rep 1
GSE55662	Non-treated, WT control at T0, biological rep 2
GSE55662	Samples for microarray analyses were taken before ciprofloxacin treatment (t0) and then at 1 hour post-treatment (t1). Cell concentration was adjusted to 109 cells
GSE55662	We compared the microarray-determined mRNA profiles (Affymetrix E. coli Genome 2.0 Array) of Δfur and WT genotypes in response to ciprofloxacin treatment (100 ng
GSE55662	WT_CPR_1
GSE55662	WT_CPR_2
GSE55662	WT_noCPR_1
GSE55662	WT_noCPR_2
GSE55719	Cells were grown in the minimal media, modified M63. The final cell concentrations were controlled ~ 10^8 cells
GSE55719	condition: histidine depleted
GSE55719	condition: histidine supplied, 1 mM
GSE55719	Escherichia coli
GSE55719	Microarray data were processed using custom scripts written in R based on the finite hybridisation (FH) model (Ono et al, 2008) and the thermodynamic model of non-specific binding (NSB) on short nucleotide microarrays (Furusawa et al, 2009). The log10 mRNA concentration (pM) data are provided as a supplementary file on the SERIES record.
GSE55719	OSU11, histidine depleted, >10 hrs
GSE55719	OSU11, histidine depleted, >10 hrs, rep 1
GSE55719	OSU11, histidine depleted, >10 hrs, rep 2
GSE55719	OSU11, histidine depleted, >10 hrs, rep 3
GSE55719	OSU11, histidine depleted, 10 min
GSE55719	OSU11, histidine depleted, 10 min, rep 1
GSE55719	OSU11, histidine depleted, 10 min, rep 2
GSE55719	OSU11, histidine depleted, 10 min, rep 3
GSE55719	OSU11, histidine depleted, 2 hrs
GSE55719	OSU11, histidine depleted, 2 hrs, rep 1
GSE55719	OSU11, histidine depleted, 2 hrs, rep 2
GSE55719	OSU11, histidine depleted, 2 hrs, rep 3
GSE55719	OSU11, histidine supplied, 1 mM
GSE55719	OSU11, histidine supplied, 1 mM, rep 1
GSE55719	OSU11, histidine supplied, 1 mM, rep 2
GSE55719	OSU11, histidine supplied, 1 mM, rep 3
GSE55719	OSU12-hisA, histidine depleted, >10 hrs
GSE55719	OSU12-hisA, histidine depleted, >10 hrs, rep 1
GSE55719	OSU12-hisA, histidine depleted, >10 hrs, rep 2
GSE55719	OSU12-hisA, histidine depleted, >10 hrs, rep 3
GSE55719	OSU12-hisA, histidine depleted, 10 min
GSE55719	OSU12-hisA, histidine depleted, 10 min, rep 1
GSE55719	OSU12-hisA, histidine depleted, 10 min, rep 2
GSE55719	OSU12-hisA, histidine depleted, 10 min, rep 3
GSE55719	OSU12-hisA, histidine depleted, 2 hrs
GSE55719	OSU12-hisA, histidine depleted, 2 hrs, rep 1
GSE55719	OSU12-hisA, histidine depleted, 2 hrs, rep 2
GSE55719	OSU12-hisA, histidine depleted, 2 hrs, rep 3
GSE55719	OSU12-hisA, histidine supplied, 1 mM
GSE55719	OSU12-hisA, histidine supplied, 1 mM, rep 1
GSE55719	OSU12-hisA, histidine supplied, 1 mM, rep 2
GSE55719	OSU12-hisA, histidine supplied, 1 mM, rep 3
GSE55719	OSU12-hisB, histidine depleted, >10 hrs
GSE55719	OSU12-hisB, histidine depleted, >10 hrs, rep 1
GSE55719	OSU12-hisB, histidine depleted, >10 hrs, rep 2
GSE55719	OSU12-hisB, histidine depleted, >10 hrs, rep 3
GSE55719	OSU12-hisB, histidine depleted, 10 min
GSE55719	OSU12-hisB, histidine depleted, 10 min, rep 1
GSE55719	OSU12-hisB, histidine depleted, 10 min, rep 2
GSE55719	OSU12-hisB, histidine depleted, 10 min, rep 3
GSE55719	OSU12-hisB, histidine depleted, 2 hrs
GSE55719	OSU12-hisB, histidine depleted, 2 hrs, rep 1
GSE55719	OSU12-hisB, histidine depleted, 2 hrs, rep 2
GSE55719	OSU12-hisB, histidine depleted, 2 hrs, rep 3
GSE55719	OSU12-hisB, histidine supplied, 1 mM
GSE55719	OSU12-hisB, histidine supplied, 1 mM, rep 1
GSE55719	OSU12-hisB, histidine supplied, 1 mM, rep 2
GSE55719	OSU12-hisB, histidine supplied, 1 mM, rep 3
GSE55719	OSU12-hisC, histidine depleted, >10 hrs
GSE55719	OSU12-hisC, histidine depleted, >10 hrs, rep 1
GSE55719	OSU12-hisC, histidine depleted, >10 hrs, rep 2
GSE55719	OSU12-hisC, histidine depleted, >10 hrs, rep 3
GSE55719	OSU12-hisC, histidine depleted, 10 min
GSE55719	OSU12-hisC, histidine depleted, 10 min, rep 1
GSE55719	OSU12-hisC, histidine depleted, 10 min, rep 2
GSE55719	OSU12-hisC, histidine depleted, 10 min, rep 3
GSE55719	OSU12-hisC, histidine depleted, 2 hrs
GSE55719	OSU12-hisC, histidine depleted, 2 hrs, rep 1
GSE55719	OSU12-hisC, histidine depleted, 2 hrs, rep 2
GSE55719	OSU12-hisC, histidine depleted, 2 hrs, rep 3
GSE55719	OSU12-hisC, histidine supplied, 1 mM
GSE55719	OSU12-hisC, histidine supplied, 1 mM, rep 1
GSE55719	OSU12-hisC, histidine supplied, 1 mM, rep 2
GSE55719	OSU12-hisC, histidine supplied, 1 mM, rep 3
GSE55719	OSU12-hisD, histidine depleted, 10 min
GSE55719	OSU12-hisD, histidine depleted, 10 min, rep 1
GSE55719	OSU12-hisD, histidine depleted, 10 min, rep 2
GSE55719	OSU12-hisD, histidine depleted, 10 min, rep 3
GSE55719	OSU12-hisD, histidine depleted, 2 hrs
GSE55719	OSU12-hisD, histidine depleted, 2 hrs, rep 1
GSE55719	OSU12-hisD, histidine depleted, 2 hrs, rep 2
GSE55719	OSU12-hisD, histidine depleted, 2 hrs, rep 3
GSE55719	OSU12-hisD, histidine supplied, 1 mM
GSE55719	OSU12-hisD, histidine supplied, 1 mM, rep 1
GSE55719	OSU12-hisD, histidine supplied, 1 mM, rep 2
GSE55719	OSU12-hisD, histidine supplied, 1 mM, rep 3
GSE55719	OSU12-hisF, histidine depleted, >10 hrs
GSE55719	OSU12-hisF, histidine depleted, >10 hrs, rep 1
GSE55719	OSU12-hisF, histidine depleted, >10 hrs, rep 2
GSE55719	OSU12-hisF, histidine depleted, >10 hrs, rep 3
GSE55719	OSU12-hisF, histidine depleted, 10 min
GSE55719	OSU12-hisF, histidine depleted, 10 min, rep 1
GSE55719	OSU12-hisF, histidine depleted, 10 min, rep 2
GSE55719	OSU12-hisF, histidine depleted, 10 min, rep 3
GSE55719	OSU12-hisF, histidine depleted, 2 hrs
GSE55719	OSU12-hisF, histidine depleted, 2 hrs, rep 1
GSE55719	OSU12-hisF, histidine depleted, 2 hrs, rep 2
GSE55719	OSU12-hisF, histidine depleted, 2 hrs, rep 3
GSE55719	OSU12-hisF, histidine supplied, 1 mM
GSE55719	OSU12-hisF, histidine supplied, 1 mM, rep 1
GSE55719	OSU12-hisF, histidine supplied, 1 mM, rep 2
GSE55719	OSU12-hisF, histidine supplied, 1 mM, rep 3
GSE55719	OSU12-hisG, histidine depleted, 10 min
GSE55719	OSU12-hisG, histidine depleted, 10 min, rep 1
GSE55719	OSU12-hisG, histidine depleted, 10 min, rep 2
GSE55719	OSU12-hisG, histidine depleted, 10 min, rep 3
GSE55719	OSU12-hisG, histidine depleted, 2 hrs
GSE55719	OSU12-hisG, histidine depleted, 2 hrs, rep 1
GSE55719	OSU12-hisG, histidine depleted, 2 hrs, rep 2
GSE55719	OSU12-hisG, histidine depleted, 2 hrs, rep 3
GSE55719	OSU12-hisG, histidine supplied, 1 mM
GSE55719	OSU12-hisG, histidine supplied, 1 mM, rep 1
GSE55719	OSU12-hisG, histidine supplied, 1 mM, rep 2
GSE55719	OSU12-hisG, histidine supplied, 1 mM, rep 3
GSE55719	OSU12-hisI, histidine depleted, >10 hrs
GSE55719	OSU12-hisI, histidine depleted, >10 hrs, rep 1
GSE55719	OSU12-hisI, histidine depleted, >10 hrs, rep 2
GSE55719	OSU12-hisI, histidine depleted, >10 hrs, rep 3
GSE55719	OSU12-hisI, histidine depleted, 10 min
GSE55719	OSU12-hisI, histidine depleted, 10 min, rep 1
GSE55719	OSU12-hisI, histidine depleted, 10 min, rep 2
GSE55719	OSU12-hisI, histidine depleted, 10 min, rep 3
GSE55719	OSU12-hisI, histidine depleted, 2 hrs
GSE55719	OSU12-hisI, histidine depleted, 2 hrs, rep 1
GSE55719	OSU12-hisI, histidine depleted, 2 hrs, rep 2
GSE55719	OSU12-hisI, histidine depleted, 2 hrs, rep 3
GSE55719	OSU12-hisI, histidine supplied, 1 mM
GSE55719	OSU12-hisI, histidine supplied, 1 mM, rep 1
GSE55719	OSU12-hisI, histidine supplied, 1 mM, rep 2
GSE55719	OSU12-hisI, histidine supplied, 1 mM, rep 3
GSE55719	strain: DH1 ΔhisA::cat ΔintC::Ptrc-dsred.t4-tetR-PEM7-zeo ΔgalK::PtetA-gfpuv5
GSE55719	strain: DH1 ΔhisB::cat ΔintC::Ptrc-dsred.t4-tetR-PEM7-zeo ΔgalK::PtetA-gfpuv5
GSE55719	strain: DH1 ΔhisC::cat ΔintC::Ptrc-dsred.t4-tetR-PEM7-zeo ΔgalK::PtetA-gfpuv5
GSE55719	strain: DH1 ΔhisD::cat ΔintC::Ptrc-dsred.t4-tetR-PEM7-zeo ΔgalK::PtetA-gfpuv5
GSE55719	strain: DH1 ΔhisF::cat ΔintC::Ptrc-dsred.t4-tetR-PEM7-zeo ΔgalK::PtetA-gfpuv5
GSE55719	strain: DH1 ΔhisG::cat ΔintC::Ptrc-dsred.t4-tetR-PEM7-zeo ΔgalK::PtetA-gfpuv5
GSE55719	strain: DH1 ΔhisI::cat ΔintC::Ptrc-dsred.t4-tetR-PEM7-zeo ΔgalK::PtetA-gfpuv5
GSE55719	strain: DH1 ΔintC::Ptrc-dsred.t4-tetR-PEM7-zeo ΔgalK::PtetA-gfpuv5
GSE55719	The cell culture was put into cold phenol-ethanol solution (1 g of phenol in 10 mL of ethanol) prepared in advance. The cells were collected by centrifugation at 16,000 × g for 5 min at 4°C, and the pelleted cells were stored at –80°C prior to use.
GSE55719	Total RNAs were extracted using an RNeasy mini kit (Qiagen) in accordance with the manufacturer’s instructions.
GSE55972	After 5 h of NP-TiO2 (or mQ water for the control) exposure, cells were incubated for 5 min with two volumes of RNAprotect Bacteria Reagent (Qiagen SAS, France) at room temperature. Cells were then pelleted by centrifugation (7,000 g, 10 min) and the pellet stored at -80°C.
GSE55972	Cell exposure to NP-TiO2 was conducted in 50 ml of sterile Milli-Q water supplemented with 10 mM NaCl. Briefly, 500 µl of the E. coli bacterial suspension and 500 µl of the NP-TiO2 stock suspension (or mQ water for the control) were prepared as previously described and then added to the NaCl solution to obtain final concentrations of 10E7 cells
GSE55972	Ecoli_control_5h_rep1
GSE55972	Ecoli_control_5h_rep2
GSE55972	Ecoli_control_5h_rep3
GSE55972	Ecoli_control_5h_rep4
GSE55972	E.coli, control culture, 5h in 10 mM NaCl, replicate 1
GSE55972	E.coli, control culture, 5h in 10 mM NaCl, replicate 2
GSE55972	E.coli, control culture, 5h in 10 mM NaCl, replicate 3
GSE55972	E.coli, control culture, 5h in 10 mM NaCl, replicate 4
GSE55972	Ecoli_NP-TiO2_5h_rep1
GSE55972	Ecoli_NP-TiO2_5h_rep2
GSE55972	Ecoli_NP-TiO2_5h_rep3
GSE55972	Ecoli_NP-TiO2_5h_rep4
GSE55972	E.coli,  NP-TiO2 exposed culture, 5h in 10 mM NaCl 100mg
GSE55972	Escherichia coli str. K-12 substr. MG1655
GSE55972	Image analysis was performed with GenePix Pro 7 software (Molecular Device), background was defined with the “Local features background median” method. Quantile normalization was applied on the total number of spots in R (version 2.11.1) with the LIMMA software package. Spots corresponding to the E. coli MG1655 K12 species were extracted.
GSE55972	incubation condition: In the dark, 5h, 20°C, 150 rpm
GSE55972	incubation medium: 10 mM NaCl
GSE55972	incubation medium: 10 mM NaCl + 100mg
GSE55972	Total RNA was extracted from cells with the UltraClean Microbial RNA isolation kit (MO BIO, CA, USA). After extraction, contaminating DNA was digested with DNAse I (Sigma Aldrich) and total RNA was purified by phenol
GSE56251	E. coli strain MC4100relA+ in mid log phase incubated at 37ºC for 4 hours with 100 μg
GSE56251	E. coli strain MC4100relA+ in mid log phase incubated at 37ºC for 4 hours with 10 μg
GSE56251	E. coli strain MC4100relA+ in mid log phase incubated at 37ºC for 4 hours without treatment.
GSE56251	E. coli strain MC4100relA+ ∆mazEF in mid log phase incubated at 37ºC for 4 hours with 100 μg
GSE56251	E. coli strain MC4100relA+ ∆mazEF in mid log phase incubated at 37ºC for 4 hours with 10 μg
GSE56251	E. coli strain MC4100relA+ ∆mazEF in mid log phase incubated at 37ºC for 4 hours without treatment
GSE56251	E. coli strain MC4100relA+ ∆mazEFlexA3 in mid log phase incubated at 37ºC for 4 hours with 100 μg
GSE56251	E. coli strain MC4100relA+ ∆mazEFlexA3 in mid log phase incubated at 37ºC for 4 hours with 10 μg
GSE56251	E. coli strain MC4100relA+ ∆mazEFlexA3 in mid log phase incubated at 37ºC for 4 hours without treatment
GSE56251	Escherichia coli
GSE56251	Gene selection was done using the False Discovery Rate (FDR) correction procedure for adjusting genes with p-value smaller than 0.05 and Fold Change greater than 2.
GSE56251	genotype: ∆mazEF
GSE56251	genotype: ∆mazEFlexA3
GSE56251	genotype: WT
GSE56251	∆mazEF 0 μg
GSE56251	∆mazEF 100 μg
GSE56251	∆mazEF 10 μg
GSE56251	∆mazEFlexA3 0 μg
GSE56251	∆mazEFlexA3 100 μg
GSE56251	∆mazEFlexA3 10 μg
GSE56251	RMA normalization was performed on CELL files using the Partek Genomic Suite 6.5. Additional statistical analysis was carried out using the Spotfire software package (Somerville, MA, USA) and custom Matlab (R2010B) routines.
GSE56251	sample type: E. coli strain MC4100relA+ in mid log phase incubated at 37ºC for 4 hours with 100 μg
GSE56251	sample type: E. coli strain MC4100relA+ in mid log phase incubated at 37ºC for 4 hours with 10 μg
GSE56251	sample type: E. coli strain MC4100relA+ in mid log phase incubated at 37ºC for 4 hours without treatment.
GSE56251	sample type: E. coli strain MC4100relA+ ∆mazEF in mid log phase incubated at 37ºC for 4 hours with 100 μg
GSE56251	sample type: E. coli strain MC4100relA+ ∆mazEF in mid log phase incubated at 37ºC for 4 hours with 10 μg
GSE56251	sample type: E. coli strain MC4100relA+ ∆mazEF in mid log phase incubated at 37ºC for 4 hours without treatment
GSE56251	sample type: E. coli strain MC4100relA+ ∆mazEFlexA3 in mid log phase incubated at 37ºC for 4 hours with 100 μg
GSE56251	sample type: E. coli strain MC4100relA+ ∆mazEFlexA3 in mid log phase incubated at 37ºC for 4 hours with 10 μg
GSE56251	sample type: E. coli strain MC4100relA+ ∆mazEFlexA3 in mid log phase incubated at 37ºC for 4 hours without treatment
GSE56251	treatment: 0 μg
GSE56251	treatment: 100 μg
GSE56251	treatment: 10 μg
GSE56251	We extracted RNA using RNAprotect Bacteria reagent (Qiagen) and RNeasy Mini Kit (Qiagen) combined with RNase-Free DNase Set (Qiagen) according to the manufacturer’s instructions.
GSE56251	We grew cells in 10 ml M9 minimal medium to OD600=0.5-0.6. Then, we divided each culture into 500µl aliquots to which we added the appropriate concentration of NA.
GSE56251	We incubated each aliquot at 37ºC for 4 hours with NA
GSE56251	WT 0 μg
GSE56251	WT 100 μg
GSE56251	WT 10 μg
GSE56372	Aerobic culture
GSE56372	Basecalls performed using CASAVA version 1.8.2.
GSE56372	Cultures were grown aerobically at 37 °C in 1 L volumes of M9 minimal medium, supplemented with MgSO4 (1 mM), CaCl2 (0.1 mM), and glucose (10 g
GSE56372	Each dataset was normalized to reads per million per position prior to further analysis.
GSE56372	Escherichia coli
GSE56372	ethanol treatment: 40 g EtOH
GSE56372	ethanol treatment: no ethanol exposure
GSE56372	Ethanol was added to 40 g
GSE56372	For metagene analyses (gene-segment analyses and codon-type analyses), pseudogenes and genes not represented in one or more datasets were excluded, leaving 3048 genes in the \all genes\ dataset (see supplementary file for list of genes in \all genes\, \low ribosome occupancy\, and \high ribosome occupancy\ gene sets)
GSE56372	Genome_build: NC_000913.2
GSE56372	Library construction was performed as described in Oh et al. 2011, Cell 147(6):1295-1308 (PMCID: PMC3277850).  Briefly, fragments of total mRNA or ribosome protected mRNA fragments were size selected via gel purification, and ligated to a 5' adenylated DNA oligo. After reverse transcription, the single stranded DNA was circularized and amplified by PCR.
GSE56372	Mutant (EP61) T0 RNA rep 1
GSE56372	Mutant (EP61) T0 RNA rep 2
GSE56372	Mutant (EP61) T0 RP rep 1
GSE56372	Mutant (EP61) T0 RP rep 2
GSE56372	Mutant (EP61) T1 RNA rep 1
GSE56372	Mutant (EP61) T1 RNA rep 2
GSE56372	Mutant (EP61) T1 RP rep 1
GSE56372	Mutant (EP61) T1 RP rep 2
GSE56372	Mutant (EP61) T2 RNA rep 1
GSE56372	Mutant (EP61) T2 RNA rep 2
GSE56372	Mutant (EP61) T2 RP rep 1
GSE56372	Mutant (EP61) T2 RP rep 2
GSE56372	Raw reads were trimmed by two nt from the 5' end (to remove any non-templated nts added by reverse transcriptase), and were then mapped using the Burrows-Wheeler Aligner to the Escherichia coli MG1655 genome (NCBI accession NC_000913).
GSE56372	ribosome-protected: No
GSE56372	ribosome-protected: Yes
GSE56372	RNA-Seq
GSE56372	RNA was extracted from samples using hot phenol. The integrity of total RNA was determined from agarose gels.
GSE56372	Signals mapping to non-coding RNA regions were removed from the datasets (see supplementary file).
GSE56372	strain: EP61
GSE56372	strain: MG1655
GSE56372	Supplementary_files_format_and_content: Gene_lists_GEO.xls; The supplementary file contains gene lists used in data analysis.
GSE56372	Supplementary_files_format_and_content: Processed data files are WIG files with non-coding RNAs removed, normalized to reads per million per position.  Those with a \-\ as the final character in the file name cover the minus strand of the genome; those with a \+\ as the final character in the file name cover the plus strand of the genome.
GSE56372	Wild-type (MG1655) T0 RNA rep 2
GSE56372	Wild-type (MG1655) T0 RP rep 1
GSE56372	Wild-type (MG1655) T0 RP rep 2
GSE56372	Wild-type (MG1655) T1 RNA rep 1
GSE56372	Wild-type (MG1655) T1 RNA rep 2
GSE56372	Wild-type (MG1655) T1 RP rep 1
GSE56372	Wild-type (MG1655) T1 RP rep 2
GSE56372	Wild-type (MG1655) T2 RNA rep 1
GSE56372	Wild-type (MG1655) T2 RNA rep 2
GSE56372	Wild-type (MG1655) T2 RP rep 1
GSE56372	Wild-type (MG1655) T2 RP rep 2
GSE56407	Aerobic culture
GSE56407	Basecalls performed using CASAVA version 1.7
GSE56407	Cells were grown in MOPS minimal medium with 0.2% glucose at 37 degrees C in gas-sparged Roux bottles to mid-log phase.
GSE56407	Culture samples were transferred directly into an ice-cold ethanol
GSE56407	Each dataset was normalized to reads per million per position prior to further analysis.
GSE56407	Escherichia coli
GSE56407	Genome_build: ASM584v1, U00096.2
GSE56407	Library construction was performed as described in Parkhomchuk et al. 2009, Nucleic Acids Res 37: e123. Briefly, ribosome-depleted RNA was fragmented and used as template for cDNA synhtesis. dUTP was included in the second strand synthesis reaction in addition to dTTP to chemically mark the second strand. cDNAs were size-selected and ligated to sequencing adapters followed by dUTP cleavage to generate adapter-ligated single-stranded cDNAs.
GSE56407	Mutant (RL2325) RNA-seq
GSE56407	RNA-Seq
GSE56407	RNA-seq reads were mapped to the E. coli K-12 MG1655 genome (GenBank ID U00096.2) using short oligonucleotide alignment program (SOAP)
GSE56407	RNA was extracted from samples using hot phenol. The integrity of total RNA was determined from agarose gels.
GSE56407	strain: MG1655
GSE56407	strain: RL2325
GSE56407	Supplementary_files_format_and_content: Processed data files are WIG files normalized to reads per million per position.  Those designated \minus\ cover the minus strand of the genome; those with designated \plus\ cover the plus strand of the genome.
GSE56407	Wild-type (MG1655) RNA-seq
GSE56720	Bacteria
GSE56720	Basecalls performed using Casava versions 1.6 or 1.7.
GSE56720	Bowtie alignments against the reference genome were converted to wiggle files. The position of each alignment was mapped to the 3' end of the nascent transcript.
GSE56720	Cell culture was rapidly filtered in 250 mL increments at 37 °C over 0.22 μm nitrocellulose filters (GE) and frozen in liquid nitrogen to simultaneously halt all transcriptional progress. Frozen cells (100 μg) were pulverized on a Qiagen TissueLyser II mixer mill 6 times at 15 Hz for 3 min in the presence of 500 μL frozen lysis buffer (20 mM Tris pH 8, 0.4% Triton X-100, 0.1% NP-40, 100 mM NH4Cl, 50 U
GSE56720	Ecoli_WT_RNAseq
GSE56720	Escherichia coli
GSE56720	For each sample, 500 mL liquid cultures were grown in 2.8 L flasks with shaking (180 rpm) at 37 °C from an OD (600 nm) 0.05 to OD 0.45 ± 0.05. Cells were grown in MOPS EZ rich defined medium with 0.2% glucose (Teknova).
GSE56720	Genome_build: E. coli: NC_000913
GSE56720	genotype
GSE56720	media: MOPS EZ Rich Defined Media
GSE56720	molecule subtype: Total RNA
GSE56720	RNA-Seq
GSE56720	Sequenced reads were trimmed for adaptor sequence.
GSE56720	strain background: MG1655
GSE56720	Supplementary_files_format_and_content: wiggle files with two columns: first column containing chromosome positions and second column containing the number of reads mapped to the position (see publication for details).
GSE56720	The full library construction protocol was described in detail previously (Churchman et al., Nature 2011). Purified total RNA was fragmented and dephosphorylated with T4 PNK, and then ligated to a 5' adenylated DNA oligo to generate RNA ranging from 30-100 nt. The RNA was reverse transcribed, and the single-stranded DNA circularized and PCR amplified.
GSE56720	Trimmed reads were aligned using Bowtie v0.12.7 against the reference genome using parameters -a -v 3 -m 1
GSE56833	Escherichia coli str. K-12 substr. MG1655
GSE56833	EvgSc_1
GSE56833	EvgSc_2
GSE56833	EvgSc mutant rep 1
GSE56833	EvgSc mutant rep 2
GSE56833	EvgSc_ompR_1
GSE56833	EvgSc_ompR_2
GSE56833	EvgSc ompR double mutant rep 1
GSE56833	EvgSc ompR double mutant rep 2
GSE56833	genotype: EvgSc KO
GSE56833	genotype: EvgSc ompR KO
GSE56833	genotype: ompR KO
GSE56833	genotype: Wild Type
GSE56833	LB media
GSE56833	ompR_1
GSE56833	ompR_2
GSE56833	ompR mutant rep 1
GSE56833	ompR mutant rep 2
GSE56833	RNA was extracted using RNAeasy columns (Qiagen) following the manufacturer's recommendations. RNA was quantified using a NanoDrop-1000 spectrophotometer and quality was monitored with the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA).
GSE56833	strain: MG1655
GSE56833	The scanned images were analyzed with Feature Extraction Software 10.5 (Agilent) using default parameters (protocol GE1_105_Dec08).
GSE56833	wild type rep 1
GSE56833	wild type rep 2
GSE56833	WT_1
GSE56833	WT_2
GSE57245	Automatic extractor in Verigene system of genomic DNA
GSE57245	Blood culture
GSE57245	Blood culture bottle
GSE57245	culture system: BACTEC
GSE57245	Direct testing of culture broth (Standard) or after centrifugation of culture broth (Supernatant)
GSE57245	Escherichia coli
GSE57245	gram status: Gram-negative
GSE57245	Sample 79
GSE57245	Scatter signal intensity after illumination at 150 ms exposure without normalization, without transformation. The non-normalized signals form the basis of conclusions in the accompanying manuscript.
GSE57245	source: Peripheral blood
GSE57245	treatment: Supernatant
GSE57784	Cells were grown at 30°C in LB medium to an OD600 of 0.55-0.6
GSE57784	culture denity: OD600=0.55-0.6 culture
GSE57784	Escherichia coli
GSE57784	genotype
GSE57784	LOWESS normalized, background subtracted data obtained from signals. Agilent GeneSpring GX 7.3 was used.
GSE57784	pFlag-only control
GSE57784	RhIB wild type
GSE57784	RhlBP238L mutant
GSE57784	RhlBP238L vs flag only 1
GSE57784	RhlBP238L vs flag only 2
GSE57784	RhlBP238L vs flag only 3
GSE57784	RhlBwt vs flag only 1
GSE57784	RhlBwt vs flag only 2
GSE57784	RhlBwt vs flag only 3
GSE57784	strain: BL21 (DE3) rne131 DrhlB
GSE57784	Total RNA was isolated according to the RNeasy Mini Kit (QIAGEN) manufacturer's protocol.
GSE58285	All cultures grown up to 0.6 OD600 with shaking at 200 rpm. Samples 1,2,5 and 6 were grown at 30°C whereas samples 3 and 4 were grown at 37°C.
GSE58285	analysis: in vitro
GSE58285	analysis: in vivo
GSE58285	Basecalls were performed using CASAVA.1.8
GSE58285	Cultures for samples 1 and 2 were incubated at 44°C for 45 min after growth.
GSE58285	E. coli cell cultures
GSE58285	Escherichia coli
GSE58285	Genome_build: U00096.2
GSE58285	genotype: n
GSE58285	genotype: rne-3071 (ts)
GSE58285	genotype: rne wild-type
GSE58285	genotype: rng mutant
GSE58285	genotype: rng wild-type
GSE58285	incubation time: 0 min
GSE58285	incubation time: 10 min
GSE58285	incubation time: n
GSE58285	Libraries were prepared for sequencing using standard Illumina protocols
GSE58285	RNA-Seq
GSE58285	rne-3071 ts
GSE58285	rne wild-type
GSE58285	rng mutant
GSE58285	rng wild-type
GSE58285	Sequence reads were trimmed for adaptor reads and mapped to E. coli K12 MG1655 genome using CLC Genomics Workbench 6.0.1
GSE58285	strain: BW25113
GSE58285	strain: GM11
GSE58285	strain: MC1061
GSE58285	strain: N3431
GSE58285	strain: N3433
GSE58285	Supplementary_files_format_and_content: Processed files are in tab delimited format. Separate files are provided for the forward and reverse strands. The start and end coordinates should be the same. Each line in the data set represents the position of the first nucleotide at the 5' end of a sequence that could be mapped to the E. coli genome.
GSE58285	T170V 0 min
GSE58285	T170V 10 min
GSE58285	Total RNA was isolated as desribed in Kime et al., 2008
GSE58556	All samples were extracted using the hot phenol extraction with DNA digestion, following standard protocol
GSE58556	BigWIG files were viewed and annotated using Jbrowse and Integrated Genome Viewer.
GSE58556	cDNA libraries were constructed at Vertis in Germany using a ligation based stratagey for Illumina whole transcriptome sequencing. Total RNA (DNase I digested) was fragmented by RNase III. RNA samples labeled as TEX were also subsequently digested with Terminator Exonuclease (TEX). Pyrophosphate groups were removed from the 5′ terminus using tobacco acid pyrophosphatase (TAP), and an RNA adapter was ligated to the 5′ end of the RNA. First-strand synthesis was performed using standard Illumina protocols.
GSE58556	Cell culture
GSE58556	Escherichia coli BW38028
GSE58556	For alignment of the reads contained within the fastq files to the E. coli MG1655 reference genome (RefSeq NC_U00096.3), the short read alignment tool Bowtie2 was utilized under default settings.  Bowtie parameters were set to include only perfect matches and map once reads that map to more than one genome location, i.e., uniquely mapped reads are retained. The output Bowtie2 was a SAM files for each sample.
GSE58556	Genome_build: Reference genome for E. coli MG1655 (RefSeq NC_000913.3).
GSE58556	genotype: rpoS
GSE58556	genotype: wt
GSE58556	growth phase: 30 min post stationary
GSE58556	growth phase: Log phase OD 0.4
GSE58556	Prior to total RNA extraction harvested bacterial cells were stored at -80.0°C in an equal volume of RNAlater.
GSE58556	RNA-Seq
GSE58556	rpoS_N_strv
GSE58556	rpoS_N_strv_TEX
GSE58556	sample type: no RNA treatment
GSE58556	Sequence data was processed by conversion of the sample alignment (BAM) files to strand-specific base count (BigWIG) files. To accomplish this an in-house script was created to extract strand-specific base count data from BAM files (outputs are positive and negative strand BigWIG files).
GSE58556	strain: BW38028
GSE58556	Supplementary_files_format_and_content: BigWIG files are provided showing uniquely mapped sequence reads.
GSE58556	The data output from the Illumina Hiseq System was obtained directly from Vertis
GSE58556	treatment: Carbon starvation
GSE58556	treatment: log phase sample
GSE58556	treatment: Nitrogen starvation
GSE58556	Used SAMTOOLS (Li, et al., PMID 1950593) to sort and index the SAM files obtained from Bowtie2 and convert them to BAM format.
GSE58556	Wild type E. coli K-12 (strain BW38038) and BW39452(ΔrpoS) cultures were grown on MOPS glucose minimal medium with 0.2% glucose as sole carbon source at 37°C, pH was initially 7.4,  and the agitation speed was 500 rpm. Culture samples were harvested during logarithmic growth and  following entry into stationary phase for the WT and rpoS mutant. OD600 measurements were made on a Beckman Coulter DU 800 spectrophotometer. Samples were harvested directly into ice-cold RNAlater at a 1:1 dilution to protect RNA from degradation and cells then were pelleted by centrifugation at 8000rpm for 10 minutes. Cell pellets were stored at -80°C in an equal volume of RNAlater prior to RNA extraction.
GSE58556	WT_glucose_log
GSE58556	WT_glucose_log_TEX
GSE58556	WT_glucose_stat
GSE58556	WT_glucose_stat_TEX
GSE58556	WT_N_strv
GSE58556	WT_N_strv_TEX
GSE58623	10 mM of sodium phosphate and formaldehyde to a final concentration of 1% were then added. After 10min of incubation at room temperature, the samples were incubated 30 min in ice
GSE58623	bacterial cell culture
GSE58623	chip antibody: anti-Flag (Sigma)
GSE58623	ChIP-Seq
GSE58623	Cross-linked cells were harvested and washed two times with ice-cold PBS. Cells were resuspended in 450μl of TES buffer (50mM Tris-HCl pH 7.5, 150mM NaCl) and 20μl of lysis solution (13.6mg
GSE58623	Escherichia coli
GSE58623	Genome_build: Reference genome used: Escherichia coli K12 MG1655, version: iGenome
GSE58623	genotype: wild type
GSE58623	genotype: ΔbolA
GSE58623	Library construction was performed by processing in vitro samples to generate a library of short inserts (the DNA Colonies Template Library) by Fasteris SA, Switzerland
GSE58623	Mapping was performed using BWA tool (version 0.5.9) against the reference genome
GSE58623	Peak detection and count of coverage were done using SEQMONK version 0.21.0 by Fasteris SA
GSE58623	Reference genome used: Escherichia coli K12 MG1655, version: iGenome
GSE58623	strain: no tag
GSE58623	strain: wt 3xflag strain
GSE58623	Supplementary_files_format_and_content: .txt file file with raw and normalized counts of coverage
GSE58623	The ΔbolA and wt 3xflag strains were used to perform ChIP-seq experiments. Overnight cultures were diluted 1
GSE58623	wild type
GSE58623	ΔbolA
GSE58637	At OD ~0.3, cultures were induced with 1mM IPTG for the appropriate length of time.
GSE58637	bacteria
GSE58637	Bacteria were grown at 30C with shaking (~200 rpm) in fully supplemented MOPS glucose media (Teknova) to OD420 ~0.4. Cultures were split into 4 subcultures, and grown to OD ~0.3.
GSE58637	Basecalls performed using Casava versions 1.6 or 1.7.
GSE58637	Bowtie alignments against the E coli genome were converted to wiggle files. The position of each alignment is distributed into several nucleotides in the center of the footprint. For each footprint read, the center residues that are at least 10 nucleotides away from either ends were given the same score, which is weighted by the length of the fragment [Oh et al,. Cell 147, 1295 (2011)]. Scores therefore represent the number of read alignments attributed to each genomic position under each scoring scheme.
GSE58637	Escherichia coli
GSE58637	Extraction was performed as described in detail previously (Li et al., 2012; Oh et al., 2011). 200 ml of cell culture was rapidly filtered at 37C by passing through a nitrocellulose filter. Cell pellets was were rapidly collected using a pre-warmed metal table crumber, flash frozen in liquid nitrogen, and combined with frozen droplets of lysis buffer. Cells and lysis buffer were pulverized in 10 ml canisters (Retsch) pre-chilled in liquid nitrogen using Qiagen TissueLyser II. Pulverized lysate was thawed on ice and clarified by centrifugation at 4C.
GSE58637	Genome_build: NC000913.2
GSE58637	media: fully supplemented MOPS glucose media
GSE58637	molecule subtype: mRNA
GSE58637	molecule subtype: ribosome protected mRNA
GSE58637	mRNA-seq in rich defined media
GSE58637	mRNA-seq MicL-S t0
GSE58637	mRNA-seq MicL-S t10
GSE58637	mRNA-seq MicL-S t20
GSE58637	mRNA-seq MicL-S t4
GSE58637	mRNA-seq MicL t0
GSE58637	mRNA-seq MicL t10
GSE58637	mRNA-seq MicL t20
GSE58637	mRNA-seq MicL t4
GSE58637	mRNA-seq Vector t0
GSE58637	mRNA-seq Vector t20
GSE58637	mRNA-seq WT t10
GSE58637	mRNA-seq WT t4
GSE58637	plasmid: empty vector
GSE58637	plasmid: pMicL
GSE58637	plasmid: pMicL-S
GSE58637	ribosome profiling in rich defined media
GSE58637	ribosome profiling MicL t0
GSE58637	ribosome profiling MicL t20
GSE58637	Ribosome protected and total mRNA fragments were size selected via gel purification. Fragments were ligated to 5' adenylated DNA oligo. After reverse transcription, the single stranded DNA was circularized, and PCR amplified [Oh et al,. Cell 147, 1295 (2011)]. More details at MS Guo, TB Updegrove, et al, Genes Dev. (2014).
GSE58637	RNA-Seq
GSE58637	Sequenced reads were trimmed for adaptor sequence.
GSE58637	strain: MG1655
GSE58637	Supplementary_files_format_and_content: wiggle files with two columns: first column containing chromosome positions and second column containing the number of reads mapped to the position (see publication for details).
GSE58637	Trimmed reads were sequentially aligned using Bowtie v0.12.7 to E coli genome using parameters -v 1 -m 1 --best. This allows one mismatch and reports only reads that align 1 or fewer times to the genome
GSE58806	biological replicate: 318
GSE58806	biological replicate: 320
GSE58806	biological replicate: 327
GSE58806	Cells (10 ml) for transcriptomic analysis were collected into tubes containing 1.25 ml ice-cold 5% (vol
GSE58806	Escherichia coli
GSE58806	Fermentations were carried out in 3 L bioreactors (Applikon Biotechnology) containing 2.45 L of ACSH or SynH media, and cultures were diluted into ACSH or SynH with initial OD at 0.2, grown anaerobically overnight, and then inoculated into bioreactors to a starting OD600 of 0.2
GSE58806	GLBRCE1, ACSH, Exp
GSE58806	GLBRCE1_ACSH_Exp_rep318_1
GSE58806	GLBRCE1_ACSH_Exp_rep320_1
GSE58806	GLBRCE1_ACSH_Exp_rep327_1
GSE58806	GLBRCE1, ACSH, Stat1
GSE58806	GLBRCE1_ACSH_Stat1_rep318_1
GSE58806	GLBRCE1_ACSH_Stat1_rep320_1
GSE58806	GLBRCE1_ACSH_Stat1_rep327_1
GSE58806	GLBRCE1, ACSH, Stat2
GSE58806	GLBRCE1_ACSH_Stat2_rep318_1
GSE58806	GLBRCE1_ACSH_Stat2_rep320_1
GSE58806	GLBRCE1_ACSH_Stat2_rep327_1
GSE58806	GLBRCE1, ACSH, Trans
GSE58806	GLBRCE1_ACSH_Trans_rep318_1
GSE58806	GLBRCE1_ACSH_Trans_rep318_2
GSE58806	GLBRCE1_ACSH_Trans_rep320_1
GSE58806	GLBRCE1_ACSH_Trans_rep327_1
GSE58806	GLBRCE1, SynH, Exp
GSE58806	GLBRCE1_SynH_Exp_rep318_1
GSE58806	GLBRCE1_SynH_Exp_rep318_2
GSE58806	GLBRCE1_SynH_Exp_rep320_1
GSE58806	GLBRCE1_SynH_Exp_rep327_1
GSE58806	GLBRCE1, SynH_LT, Exp
GSE58806	GLBRCE1_SynH_LT_Exp_rep318_1
GSE58806	GLBRCE1_SynH_LT_Exp_rep320_1
GSE58806	GLBRCE1_SynH_LT_Exp_rep327_1
GSE58806	GLBRCE1, SynH_LT, Stat1
GSE58806	GLBRCE1_SynH_LT_Stat1_rep318_1
GSE58806	GLBRCE1_SynH_LT_Stat1_rep320_1
GSE58806	GLBRCE1_SynH_LT_Stat1_rep327_1
GSE58806	GLBRCE1, SynH_LT, Stat2
GSE58806	GLBRCE1_SynH_LT_Stat2_rep318_1
GSE58806	GLBRCE1_SynH_LT_Stat2_rep320_1
GSE58806	GLBRCE1_SynH_LT_Stat2_rep327_1
GSE58806	GLBRCE1, SynH_LT, Trans
GSE58806	GLBRCE1_SynH_LT_Trans_rep318_1
GSE58806	GLBRCE1_SynH_LT_Trans_rep320_1
GSE58806	GLBRCE1_SynH_LT_Trans_rep327_1
GSE58806	GLBRCE1, SynH, Stat1
GSE58806	GLBRCE1_SynH_Stat1_rep318_1
GSE58806	GLBRCE1_SynH_Stat1_rep320_1
GSE58806	GLBRCE1_SynH_Stat1_rep327_1
GSE58806	GLBRCE1, SynH, Stat2
GSE58806	GLBRCE1_SynH_Stat2_rep327_1
GSE58806	GLBRCE1, SynH, Trans
GSE58806	GLBRCE1_SynH_Trans_rep318_1
GSE58806	GLBRCE1_SynH_Trans_rep320_1
GSE58806	GLBRCE1_SynH_Trans_rep327_1
GSE58806	growth phase: Exp
GSE58806	growth phase: Stat1
GSE58806	growth phase: Stat2
GSE58806	growth phase: Trans
GSE58806	medium: ACSH
GSE58806	medium: SynH
GSE58806	medium: SynH_LT
GSE58806	Probe signal intensities were preprocessed using robust multichip averaging (RMA) in the program ArrayStar (DNASTAR), and the resulting gene expression signals were quantile-normalized across all samples using the normalize.quantiles function in the Bioconductor package for R.
GSE58806	RNA was obtained from cells pellets by lysozyme treatment and phenol-chloroform extraction, analyzed by agarose gel electrophoresis to confirm integrity, quantified using a Nanodrop spectrophotometer (Thermo Scientific), and stored at -80°C
GSE58806	strain: GLBRCE1
GSE58806	technical replicate: 1
GSE58806	technical replicate: 2
GSE58902	Cells (10 ml) for transcriptomic analysis were collected into tubes containing 1.25 ml ice-cold 5% (vol
GSE58902	E.coli ethanologen strain GLBRCE1 or GLBRCE1 lacking the plasmid-borne PET cassette (GLBRCE1_pBBR) was grown in AFEX corn stover hydrolysate (ACSH). Fermentations were carried out in 3 L bioreactors (Applikon Biotechnology) containing 2.45 L of ACSH and cultures were diluted into ACSH with initial OD at 0.2, grown anaerobically overnight, and then inoculated into bioreactors to a starting OD600 of 0.2.  One biological replicate was grown in each medium.  RNA samples were obtained at 3 time points, corresponding to mid-exponential (Exp), transitional (Trans), and stationary (Stat) growth phases.
GSE58902	Escherichia coli
GSE58902	Escherichia coli GLBRCE1
GSE58902	Escherichia coli GLBRCE1_pBBR
GSE58902	GLBRCE1_ACSH_Exp
GSE58902	GLBRCE1_ACSH_Stat
GSE58902	GLBRCE1_ACSH_Trans
GSE58902	GLBRCE1_pBBR_ACSH_Exp
GSE58902	GLBRCE1_pBBR_ACSH_Stat
GSE58902	GLBRCE1_pBBR_ACSH_Trans
GSE58902	growth phase: Exp
GSE58902	growth phase: Stat
GSE58902	growth phase: Trans
GSE58902	medium: ACSH
GSE58902	Probe signal intensities were preprocessed using robust multichip averaging (RMA) in the program ArrayStar (DNASTAR), and the resulting gene expression signals were quantile-normalized across all samples using the normalize.quantiles function in the Bioconductor package for R.
GSE58902	RNA was obtained from cells pellets by lysozyme treatment and phenol-chloroform extraction, analyzed by agarose gel electrophoresis to confirm integrity, quantified using a Nanodrop spectrophotometer (Thermo Scientific), and stored at -80°C
GSE58902	strain: GLBRCE1
GSE58902	strain: GLBRCE1_pBBR
GSE58976	Cells (10 ml) for transcriptomic analysis were collected into tubes containing 1.25 ml ice-cold 5% (vol
GSE58976	Escherichia coli
GSE58976	Escherichia coli GLBRCE1
GSE58976	Fermentations were carried out in 3 L bioreactors (Applikon Biotechnology) containing 2.45 L of ACSH or SynH media, and cultures were diluted into ACSH or SynH with initial OD at 0.2, grown anaerobically overnight, and then inoculated into bioreactors to a starting OD600 of 0.2
GSE58976	growth phase: log phase
GSE58976	growth phase: stat 1
GSE58976	growth phase: stat 2
GSE58976	growth phase: transition
GSE58976	LIMS477_S1_T10
GSE58976	LIMS477_S1_T3
GSE58976	LIMS477_S1_T6
GSE58976	LIMS477_S2_T4
GSE58976	LIMS477_S2_T6
GSE58976	LIMS477_S2_T8
GSE58976	LIMS477_S3_T11
GSE58976	LIMS477_S3_T3
GSE58976	LIMS477_S3_T6
GSE58976	LIMS477_S5_T4
GSE58976	LIMS477_S5_T6
GSE58976	LIMS477_S5_T8
GSE58976	LIMS484_S1_T3
GSE58976	LIMS484_S1_T6
GSE58976	LIMS484_S1_T8
GSE58976	LIMS484_S2_T2
GSE58976	LIMS484_S2_T6
GSE58976	LIMS484_S2_T8
GSE58976	LIMS484_S5_T2
GSE58976	LIMS484_S5_T6
GSE58976	LIMS484_S5_T8
GSE58976	LIMS484_S6_T4
GSE58976	LIMS484_S6_T6
GSE58976	LIMS484_S6_T8
GSE58976	medium: SynH
GSE58976	medium: SynH + LTs
GSE58976	medium: SynH w
GSE58976	Probe signal intensities were preprocessed using robust multichip averaging (RMA) in the program ArrayStar (DNASTAR), and the resulting gene expression signals were quantile-normalized across all samples using the normalize.quantiles function in the Bioconductor package for R.
GSE58976	RNA was obtained from cells pellets by lysozyme treatment and phenol-chloroform extraction, analyzed by agarose gel electrophoresis to confirm integrity, quantified using a Nanodrop spectrophotometer (Thermo Scientific), and stored at -80°C
GSE58976	strain: GLBRCE1
GSE58977	Cells (10 ml) for transcriptomic analysis were collected into tubes containing 1.25 ml ice-cold 5% (vol
GSE58977	Escherichia coli
GSE58977	Escherichia coli GLBRCE1
GSE58977	Fermentations were carried out in 3L bioreactors (Applikon Biotechnology) containing 2.45L of ACSH, SynH, SynH+LT, or SynH + Acid
GSE58977	growth phase: Exp
GSE58977	growth phase: Exp1
GSE58977	growth phase: Exp2
GSE58977	growth phase: Exp3
GSE58977	growth phase: Stat
GSE58977	growth phase: Stat1
GSE58977	growth phase: Stat2
GSE58977	growth phase: Trans
GSE58977	medium: ACSH
GSE58977	medium: SynH
GSE58977	medium: SynH_Acids_Amides
GSE58977	medium: SynH_LT
GSE58977	Probe signal intensities were preprocessed using robust multichip averaging (RMA) in the program ArrayStar (DNASTAR), and the resulting gene expression signals were quantile-normalized across all samples using the normalize.quantiles function in the Bioconductor package for R.
GSE58977	RNA was obtained from cells pellets by lysozyme treatment and phenol-chloroform extraction, analyzed by agarose gel electrophoresis to confirm integrity, quantified using a Nanodrop spectrophotometer (Thermo Scientific), and stored at -80°C
GSE58977	strain: GLBRCE1
GSE58977	X515_V1_T4_424287A03
GSE58977	X515_V1_T4_475655A02
GSE58977	X515_V1_T6_475649A04s
GSE58977	X515_V1_T7_475654A02
GSE58977	X515_V1_T8_475585A04
GSE58977	X515_V2_T4_424219A04
GSE58977	X515_V2_T4_475655A03
GSE58977	X515_V2_T6_475644A04
GSE58977	X515_V2_T7_475649A01
GSE58977	X515_V2_T8_424219A01s
GSE58977	X515_V3_T4_475585A02s
GSE58977	X515_V3_T6_424221A04
GSE58977	X515_V3_T7_475649A02
GSE58977	X515_V3_T8_475641A04
GSE58977	X515_V4_T4_475585A03
GSE58977	X515_V4_T4_475644A01
GSE58977	X515_V4_T6_424221A03
GSE58977	X515_V4_T7_424287A04
GSE58977	X515_V4_T8_475655A04
GSE58977	X520_V1_T4_424221A01
GSE58977	X520_V1_T6_475649A03
GSE58977	X520_V1_T7_475655A01
GSE58977	X520_V1_T8_475641A01
GSE58977	X520_V2_T3_424221A02
GSE58977	X520_V2_T4_475641A03
GSE58977	X520_V2_T6_424287A02
GSE58977	X520_V2_T7_475654A01
GSE58977	X520_V2_T8_424219A02
GSE58977	X520_V3_T4_475654A04
GSE58977	X520_V3_T6_475641A02
GSE58977	X520_V3_T7_475644A02s
GSE58977	X520_V3_T8_424219A03
GSE58977	X520_V4_T4_475654A03
GSE58977	X520_V4_T6_424287A01
GSE58977	X520_V4_T7_475644A03
GSE58977	X520_V4_T8_475585A01
GSE59050	Each strain was inoculated from the frozen stock into 10 mL of M9 medium for preculture. Five-microliter aliquots of preculture medium cells were inoculated into the fresh minimal media, M9 with 5%(v
GSE59050	Escherichia coli
GSE59050	Evolved strain A, time point 1
GSE59050	Evolved strain A, time point 2
GSE59050	Evolved strain A, time point 3
GSE59050	Evolved strain A, time point 4
GSE59050	Evolved strain A, time point 5
GSE59050	Evolved strain B, time point 1
GSE59050	Evolved strain B, time point 2
GSE59050	Evolved strain B, time point 3
GSE59050	Evolved strain B, time point 4
GSE59050	Evolved strain B, time point 5
GSE59050	Evolved strain C, time point 1
GSE59050	Evolved strain C, time point 2
GSE59050	Evolved strain C, time point 3
GSE59050	Evolved strain C, time point 4
GSE59050	Evolved strain C, time point 5
GSE59050	Evolved strain D, time point 1
GSE59050	Evolved strain D, time point 2
GSE59050	Evolved strain D, time point 3
GSE59050	Evolved strain D, time point 4
GSE59050	Evolved strain D, time point 5
GSE59050	Evolved strain E, time point 1
GSE59050	Evolved strain E, time point 2
GSE59050	Evolved strain E, time point 3
GSE59050	Evolved strain E, time point 4
GSE59050	Evolved strain E, time point 5
GSE59050	Evolved strain F, time point 1
GSE59050	Evolved strain F, time point 2
GSE59050	Evolved strain F, time point 3
GSE59050	Evolved strain F, time point 4
GSE59050	Evolved strain F, time point 5
GSE59050	Log10 mRNA concentration (pM) data are provided as a supplementary file. Expression levels were normalized using the quantile normalization method (Bolstad et al., 2003).
GSE59050	Parent strain of experimental evolution
GSE59050	Parent strain of experimental evolution as adaptive evolved E. coli W3110 strain to M9 synthetic medium without ethanol stress
GSE59050	platform_id_id design: EcFS_1
GSE59050	platform_id_id design: EcFS_2
GSE59050	platform_id_id design: EcFS_3
GSE59050	Strain A of experimental evolution under ethanol stress in 1224 hours.
GSE59050	Strain A of experimental evolution under ethanol stress in 1824 hours.
GSE59050	Strain A of experimental evolution under ethanol stress in 2496 hours.
GSE59050	Strain A of experimental evolution under ethanol stress in 384 hours.
GSE59050	Strain A of experimental evolution under ethanol stress in 744 hours.
GSE59050	strain B of experimental evolution under ethanol stress in 1224 hours.
GSE59050	strain B of experimental evolution under ethanol stress in 1824 hours.
GSE59050	strain B of experimental evolution under ethanol stress in 2496 hours.
GSE59050	strain B of experimental evolution under ethanol stress in 384 hours.
GSE59050	strain B of experimental evolution under ethanol stress in 744 hours.
GSE59050	strain C of experimental evolution under ethanol stress in 1224 hours.
GSE59050	strain C of experimental evolution under ethanol stress in 1824 hours.
GSE59050	strain C of experimental evolution under ethanol stress in 2496 hours.
GSE59050	strain C of experimental evolution under ethanol stress in 384 hours.
GSE59050	strain C of experimental evolution under ethanol stress in 744 hours.
GSE59050	strain D of experimental evolution under ethanol stress in 1224 hours.
GSE59050	strain D of experimental evolution under ethanol stress in 1824 hours.
GSE59050	strain D of experimental evolution under ethanol stress in 2496 hours.
GSE59050	strain D of experimental evolution under ethanol stress in 384 hours.
GSE59050	strain D of experimental evolution under ethanol stress in 744 hours.
GSE59050	strain E of experimental evolution under ethanol stress in 1224 hours.
GSE59050	strain E of experimental evolution under ethanol stress in 1824 hours.
GSE59050	strain E of experimental evolution under ethanol stress in 2496 hours.
GSE59050	strain E of experimental evolution under ethanol stress in 384 hours.
GSE59050	strain E of experimental evolution under ethanol stress in 744 hours.
GSE59050	strain F of experimental evolution under ethanol stress in 1224 hours.
GSE59050	strain F of experimental evolution under ethanol stress in 1824 hours.
GSE59050	strain F of experimental evolution under ethanol stress in 2496 hours.
GSE59050	strain F of experimental evolution under ethanol stress in 384 hours.
GSE59050	strain F of experimental evolution under ethanol stress in 744 hours.
GSE59050	The cells were collected by centrifugation at 8,000 × g for 5 min at 25°C, and the pelleted cells were stored at –80°C prior to use.
GSE59050	To obtain the absolute expression levels of genes from microarray raw data, we used the Finite Hybridization model (Furusawa et al, 2009; Ono et al, 2008).
GSE59050	Total RNA was isolated and purified from cells using an RNeasy mini kit with on-column DNA digestion.
GSE59397	ACSH_Exp_CIYS
GSE59397	ACSH_Exp_CNFT
GSE59397	ACSH_Stat1_CNFW
GSE59397	ACSH_Stat1_CNGG
GSE59397	ACSH_Trans_CIYT
GSE59397	ACSH_Trans_CNFU
GSE59397	Basecalling was done on the sequencers using the sequencer's Real-Time Analysis (RTA) software.  CASAVA was used to process the basecalled data into FASTQ format.
GSE59397	Cells (10 ml) for transcriptomic analysis were collected into tubes containing 1.25 ml ice-cold 5% (vol
GSE59397	Escherichia coli
GSE59397	Escherichia coli GLBRCE1
GSE59397	FASTQ formatted sequence files from strand-specific Illumina RNA-Seq reads were aligned to the GLBRCE1 reference genome NC_000913 using Bowtie version 0.12.7(Langmead et al., 2009) with '--nofw' strand-specific parameter and maximal distance between the paired reads of 1000 bp. NOTE: Genome NC_000913 (ASM584v2) represents the parental strain.  The strain used in our study was modified from the parental strain by replacing gene pflB with an insertion that contained 3 different genes.
GSE59397	Fermentations were carried out in 3 L bioreactors (Applikon Biotechnology) containing 2.45 L of ACSH or SynH media, and cultures were diluted into ACSH or SynH with initial OD at 0.2, grown anaerobically overnight, and then inoculated into bioreactors to a starting OD600 of 0.2
GSE59397	Genome_build: ASM584v2
GSE59397	growth phase: Exp
GSE59397	growth phase: Stat1
GSE59397	growth phase: Trans
GSE59397	medium: ACSH
GSE59397	medium: SynH
GSE59397	medium: SynH_LT
GSE59397	Probabilistic expression counting was performed using the RNA-Seq by Expectation-Maximization (RSEM) version 1.2.4 (Li and Dewey, 2011)
GSE59397	RNA-Seq
GSE59397	RNA was obtained from cells pellets by lysozyme treatment and phenol-chloroform extraction, analyzed by agarose gel electrophoresis to confirm integrity, quantified using a Nanodrop spectrophotometer (Thermo Scientific), and stored at -80°C
GSE59397	strain: GLBRCE1
GSE59397	Supplementary_files_format_and_content: CSV file contains counts generated using RSEM software.  Ribosomal RNA transcripts excluded.
GSE59397	SynH_Exp_BXHU
GSE59397	SynH_Exp_CBYS
GSE59397	SynH_LT_Exp_BXNX
GSE59397	SynH_LT_Exp_CBYU
GSE59397	SynH_LT_Exp_CCOG
GSE59397	SynH_LT_Stat1_BXNB
GSE59397	SynH_LT_Stat1_BXNZ
GSE59397	SynH_LT_Stat1_CHBW
GSE59397	SynH_LT_Trans_BXNC
GSE59397	SynH_LT_Trans_BXXC
GSE59397	SynH_LT_Trans_CBYW
GSE59397	SynH_Stat1_CBYN
GSE59397	SynH_Stat1_CUOC
GSE59397	SynH_Trans_CUNZ
GSE59397	SynH_Trans_CUOB
GSE59397	Total RNA (2ug) was subjected to rRNA depletion using Ribozero rRNA removal kit – Bacteria (Epicenter, illumina). rRNA-depleted RNA was purified using Ampure XP beads. Purified RNA was then fragmented using RNA Fragmentation Reagents (Ambion) at 70C for 2mins, targeting fragments ranging from 200-300bp. Fragmented RNA was then purified using Ampure XP beads (Agencourt). Reverse transcription was performed using SuperScript II Reverse Transcription (Invitrogen) with an initial annealing of random hexamers (Fermentas) at 65C for 5mins, follow by an incubation of 42C for 50mins and an inactivation step at 70C for 10mins. cDNA was then purified with Ampure XP beads. This was followed by second strand synthesis using dNTP mix where dTTP is replaced by dUTP. Reaction was performed at 16C for 1h. Double stranded cDNA fragments were purified and selected for targeted fragments (200-300bp) using Ampure XP beads. The dscDNA were then blunt-ended, the 3' ends were adenylated with a single A, and ligated with library adapters using Kapa Library Amplification Kit (Kapa Biosystems). Adapter-ligated DNA was purified using Ampure XP beads. Digestion of dUTP was then performed using AmpErase UNG (Applied Biosystems) to remove second strand cDNA. Digested cDNA was again cleaned up with Ampure SPRI beads. This was followed by amplification by 10 cycles of PCR using Kapa Library Amplification Kit (Kapa Biosystems). The final library was cleaned up with Ampure SPRI beads. Sequencing was done on the Illumina HiSeq platform generating paired end reads of 100bp each. Note: Target fragments here refers to the insert only, that is the cDNA.  The actual size we use in selection will be larger, typically the target fragment size + 125bp adaptors (~300-450bp).
GSE59441	BW25113 HEPES-glu 30 min 4.5% deoxycholate
GSE59441	BW25113 with deoxycholate stress
GSE59441	BW25113 ΔmqsRA HEPES-glu 30 min 4.5% deoxycholate
GSE59441	BW25113 ΔmqsRA with deoxycholate stress
GSE59441	Cells were lysed using a bead beater (Biospec) and mRNA was isolated using a Qiagen RNeasy mini kit (Cat# 74104).
GSE59441	Cells were pelleted in the presence of RNALater (Applied Biosystems) and flash frozen in ethanol-dry ice.
GSE59441	Data was analyzed in the Affymetrix GenomeChipOperating Software (GCOS).
GSE59441	Escherichia coli BW25113
GSE59441	genotype
GSE59441	Strains were grown in LB at 37°C with shaking at 250 rpm.  16 h overnight cultures were diluted to OD600 = 0.05 in HEPES-glucose (0.4%), grown to OD600 ~ 0.6, and exposed to 4.5% deoxycholate for 30 min.
GSE59682	0.2 ppm deoxynivalenol
GSE59682	0.2 ppm nivalenol
GSE59682	1 ml of each culture with the mycotoxin was centrifuged and total RNA was prepared using Hybrid-RTM kit (Gene All, Seoul, Korea) according to the manufacturer’s protocols. A MICOBExpressTM bacterial mRNA enrichment kit (Ambion, Texas, USA) was used to remove bacterial rRNA from the total RNA samples.
GSE59682	2 ppm deoxynivalenol
GSE59682	2 ppm nivalenol
GSE59682	acetonitrile
GSE59682	Bacterial culture with 0.2 ppm deoxynivalenol
GSE59682	Bacterial culture with 0.2 ppm nivalenol
GSE59682	Bacterial culture with 2 ppm deoxynivalenol
GSE59682	Bacterial culture with 2 ppm nivalenol
GSE59682	Bacterial culture with acetonitrile
GSE59682	concentration: 0.2 ppm
GSE59682	concentration: 2 ppm
GSE59682	condition: acetonitrile (control)
GSE59682	condition: myxotoxin
GSE59682	E. coli K-12 was incubated in 5 ml LB liquid for 16 h at 37°C with constant shaking, and then 100 µl of each myxotoxin dissolved in acetonitrile was added to each culture to a final concentration of 0.2, and 2 ppm. Additional incubation was performed for 2 h.
GSE59682	Escherichia coli
GSE59682	Genome_build: Escherichia coli K-12 substr. DH10B ASM1942v1
GSE59682	Mapped reads per annotated gene were counted by Bam2readcount.
GSE59682	Reads per kilobase of gene per million mapped sequence reads (RPKM) were calculated for normalization.
GSE59682	RNA libraries were prepared for sequencing using standard Illumina protocols
GSE59682	RNA-Seq
GSE59682	strain: K-12 substr. DH10B
GSE59682	Supplementary_files_format_and_content: txt: tab-delimited text files include RPKM values for each Sample
GSE59682	The reads were processed using BWA software.
GSE59682	toxin: deoxynivalenol
GSE59682	toxin: nivalenol
GSE60107	Culture cells
GSE60107	Escherichia coli
GSE60107	Genome_build: ASM584v2
GSE60107	genotype: PNPase mutant
GSE60107	genotype: RNase II mutant
GSE60107	genotype: RNase R mutant
GSE60107	genotype: Wild-type
GSE60107	growth phase: Exponential Phase
GSE60107	Overnight cultures from isolated colonies were diluted in fresh medium to an initial OD600~0.03 and grown to exponential phase (OD600~0.3) at 37ºC, with shaking at 200 rpm in Luria-Bertani (LB) medium supplemented with thymine (50 mg ml-1). When required, antibiotics were present at the following concentrations: kanamycin, 50 mg ml-1; tetracycline, 20 mg ml-1; streptomycin
GSE60107	∆pnp_RNA-Seq
GSE60107	RNA libraries were prepared for sequencing by the company Vertis Biotechnologie AG in Germany
GSE60107	RNA-Seq
GSE60107	RNA was isolated following cell lysis and phenol:chloroform extraction as previously described (Andrade, Pobre et al. 2012). After precipitation step in ethanol and 300 mM sodium acetate, RNA was resuspended in MilliQ-water. The integrity of RNA samples was evaluated by agarose gel electrophoresis. Turbo DNase (Ambion) treatment was used to remove contaminant DNA.
GSE60107	∆rnb_RNA-Seq
GSE60107	∆rnr_RNA-Seq
GSE60107	strain: K12-MG1693
GSE60107	Supplementary_files_format_and_content: tab-delimited text files include RPKM values for each Sample …
GSE60107	Vertis Biotechnologie AG bioinformatics department did a preliminary analysis of the high-throughput sequencing results which included the mapping of the reads against E. coli genome (NC_000913 downloaded from NCBI genome database).
GSE60107	We then used the mapped files to run Cufflinks (estimates the relative abundance of the transcripts) and after Cuffdiff to find significant changes in transcript expression when comparing two samples (Trapnell, Williams et al. 2010).
GSE60107	WT_RNA-Seq
GSE6033	common reference (OD600=0.5)
GSE6033	Escherichia coli
GSE6033	Normalization is performed by TREBAX, using MA-plots. MA-plots can reveal the spot artifacts globally and show the intensity-dependent logarithmic ratio of raw microarray data. In MA-plots, we calculate two parameters, average of logarithmic transferred intensity As=(log(Ts)+log(Rs))
GSE6033	OD: 0.1
GSE6033	OD: 0.3
GSE6033	OD: 0.4
GSE6033	OD: 0.5
GSE6033	OD: 0.6
GSE6033	OD: 1.0
GSE6033	OD: 1.3
GSE6033	OD: 1.7
GSE6033	OD: 2.7
GSE6033	OD: 4.5
GSE6033	OD: 4.7
GSE6033	OD: 4.8
GSE6033	Qiagen RNeasy mini Kit
GSE6033	Reference Design timecourse c_t10.1
GSE6033	Reference Design timecourse c_t10.2
GSE6033	Reference Design timecourse c_t1.1
GSE6033	Reference Design timecourse c_t11.1
GSE6033	Reference Design timecourse c_t11.2
GSE6033	Reference Design timecourse c_t1.2
GSE6033	Reference Design timecourse c_t2.1
GSE6033	Reference Design timecourse c_t2.2
GSE6033	Reference Design timecourse c_t3.1
GSE6033	Reference Design timecourse c_t3.2
GSE6033	Reference Design timecourse c_t4.1
GSE6033	Reference Design timecourse c_t4.2
GSE6033	Reference Design timecourse c_t5.1
GSE6033	Reference Design timecourse c_t5.2
GSE6033	Reference Design timecourse c_t6.1
GSE6033	Reference Design timecourse c_t6.2
GSE6033	Reference Design timecourse c_t7.1
GSE6033	Reference Design timecourse c_t7.2
GSE6033	Reference Design timecourse c_t8.1
GSE6033	Reference Design timecourse c_t8.2
GSE6033	Reference Design timecourse c_t9.1
GSE6033	Reference Design timecourse c_t9.2
GSE6033	Strain: W3110
GSE6033	time 10 (OD600=4.7)
GSE6033	time 11 (OD600=4.8)
GSE6033	time 1 (OD600=0.1)
GSE6033	time 2 (OD600=0.3)
GSE6033	time 3 (OD600=0.4)
GSE6033	time 4 (OD600=0.6)
GSE6033	time 5 (OD600=1.0)
GSE6033	time 6 (OD600=1.3)
GSE6033	time 7 (OD600=1.7)
GSE6033	time 8 (OD600=2.7)
GSE6033	time 9 (OD600=4.5)
GSE60546	All sequencing reads were mapped to E. coli MG1655 reference genome (NC_000913) using CLC Genomics Workbench5 with the length fraction of 0.9 and the similarity of 0.99.
GSE60546	All strains used are E. coli K-12 MG1655 and its derivatives. Glycerol stock of the E. coli strain was inoculated into 3 mL Luria broth supplemented with 150 μg kanamycin and cultured overnight at 37°C with constant agitation.
GSE60546	ArgR (-arg) rep1 and rep2
GSE60546	ArgR (+arg) rep1 and rep2
GSE60546	Basecalls performed using CASAVA version 1.4
GSE60546	chip antibody: Anti-myc (9E10) (Santa Cruz, Dallas, TX)
GSE60546	ChIP-Seq
GSE60546	Cultured cells (50 mL) were cross-linked with 1% formaldehyde at room temperature for 30 min and added 2 mL of 2.5M glycine to quench the unused formaldehyde. After washing  three times with 50 mL of ice-cold Tris-buffered saline (TBS), the washed cells were resuspended in 0.5 mL of lysis buffer composed of 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM EDTA, 1 μg
GSE60546	Escherichia coli str. K-12 substr. MG1655
GSE60546	substrain: MG1655
GSE60546	Supplementary_files_format_and_content: gff file is generated by in-house script
GSE60546	The cross-linked DNA-ArgR complexes in the supernatant were then immunoprecipitated by adding 10 µL of Anti-myc (9E10) (Santa Cruz, Dallas, TX). For mock-IP control, 2 µg of normal mouse IgG (Santa Cruz) was added into the supernatant in parallel. They were then incubated overnight at 4oC with constant rotation. The cross-linked DNA-protein and antibody complexes were selectively captured by adding 50 µL of Dynabeads Pan Mouse IgG magnetic beads (Invitrogen, Grand Island, NY). Then, DNAs were end-polished using T4 DNA polymerase (NEB, Ipswich, MA), ligated with the annealed adaptor 1 (5’- Phospho-AACTGCCCCGGGTTGCTCTTCCGATCT and 5’- OH-AGATCGGAAGAGC-OH), nick-repaired using phi29 polymerase (NEB), and digested with λ exonuclease (NEB) as reported previously. Then, protein-DNA complexes were reverse-cross-linked by heating at 65°C overnight and proteins were degraded by 8 µg of protease K (Invitrogen). The purified DNAs were denatured at 95°C and extended by P1 primer (5’-OH-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT), further ligated with the annealed adaptor 2 (5’-OH-ACACTCTTTCCCTACACGACGCTCTTCCGATCT and 5’-OH-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAG). The ligated DNA products were purified using Qiagen PCR purification kit and were PCR-amplified by P2 primer (5’-OH-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and P3 primer (5’-OH-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGT). The degenerative sequence (the underlined 6Ns) in the P3 primer indicates the index sequence for the Illumina next-generation sequencing (Illumina, San Diego, CA). The PCR-amplified DNA products were then loaded onto 2% agarose gel and extracted using QIAquick gel purification columns.
GSE60546	The cultured cells were inoculated with 1:100 dilution into 50 mL of the fresh M9 medium containing 2 g
GSE60546	To capture target protein binding sites corresponding genomic position of mapped reads start position (MRSP) was counted and stored for visual inspection using in-house scripts.
GSE6060	cDNA_A_cy3
GSE6060	cDNA_B_cy5
GSE6060	E. coli MG1655 genomic DNA
GSE6060	E. coli MG1655 RNA
GSE6060	Escherichia coli
GSE6060	gDNA_A_cy5
GSE6060	gDNA_B_cy3
GSE6060	Genomic DNA was purified using a 20
GSE6060	Linearly scaled so that intensity values in gDNA_A_cy5, cDNA_A_cy3, gDNA_B_cy3, and cDNA_B_cy5 are comparable
GSE6060	Strain MG1655
GSE6060	Total RNA was purified on a RNeasy columns (Qiagen); ribosomal RNAs were removed with the MicroExpress kit (Ambion). The resulting RNA was reverse transcribed with SuperScript II reverse transcriptase (Invitrogen) + random hexamers + dNTP mix containing aminoallyl-dUTP.
GSE6061	Beta_ChIP_A_cy5
GSE6061	Beta_ChIP_B_cy5
GSE6061	Beta_ChIP_control_A_cy3
GSE6061	Beta_ChIP_control_B_cy3
GSE6061	Cells were fixed in 1% formaldehyde at room temperature for 20 min, quenched with glycine, and lysed. Chromatin was pelleted and solublized by sonication.
GSE6061	Cells were fixed in 1% formaldehyde at room temperature for 20 min, quenched with glycine, and lysed. Chromatin was pelleted and solublized by sonication. Crosslinked chromatin was then immunoprecipitated.
GSE6061	E. coli MG1655
GSE6061	Escherichia coli
GSE6061	Linearly scaled so that intensity values in Sigma70_ChIP_control_A_cy3, Sigma70_ChIP_A_cy5, Sigma70_ChIP_control_B_cy3, Sigma70_ChIP_B_cy5, Beta_ChIP_control_A_cy3, Beta_ChIP_A_cy5, Beta_ChIP_control_B_cy3, Beta_ChIP_B_cy5 are comparable
GSE6061	Sigma70_ChIP_A_cy5
GSE6061	Sigma70_ChIP_B_cy5
GSE6061	Sigma70_ChIP_control_A_cy3
GSE6061	Sigma70_ChIP_control_B_cy3
GSE6061	Strain MG1655
GSE6100	Escherichia coli
GSE6100	Normalization is performed by TREBAX, using MA-plots. MA-plots can reveal the spot artifacts globally and show the intensity-dependent logarithmic ratio of raw microarray data. In MA-plots, we calculate two parameters, average of logarithmic transferred intensity As=(log(Ts)+log(Rs))
GSE6100	OD :0.1
GSE6100	OD :0.3
GSE6100	OD :0.4
GSE6100	OD :0.6
GSE6100	OD: 0.6
GSE6100	OD :1.0
GSE6100	OD :1.3
GSE6100	OD :1.7
GSE6100	OD :2.7
GSE6100	OD :4.5
GSE6100	OD 4.5
GSE6100	OD :4.7
GSE6100	OD :4.8
GSE6100	OD :OD 0.1
GSE6100	Qiagen RNeasy mini Kit
GSE6100	Sequential Design timecourse t10_t11.1
GSE6100	Sequential Design timecourse t10_t11.2
GSE6100	Sequential Design timecourse t1_t2.1
GSE6100	Sequential Design timecourse t1_t2.2
GSE6100	Sequential Design timecourse t2_t3.1
GSE6100	Sequential Design timecourse t2_t3.2
GSE6100	Sequential Design timecourse t3_t4.1
GSE6100	Sequential Design timecourse t3_t4.2
GSE6100	Sequential Design timecourse t4_t5.1
GSE6100	Sequential Design timecourse t4_t5.2
GSE6100	Sequential Design timecourse t5_t6.1
GSE6100	Sequential Design timecourse t5_t6.2
GSE6100	Sequential Design timecourse t6_t7.1
GSE6100	Sequential Design timecourse t6_t7.2
GSE6100	Sequential Design timecourse t7_t8.1
GSE6100	Sequential Design timecourse t7_t8.2
GSE6100	Sequential Design timecourse t8_t9.1
GSE6100	Sequential Design timecourse t8_t9.2
GSE6100	Sequential Design timecourse t9_t10.1
GSE6100	Sequential Design timecourse t9_t10.2
GSE6100	Strain W3110
GSE6100	Strain :W3110
GSE6100	Strain : W3110
GSE6100	Strain: W3110
GSE6100	Strian :W3110
GSE6100	time 10 (OD600=4.7)
GSE6100	time 11 (OD600=4.8)
GSE6100	time 1 (OD600=0.1)
GSE6100	time 2 (OD600=0.3)
GSE6100	time 3 (OD600=0.4)
GSE6100	time 4 (OD600=0.6)
GSE6100	time 5 (OD600=1.0)
GSE6100	time 6 (OD600=1.3)
GSE6100	time 7 (OD=1.7)
GSE6100	time 7 (OD600=1.7)
GSE6100	time 8 (OD=2.7)
GSE6100	time 8 (OD600=2.7)
GSE6100	time 9 (OD600=4.5)
GSE61092	E. coli HB101 grown in Terrific broth media for 12 hours were washed three times in sdH2O and re-suspended in S-Basal complete medium.
GSE61092	E. coli were incubated in S-Basal complete medium alone or in the presence of C. elegans, Giardia conditioned meida, and both C. elegans and Giardia conditioned media.
GSE61092	Escherchia coli HB101
GSE61092	Escherchia coli HB101 exposed to C. elegans and Giardia for 24 hours
GSE61092	Escherchia coli HB101 exposed to C. elegans for 24 hours
GSE61092	Escherchia coli HB101 exposed to Giardia for 24 hours
GSE61092	Escherichia coli
GSE61092	genotype: E. coli [supE44 hsdS20(rB-mB-) recA13 ara-14 proA2 lacY1 galK2 rpsL20 xyl-5 mtl-1]
GSE61092	HB101, biological rep2
GSE61092	HB101, biological rep3
GSE61092	HB101, exposed to C. elegans and Giardia, biological rep1
GSE61092	HB101, exposed to C. elegans and Giardia, biological rep2
GSE61092	HB101, exposed to C. elegans and Giardia, biological rep3
GSE61092	HB101, exposed to C. elegans, biological rep1
GSE61092	HB101, exposed to C. elegans, biological rep2
GSE61092	HB101, exposed to C. elegans, biological rep3
GSE61092	HB101, exposed to Giardia, biological rep1
GSE61092	HB101, exposed to Giardia, biological rep2
GSE61092	HB101, exposed to Giardia, biological rep3
GSE61092	strain: HB101
GSE61092	The microarray data files were processed using statistical software R version 3.0.1 and Bioconductor packages. The Single-Channel Array Normalization (SCAN.UPC) package was used to normalize the microarray data. Batch effects were adjusted by using the Empirical Bayes method implemented in COMBAT software.
GSE61092	Total RNA was extracted using RNeasy Mini Kit (Qiagen) according to instructions in the kit.
GSE61604	CEL files were quantified with Distribution Free Weighted method (DFW), using the statistical language R (R-2.7.2) and Bioconductor 2.2.
GSE61604	E. coli BW25113 were maintained in Luria-Bertani medium at 37ºC for about 14 h until they reached the stationary phase of cell growth before treatment.
GSE61604	E. coli incubated with GST-fused Drosophila immune proteins for 10 min
GSE61604	E. coli incubated with GST-fused Drosophila immune proteins for 10 min, biological rep1
GSE61604	E. coli incubated with GST-fused Drosophila immune proteins for 10 min, biological rep2
GSE61604	E. coli incubated with GST-fused Drosophila immune proteins for 10 min, biological rep3
GSE61604	E. coli incubated with GST protein alone for 10 min
GSE61604	E. coli incubated with GST protein for 10 min, biological rep1
GSE61604	E. coli incubated with GST protein for 10 min, biological rep2
GSE61604	E. coli incubated with GST protein for 10 min, biological rep3
GSE61604	Escherichia coli
GSE61604	genotype
GSE61604	incubated with: Drosophila immune proteins
GSE61604	incubated with: GST alone (3 μM; control)
GSE61604	incubation duration: 10 min
GSE61604	strain: BW25113
GSE61604	The E. coli strain BW25113 (2 x 10^9) suspended with insect saline (0.13 M NaCl, 4.7 mM KCl, 1.9 mM CaCl2), was incubated with GST or GST-fused Drosophila immune proteins for 10 min at room temperature.
GSE61604	Total RNA was purified with an RNeasy micro kit (Qiagen K.K., Tokyo, Japan).
GSE61736	cDNA were synthesized from the reverse transcription of Total RNA using the Life Technologies SuperScript II Double-Strand Synthesis Kit
GSE61736	E. coli MG1655 Cold Shock
GSE61736	E. coli MG1655 Cold Shock was grown at 15°C for 4 hour then grown untill reach to half of O.D.600nm of Standard sample at 37°C in LB media.
GSE61736	E. coli MG1655 Heat Shock
GSE61736	E. coli MG1655 Heat Shock was grown at 50°C for 4 hour then grown untill reach to half of O.D.600nm of Standard sample at 37°C in LB media.
GSE61736	E. coli MG1655 Low pH
GSE61736	E. coli MG1655 Low pH was grown at 37°C for 1 hour in LB media with pH4.5 then grown untill reach to half of O.D.600nm of Standard sample at 37°C in LB media.
GSE61736	E. coli MG1655 minimal C
GSE61736	E. coli MG1655 minimal C&N
GSE61736	E. coli MG1655 minimal C&N Source was grown untill reach to quater of O.D.600nm of Standard sample at 37°C in minimal C and N source MOPS media(C-N- MOPS).
GSE61736	E. coli MG1655 minimal C Source was grown untill reach to half of O.D.600nm of Standard sample at 37°C in minimal C source MOPS media(C- MOPS).
GSE61736	E. coli MG1655 minimal N
GSE61736	E. coli MG1655 minimal N Source was grown untill reach to half of O.D.600nm of Standard sample at 37°C in minimal N source MOPS media(N- MOPS).
GSE61736	E. coli MG1655 Osmotic stress
GSE61736	E. coli MG1655 Osmotic Stress was grown untill reach to half of O.D.600nm of Standard sample at 37°C in 45ml MOPS media with 6ml 4M Sodium Chloride.
GSE61736	E. coli MG1655 Oxidative stress
GSE61736	E. coli MG1655 Oxidative Stress was grown untill reach to half of O.D.600nm of Standard sample at 37°C in 49ml MOPS media with 400μl 7% Hydrogen peroxide.
GSE61736	E. coli MG1655 Standard
GSE61736	E. coli MG1655 Standard was grown to mid-log phase (O.D.600nm 0.6~0.8) at 37°C in LB media.
GSE61736	E. coli MG1655 UV
GSE61736	E. coli MG1655 UV was exposed to UV light for 15 minutes then grown untill reach to half of O.D.600nm of Standard sample at 37°C in LB media.
GSE61736	Escherichia coli str. K-12 substr. MG1655
GSE61736	MG1655_standard_condition_rep1
GSE61736	MG1655_standard_condition_rep2
GSE61736	MG1655_under_ColdShock_rep1
GSE61736	MG1655_under_ColdShock_rep2
GSE61736	MG1655_under_HeatShock_rep2
GSE61736	MG1655_under_Low_pH_rep1
GSE61736	MG1655_under_minimal_C&N_source_rep1
GSE61736	MG1655_under_minimal_C&N_source_rep2
GSE61736	MG1655_under_minimal_C_source_rep1
GSE61736	MG1655_under_minimal_C_source_rep2
GSE61736	MG1655_under_minimal_N_source_rep1
GSE61736	MG1655_under_minimal_N_source_rep2
GSE61736	MG1655_under_Osmotic_Stress_rep1
GSE61736	MG1655_under_Osmotic_Stress_rep2
GSE61736	MG1655_under_Oxidative_Stress_rep1
GSE61736	MG1655_under_Oxidative_Stress_rep2
GSE61736	MG1655_UV_Treatment_rep1
GSE61736	MG1655_UV_Treatment_rep2
GSE61736	strain: MG1655
GSE61736	The raw data (.pair file) was subjected to RMA (Robust Multi-Array Analysis; Irizarry et al. Biostatistics 4(2):249), quantile normalization (Bolstad et al. Bioinformatics 19(2):185), and background correction as implemented in the NimbleGen Deva software, version 1.2 (Roche NimbleGen, Inc.).
GSE61736	Total RNA was extracted using the RNeasy Mini kit (Qiagen) and DNA was removed by on-column DNase digestion with the RNase-Free DNase set (Qiagen). RNA  concentration was measured by SpectorPhotometer(NonoDrop).
GSE61736	treatment: Cold Shock
GSE61736	treatment: Heat Shock
GSE61736	treatment: Low pH
GSE61736	treatment: minimal C&N source
GSE61736	treatment: minimal C source
GSE61736	treatment: minimal N source
GSE61736	treatment: Osmotic stress
GSE61736	treatment: Oxidative stress
GSE61736	treatment: Standard
GSE61736	treatment: UV
GSE61749	Cells were grown in the minimal media, M63. The final cell concentrations were controlled ~ 10^8 cells
GSE61749	condition: exponential growth, 36.9ºC
GSE61749	condition: exponential growth, 41.2ºC
GSE61749	condition: exponential growth, 43.2ºC
GSE61749	condition: exponential growth, 44.8ºC
GSE61749	condition: heat shock response, 44.8ºC
GSE61749	E. coli 37L evolved strain, under 37ºC, rep 1
GSE61749	E. coli 37L evolved strain, under 37ºC, rep 2
GSE61749	E. coli 37L evolved strain, under 37ºC, rep 3
GSE61749	E. coli 41B evolved strain, evolutionary temperature, rep 1
GSE61749	E. coli 41B evolved strain, evolutionary temperature, rep 2
GSE61749	E. coli 41B evolved strain, evolutionary temperature, rep 3
GSE61749	E. coli 41B evolved strain, regular temperature, rep 1
GSE61749	E. coli 41B evolved strain, regular temperature, rep 2
GSE61749	E. coli 41B evolved strain, regular temperature, rep 3
GSE61749	E. coli 41B evolved strain, under 37ºC, rep 1
GSE61749	E. coli 41B evolved strain, under 37ºC, rep 2
GSE61749	E. coli 41B evolved strain, under 37ºC, rep 3
GSE61749	E. coli 41B evolved strain, under 41ºC, rep 1
GSE61749	E. coli 41B evolved strain, under 41ºC, rep 2
GSE61749	E. coli 41B evolved strain, under 41ºC, rep 3
GSE61749	E. coli 41B strain, 30 min heat shock at 45ºC, rep 1
GSE61749	E. coli 41B strain, 30 min heat shock at 45ºC, rep 2
GSE61749	E. coli 41B strain, 5 min heat shock at 45ºC, rep 1
GSE61749	E. coli 41B strain, 5 min heat shock at 45ºC, rep 2
GSE61749	E. coli 41B strain, heat shock, long, rep 1
GSE61749	E. coli 41B strain, heat shock, long, rep 2
GSE61749	E. coli 41B strain, heat shock, rep 1
GSE61749	E. coli 41B strain, heat shock, rep 2
GSE61749	E. coli 43B evolved strain, evolutionary temperature, rep 1
GSE61749	E. coli 43B evolved strain, evolutionary temperature, rep 2
GSE61749	E. coli 43B evolved strain, evolutionary temperature, rep 3
GSE61749	E. coli 43B evolved strain, regular temperature, rep 1
GSE61749	E. coli 43B evolved strain, regular temperature, rep 2
GSE61749	E. coli 43B evolved strain, regular temperature, rep 3
GSE61749	E. coli 43B evolved strain, under 37ºC, rep 1
GSE61749	E. coli 43B evolved strain, under 37ºC, rep 2
GSE61749	E. coli 43B evolved strain, under 37ºC, rep 3
GSE61749	E. coli 43B evolved strain, under 43ºC, rep 1
GSE61749	E. coli 43B evolved strain, under 43ºC, rep 2
GSE61749	E. coli 43B evolved strain, under 43ºC, rep 3
GSE61749	E. coli 43B strain, 30 min heat shock at 45ºC, rep 1
GSE61749	E. coli 43B strain, 30 min heat shock at 45ºC, rep 2
GSE61749	E. coli 43B strain, 5 min heat shock at 45ºC, rep 1
GSE61749	E. coli 43B strain, 5 min heat shock at 45ºC, rep 2
GSE61749	E. coli 43B strain, heat shock, long, rep 1
GSE61749	E. coli 43B strain, heat shock, long, rep 2
GSE61749	E. coli 43B strain, heat shock, rep 1
GSE61749	E. coli 43B strain, heat shock, rep 2
GSE61749	E. coli 45L evolved strain, evolutionary temperature, rep 1
GSE61749	E. coli 45L evolved strain, evolutionary temperature, rep 2
GSE61749	E. coli 45L evolved strain, evolutionary temperature, rep 3
GSE61749	E. coli 45L evolved strain, regular temperature, rep 1
GSE61749	E. coli 45L evolved strain, regular temperature, rep 2
GSE61749	E. coli 45L evolved strain, regular temperature, rep 3
GSE61749	E. coli 45L evolved strain, under 37ºC, rep 1
GSE61749	E. coli 45L evolved strain, under 37ºC, rep 2
GSE61749	E. coli 45L evolved strain, under 37ºC, rep 3
GSE61749	E. coli 45L evolved strain, under 45ºC, rep 1
GSE61749	E. coli 45L evolved strain, under 45ºC, rep 2
GSE61749	E. coli 45L evolved strain, under 45ºC, rep 3
GSE61749	E. coli 45L strain, 30 min heat shock at 45ºC, rep 1
GSE61749	E. coli 45L strain, 30 min heat shock at 45ºC, rep 2
GSE61749	E. coli 45L strain, 5 min heat shock at 45ºC, rep 1
GSE61749	E. coli 45L strain, 5 min heat shock at 45ºC, rep 2
GSE61749	E. coli 45L strain, heat shock, long, rep 1
GSE61749	E. coli 45L strain, heat shock, long, rep 2
GSE61749	E. coli 45L strain, heat shock, rep 1
GSE61749	E. coli 45L strain, heat shock, rep 2
GSE61749	E. coli ancestor strain, 30 min heat shock at 45ºC, rep 1
GSE61749	E. coli ancestor strain, 30 min heat shock at 45ºC, rep 2
GSE61749	E. coli ancestor strain, 5 min heat shock at 45ºC, rep 1
GSE61749	E. coli ancestor strain, 5 min heat shock at 45ºC, rep 2
GSE61749	E. coli ancestor strain, under 37ºC, rep 1
GSE61749	E. coli ancestor strain, under 37ºC, rep 2
GSE61749	E. coli ancestor strain, under 37ºC, rep 3
GSE61749	E. coli Anc strain, heat shock, long, rep 1
GSE61749	E. coli Anc strain, heat shock, long, rep 2
GSE61749	E. coli Anc strain, heat shock, rep 1
GSE61749	E. coli Anc strain, heat shock, rep 2
GSE61749	E. coli Anc strain, regular temperature, rep 1
GSE61749	E. coli Anc strain, regular temperature, rep 2
GSE61749	E. coli Anc strain, regular temperature, rep 3
GSE61749	Escherichia coli
GSE61749	Microarray data were processed using custom scripts written in R based on the finite hybridisation (FH) model (Ono et al, 2008) and the thermodynamic model of non-specific binding (NSB) on short nucleotide microarrays (Furusawa et al, 2009).
GSE61749	strain: DH1ΔleuB::gfpuv5-kmr
GSE61749	The cell culture was put into cold phenol-ethanol solution (1 g of phenol in 10 mL of ethanol) prepared in advance. The cells were collected by centrifugation at 7,000 × g for 3 min at 4°C, and the pelleted cells were stored at –80°C prior to use.
GSE61749	The normalized data can be found on the series record in the file \GSE61749_Normalized_data.txt\. The data values presented in this file are log10 mRNA concentration (pM).
GSE61749	Total RNAs were extracted using an RNeasy mini kit (Qiagen) in accordance with the manufacturer’s instructions.
GSE6195	7 h 7HI biofilm cells
GSE6195	7 h biofilm cells
GSE6195	7 h isatin biofilm cells
GSE6195	7 h suspension cells
GSE6195	EHEC LB 7 h 7HI biofilm cells
GSE6195	EHEC LB 7 h biofilm cells
GSE6195	EHEC LB 7 h isatin biofilm cells
GSE6195	EHEC LB 7 h suspension cells
GSE6195	Escherichia coli
GSE6195	MAS 5.0 Expression Analysis Default Setting
GSE6195	RNA extracted from biofilm cells of EHEC wild type after 7h of growth in LB and 0.1 % DMF with glass wool
GSE6195	RNA extracted from biofilm cells of EHEC wild type after 7h of growth in LB and 1000 micro M 7-hydroxyindole with glass wool
GSE6195	RNA extracted from biofilm cells of EHEC wild type after 7h of growth in LB and 250 micro M isatin with glass wool
GSE6195	RNA extracted from suspension cells of EHEC wild type after 7 h of growth in LB and 0.1 % DMF with glass wool
GSE6195	To lyse the cells, 1.0 mL RLT buffer (Qiagen, Inc., Valencia, CA) and 0.2 mL 0.1 mm zirconia
GSE62102	cDNA library of the nascent RNA was constructed according to Churchman and Weissman, Nature 2011 (PMID: 21248844).
GSE62102	Each tube of the cell pellet stored at -80˚C was resuspended in 650 ml TES buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 100 mM NaCl, 0.1% TritonX 100, 0.3 mM PMSF) at room temperature (RT). The cell suspension was mixed with 100 kU Ready-Lyse Lysozyme (Epicentre) and 50 µg RNaseA (Sigma) and incubated for 5 min, allowing rapid cell lysis. To digest the nucleoide, 62.5 U DNaseI (Roche) and 250 µg
GSE62102	Escherichia coli
GSE62102	genotype
GSE62102	molecule subtype: nascent 3' RNA
GSE62102	Pause sites in E. coli wild-type strain identified by RNET-seq
GSE62102	Pause sites in E. coli ΔgreAB strain identified by RNET-seq
GSE62102	RNA-Seq
GSE62102	The 200 ml eluate from the Ni-NTA agarose was mixed with equal volume of pre-warmed PCI and incubated for 2 min at 70˚C. The mixture was centrifuged, and RNA and DNA were precipitated with isopropanol from the supernatant. The pellet was dissolved in 30 ml DNase I buffer with 5 U DNaseI (Takara Bio) and 20 U SUPERase, incubated for 10 min at RT. RNA was separated from the digested DNA by the PCI extraction and RNA was precipitated with isopropanol. The pellet was dissolved in diethylpyrocarbonate-treated water and used for cDNA synthesis.
GSE62102	The cells were grown in ~300 ml LB broth +25 mg
GSE62102	The fastq files of 36-bp sequenced reads were generated with the CASAVA v1.8 (Illumina). For the bulk RNET-seq analysis, the specific adapter sequences were trimmed with the Trimmomatic v0.25 to obtain reads ≥ 21-nt from the 5’ end. The reads ≥ 21-nt were mapped to the reference genome of E. coli K-12 strain W3110 (NC_007779.1) using the Bowtie2 v2.1.0 with the default parameter. A gene annotation file of E. coli W3110 was downloaded from the ftp server of Ensembl.
GSE62102	The processed data file (csv) includes information about genomic position, reference
GSE62102	To analyze RNAP pausing on the E. coli chromosome, we counted the number of reads at every genomic nucleotide position using the mpileup command of SAM tools v0.1.18 with –A –B parameters. Pausing sites were defined P(φ, δ), where φ is the minimal fraction of having 3’ RNA ends in the mapped reads and δ is the minimal read depth for any genomic position. We chose δ to be 100 for WT and 160 for ΔgreAB, which normalized these respective numbers for each strain since there were 1.6-fold more total reads in the ΔgreAB strain. The high φ parameter allowed us to define a reliable pause-inducing element for WT or ΔgreAB cells.
GSE62102	W3110 rpoC-6xHis::kan gal490
GSE62102	W3110 rpoC-6xHis::kan greA::tet, greB::amp
GSE62394	10 μg of total RNA sample was subjected to purification for discarding rRNA via the MICROBExpress kit (Ambion) according to the manufacturer’s protocol. Following purification, the RNA was interrupted into short fragments using divalent cations under elevated temperature and the short fragments were used for the cDNA synthesis using a SuperScript Double-Stranded cDNA Synthesis Kit (Invitrogen) according to the manufacturer’s instructions. These cDNA fragments were purified with a QIAquick PCR purification kit (Qiagen), and then went through end reparation, adding poly(A) and ligation of sequencing adaptors. These products were purified with agarose gel electrophoresis and fragments in the size of 200-250 bp were selected for PCR amplification to construct the cDNA library.
GSE62394	All those uniquely mapped reads were used to calculate the gene expression level by the RPKM method, which is able to eliminate the influence of different gene length and sequencing discrepancy on the calculation of gene expression and thus the calculated gene expression level can be directly used for comparing the difference of gene expression among samples.
GSE62394	Bacterium
GSE62394	Base calling performed using  Illumina GA pipeline 1.6.
GSE62394	cas_RNAA
GSE62394	con_RNAA
GSE62394	Escherichia coli
GSE62394	Genome_build: ASM666v1; NC_002655.2
GSE62394	In order to generate the VBNC state in E. coli O157:H7, 20 mL of the exponential-phase cell suspensions in a 50 mL sterile glass tube was treated by HPCD at 5 MPa and 25℃ for 40 min.
GSE62394	RNA-Seq
GSE62394	strain: O157:H7 NCTC 12900
GSE62394	Supplementary_files_format_and_content: Microsoft excel spreadsheet files include RPKM values for each gene of sample
GSE62394	The clean reads obtained were aligned to the genome sequence of E. coli O157:H7 EDL933 using SOAP2
GSE62394	The raw reads were filtered for removing dirty raw reads which contain adapters, unknown or low quality bases.
GSE62394	The strain was stocked in tryptic soy broth (TSB) with 25% glycerol at -80℃, and was activated by streaking onto TSA plate and incubating at 37℃ for 24 h. And then, a single colony was picked and used to inoculate TSB and incubated at 37℃ for 12 h with shaking at 200 rpm. This overnight culture was transferred to TSB at a dilution of 1:100 and grew to the exponential phase (OD550=0.93).
GSE62394	Total RNA was isolated from the VBNC cells and the exponential-phase cells using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. The RNA samples were treated with DNase Ⅰ (Invitrogen) to remove residual genomic DNA.
GSE62394	treatment: None
GSE62394	treatment: Treated by HPCD at 5 MPa and 25℃ for 40 min
GSE62898	bacterial cells grown to OD600=0.5
GSE62898	Bacterial strains were grown in LB. Overnight cultures were diluted 1:100 in fresh LB and grown at 37°C with shaking to an OD600 = 0.5.
GSE62898	Escherichia coli
GSE62898	GPR files were analyzed further with Acuity 4.0 software (Molecular Devices, USA) starting with lowess normalization. Normalized log2 ratio data from biological replicates and technical replicates (dye swap) were averaged and the statistical significance (p-value) was calculated.
GSE62898	recA730_vs_recA730,dcd
GSE62898	recA730_vs_recA730,ndk
GSE62898	RNA was isolated using the RNeasy Protect Bacteria Mini Kit (Qiagen), following manufacturer's instructions.
GSE62898	strain: MC4100 derivative
GSE62898	strain: MC4100 derivative, dcd::kan
GSE62898	strain: MC4100 derivative, ndk::cam
GSE62898	strain: MC4100 derivative, recA730
GSE62898	strain: MC4100 derivative, recA730, dcd::kan
GSE62898	strain: MC4100 derivative, recA730, ndk::cam
GSE62898	WT_vs_dcd
GSE62898	WT_vs_ndk
GSE62898	WT_vs_recA730
GSE62987	50 OD600 of bacteria have been grown to the desired growth stage and harvested by centrifugation. They were lysed in 500 µl of the lysis buffer (20 mM Tris-HCl, pH7.5, 150 mM KCl, 1 mM MgCl2, 1 mM DTT, 1 mM PMSF, 0.2% Triton X100, 20 U
GSE62987	bacterial cells
GSE62987	Coverage calculation and normalisation (via READemption)
GSE62987	Demultiplexing
GSE62987	Escherichia coli
GSE62987	Escherichia ProQ coIP
GSE62987	Escherichia ProQ Lysate
GSE62987	Escherichia WT coIP
GSE62987	Escherichia WT Lysate
GSE62987	Fastq quality trimming using FastX and a cut-off value of 20
GSE62987	Fastq to fasta conversion using FastX
GSE62987	Genome_build: NC_007779.1
GSE62987	LB, 37°C, 220 rpm, OD600=0.5, 2.0, 2.0+6 h
GSE62987	Read mapping using segemehl (via READemption)
GSE62987	rip antibody: Monoclonal ANTI-FLAG^=AE M2 antibody produced in mouse, Sigma, F1804-200UG,SLBG5673V
GSE62987	RIP-Seq
GSE62987	RNA-seq libraries were prepared by Vertis AG (Freising-Weihenstephan, Germany). Briefly, RNA was polyadenylated with poly(A) polymerase, 5’-triphosphates were removed with tobacco acid pyrophosphatase followed by ligation of a 5’-adapter. First-strand cDNA synthesis was performed with the use of an oligo(dT) barcoded adapter primer and the M-MVL reverse transcriptase. The resulting cDNA was PCR-amplified with a high fidelity DNA polymerase. cDNA was purified with the Agencourt AMPure XP kit (Beckman Coulter Genomics).
GSE62987	Size filtering: discarding reads shorter than 12 nt (via READemption)
GSE62987	strain: W3110
GSE62987	Supplementary_files_format_and_content: wiggle
GSE62987	The equivalent of 5 OD600 was saved for RNA extraction with TriZOL before adding antibodies (lysate RNA sample). For coIP samples, beads were resuspended in the lysis buffer, mixed with an equal volume of phenol:chloroform:isopropanol (25:24:1, pH4.5, Roth) for 20 s and incubated at room temperature for 3 min. After centrifugation, the aqueous phase was precipitated with isopropanol (coIP RNA sample). The purified RNA coIP sample was treated with DNase I (Thermo Scientific) to remove the residual DNA and reisolated with phenol:chloroform:isopropanol. The spike-in RNA (5’P-CUCGUCCGACGUCACCUAGA, IBA) had been added to 40 pg
GSE63817	Adapter cutting using cutadapt, version 1.2.1, parameters -e 0.1 -O 1 -m 12
GSE63817	AT1 biological replicate
GSE63817	E. coli MC4100 strain was cultured at 37°C to mid-log phase (OD600 ~ 0.4) in LB media
GSE63817	Escherichia coli
GSE63817	Genome_build: strain MG1655, version U00096.2, downloaded from NCBI
GSE63817	Genome mapping using Bowtie, version 0.12.9, parameters for samples 1-5: -v 2 --best --strata -m 1, parameters for samples 6-9: -v 3 --best --strata -m 1
GSE63817	LB mRNA
GSE63817	LB mRNA biological replicate
GSE63817	LB mRNA technical replicate
GSE63817	LB RPF
GSE63817	LB RPF biological replicate
GSE63817	media: LB
GSE63817	Quality trimming using FASTX-toolkit, version 0.0.13.2, parameters -v -t 20 -l 10
GSE63817	Read counts were normalized by million mapped reads for each nucleotide
GSE63817	Read using bedtools, version 2.17.0, parameter: -s, for samples 1-5 the middle nucleotide of each read was taken, for samples 6-9 the first nucleotide was taken and the read count was assigned to the nucleotide 5' of the first nucleotide see {Kertesz, 2010} for details
GSE63817	RNA-Seq
GSE63817	RNA-size selection and generation of the cDNA libraries was performed as described {Ingolia, 2009}
GSE63817	sample type: AT1 digested total RNA
GSE63817	sample type: ribosome protected
GSE63817	sample type: V1 digested total RNA
GSE63817	strain: MC4100
GSE63817	strain: MC4101
GSE63817	strain: MC4102
GSE63817	strain: MC4103
GSE63817	strain: MC4104
GSE63817	strain: MC4105
GSE63817	strain: MC4106
GSE63817	strain: MC4107
GSE63817	Supplementary_files_format_and_content: Column 1 names the nucleotide in the genome, column 2 gives counts for the forward strand, column 3 for the reverse strand, columns are tab separated
GSE63817	Total RNA was extracted using TRIzol reagent (Invitrogen) and the sample was enriched in mRNA, depleting small RNAs with GeneJET™ RNA Purification Kit (Fermentas) and ribosomal RNA with two cycle of MICROBExpress™Bacterial mRNA Enrichment Kit (Ambion). To probe the RNA structure two µg of enriched mRNA were resuspended in 45 µl of DEPC water and denatured for 3 min at 95°C,refolded at 37 °C, after addition of 10x RNA-structure buffer with pH 7.0 (100 mM Tris, 1 M KCl, 100 mM MgCl2) and digested for 1 min at 37 °C with either 0.05 U RNase V1 (Life Technologies) or a combination of 2 µg RNase A and 5 U RNase T1 (Thermo Scientific). The reaction was stopped by extracting the RNA with phenol-chlorophorm. The RNase A
GSE63817	V1 biological replicate
GSE6444	At OD450 = 0.3, cultures induced with 1 mM IPTG. Cells harvested 20 min after induction
GSE6444	Cells harvested at OD450 = 0.3
GSE6444	Culture samples for microarray analysis were added to ice-cold 5% water-saturated phenol in ethanol solution, centrifuged at 6,600 g and the cell pellets flash frozen in liquid N2 before storing at -80 degrees C until required. Total RNA was isolated from the stored cell pellets using the hot phenol method, and labeled Cy3 and Cy5 cDNA was prepared from 16 ug total RNA with 10 ug random hexamer (Integrated DNA Technologies, Inc., Coralville, IA, USA).
GSE6444	Data filtered for PCR success, >3x local background and spot quality (GenePix Flag). Normalized using Lowess smoothing from MA plot
GSE6444	delta hfq
GSE6444	Delta hfq
GSE6444	Delta rseA
GSE6444	EC12n097 delta rseA
GSE6444	EC12n098 delta rseA
GSE6444	EC12n099 delta rseA
GSE6444	EC18n018 hfq+ rpoE overexpression 20 min
GSE6444	EC18n019 hfq- rpoE overexpression 20 min
GSE6444	EC18n035 delta rseA
GSE6444	EC18n036 delta rseA
GSE6444	EC18n037 delta hfq
GSE6444	EC18n038 delta hfq
GSE6444	EC18n039 delta hfq
GSE6444	EC18n040 delta hfq
GSE6444	EC18n136 hfq+ rpoE overexpression 20 min
GSE6444	Ec18n137 hfq- rpoE overexpression 20 min
GSE6444	EC18n139 hfq+ rpoE overexpression 20 min
GSE6444	EC18n140 hfq- rpoE overexpression 20 min
GSE6444	EC19n075 delta hfq
GSE6444	EC19n076 delta hfq
GSE6444	EC19n098 delta hfq
GSE6444	EC19n099 delta hfq
GSE6444	EC19n100 delta rseA
GSE6444	EC19n101 delta rseA
GSE6444	Escherichia coli
GSE6444	Hfq- RpoE overexpression (20 min)
GSE6444	hfq+ Wild type control (20 min)
GSE6444	M9 minimal complete media, cultures grown aerobically at 30 degrees C in a gyratory water bath shaking at 240 rpm
GSE6444	MG1655 rpoHp3::lacZ delta lacX74
GSE6444	MG1655 rpoHp3::lacZ delta lacX74 hfq1::omega(Km;BclI) (hfq-)
GSE6444	MG1655 rpoHp3::lacZ delta lacX74 hfq2::omega(Km;KpnI) (hfq+)
GSE6444	MG1655 rpoHp3::lacZ delta lacX74 nadB::Tn10 drseA
GSE6444	RpoE induced (20 min)
GSE6444	Wild type control
GSE6444	Wild type control (20 min)
GSE64847	bowtie2 v2.2.3 was used for alignment
GSE64847	Cells were crosslinked in 1% formadehyde for 25 min at room temperature followed by 5 minutes of quenching with glycine. Cells were washed 3X with ice cold TBS. Cell pellets were stored at -80 C.
GSE64847	Cells were enyzmatically lysed in the presence of protease inhibitors prior to fragmentation using sonication. Protein
GSE64847	Cells were grown in shake flasks to mid-exponential phase under either aerobic or anaerobic conditions depending on the sample. M9 minimal media supplement with either glucose, fructose, or glycerol as the sole carbon source was used depending on the sample.
GSE64847	chip antibody: c-Myc Antibody (9E10), Santa Cruz Biotech, sc-40
GSE64847	chip antibody: E. coli CRP Monoclonal Antibody, Neoclone, #N0004
GSE64847	chip antibody: E. coli RNA Sigma 70 Monoclonal Antibody, Neoclone, #WP004
GSE64847	ChIPExo-ArcA_ArcA8myc_glucose_NH4Cl_anaerobic_1_anti-myc
GSE64847	ChIPExo-ArcA_ArcA8myc_glucose_NH4Cl_anaerobic_2_anti-myc
GSE64847	ChIPExo-ArcA_ArcA8myc_glucose_NH4Cl_anaerobic_3_anti-myc
GSE64847	ChIPExo-Crp_delAr1delAr2_glycerol_NH4Cl_O2_1_anti-crp
GSE64847	ChIPExo-Crp_delAr1delAr2_glycerol_NH4Cl_O2_2_anti-crp
GSE64847	ChIPExo-Crp_delAr1delAr2_glycerol_NH4Cl_O2_3_anti-crp
GSE64847	ChIPExo-Crp_delAr1_glycerol_NH4Cl_O2_1_anti-crp
GSE64847	ChIPExo-Crp_delAr1_glycerol_NH4Cl_O2_2_anti-crp
GSE64847	ChIPExo-Crp_delAr1_glycerol_NH4Cl_O2_3_anti-crp
GSE64847	ChIPExo-Crp_delAr2_glycerol_NH4Cl_O2_1_anti-crp
GSE64847	ChIPExo-Crp_delAr2_glycerol_NH4Cl_O2_2_anti-crp
GSE64847	ChIPExo-Crp_delAr2_glycerol_NH4Cl_O2_3_anti-crp
GSE64847	ChIPExo-Crp_delta-crp_glycerol_NH4Cl_O2_1_anti-crp
GSE64847	ChIPExo-Crp_delta-crp_glycerol_NH4Cl_O2_2_anti-crp
GSE64847	ChIPExo-Crp_delta-crp_glycerol_NH4Cl_O2_3_anti-crp
GSE64847	ChIPExo-Crp_wt_fructose_NH4Cl_O2_1_anti-crp
GSE64847	ChIPExo-Crp_wt_fructose_NH4Cl_O2_2_anti-crp
GSE64847	ChIPExo-Crp_wt_fructose_NH4Cl_O2_3_anti-crp
GSE64847	ChIPExo-Crp_wt_fructose_NH4Cl_O2_4_anti-crp
GSE64847	ChIPExo-Crp_wt_fructose_NH4Cl_O2_5_anti-crp
GSE64847	ChIPExo-Crp_wt_glucose_NH4Cl_O2_1_anti-crp
GSE64847	ChIPExo-Crp_wt_glucose_NH4Cl_O2_2_anti-crp
GSE64847	ChIPExo-Crp_wt_glycerol_NH4Cl_O2_1_anti-crp
GSE64847	ChIPExo-Crp_wt_glycerol_NH4Cl_O2_1_anti-crp_rif
GSE64847	ChIPExo-Crp_wt_glycerol_NH4Cl_O2_2_anti-crp
GSE64847	ChIPExo-Crp_wt_glycerol_NH4Cl_O2_2_anti-crp_rif
GSE64847	ChIPExo-Crp_wt_glycerol_NH4Cl_O2_3_anti-crp
GSE64847	ChIPExo-Crp_wt_glycerol_NH4Cl_O2_3_anti-crp_rif
GSE64847	ChIPExo-Crp_wt_glycerol_NH4Cl_O2_4_anti-crp
GSE64847	ChIPExo-Crp_wt_glycerol_NH4Cl_O2_5_anti-crp
GSE64847	ChIPExo-Crp_wt_glycerol_NH4Cl_O2_6_anti-crp
GSE64847	ChIPExo-Fnr_Fnr8myc_glucose_NH4Cl_anaerobic_1_anti-myc
GSE64847	ChIPExo-Fnr_Fnr8myc_glucose_NH4Cl_anaerobic_2_anti-myc
GSE64847	ChIPExo-Fnr_Fnr8myc_glucose_NH4Cl_anaerobic_3_anti-myc
GSE64847	ChIPExo-RpoD_wt_fructose_NH4Cl_O2_1_anti-rpod
GSE64847	ChIPExo-RpoD_wt_fructose_NH4Cl_O2_2_anti-rpod
GSE64847	ChIPExo-RpoD_wt_fructose_NH4Cl_O2_3_anti-rpod
GSE64847	ChIPExo-RpoD_wt_glucose_NH4Cl_O2_1_anti-rpod
GSE64847	ChIPExo-RpoD_wt_glucose_NH4Cl_O2_2_anti-rpod
GSE64847	ChIPExo-RpoD_wt_glucose_NH4Cl_O2_3_anti-rpod
GSE64847	ChIPExo-RpoD_wt_glycerol_NH4Cl_O2_1_anti-rpod
GSE64847	ChIPExo-RpoD_wt_glycerol_NH4Cl_O2_2_anti-rpod
GSE64847	ChIPExo-RpoD_wt_glycerol_NH4Cl_O2_3_anti-rpod
GSE64847	ChIP-Seq
GSE64847	Chromosomal DNA
GSE64847	Escherichia coli
GSE64847	Genome_build: NC_000913.2
GSE64847	Library construction was based on the method described by Rhee et al. (doi:10.1016
GSE64847	Peak-calls were done using GPS within the GEMS software package (v2.3) adapted for ChIP-exo data
GSE64847	strain: ArcA8myc
GSE64847	strain: Crp_delAr1
GSE64847	strain: Crp_delAr1delAr2
GSE64847	strain: Crp_delAr2
GSE64847	strain: delta Crp
GSE64847	strain: Fnr8myc
GSE64847	strain: wt
GSE64847	Supplementary_files_format_and_content: Processed data is presented in gff files containing a pileup of 5' tags. GFF column headers \Genbank fna ID, file name, left genomic position, right genomic position, value, strand, extra value, information\
GSE64847	The MiSeq Reporter MiSeq Reporter 2.4.60.8 was used for basecalling and demultiplexing
GSE64848	bowtie2 v2.2.3 was used for alignment
GSE64848	Cells were grown in shake flasks to mid-exponential phase under either aerobic or anaerobic conditions depending on the sample. M9 minimal media supplement with either glucose, fructose, or glycerol as the sole carbon source was used depending on the sample.
GSE64848	E. coli K12 MG1655
GSE64848	Escherichia coli
GSE64848	Gene expression analysis was performed using a strand-specific, paired-end RNA-seq protocol using the dUTP method (Levin et al., 2010).  Total RNA was isolated and purified using the Qiagen Rneasy Kit with on-column DNase treatment.
GSE64848	Genome_build: NC_000913.2
GSE64848	Reads were mapped to the NC_000913.2 reference genome using the default settings in bowtie2 (Langmead and Salzberg, 2012). Datasets were quantified using cuffdiff in the cufflinks package to generate FPKM (Framents Per Kilobase per Million reads mapped) values for all genes (Trapnell et al., 2013).
GSE64848	RNA-Seq
GSE64848	RNAseq_delAr1delAr2_glycerol_NH4Cl_O2_1
GSE64848	RNAseq_delAr1delAr2_glycerol_NH4Cl_O2_2
GSE64848	RNAseq_delAr1delAr2_glycerol_NH4Cl_O2_3
GSE64848	RNAseq_delAr1_glycerol_NH4Cl_O2_1
GSE64848	RNAseq_delAr1_glycerol_NH4Cl_O2_2
GSE64848	RNAseq_delAr1_glycerol_NH4Cl_O2_3
GSE64848	RNAseq_delAr2_glycerol_NH4Cl_O2_1
GSE64848	RNAseq_delAr2_glycerol_NH4Cl_O2_2
GSE64848	RNAseq_delAr2_glycerol_NH4Cl_O2_3
GSE64848	RNAseq_delta-crp_fructose_NH4Cl_O2_1
GSE64848	RNAseq_delta-crp_fructose_NH4Cl_O2_2
GSE64848	RNAseq_delta-crp_fructose_NH4Cl_O2_3
GSE64848	RNAseq_delta-crp_glucose_NH4Cl_O2_1
GSE64848	RNAseq_delta-crp_glucose_NH4Cl_O2_2
GSE64848	RNAseq_delta-crp_glucose_NH4Cl_O2_3
GSE64848	RNAseq_delta-crp_glycerol_NH4Cl_O2_1
GSE64848	RNAseq_delta-crp_glycerol_NH4Cl_O2_2
GSE64848	RNAseq_delta-crp_glycerol_NH4Cl_O2_3
GSE64848	RNAseq_wt_fructose_NH4Cl_O2_1
GSE64848	RNAseq_wt_fructose_NH4Cl_O2_2
GSE64848	RNAseq_wt_glucose_NH4Cl_O2_1
GSE64848	RNAseq_wt_glucose_NH4Cl_O2_2
GSE64848	RNAseq_wt_glucose_NH4Cl_O2_3
GSE64848	RNAseq_wt_glycerol_NH4Cl_O2_1
GSE64848	RNAseq_wt_glycerol_NH4Cl_O2_2
GSE64848	rRNA depleted RNA was then primed using random hexamers and reverse transcribed using SuperScript III (Life Technologies).
GSE64848	strain: Crp_delAr1
GSE64848	strain: Crp_delAr1delAr2
GSE64848	strain: Crp_delAr2
GSE64848	strain: delta Crp
GSE64848	strain: wt
GSE64848	Supplementary_files_format_and_content: Processed data is presented in a cuff diff analysis format
GSE64848	The MiSeq Reporter MiSeq Reporter 2.4.60.8 was used for basecalling and demultiplexing
GSE64848	Total RNA was depleted of ribosomal RNAs using Epicentre’s RiboZero rRNA removal kit.
GSE6486	DNeasy (Qiagen)
GSE6486	Escherichia coli
GSE6486	Escherichia coli K-12
GSE6486	gDNA 520
GSE6486	gDNA 521
GSE6486	gDNA B02
GSE6486	gDNA B05
GSE6486	gDNA C01
GSE6486	gDNA C02
GSE6486	gDNA_EColi_520
GSE6486	gDNA_EColi_521
GSE6486	gDNA_EColi_B02
GSE6486	gDNA_EColi_B05
GSE6486	gDNA_EColi_C01
GSE6486	gDNA_EColi_C02
GSE6486	gDNA_EColi_F01
GSE6486	gDNA_EColi_F02
GSE6486	gDNA_EColi_H01
GSE6486	gDNA_EColi_H02
GSE6486	gDNA_EColi_H03
GSE6486	gDNA_EColi_H04
GSE6486	gDNA_EColi_H05
GSE6486	gDNA_EColi_H12
GSE6486	gDNA_EColi_H23
GSE6486	gDNA_EColi_H27
GSE6486	gDNA_EColi_S04
GSE6486	gDNA_EColi_S05
GSE6486	gDNA_EColi_S13
GSE6486	gDNA F01
GSE6486	gDNA F02
GSE6486	gDNA from E.coli K12 cyanine 3
GSE6486	gDNA H01
GSE6486	gDNA H02
GSE6486	gDNA H03
GSE6486	gDNA H04
GSE6486	gDNA H05
GSE6486	gDNA H12
GSE6486	gDNA H23
GSE6486	gDNA H27
GSE6486	gDNA K12
GSE6486	gDNA S04
GSE6486	gDNA S05
GSE6486	gDNA S13
GSE6486	Local Background Substracted Signal Corrected for unequal Dye incorporation or unequal load of labelled product
GSE6486	strain 520
GSE6486	strain 521
GSE6486	strain B02
GSE6486	strain B05
GSE6486	strain C01
GSE6486	strain C02
GSE6486	strain F01
GSE6486	strain F02
GSE6486	strain H01
GSE6486	strain H02
GSE6486	strain H03
GSE6486	strain H04
GSE6486	strain H05
GSE6486	strain H12
GSE6486	strain H23
GSE6486	strain H27
GSE6486	strain S04
GSE6486	strain S05
GSE6486	strain S13
GSE65244	Escherichia coli
GSE65244	Escherichia coli CSH50
GSE65244	Escherichia coli CSH50 Δfis
GSE65244	Escherichia coli CSH50 Δhns
GSE65244	Fis – 120 min
GSE65244	Fis – 180 min
GSE65244	Fis – 420 min
GSE65244	Fis – 60 min
GSE65244	GATC
GSE65244	GATC software for read mapping on MG1655
GSE65244	gene expression sum normalized to 1 at each time point
GSE65244	Gene wise natural spline interpolation of temporal data from initial time points to a dataset of 10 minutes steps (see processed data files). Expression values at the time points of the raw data are not affected by the interpolation.
GSE65244	genotype: delta-fis
GSE65244	genotype: delta-hns
GSE65244	genotype: wildtype
GSE65244	Hns – 120 min
GSE65244	Hns -180 min
GSE65244	Hns – 420 min
GSE65244	Hns – 60 min
GSE65244	LB medium, 37°C, airated, constant pH 7.5
GSE65244	RNA extraction Kit
GSE65244	RNA-Seq
GSE65244	strain: CSH50
GSE65244	Supplementary_files_format_and_content: expression of genes in time, rows = genes, cols = time points
GSE65244	time: 120 minutes
GSE65244	time: 180 minutes
GSE65244	time: 300 minutes
GSE65244	time: 420 minutes
GSE65244	time: 60 minutes
GSE65244	verified with in-house pipeline
GSE65244	Wt – 120 min
GSE65244	Wt – 180 min
GSE65244	Wt – 300 min
GSE65244	Wt – 420 min
GSE65244	Wt – 60 min
GSE65385	Bacteria were cultured in an M9 minimal medium supplemented with 2 g
GSE65385	Data analysis was done using R language and environment for a statistical computing and Bioconductor.  Array data were normalized with gcRMA method.
GSE65385	Escherichia coli
GSE65385	Escherichia coli K-12 tynA- 1h after induction of tynA expression
GSE65385	Escherichia coli K-12 tynA- 4h after the induction of tynA expression
GSE65385	Escherichia coli K-12 tynA- at time of induction of tynA expression
GSE65385	Escherichia coli K-12 wt 1h after the induction of tynA expression
GSE65385	Escherichia coli K-12 wt 4h after the induction of tynA expression
GSE65385	Escherichia coli K-12 wt at time of induction of tynA expression
GSE65385	genotype: tynA-
GSE65385	genotype: wild type
GSE65385	Samples were treated with Prokaryotic Target Preparation protocol (GeneChip Expression Analysis Technical Manual).
GSE65385	strain: K12
GSE65385	Total RNA was isolated using the RNeasy Mini-Kit (Qiagen) according to the manufacturer`s instruction and DNA was removed by using RNAse-Free DNAse Set (Qiagen).
GSE65385	tynA- at T0
GSE65385	tynA- at T1h
GSE65385	tynA- at T4h
GSE65385	wt at T0
GSE65385	wt at T1h
GSE65385	wt at T4h
GSE65641	acetate
GSE65641	chip antibody: anti-myc
GSE65641	chip antibody: anti-rpoB (Santa Cruz Biotech, sc-56766)
GSE65641	chip antibody cat. #: sc-28207
GSE65641	chip antibody vendor: Santa Cruz Biotech
GSE65641	ChIP-exo reads were aligned to the ASM584v2 genome reference sequence using using bowtie v1.0.0 with parameters  -S
GSE65641	ChIP-Seq
GSE65641	ChIP-seq libraries were prepared for sequencing using standard Illumina protocols
GSE65641	cra-8myc tagged strain_acetate
GSE65641	cra-8myc tagged strain_fructose
GSE65641	cra-8myc tagged strain_glucose
GSE65641	Cra acetate 1
GSE65641	Cra acetate 2
GSE65641	Cra fructose 1
GSE65641	Cra fructose 2
GSE65641	Cra glucose 1
GSE65641	Cra glucose 2
GSE65641	Crosslinked cells were then resuspended in 500 ul of lysis buffer (10 mM Tris-HCl (pH 7.5), 100 mM NaCl and 1 mM EDTA) with 40 ul of protease inhibitor cocktail (50 mg in 0.25 ml of DMSO and 0.75 ml of TDW). Cells were lyzed with 1 ul of lysozyme for 30 min at 37C on a rocker. 0.55 ml of 2X IP buffer (100 mM Tris-HCl (pH 7.5), 200 mM NaCl, 2% Triton X-100 and 1 mM EDTA) were added to the sample, and then was sonicated to fragmentize genomic DNA. 0.3 ml of Wash buffer I (50 mM Tris-HCl (pH 7.5), 140 mM NaCl, 1% Triton X-100 and 1mM EDTA) was added to make the volume up to 1.4 ml. Only 0.7 ml was taken and transfered to a new tube, and 15 ul of Anti-c-myc mouse antibody was added, and the sample was incubated overnight at 4C to make Antibody-TF complex. 50 ul of Dynabeads Pan mouse IgG were washed 3 times with bead washing solution (250 mg BSA in 50 ml of PBS), and were added to the sample. Cell lysate with beads were incubated for 6 hours or overnight at 4C to make Dynabead-antibody-TF complex. The beads were pulled down on a magnet stand, and washed 2 times with wash buffer I and with wash buffer II (50 mM Tris-HCl (pH 7.5), 500 mM NaCl, 1% Triton X-100 and 1mM EDTA), wash buffer III (10 mM Tris-HCl (pH 8.0), 250 mM LiCl, 1% Triton X-100 and 1mM EDTA), and wash buffer IV (10 mM Tris-HCl (pH 8.0), 1mM EDTA). The bead-bound TF-DNA complex was then end-repaired, dA-tailed, and ligated to the first adapter. Adapter-ligated sample was then treated with nick-repair reagent, and was treated with lambda exonuclease and RecJ exonuclease. Then DNA was eluted away from Dynabeads by incubating in 200 ul of elution buffer (50 mM Tris-HCl (pH 8.0), 1% SDS and 1 mM EDTA) at 65C overnight. Protein was removed by treating 4 ul of protease K and being incubated at 55C for 2 hours, and by Phenol-Chloroform-IAA extraction. Purified DNA was used to bulid the second strand synthesis, followed by another dA-tailing, second strand ligation, and 3' overhang removal stpes. Then the sequencing library was amplified with PCR enrichment.
GSE65641	Crosslinked cells were then resuspended in 500 ul of lysis buffer (10 mM Tris-HCl (pH 7.5), 100 mM NaCl and 1 mM EDTA) with 40 ul of protease inhibitor cocktail (50 mg in 0.25 ml of DMSO and 0.75 ml of TDW). Cells were lyzed with 1 ul of lysozyme for 30 min at 37oC on a rocker. 0.55 ml of 2X IP buffer (100 mM Tris-HCl (pH 7.5), 200 mM NaCl, 2% Triton X-100 and 1 mM EDTA) were added to the sample, and then was sonicated to fragmentize genomic DNA. 0.3 ml of Wash buffer I (50 mM Tris-HCl (pH 7.5), 140 mM NaCl, 1% Triton X-100 and 1mM EDTA) was added to make the volume up to 1.4 ml. Only 0.7 ml was taken and transfered to a new tube, and 10 ul of Anti-rpoB mouse antibody was added, and the sample was incubated overnight at 4 oC to make Antibody-TF complex. 50 ul of Dynabeads Pan mouse IgG were washed 3 times with bead washing solution (250 mg BSA in 50 ml of PBS), and were added to the sample. Cell lysate with beads were incubated for 6 hours or overnight at 4oC to make Dynabead-antibody-TF complex. The beads were pulled down on a magnet stand, and washed 2 times with wash buffer I and with wash buffer II (50 mM Tris-HCl (pH 7.5), 500 mM NaCl, 1% Triton X-100 and 1mM EDTA), wash buffer III (10 mM Tris-HCl (pH 8.0), 250 mM LiCl, 1% Triton X-100 and 1mM EDTA), and wash buffer IV (10 mM Tris-HCl (pH 8.0), 1mM EDTA). The bead-bound TF-DNA complex was then end-repaired, dA-tailed, and ligated to the first adapter. Adapter-ligated sample was then treated with nick-repair reagent, and was treated with lambda exonuclease and RecJ exonuclease. Then DNA was eluted away from Dynabeads by incubating in 200 ul of elution buffer (50 mM Tris-HCl (pH 8.0), 1% SDS and 1 mM EDTA) at 65oC overnight. Protein was removed by treating 4 ul of protease K and being incubated at 55 oC for 2 hours, and by Phenol-Chloroform-IAA extraction. Purified DNA was used to bulid the second strand synthesis, followed by another dA-tailing, second strand ligation, and 3' overhang removal stpes. Then the sequencing library was amplified with PCR enrichment.
GSE65641	cultured in: M9 minimal media with 0.2% acetate
GSE65641	cultured in: M9 minimal media with 0.2% fructose
GSE65641	cultured in: M9 minimal media with 0.2% glucose
GSE65641	E. coli cells were crosslinked in 1% formaldehyde for 25 minutes at RT on a rocker, then washed 3 times with 50 ml of ice-cold TBS (Tris buffered saline) each time.
GSE65641	E. coli K-12 MG1655 cra-8myc tagged strains was grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose, fructose and acetate.
GSE65641	Escherichia coli
GSE65641	For each peak detected with MACE, binding intensity was calculated by averaging read counts from two biological replicates and dividing by background intensity.
GSE65641	Genome_build: ASM584v2
GSE65641	genotype
GSE65641	genotype: delta-cra Knock-out strain
GSE65641	genotype: delta-crp Knock-out strain
GSE65641	genotype: Wildtype
GSE65641	growth phase: mid-log
GSE65641	MACE software (https:
GSE65641	Read count was calculated for each genomic position from sequence alignment, and 95% strongest intensity was used as background intensity.
GSE65641	RpoB ∆cra 1
GSE65641	RpoB ∆cra 2
GSE65641	RpoB ∆crp 1
GSE65641	RpoB ∆crp 2
GSE65641	RpoB WT 1
GSE65641	RpoB WT 2
GSE65641	strain: K-12 MG1655
GSE65641	Supplementary_files_format_and_content: Tab-delimited text files in gff format which has 8 columns: sequence id, source(empty), feature (+
GSE65642	carbon source: acetate
GSE65642	carbon source: fructose
GSE65642	carbon source: glucose
GSE65642	E. coli K-12 MG1655 WT, and Δcra were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose, fructose and acetate.
GSE65642	Escherichia coli
GSE65642	Fragments Per Kilobase of exon per Megabase of library size (FPKM) were calculated using cufflinks v.1.3.0
GSE65642	Genome_build: NC_000913
GSE65642	genotype
GSE65642	RNA libraries were prepared for sequencing using standard Illumina protocols
GSE65642	RNA-Seq
GSE65642	Sequenced reads were mapped onto NC_000913 reference genome sequence using bowtie v1.0.0 with parameters -X 1000 -n 2 -3 3 -S
GSE65642	strain: K-12 MG1655
GSE65642	Supplementary_files_format_and_content: comma-delimited text files include FPKM values for each Sample.
GSE65642	The cell culture was treated with the RNAprotect reagent (Qiagen).
GSE65642	Total RNA was extracted using the RNeasy Plus Mini kit (Qiagen Inc., Valencia, CA, USA) and genomic DNA was removed by gDNA Eliminator spin column in the RNeasy Plus Mini Kit. RNA quality and concentration was determined by analysis with a NanoDrop 1000 (Thermo Scientific Inc., Wilmington, DE, USA).
GSE65642	WT_acetate
GSE65642	WT acetate 1
GSE65642	WT acetate 2
GSE65642	WT_fructose
GSE65642	WT fructose 1
GSE65642	WT fructose 2
GSE65642	WT_glucose
GSE65642	WT glucose 1
GSE65642	WT glucose 2
GSE65642	Δcra_acetate
GSE65642	Δcra acetate 1
GSE65642	Δcra acetate 2
GSE65642	Δcra_fructose
GSE65642	Δcra fructose 1
GSE65642	Δcra fructose 2
GSE65642	Δcra_glucose
GSE65642	Δcra glucose 1
GSE65642	Δcra glucose 2
GSE65710	A total of six samples were analyzed. oxyR-8myc, soxR-8myc, and soxS-8myc tagged cells were cultured in M9 minimal media with 0.2% glucose. Then cells were treated with 250 uM of paraquat at mid-log pahse for 20 min with agitation.
GSE65710	chip antibody: anti-myc
GSE65710	chip antibody cat. #: sc-28207
GSE65710	chip antibody vendor: Santa Cruz Biotech
GSE65710	ChIP-exo reads were aligned to the ASM584v2 genome reference sequence using using bowtie v1.0.0 with parameters  -S
GSE65710	ChIP-Seq
GSE65710	ChIP-seq libraries were prepared for sequencing using standard Illumina protocols
GSE65710	Crosslinked cells were then resuspended in 500 ul of lysis buffer (10 mM Tris-HCl (pH 7.5), 100 mM NaCl and 1 mM EDTA) with 40 ul of protease inhibitor cocktail (50 mg in 0.25 ml of DMSO and 0.75 ml of TDW). Cells were lyzed with 1 ul of lysozyme for 30 min at 37oC on a rocker. 0.55 ml of 2X IP buffer (100 mM Tris-HCl (pH 7.5), 200 mM NaCl, 2% Triton X-100 and 1 mM EDTA) were added to the sample, and then was sonicated to fragmentize genomic DNA. 0.3 ml of Wash buffer I (50 mM Tris-HCl (pH 7.5), 140 mM NaCl, 1% Triton X-100 and 1mM EDTA) was added to make the volume up to 1.4 ml. Only 0.7 ml was taken and transfered to a new tube, and 15 ul of Anti-c-myc mouse antibody was added, and the sample was incubated overnight at 4 oC to make Antibody-TF complex. 50 ul of Dynabeads Pan mouse IgG were washed 3 times with bead washing solution (250 mg BSA in 50 ml of PBS), and were added to the sample. Cell lysate with beads were incubated for 6 hours or overnight at 4oC to make Dynabead-antibody-TF complex. The beads were pulled down on a magnet stand, and washed 2 times with wash buffer I and with wash buffer II (50 mM Tris-HCl (pH 7.5), 500 mM NaCl, 1% Triton X-100 and 1mM EDTA), wash buffer III (10 mM Tris-HCl (pH 8.0), 250 mM LiCl, 1% Triton X-100 and 1mM EDTA), and wash buffer IV (10 mM Tris-HCl (pH 8.0), 1mM EDTA). The bead-bound TF-DNA complex was then end-repaired, dA-tailed, and ligated to the first adapter. Adapter-ligated sample was then treated with nick-repair reagent, and was treated with lambda exonuclease and RecJ exonuclease. Then DNA was eluted away from Dynabeads by incubating in 200 ul of elution buffer (50 mM Tris-HCl (pH 8.0), 1% SDS and 1 mM EDTA) at 65oC overnight. Protein was removed by treating 4 ul of protease K and being incubated at 55 oC for 2 hours, and by Phenol-Chloroform-IAA extraction. Purified DNA was used to bulid the second strand synthesis, followed by another dA-tailing, second strand ligation, and 3' overhang removal stpes. Then the sequencing library was amplified with PCR enrichment.
GSE65710	E. coli cells were crosslinked in 1% formaldehyde for 25 minutes at RT on a rocker, then washed 3 times with 50 ml of ice-cold TBS (Tris buffered saline) each time.
GSE65710	Escherichia coli
GSE65710	For each peak detected with MACE, binding intensity was calculated by averaging read counts from two biological replicates and dividing by background intensity.
GSE65710	Genome_build: ASM584v2
GSE65710	genotype
GSE65710	library strategy: ChIP-seq (ChIP-exo)
GSE65710	MACE software (https:
GSE65710	oxyR-8myc-tagged_PQ treated
GSE65710	OxyR PQ 1
GSE65710	OxyR PQ 2
GSE65710	Read count was calculated for each genomic position from sequence alignment, and 95% strongest intensity was used as background intensity.
GSE65710	soxR-8myc-tagged_PQ treated
GSE65710	SoxR PQ 1
GSE65710	SoxR PQ 2
GSE65710	soxS-8myc-tagged_PQ treated
GSE65710	SoxS PQ 1
GSE65710	SoxS PQ 2
GSE65710	strain: K-12 MG1655
GSE65710	Supplementary_files_format_and_content: Tab-delimited text files in gff format which has 8 columns: sequence id, source(empty), feature (+
GSE65710	treated with: 250 uM of paraquat at mid-log phase for 20 min
GSE65711	E. coli K-12 MG1655 WT, ΔoxyR, ΔsoxR, and ΔsoxS were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. Then cells were treated with 250 uM of paraquat at mid-log pahse for 20 min with agitation.
GSE65711	Escherichia coli
GSE65711	Fragments Per Kilobase of exon per Megabase of library size (FPKM) were calculated using cufflinks v.1.3.0
GSE65711	Genome_build: NC_000913
GSE65711	genotype
GSE65711	RNA libraries were prepared for sequencing using standard Illumina protocols
GSE65711	RNA-Seq
GSE65711	Sequenced reads were mapped onto NC_000913 reference genome sequence using bowtie v1.0.0 with parameters -X 1000 -n 2 -3 3 -S
GSE65711	strain: K-12 MG1655
GSE65711	Supplementary_files_format_and_content: comma-delimited text files include FPKM values for each Sample.
GSE65711	The cell culture was treated with the RNAprotect reagent (Qiagen).
GSE65711	Total RNA was extracted using the RNeasy Plus Mini kit (Qiagen Inc., Valencia, CA, USA) and genomic DNA was removed by gDNA Eliminator spin column in the RNeasy Plus Mini Kit. RNA quality and concentration was determined by analysis with a NanoDrop 1000 (Thermo Scientific Inc., Wilmington, DE, USA).
GSE65711	treated with: 250 uM of paraquat at mid-log pahse for 20 min
GSE65711	WT PQ
GSE65711	WT PQ 1
GSE65711	WT PQ 2
GSE65711	ΔoxyR PQ
GSE65711	ΔoxyR PQ 1
GSE65711	ΔoxyR PQ 2
GSE65711	ΔsoxR PQ
GSE65711	ΔsoxR PQ 1
GSE65711	ΔsoxR PQ 2
GSE65711	ΔsoxS PQ
GSE65711	ΔsoxS PQ 1
GSE65711	ΔsoxS PQ 2
GSE6609	16,000 g for 40 s at room temperature.  The supernatant was discarded, and cell pellets
GSE6609	1.8 ml (ca. 3E+9 cells) were pipetted into 2.0 ml tubes and immediately centrifuged at
GSE6609	68908
GSE6609	68909
GSE6609	68910
GSE6609	68911
GSE6609	68912
GSE6609	68913
GSE6609	68915
GSE6609	68916
GSE6609	68917
GSE6609	68919
GSE6609	68920
GSE6609	68921
GSE6609	68922
GSE6609	68923
GSE6609	68924
GSE6609	68925
GSE6609	68926
GSE6609	68927
GSE6609	68928
GSE6609	68929
GSE6609	68930
GSE6609	68931
GSE6609	68932
GSE6609	68933
GSE6609	Cells were harvested on days 1 and 3 of glucose starvation, with samples taken from the
GSE6609	chilled in a dry ice
GSE6609	D1-ae10
GSE6609	D1-ae11
GSE6609	D1-ae12
GSE6609	D1+ae7
GSE6609	D1+ae8
GSE6609	D1+ae9
GSE6609	D1+AN
GSE6609	D1+AN2
GSE6609	D1+AN3
GSE6609	D1-AN4
GSE6609	D1-AN5
GSE6609	D1-AN6
GSE6609	D3+ae19
GSE6609	D3+ae20
GSE6609	D3+ae21
GSE6609	D3-ae22
GSE6609	D3-ae23
GSE6609	D3-ae24
GSE6609	D3+AN13
GSE6609	D3+AN14
GSE6609	D3+AN15
GSE6609	D3-AN16
GSE6609	D3-AN17
GSE6609	D3-AN18
GSE6609	day: . strain: . oxygen: .
GSE6609	Escherichia coli
GSE6609	Feature pixel median minus background pixel mean;
GSE6609	further processing
GSE6609	isolated by chloroform extraction and precipitation by isopropanol. Precipitated RNA
GSE6609	normalization subtracting array-median log2 ratio.
GSE6609	pool of aliquots from all samples
GSE6609	ratio set to missing where SNR (feature mean - backround mean 
GSE6609	Reference Pool
GSE6609	re-suspended in 200 ul Trizol and combined for a total volume of 1 ml, then promptly
GSE6609	same cultures used for the viability assay. For each experimental condition, 15 aliquots of
GSE6609	triplicate samples were prepared by combining cells from 5 tubes each.  Each pellet was
GSE6609	was washed with 70 percent ethanol, resuspended in 30 ul water, and held at 4 deg. C for
GSE6609	were immediately frozen in liquid nitrogen and stored at -80 deg. C.  For RNA isolation,
GSE66441	chip antibody: anti-myc (Santa Cruz Biotech, sc-28207)
GSE66441	chip antibody: anti-RpoS (neoclone, WP009)
GSE66441	ChIP-exo GadE pH5.5 1
GSE66441	ChIP-exo GadE pH5.5 2
GSE66441	ChIP-exo GadW pH5.5 1
GSE66441	ChIP-exo GadW pH5.5 2
GSE66441	ChIP-exo GadX pH5.5 1
GSE66441	ChIP-exo GadX pH5.5 2
GSE66441	ChIP-exo reads were aligned to the ASM584v2 genome reference sequence using using bowtie v1.0.0 with parameters  -S
GSE66441	ChIP-exo RpoS pH5.5 1
GSE66441	ChIP-exo RpoS pH5.5 2
GSE66441	ChIP-Seq
GSE66441	ChIP-seq libraries were prepared for sequencing using standard Illumina protocols
GSE66441	E. coli K-12 MG1655 WT, GadE-8-myc, GadW-8-myc, and GadX-8-myc tagged strains were grown to mid-log phase (OD600 = 0.3) aerobically (250 rpm) at 37°C in M9 minimal media supplemented with 0.2% glucose at pH 5.5.
GSE66441	Escherichia coli str. K-12 substr. MG1655
GSE66441	For each peak detected with MACE, binding intensity was calculated by averaging read counts from two biological replicates and dividing by background intensity.
GSE66441	Genome_build: ASM584v2
GSE66441	genotype: gadE-8myc
GSE66441	genotype: gadW-8myc
GSE66441	genotype: gadX-8myc
GSE66441	genotype: WT
GSE66441	Immunoprecipitated DNA
GSE66441	MACE software (https:
GSE66441	Read count was calculated for each genomic position from sequence alignment, and 95% strongest intensity was used as background intensity.
GSE66441	strain: K-12 MG1655
GSE66441	Supplementary_files_format_and_content: Tab-delimited text files in gff format which has 8 columns: sequence id, source(empty), feature (+
GSE66481	E. coli K-12 MG1655 WT, gadE, gadW and gadX mutant cells were grown to mid-log phase (OD600 = 0.3) aerobically (250 rpm) at 37°C in M9 minimal media supplemented with 0.2% glucose at pH 5.5.
GSE66481	Escherichia coli
GSE66481	Fragments Per Kilobase of exon per Megabase of library size (FPKM) were calculated using cufflinks v.1.3.0
GSE66481	Genome_build: NC_000913
GSE66481	genotype
GSE66481	growth phase: mid-log phase (OD600 = 0.3)
GSE66481	RNA libraries were prepared for sequencing using standard Illumina protocols
GSE66481	RNA-Seq
GSE66481	Sequenced reads were mapped onto NC_000913 reference genome sequence using bowtie v1.0.0 with parameters -X 1000 -n 2 -3 3 -S
GSE66481	strain: K-12 MG1655
GSE66481	Supplementary_files_format_and_content: comma-delimited text files include FPKM values for each Sample.
GSE66481	The cell culture was treated with the RNAprotect reagent (Qiagen).
GSE66481	Total RNA was extracted using the RNeasy Plus Mini kit (Qiagen Inc., Valencia, CA, USA) and genomic DNA was removed by gDNA Eliminator spin column in the RNeasy Plus Mini Kit. RNA quality and concentration was determined by analysis with a NanoDrop 1000 (Thermo Scientific Inc., Wilmington, DE, USA).
GSE66481	WT pH5.5
GSE66481	WT pH5.5 1
GSE66481	WT pH5.5 2
GSE66481	ΔgadE pH5.5
GSE66481	ΔgadE pH5.5 1
GSE66481	ΔgadE pH5.5 2
GSE66481	ΔgadW pH5.5
GSE66481	ΔgadW pH5.5 1
GSE66481	ΔgadW pH5.5 2
GSE66481	ΔgadX pH5.5
GSE66481	ΔgadX pH5.5 1
GSE66481	ΔgadX pH5.5 2
GSE66995	Background subtractions and normalization of extracted data were performed through R using the Bioconductor package as described (Yang, Y.H. et al. Normalization for cDNA microarray data: a robust composite method addressing single and multiple slide systematic variation, Nucleic Acid Res 30, e15, 2002; Smyth, G.K. in Bioinformatics and Computational Biology Solutions using R and Bioconductor. 397-420, Springer, New York, 2005).
GSE66995	Cultures of both strains were started with a 2% overnight inoculum in LB media containing 35ug
GSE66995	Escherichia coli
GSE66995	growth phase: exponential growth phase
GSE66995	growth phase: stationary growth phase
GSE66995	growth phase: transition growth phase
GSE66995	pControl_exponential growth phase_1 ml cell pellet
GSE66995	pControl_stationary growth phase_1 ml cell pellet
GSE66995	pControl_transition growth phase_1 ml cell pellet
GSE66995	plasmid: pControl
GSE66995	plasmid: pLPLσ
GSE66995	pLPLσ_exponential growth phase_1 ml cell pellet
GSE66995	pLPLσ_stationary growth phase_1 ml cell pellet
GSE66995	pLPLσ_transition growth phase_1 ml cell pellet
GSE66995	Replicate 1 - timepoint 1 (4.5h)
GSE66995	Replicate 1 - timepoint 1 (4.5h) - dye swap
GSE66995	Replicate 1 - timepoint 2 (6h)
GSE66995	Replicate 1 - timepoint 2 (6h) - dye swap
GSE66995	Replicate 1 - timepoint 3 (9h)
GSE66995	Replicate 1 - timepoint 3 (9h) - dye swap
GSE66995	Replicate 2 - timepoint 1 (4.5h)
GSE66995	Replicate 2 - timepoint 1 (4.5h) - dye swap
GSE66995	Replicate 2 - timepoint 2 (6h)
GSE66995	Replicate 2 - timepoint 2 (6h) - dye swap
GSE66995	Replicate 2 - timepoint 3 (9h)
GSE66995	Replicate 2 - timepoint 3 (9h) - dye swap
GSE66995	strain: MG1655
GSE66995	The optical density was measured every 30 min and expression of the heterologous sigma factor was induced with 1mM IPTG at an optical density of 0.1. Samples for RNA extractions (1ml) were taken after 4.5, 6 and 9 hours after induction. Cell pellets were stored at -80°C until total RNA extraction was performed.
GSE66995	time point: 4.5 hrs after induction
GSE66995	time point: 6 hrs after induction
GSE66995	time point: 9 hrs after induction
GSE66995	Total RNA was extracted using the RNeasy Mini kit (Qiagen, Hilden, Germany) according to the manufactures recommendations.
GSE67119	10-HT874-PS-60min1
GSE67119	11-HT874-PS-60min2
GSE67119	12-HT874-PS-60min3
GSE67119	1-HT873-PA1
GSE67119	1-HT873-PA1-
GSE67119	2-HT873-PA2
GSE67119	2-HT873-PA2-
GSE67119	3-HT873-PA3
GSE67119	3-HT873-PA3-
GSE67119	4-HT873-PS-60min1
GSE67119	5-HT873-PS-60min2
GSE67119	6-HT873-PS-60min3
GSE67119	7-HT874-PA1
GSE67119	7-HT874-PA1-
GSE67119	873-Con1--
GSE67119	873-Con2--
GSE67119	873-Con3--
GSE67119	873-PA1--
GSE67119	873-PA2--
GSE67119	873-PA3--
GSE67119	875-Con1--
GSE67119	875-Con2--
GSE67119	875-Con3--
GSE67119	875-PA1--
GSE67119	875-PA2--
GSE67119	875-PA3--
GSE67119	8-HT874-PA2
GSE67119	8-HT874-PA2-
GSE67119	9-HT874-PA3
GSE67119	9-HT874-PA3-
GSE67119	Data was analyzed with RMA using the program Partek 6.6
GSE67119	E. coli strains HT874, HT873, HT875, HT873 treated with or no polyamines by Trizol protocol.
GSE67119	Escherichia coli
GSE67119	HT873-Con1
GSE67119	HT873-Con2
GSE67119	HT873-Con3
GSE67119	HT873-PA1
GSE67119	HT873-PA2
GSE67119	HT873-PA3
GSE67119	HT875-Con1
GSE67119	HT875-Con2
GSE67119	HT875-Con3
GSE67119	HT875-PA1
GSE67119	HT875-PA2
GSE67119	HT875-PA3
GSE67119	RNA were isolated from wild type and mutants. Trizol extraction of total RNA was performed according to standard affymetrix labeling protocols.
GSE67119	strain: HT873
GSE67119	strain: HT874
GSE67119	strain: HT875
GSE67119	treatment: Con1
GSE67119	treatment: Con2
GSE67119	treatment: Con3
GSE67119	treatment: PA1
GSE67119	treatment: PA2
GSE67119	treatment: PA3
GSE67119	treatment: PS-60min
GSE67218	50 ng of the fragmented RNA was converted to sequencing library using TruSeq® Stranded mRNA Sample Prep Kit in accordance with manufacturer’s instruction (Illumina).
GSE67218	All sequencing reads were mapped to E. coli MG1655 reference genome (NC_000913) using CLC Genomics Workbench5 with the length fraction of 0.9 and the similarity of 0.99.
GSE67218	Basecalls performed using CASAVA version 1.4
GSE67218	cell type: Escherichia coli str. K-12 substr. MG1655
GSE67218	Escherichia coli str. K-12 substr. MG1655
GSE67218	From the cells cultured in LB media at 37 ℃, total RNA was extracted using RNAsnapTM method, followed by the ethanol precipitation. rRNA was removed using ribo-zeroTM magnetic kit for bacteria in accordance with manufacturer’s instruction (Epicentre). rRNA removal was confirmed using ExperionTM system. Subsequently, 4 µg of the purified RNA was fragmented to sizes of ~300 bp using RNA fragmentation reagent (Ambion, Grand Island, NY).
GSE67218	Glycerol stocks of E. coli K12 strain MG1655 were inoculated into LB media  grown at 37 ℃ with constant agitation overnight. Cultures were diluted 1:100 into fresh minimal medium and then cultured at 37 ℃ to mid-exponential phase (OD600 nm ~ 0.6).
GSE67218	No treatment
GSE67218	RNA-Seq
GSE67218	RNA-seq 37C LB rep1
GSE67218	RNA-seq 37C LB rep2
GSE67218	Supplementary_files_format_and_content: RPKM is generated by in-house script
GSE67218	The expression levels were based upon the RPKM metric obtained from strand-specific manner.
GSE67221	Cells were grown in LB at 22°C or 37°C, as indicated.
GSE67221	Cells were resuspended in Lysis buffer (10mM tris, 20% sucrose, 50mM NaCl, 10mM EDTA, 10mg
GSE67221	chip antibody: anti-Flag
GSE67221	ChIP-Seq
GSE67221	Crosslinking was performed using 1% of forlmaldehyde
GSE67221	deltamatP 22°C
GSE67221	E. coli
GSE67221	Escherichia coli K-12
GSE67221	Genome_build: NC_000913.2
GSE67221	genotype
GSE67221	growth temperature: 22°C
GSE67221	growth temperature: 37°C
GSE67221	Illumina Casava v1.8 used for basecalling.
GSE67221	MACS v2.0.10.20131216 was used for peak calling with parameters --llocal=10000 -g 4639675 --bw 300 -p 0.05 --slocal=1000 --keep-dup=20
GSE67221	MatP 37°C
GSE67221	MukB 22°C
GSE67221	MukB 37°C
GSE67221	MukBDA 22°C
GSE67221	MukB deltamatP 22°C
GSE67221	MukBEQ 22°C
GSE67221	MukBEQ deltamatP 22°C
GSE67221	Reads were adapter removed and trimmed to 40Bp using trimmomatic 0.32 with parameters ILLUMINACLIP:
GSE67221	Sequences were mapped to NC_000913.2 using bowtie2 v2.2.2 with parameters -N 0 --sensitive --minins 130 --maxins 780 -q --no-mixed --no-discordant  --no-unal
GSE67221	Sequencing libraries were constructed using the NEBNext Ultra DNA Library Prep Kit for Illumina (#E7370, NEB) for samples 1 to 3 (37 C) and the WaferGen PrepX ILM ChiP-Seq Library Kit (#400075, WaferGen) on the Apollo 324 System for samples 4 to 10 (22 C).
GSE67221	Supplementary_files_format_and_content: MACS v2.0.10.20131216 peaks file
GSE67221	WT 22°C
GSE67221	WT 37°C
GSE67402	Escherichia coli
GSE67402	Escherichia coli B strain REL606 was revived from a freezer stock via overnight growth in 10 ml Davis Minimal medium supplemented with limiting glucose at 0.5 g
GSE67402	Exact details for the full computational pipeline are available at https:
GSE67402	Genome_build: NC_012967.1 plus small RNAs as annotated in Rfam 11.0 database
GSE67402	Glucose time course, 168 hour time point, biological replicate 1
GSE67402	Glucose time course, 168 hour time point, biological replicate 2
GSE67402	Glucose time course, 168 hour time point, biological replicate 3
GSE67402	Glucose time course, 168 hour time point, biological replicate 3, rRNA not depleted
GSE67402	Glucose time course, 24 hour time point, biological replicate 1
GSE67402	Glucose time course, 24 hour time point, biological replicate 2
GSE67402	Glucose time course, 24 hour time point, biological replicate 3
GSE67402	Glucose time course, 24 hour time point, biological replicate 3, rRNA not depleted
GSE67402	Glucose time course, 336 hour time point, biological replicate 1
GSE67402	Glucose time course, 336 hour time point, biological replicate 2
GSE67402	Glucose time course, 336 hour time point, biological replicate 3
GSE67402	Glucose time course, 336 hour time point, biological replicate 3, rRNA not depleted
GSE67402	Glucose time course, 3 hour time point, biological replicate 1
GSE67402	Glucose time course, 3 hour time point, biological replicate 2
GSE67402	Glucose time course, 3 hour time point, biological replicate 3
GSE67402	Glucose time course, 3 hour time point, biological replicate 3, rRNA not depleted
GSE67402	Glucose time course, 48 hour time point, biological replicate 1
GSE67402	Glucose time course, 48 hour time point, biological replicate 2
GSE67402	Glucose time course, 48 hour time point, biological replicate 3
GSE67402	Glucose time course, 48 hour time point, biological replicate 3, rRNA not depleted
GSE67402	Glucose time course, 4 hour time point, biological replicate 1
GSE67402	Glucose time course, 4 hour time point, biological replicate 2
GSE67402	Glucose time course, 4 hour time point, biological replicate 3
GSE67402	Glucose time course, 4 hour time point, biological replicate 3, rRNA not depleted
GSE67402	Glucose time course, 5 hour time point, biological replicate 1
GSE67402	Glucose time course, 5 hour time point, biological replicate 2
GSE67402	Glucose time course, 5 hour time point, biological replicate 3
GSE67402	Glucose time course, 5 hour time point, biological replicate 3, rRNA not depleted
GSE67402	Glucose time course, 6 hour time point, biological replicate 1
GSE67402	Glucose time course, 6 hour time point, biological replicate 2
GSE67402	Glucose time course, 6 hour time point, biological replicate 3
GSE67402	Glucose time course, 6 hour time point, biological replicate 3, rRNA not depleted
GSE67402	Glucose time course, 8 hour time point, biological replicate 1
GSE67402	Glucose time course, 8 hour time point, biological replicate 2
GSE67402	Glucose time course, 8 hourt ime point, biological replicate 3
GSE67402	Glucose time course, 8 hourt ime point, biological replicate 3, rRNA not depleted
GSE67402	Mapped R1 reads in single-end mode using Bowtie2 2.1.0 with the –k 1 option
GSE67402	molecule subtype: rRNA-depleted total RNA
GSE67402	molecule subtype: total RNA
GSE67402	REL606_glucose-limited minimal medium_168 hr
GSE67402	REL606_glucose-limited minimal medium_168 hr_rRNA not depleted
GSE67402	REL606_glucose-limited minimal medium_24 hr
GSE67402	REL606_glucose-limited minimal medium_24 hr_rRNA not depleted
GSE67402	REL606_glucose-limited minimal medium_336 hr
GSE67402	REL606_glucose-limited minimal medium_336 hr_rRNA not depleted
GSE67402	REL606_glucose-limited minimal medium_3 hr
GSE67402	REL606_glucose-limited minimal medium_3 hr_rRNA not depleted
GSE67402	REL606_glucose-limited minimal medium_48 hr
GSE67402	REL606_glucose-limited minimal medium_48 hr_rRNA not depleted
GSE67402	REL606_glucose-limited minimal medium_4 hr
GSE67402	REL606_glucose-limited minimal medium_4 hr_rRNA not depleted
GSE67402	REL606_glucose-limited minimal medium_5 hr
GSE67402	REL606_glucose-limited minimal medium_5 hr_rRNA not depleted
GSE67402	REL606_glucose-limited minimal medium_6 hr
GSE67402	REL606_glucose-limited minimal medium_6 hr_rRNA not depleted
GSE67402	REL606_glucose-limited minimal medium_8 hr
GSE67402	REL606_glucose-limited minimal medium_8 hr_rRNA not depleted
GSE67402	RNA-Seq
GSE67402	RNAsnap
GSE67402	RNAsnap followed by RiboZero rRNA removal kit for gram-negative bacteria (Epicentre)
GSE67402	RNA was fragmented using the NEBNext Magnesium RNA Fragmentation Module (New England Biolabs). Then, RNA was phosphorylated using T4 polynucleotide kinase and prepared using the NEBNext Small RNA Library Prep Set for Illumina (Multiplex Compatible). DNA fragments greater than 100 bp were excised from a 4% agarose gel after library preparation and recovered using the Zymoclean Gel DNA Recovery Kit (Zymo Research).
GSE67402	strain: REL606
GSE67402	Supplementary_files_format_and_content: Read counts aligned to genes and noncoding Rfam features in CSV format
GSE67402	The number of R1 reads mapping to each gene were counted using HTSeq 0.6.0
GSE67402	time point: 168 hours
GSE67402	time point: 24 hours
GSE67402	time point: 336 hours
GSE67402	time point: 3 hours
GSE67402	time point: 48 hours
GSE67402	time point: 4 hours
GSE67402	time point: 5 hours
GSE67402	time point: 6 hours
GSE67402	time point: 8 hours
GSE67402	Trimmed adaptor sequences from reads using Flexbar 2.31
GSE67735	After normalization, the expression of a gene was calculated by a RMA-summarization procedure within each growth condition.
GSE67735	agno3 concentration in µm: 0
GSE67735	agno3 concentration in µm: 5
GSE67735	agno3 concentration in µm: 6.5
GSE67735	agno3 concentration in µm: 8.5
GSE67735	At 3 h of culture, 60 mL of culture (at OD595 nm = 0.73 ± 0.07, 0.63 ± 0.02, 0.12 ± 0.01 and 0.11 ± 0.02 for cultures subjected to 0, 5.0, 6.5 and 8.5 µM AgNO3, respectively) were sampled and centrifuged (4000 rpm, 5 min, 4 °C), then the pellet was frozen in liquid nitrogen. The pellet was resuspended with 1 mL of TE buffer (Tris-HCl 10 mM, pH 8, EDTA 1 mM, 1 mg lysozyme) and incubated 5 min at room temperature. Total RNA was extracted with a RNeasy midi kit (Qiagen), including the DNase I treatment described in the manufacturer’s instructions. Total RNA quantity and integrity were checked by Nanodrop® and Agilent BioAnalyzer, respectively.
GSE67735	Ecoli_Ag0.0_rep1
GSE67735	Ecoli_Ag0.0_rep2
GSE67735	Ecoli_Ag0.0_rep3
GSE67735	Ecoli_Ag5.0_rep1
GSE67735	Ecoli_Ag5.0_rep2
GSE67735	Ecoli_Ag5.0_rep3
GSE67735	Ecoli_Ag6.5_rep1
GSE67735	Ecoli_Ag6.5_rep2
GSE67735	Ecoli_Ag6.5_rep3
GSE67735	Ecoli_Ag8.5_rep1
GSE67735	Ecoli_Ag8.5_rep2
GSE67735	Ecoli_Ag8.5_rep3
GSE67735	Escherichia coli,  0 µM AgNO3
GSE67735	Escherichia coli, 0 µM AgNO3
GSE67735	Escherichia coli, 5 µM AgNO3
GSE67735	Escherichia coli, 6.5 µM AgNO3
GSE67735	Escherichia coli, 8.5 µM AgNO3
GSE67735	Escherichia coli str. K-12 substr. MG1655
GSE67735	Ionic silver stock solutions were prepared from AgNO3 powder (Fisher Scientific Bioblock) as previously described (Saulou, Jamme et al., 2013) and stored in darkness. The final tested concentrations (5.0, 6.5, and 8.5 µM) were obtained by diluting the corresponding AgNO3 stock solution directly into the M9 growth medium. Control experiment was simultaneously performed by adding deionised water into the M9 broth. In both cases, a stabilization period of 24 h (at 37 °C and 120 rpm) was carried out before cell inoculation.
GSE67735	Raw probe intensities ( .pair files three replicates for each growth condition with respectively 0, 5.0, 6.5 and 8.5 µM of AgNO3 in the medium) was processed and analyzed with R computing environment using the affy and limma package of Bioconductor. Raw data were submitted to a RMA-base background correction [Irizarry et al, 2003, Biostatistics 4(2): 249-264]. After background correction, intra-replicate quantil normalization was performed for each growth condition. A set of probes in the background for which the ranks were roughly invariant across all the twelve arrays was selected. The median value of the invariant probeset intensities on each array was used as a scaling factor for normalization between growth conditions.
GSE67735	The laboratory strain E. coli K12 MG1655 was grown for 24 h at 37 °C under continuous shaking (120 rpm), in 200 mL M9 medium (Merck Prolabo) complemented with 2.5 g
GSE6781	15 ml of culture was mixed with 30 ml of RNAprotect bacterial reagent (QIAGEN Ltd).
GSE6781	An RNeasy midikit was used to prepare total RNA according to the manufacturer’s instructions (QIAGEN Ltd.). Any contaminating DNA was removed using a DNAase column kit (QIAGEN Ltd).
GSE6781	Data was analysed using GeneSpring
GSE6781	Escherichia coli
GSE6781	Growth: Anaerobic to early exponential growth
GSE6781	Media:Minimal salts + 20 mM trimethylamine-N-oxide
GSE6781	Media:Minimal salts + 20 mM trimethylamine-N-oxide +2.5 mM sodium nitrite
GSE6781	pGIT1
GSE6781	pGIT1.1
GSE6781	pGIT1.1 + NO2
GSE6781	pGIT1.2
GSE6781	pGIT1.2 + NO2
GSE6781	pGIT1.3
GSE6781	pGIT1.3 + NO2
GSE6781	pGIT1.4
GSE6781	pGIT1.4 + NO2
GSE6781	pGIT1 + NO2
GSE6781	pGIT8
GSE6781	pGIT8.1 + NO2
GSE6781	pGIT8.2 + NO2
GSE6781	pGIT8.3 + NO2
GSE6781	pGIT8.4 + NO2
GSE6781	pGIT8 + NO2
GSE6781	Pool of eight independent cultures
GSE6781	Strain: MG1655 pGIT1 (carries the ytfE promoter in multicopy, titrates out NsrR to phenocopy an NsrR- mutation)
GSE6781	Strain: MG1655 pGIT1 (carries the ytfE promoter in multicopy, titrates out NsrR to phenocopy an NsrR- mutation) Growth: Anaerobic to early exponential growth Media:Minimal salts + 20 mM trimethylamine-N-oxide
GSE6781	Strain: MG1655 pGIT1 (carries the ytfE promoter in multicopy, titrates out NsrR to phenocopy an NsrR- mutation) Growth: Anaerobic to early exponential growth Media:Minimal salts + 20 mM trimethylamine-N-oxide 
GSE6781	Strain: MG1655 pGIT1 (carries the ytfE promoter in multicopy, titrates out NsrR to phenocopy an NsrR- mutation) Growth: Anaerobic to early exponential growth Media:Minimal salts + 20 mM trimethylamine-N-oxide +2.5 mM sodium nitrite
GSE6781	Strain: MG1655 pGIT8 (carries 1 base pair deletion in the NsrR-binding site of the ytfE promoter)
GSE6781	Strain: MG1655 pGIT8 (carries 1 base pair deletion in the NsrR-binding site of the ytfE promoter) Growth: Anaerobic to early exponential growth Media:Minimal salts + 20 mM trimethylamine-N-oxide + 2.5 mM sodium nitrite
GSE6781	Strain: MG1655 pGIT8 (carries 1 base pair deletion in the NsrR-binding site of the ytfE promoter) Growth: Anaerobic to early exponential growth Media:Minimal salts + 20 mM trimethylamine-N-oxide +2.5 mM sodium nitrite
GSE6781	Strain: MG1655 pGIT8 (carries 1 base pair deletion in the NsrR-binding site of the ytfE promoter) Growth: Anaerobic to early exponential growth Media:Minimal salts + 20 mM trimethylamine-N-oxide + .5 mM sodium nitrite
GSE6781	Strain: MG1655 pGIT8 (carries 1 base pair deletion in the NsrR-binding site of the ytfE promoter) Growth: Anaerobic to early exponential growth Media:Minimal salts + 20 mM trimethylamine-N-oxide Pool of eight independent cultures
GSE6836	b2618_U_N0075_r1
GSE6836	b2618_U_N0075_r2
GSE6836	b2618_U_N0075_r3
GSE6836	b2618 upregulation, 0.075 ug
GSE6836	bcp___U_N0075_r1
GSE6836	bcp___U_N0075_r2
GSE6836	bcp___U_N0075_r3
GSE6836	bcp upregulation, 0.075 ug
GSE6836	ccdB_K12_0_r1
GSE6836	ccdB_K12_120_r1
GSE6836	ccdB_K12_30_r1
GSE6836	ccdB_K12_60_r1
GSE6836	ccdB_K12_90_r1
GSE6836	ccdB_MG1063_0_r1
GSE6836	ccdB_MG1063_0_r2
GSE6836	ccdB_MG1063_120_r1
GSE6836	ccdB_MG1063_30_r1
GSE6836	ccdB_MG1063_30_r2
GSE6836	ccdB_MG1063_60_r1
GSE6836	ccdB_MG1063_60_r2
GSE6836	ccdB_MG1063_90_r1
GSE6836	ccdB_MG1063_90_r2
GSE6836	ccdB_W1863_0_r1
GSE6836	ccdB_W1863_30_r1
GSE6836	ccdB_W1863_60_r1
GSE6836	ccdB_W1863_90_r1
GSE6836	cells 12 min after treatment by norfloxacin
GSE6836	cells 24 min after treatment by norfloxacin
GSE6836	cells 36 min after treatment by norfloxacin
GSE6836	cells 48 min after treatment by norfloxacin
GSE6836	cells 60 min after treatment by norfloxacin
GSE6836	cells prior to treatment by norfloxacin
GSE6836	cpxR__U_N0075_r1
GSE6836	cpxR__U_N0075_r2
GSE6836	cpxR__U_N0075_r3
GSE6836	cpxR upregulation, 0.075 ug
GSE6836	crcB__U_N0075_r1
GSE6836	crcB__U_N0075_r2
GSE6836	crcB__U_N0075_r3
GSE6836	crcB upregulation, 0.075 ug
GSE6836	crp___U_N0075_r1
GSE6836	crp___U_N0075_r2
GSE6836	crp___U_N0075_r3
GSE6836	crp upregulation, 0.075 ug
GSE6836	cspF__U_N0075_r1
GSE6836	cspF__U_N0075_r2
GSE6836	cspF__U_N0075_r3
GSE6836	cspF upregulation, 0.075 ug
GSE6836	dam___U_N0075_r1
GSE6836	dam___U_N0075_r2
GSE6836	dam___U_N0075_r3
GSE6836	dam upregulation, 0.075 ug
GSE6836	dinI___U_N0025_r1
GSE6836	dinI___U_N0025_r2
GSE6836	dinI___U_N0025_r3
GSE6836	dinI upregulation, amp 50ug
GSE6836	dinP___U_N0025_r1
GSE6836	dinP___U_N0025_r2
GSE6836	dinP___U_N0025_r3
GSE6836	dinP upregulation, amp 50ug
GSE6836	dnaA__U_N0075_r1
GSE6836	dnaA__U_N0075_r2
GSE6836	dnaA__U_N0075_r3
GSE6836	dnaA upregulation, 0.075 ug
GSE6836	dnaN__U_N0075_r1
GSE6836	dnaN__U_N0075_r2
GSE6836	dnaN__U_N0075_r3
GSE6836	dnaN upregulation, 0.075 ug
GSE6836	dnaT__U_N0075_r1
GSE6836	dnaT__U_N0075_r2
GSE6836	dnaT__U_N0075_r3
GSE6836	dnaT upregulation, 0.075 ug
GSE6836	E.coli K12 with ccdB upregulation 0 minutes after induction
GSE6836	E.coli K12 with ccdB upregulation 120 minutes after induction
GSE6836	E.coli K12 with ccdB upregulation 30 minutes after induction
GSE6836	E.coli K12 with ccdB upregulation 60 minutes after induction
GSE6836	E.coli K12 with ccdB upregulation 90 minutes after induction
GSE6836	E.coli K12 with lacZ upregulation 0 minutes after induction
GSE6836	E.coli K12 with lacZ upregulation 120 minutes after induction
GSE6836	E.coli K12 with lacZ upregulation 30 minutes after induction
GSE6836	E.coli K12 with lacZ upregulation 60 minutes after induction
GSE6836	E.coli K12 with lacZ upregulation 90 minutes after induction
GSE6836	E.coli MG1063 (recA56 = recA-) with ccdB upregulation 0 minutes after induction
GSE6836	E.coli MG1063 (recA56 = recA-) with ccdB upregulation 120 minutes after induction
GSE6836	E.coli MG1063 (recA56 = recA-) with ccdB upregulation 30 minutes after induction
GSE6836	E.coli MG1063 (recA56 = recA-) with ccdB upregulation 60 minutes after induction
GSE6836	E.coli MG1063 (recA56 = recA-) with ccdB upregulation 90 minutes after induction
GSE6836	E.coli MG1063 (recA56 = recA-) with lacZ upregulation 0 minutes after induction
GSE6836	E.coli MG1063 (recA56 = recA-) with lacZ upregulation 120 minutes after induction
GSE6836	E.coli MG1063 (recA56 = recA-) with lacZ upregulation 30 minutes after induction
GSE6836	E.coli MG1063 (recA56 = recA-) with lacZ upregulation 60 minutes after induction
GSE6836	E.coli MG1063 (recA56 = recA-) with lacZ upregulation 90 minutes after induction
GSE6836	E.coli W1863 wt lambda- with ccdB upregulation 0 minutes after induction
GSE6836	E.coli W1863 wt lambda- with ccdB upregulation 30 minutes after induction
GSE6836	E.coli W1863 wt lambda- with ccdB upregulation 60 minutes after induction
GSE6836	E.coli W1863 wt lambda- with ccdB upregulation 90 minutes after induction
GSE6836	E.coli W1863 wt lambda- with lacZ upregulation 0 minutes after induction
GSE6836	E.coli W1863 wt lambda- with lacZ upregulation 30 minutes after induction
GSE6836	E.coli W1863 wt lambda- with lacZ upregulation 60 minutes after induction
GSE6836	E.coli W1863 wt lambda- with lacZ upregulation 90 minutes after induction
GSE6836	emrR__U_N0075_r1
GSE6836	emrR__U_N0075_r3
GSE6836	emrR upregulation, 0.075 ug
GSE6836	era___U_N0075_r1
GSE6836	era___U_N0075_r2
GSE6836	era___U_N0075_r3
GSE6836	era upregulation, 0.075 ug
GSE6836	Escherichia coli
GSE6836	fis___U_N0075_r1
GSE6836	fis___U_N0075_r2
GSE6836	fis___U_N0075_r3
GSE6836	fis upregulation, 0.075 ug
GSE6836	fklB__U_N0075_r1
GSE6836	fklB__U_N0075_r2
GSE6836	fklB__U_N0075_r3
GSE6836	fklB upregulation, 0.075 ug
GSE6836	folA__U_N0075_r1
GSE6836	folA__U_N0075_r2
GSE6836	folA__U_N0075_r3
GSE6836	folA upregulation, 0.075 ug
GSE6836	galF__U_N0075_r1
GSE6836	galF__U_N0075_r2
GSE6836	galF__U_N0075_r3
GSE6836	galF upregulation, 0.075 ug
GSE6836	gcvR__U_N0075_r1
GSE6836	gcvR__U_N0075_r2
GSE6836	gcvR__U_N0075_r3
GSE6836	gcvR upregulation, 0.075 mg
GSE6836	GeneChips were washed and stained with an FS450 fluidics machine and scanned using a GeneChip Scanner 3000
GSE6836	gyrA__U_N0075_r1
GSE6836	gyrA__U_N0075_r2
GSE6836	gyrA__U_N0075_r3
GSE6836	gyrA upregulation, 0.075 mg
GSE6836	gyrI__U_N0075_r1
GSE6836	gyrI__U_N0075_r2
GSE6836	gyrI__U_N0075_r3
GSE6836	gyrI upregulation, 0.075 mg
GSE6836	hlpA__U_N0075_r1
GSE6836	hlpA__U_N0075_r2
GSE6836	hlpA__U_N0075_r3
GSE6836	hlpA upregulation, 0.075 mg
GSE6836	holD__U_N0075_r1
GSE6836	holD__U_N0075_r2
GSE6836	holD__U_N0075_r3
GSE6836	holD upregulation, 0.075 mg
GSE6836	hscA__U_N0075_r1
GSE6836	hscA__U_N0075_r2
GSE6836	hscA__U_N0075_r3
GSE6836	hscA upregulation, 0.075 mg
GSE6836	IHF___U_N0075_r1
GSE6836	IHF___U_N0075_r3
GSE6836	IHF upregulation, 0.075 mg
GSE6836	ik_H2_T2.5_r1
GSE6836	ik_H2_T3.5_r1
GSE6836	ik_H2_T3_r1
GSE6836	ik_H2_T4.5_r1
GSE6836	ik_H2_T4_r1
GSE6836	ik_H2_T5.5_r1
GSE6836	ik_H2_T5_r1
GSE6836	ik_H2_T6_r1
GSE6836	ik_H2_T8_r1
GSE6836	ik_L2_T2.5_r1
GSE6836	ik_L2_T3.5_r1
GSE6836	ik_L2_T3_r1
GSE6836	ik_L2_T4.5_r1
GSE6836	ik_L2_T4_r1
GSE6836	ik_L2_T5.5_r1
GSE6836	ik_L2_T5_r1
GSE6836	ik_L2_T6_r1
GSE6836	ik_L2_T8_r1
GSE6836	K12 EMG2 on LB with 0.2 percent glucose, 2.5 hours post-incubation
GSE6836	K12 EMG2 on LB with 0.2 percent glucose, 3.5 hours post-incubation
GSE6836	K12 EMG2 on LB with 0.2 percent glucose, 3 hours post-incubation
GSE6836	K12 EMG2 on LB with 0.2 percent glucose, 4.5 hours post-incubation
GSE6836	K12 EMG2 on LB with 0.2 percent glucose, 4 hours post-incubation
GSE6836	K12 EMG2 on LB with 0.2 percent glucose, 5.5 hours post-incubation
GSE6836	K12 EMG2 on LB with 0.2 percent glucose, 5 hours post-incubation
GSE6836	K12 EMG2 on LB with 0.2 percent glucose, 6 hours post-incubation
GSE6836	K12 EMG2 on LB with 0.2 percent glucose, 8 hours post-incubation
GSE6836	K12 EMG2 on LB with 0.4 percent glucose, 2.5 hours post-incubation
GSE6836	K12 EMG2 on LB with 0.4 percent glucose, 3.5 hours post-incubation
GSE6836	K12 EMG2 on LB with 0.4 percent glucose, 3 hours post-incubation
GSE6836	K12 EMG2 on LB with 0.4 percent glucose, 4.5 hours post-incubation
GSE6836	K12 EMG2 on LB with 0.4 percent glucose, 4 hours post-incubation
GSE6836	K12 EMG2 on LB with 0.4 percent glucose, 5.5 hours post-incubation
GSE6836	K12 EMG2 on LB with 0.4 percent glucose, 5 hours post-incubation
GSE6836	K12 EMG2 on LB with 0.4 percent glucose, 6 hours post-incubation
GSE6836	K12 EMG2 on LB with 0.4 percent glucose, 8 hours post-incubation
GSE6836	lacZ_K12_0_r1
GSE6836	lacZ_K12_120_r1
GSE6836	lacZ_K12_30_r1
GSE6836	lacZ_K12_60_r1
GSE6836	lacZ_K12_90_r1
GSE6836	lacZ_MG1063_0_r1
GSE6836	lacZ_MG1063_0_r2
GSE6836	lacZ_MG1063_120_r1
GSE6836	lacZ_MG1063_30_r1
GSE6836	lacZ_MG1063_30_r2
GSE6836	lacZ_MG1063_60_r1
GSE6836	lacZ_MG1063_60_r2
GSE6836	lacZ_MG1063_90_r1
GSE6836	lacZ_MG1063_90_r2
GSE6836	lacZ_W1863_0_r1
GSE6836	lacZ_W1863_30_r1
GSE6836	lacZ_W1863_60_r1
GSE6836	lacZ_W1863_90_r1
GSE6836	ldrA__U_N0075_r1
GSE6836	ldrA__U_N0075_r2
GSE6836	ldrA__U_N0075_r3
GSE6836	ldrA upregulation, 0.075 mg
GSE6836	lexA___U_N0025_r1
GSE6836	lexA___U_N0025_r2
GSE6836	lexA___U_N0025_r3
GSE6836	lexA upregulation, amp 50ug
GSE6836	lon___U_N0025_r1
GSE6836	lon___U_N0025_r2
GSE6836	lon___U_N0025_r3
GSE6836	lon upregulation, amp 50ug
GSE6836	luc2_U_N0000_r1
GSE6836	luc2_U_N0000_r2
GSE6836	luc2_U_N0025_r1
GSE6836	luc2_U_N0025_r2
GSE6836	luciferase 0.025ug
GSE6836	luciferase no drug
GSE6836	luc___U_N0000_r1
GSE6836	luc___U_N0000_r2
GSE6836	luc___U_N0000_r3
GSE6836	luc___U_N0025_r1
GSE6836	luc___U_N0025_r2
GSE6836	luc___U_N0025_r3
GSE6836	luc___U_N0075_r1
GSE6836	luc___U_N0075_r2
GSE6836	luc___U_N0075_r3
GSE6836	luc upregulation, 0.000 ug
GSE6836	luc upregulation, 0.075ug
GSE6836	luc upregulation, amp 50ug
GSE6836	mazF_chpA upregulation, amp 50ug
GSE6836	mazF___U_N0025_r1
GSE6836	mazF___U_N0025_r2
GSE6836	mazF___U_N0025_r3
GSE6836	mcrB__U_N0075_r1
GSE6836	mcrB__U_N0075_r2
GSE6836	mcrB__U_N0075_r3
GSE6836	mcrB upregulation, 0.075 mg
GSE6836	mcrC__U_N0075_r1
GSE6836	mcrC__U_N0075_r2
GSE6836	mcrC__U_N0075_r3
GSE6836	mcrC upregulation, 0.075 mg
GSE6836	menB__U_N0075_r1
GSE6836	menB__U_N0075_r2
GSE6836	menB__U_N0075_r3
GSE6836	menB upregulation, 0.075 mg
GSE6836	menC__U_N0075_r1
GSE6836	menC__U_N0075_r2
GSE6836	menC__U_N0075_r3
GSE6836	menC upregulation, 0.075 mg
GSE6836	minD__U_N0075_r1
GSE6836	minD__U_N0075_r2
GSE6836	minD__U_N0075_r3
GSE6836	minD upregulation, 0.075 mg
GSE6836	minE__U_N0075_r1
GSE6836	minE__U_N0075_r2
GSE6836	minE__U_N0075_r3
GSE6836	minE upregulation, 0.075 mg
GSE6836	murI__U_N0075_r1
GSE6836	murI__U_N0075_r2
GSE6836	murI__U_N0075_r3
GSE6836	murI upregulation, 0.075 mg
GSE6836	nrdA__U_N0075_r1
GSE6836	nrdA__U_N0075_r2
GSE6836	nrdA__U_N0075_r3
GSE6836	nrdA upregulation, 0.075 mg
GSE6836	nrdB__U_N0075_r1
GSE6836	nrdB__U_N0075_r3
GSE6836	nrdB upregulation, 0.075 mg
GSE6836	nupC__U_N0075_r1
GSE6836	nupC__U_N0075_r2
GSE6836	nupC__U_N0075_r3
GSE6836	nupC upregulation, 0.075 mg
GSE6836	pyrC__U_N0075_r1
GSE6836	pyrC__U_N0075_r2
GSE6836	pyrC__U_N0075_r3
GSE6836	pyrC upregulation, 0.075 mg
GSE6836	recA deletion 0.05 ug
GSE6836	recA deletion 0 ug
GSE6836	recA deletion 1.0 ug
GSE6836	recA_D_N0000_r1
GSE6836	recA_D_N0000_r2
GSE6836	recA_D_N0050_r1
GSE6836	recA_D_N0050_r2
GSE6836	recA_D_N1000_r1
GSE6836	recA_D_N1000_r2
GSE6836	recA___U_N0025_r1
GSE6836	recA___U_N0025_r2
GSE6836	recA___U_N0025_r3
GSE6836	recA upregulation, amp 50ug
GSE6836	relE___U_N0025_r1
GSE6836	relE___U_N0025_r2
GSE6836	relE___U_N0025_r3
GSE6836	relE upregulation, amp 50ug
GSE6836	rimI__U_N0075_r1
GSE6836	rimI__U_N0075_r2
GSE6836	rimI__U_N0075_r3
GSE6836	rimI upregulation, 0.075 mg
GSE6836	RNAEasy with RNAProtect(Qiagen)
GSE6836	rstB__U_N0075_r1
GSE6836	rstB__U_N0075_r2
GSE6836	rstB__U_N0075_r3
GSE6836	rstB upregulation, 0.075 mg
GSE6836	ruvA___U_N0025_r1
GSE6836	ruvA___U_N0025_r2
GSE6836	ruvA___U_N0025_r3
GSE6836	ruvA upregulation, amp 50ug
GSE6836	ruvC__U_N0075_r1
GSE6836	ruvC__U_N0075_r2
GSE6836	ruvC__U_N0075_r3
GSE6836	ruvC upregulation, 0.075 mg
GSE6836	sbcB__U_N0075_r1
GSE6836	sbcB__U_N0075_r2
GSE6836	sbcB__U_N0075_r3
GSE6836	sbcB upregulation, 0.075 mg
GSE6836	sulA___U_N0025_r1
GSE6836	sulA___U_N0025_r2
GSE6836	sulA___U_N0025_r3
GSE6836	sulA upregulation, amp 50ug
GSE6836	T0_N0025_r1
GSE6836	T0_N0025_r2
GSE6836	T0_N0025_r3
GSE6836	T12_N0025_r1
GSE6836	T12_N0025_r2
GSE6836	T12_N0025_r3
GSE6836	T24_N0000_r1
GSE6836	T24_N0000_r2
GSE6836	T24_N0000_r3
GSE6836	T24_N0025_r1
GSE6836	T24_N0025_r2
GSE6836	T24_N0025_r3
GSE6836	T36_N0025_r1
GSE6836	T36_N0025_r2
GSE6836	T36_N0025_r3
GSE6836	T48_N0025_r1
GSE6836	T48_N0025_r2
GSE6836	T48_N0025_r3
GSE6836	T60_N0000_r1
GSE6836	T60_N0000_r2
GSE6836	T60_N0000_r3
GSE6836	T60_N0025_r1
GSE6836	T60_N0025_r2
GSE6836	T60_N0025_r3
GSE6836	umuD___U_N0025_r1
GSE6836	umuD___U_N0025_r2
GSE6836	umuD___U_N0025_r3
GSE6836	umuD upregulation, amp 50ug
GSE6836	untreated cells after 24 min
GSE6836	untreated cells after 60 min
GSE6836	uspA__U_N0075_r1
GSE6836	uspA__U_N0075_r2
GSE6836	uspA__U_N0075_r3
GSE6836	uspA upregulation, 0.075 mg
GSE6836	uvrA___U_N0025_r1
GSE6836	uvrA___U_N0025_r2
GSE6836	uvrA___U_N0025_r3
GSE6836	uvrA upregulation, amp 50ug
GSE6836	wild-type 1.0 ug
GSE6836	wild-type cells with 0.025 ug
GSE6836	wild-type cells with 0.050 ug
GSE6836	wild-type cells with 0.075 ug
GSE6836	wild-type cells without norfloxacin
GSE6836	WT_D_N1000_r1
GSE6836	WT_D_N1000_r2
GSE6836	WT_N0000_r1
GSE6836	WT_N0000_r2
GSE6836	WT_N0025_r1
GSE6836	WT_N0025_r2
GSE6836	WT_N0050_r1
GSE6836	WT_N0050_r2
GSE6836	WT_N0075_r1
GSE6836	WT_N0075_r2
GSE6836	yebF__U_N0075_r1
GSE6836	yebF__U_N0075_r2
GSE6836	yebF__U_N0075_r3
GSE6836	yebF upregulation, 0.075ug
GSE6836	yoeB__U_N0075_r1
GSE6836	yoeB__U_N0075_r2
GSE6836	yoeB__U_N0075_r3
GSE6836	yoeB upregulation, 0.075 mg
GSE6836	zipA__U_N0075_r1
GSE6836	zipA__U_N0075_r2
GSE6836	zipA__U_N0075_r3
GSE6836	zipA upregulation, 0.075ug
GSE6925	BW25113 W
GSE6925	BW25113 ymgB LBglu 24h biofilm cells
GSE6925	channel 1
GSE6925	Channel 1
GSE6925	Escherichia coli
GSE6925	MAS 5.0 Expression Analysis Default Setting
GSE6925	RNA extracted from biofilm cells of BW25113 wild type after 24h of growth in LBglu with glass wool
GSE6925	RNA extracted from biofilm cells of BW25113 ymgB mutant after 24h of growth in LBglu with glass wool
GSE6925	To lyse the cells, 1.0 mL RLT buffer (Qiagen, Inc., Valencia, CA) and 0.2 mL 0.1 mm zirconia
GSE69265	agent: control
GSE69265	agent: glycolaldehyde
GSE69265	Data were analyzed by Feature Extraction V.11.5.1.1. RNA
GSE69265	Escherichia coli
GSE69265	genotype
GSE69265	M9 mineral medium containing (D)-xylose as the only carbon source (100 ml in 500 ml shake flasks) was inoculated from exponentially growing wild-type cells or synthetic cells (cultivated on xylose M9 medium) to adjust an OD of ~0.1. Cultures were incubated at 37°C under shaking until OD reached ~1. Then they were split into two 50 ml aliquots and further cultivated in 250 ml shake flasks in the presence or absence of 10 mM glycolaldehyde. After 30 min of incubation, 1 ml of the cell suspension was withdrawn and centrifuged at 1500 x g (Eppendorf 5415D) for 5 min. The supernatant was removed and the cell pellets were directly subject to RNA extraction. Experiment were repeated three times.
GSE69265	PEN205
GSE69265	PEN205 strain first repetition
GSE69265	PEN205 strain second repetition
GSE69265	PEN205 strain third repetition
GSE69265	strain: MG1655
GSE69265	The RNeasy Mini Kit (QIAGEN) was used to extract RNA. Quantity and quality of the samples were determined by NanoDrop (Thermo) and Bioanalyzer (Agilent Technologies), respectively
GSE69265	wild-type MG1655
GSE69265	wild-type MG1655 + glycolaldehyde 10 mM
GSE69265	WT cells were treated with 10 mM Glycolaldehyde for 30 min whenever the culture OD600nm reached ~1.
GSE69265	WT strain treated with glycolaldehyde first repetition
GSE69265	WT strain treated with glycolaldehyde second repetition
GSE69265	WT strain treated with glycolaldehyde third repetition
GSE69265	WT strain without glycolaldehyde first repetition
GSE69265	WT strain without glycolaldehyde second repetition
GSE69265	WT strain without glycolaldehyde third repetition
GSE69829	Cells were disrupted by sonication and NsrR bound DNA was isolated with anti-Flag antibody.
GSE69829	chip antibody: Monoclonal ANTI-FLAG  M5(Sigma-Aldrich, catalog number: F4042 )
GSE69829	chip antibody: none
GSE69829	ChIP-Seq
GSE69829	ChIP-seq reads were aligned to the CFT073 genome using bowtie (version 0.12.8)
GSE69829	DNA fragments were treated with Epicentre End-It DNA End Repair Kit and 3’ A overhangs were added with DNA polymerase I (Klenow fragment).  Adapters from the IlluminaTruSeq DNA sample preparation kit were ligated using LigFast (Promega) and DNAs were amplified by PCR using primers provided in the IlluminaTruSeq DNA sample preparation kit and Phusion DNA polymerase (NEB).  Products of the ligation reaction and PCR amplification in the range 300-400 bp were purified by 2% agarose gel electrophoresis.  DNA concentrations were measured using Qubit™ dsDNA HS Assay Kits (Invitrogen).
GSE69829	Escherichia coli CFT073
GSE69829	Genome_build: CFT073(AE014075.1)
GSE69829	NsrR_ChIPSeq_rep1
GSE69829	NsrR_ChIPSeq_rep2
GSE69829	NsrR_ChIPSeq_rep3
GSE69829	NsrR_input
GSE69829	peaks were called using MACS2 with default parameters
GSE69829	samples were grown aerobically in rich media
GSE69829	strain: CFT073 nsrR::3X-Flag tag
GSE69829	Supplementary_files_format_and_content: bed format peak file generated from MACS2
GSE69829	uropathogenic Escherichia coli (UPEC)
GSE69830	Escherichia coli CFT073
GSE69830	Genome_build: CFT073(AE014075.1)
GSE69830	genotype: deltahmp deltanrfA deltanorVW
GSE69830	(-NO)1
GSE69830	(+NO)1
GSE69830	(-NO)2
GSE69830	(+NO)2
GSE69830	(-NO)3
GSE69830	(+NO)3
GSE69830	RNA libraries were prepared for sequencing using standard Illumina protocols
GSE69830	RNA-Seq
GSE69830	RNA-seq reads were aligned to the CFT073 genome using bowtie (version 0.12.8)
GSE69830	Samples were grown anaerobically in MOPS minimal media supplemented with casamino acids using glucose as the carbon source. 20mM nitrate was added to (+NO) cultures for inducing nitrosative stress.
GSE69830	strain: CFT073
GSE69830	Supplementary_files_format_and_content: tab-delimited text files include TPM values for each Sample; column1: transcript id; column2: TPM value
GSE69830	Total Rna was extracted from cultures using Qiagen RNeasy Protect Bacteria Mini Kit. For rRNA depletion, samples were treated with the MICROBExpressTM Bacterial mRNA Enrichment Kit (Life Technologies) according to the manufacturer’s instructions.  Samples were cleaned with the Zymo RNA Clean and ConcentratorTM (Zymo Research) and then subjected to a second cycle of rRNA depletion.  RNA was recovered by ethanol precipitation.
GSE69830	TPM (transcripts per million) was calculated by RSEM(version 1.2.19)
GSE69830	uropathogenic Escherichia coli (UPEC) grown with nitrosative stress
GSE69830	uropathogenic Escherichia coli (UPEC) grown without nitrosative stress
GSE69912	DnaK deletant_37C
GSE69912	E.coli gene expression data in deletion of chaperone DnaK
GSE69912	Escherichia coli
GSE69912	genotype
GSE69912	strain background: BW25113
GSE69912	The signal
GSE69912	Total RNA was isolated from strains using NucleoSpin RNAII kit (Macherey-Nagel Corporation) following the instruction. RNA samples were examined in a 1.5% denaturing agarose gel, quantitated by absorbance at 260 nm and stored until further use for microarray.
GSE69912	WT_37C
GSE6992	Escherichia coli
GSE6992	Escherichia coli MG1655 10 minutes paraquat treatment
GSE6992	Escherichia coli MG1655 2 minutes paraquat treatment
GSE6992	Escherichia coli MG1655 4 minutes paraquat treatment
GSE6992	Escherichia coli MG1655 6 minutes paraquat treatment
GSE6992	Escherichia coli MG1655 8 minutes paraquat treatment
GSE6992	Escherichia coli MG1655 before paraquat treatment
GSE6992	Escherichia coli MG1655 with a precise deletion in soxR and 10 minutes paraquat treatment
GSE6992	Escherichia coli MG1655 with a precise deletion in soxR and 2 minutes paraquat treatment
GSE6992	Escherichia coli MG1655 with a precise deletion in soxR and 4 minutes paraquat treatment
GSE6992	Escherichia coli MG1655 with a precise deletion in soxR and 6 minutes paraquat treatment
GSE6992	Escherichia coli MG1655 with a precise deletion in soxR and 8 minutes paraquat treatment
GSE6992	Escherichia coli MG1655 with a precise deletion in soxR before paraquat treatment
GSE6992	M1655 wild type at t0, rep1
GSE6992	M1655 wild type at t0, rep2
GSE6992	M1655 wild type at t10, rep1
GSE6992	M1655 wild type at t10, rep2
GSE6992	M1655 wild type at t2, rep1
GSE6992	M1655 wild type at t2, rep2
GSE6992	M1655 wild type at t4, rep1
GSE6992	M1655 wild type at t4, rep2
GSE6992	M1655 wild type at t6, rep1
GSE6992	M1655 wild type at t6, rep2
GSE6992	M1655 wild type at t8, rep1
GSE6992	M1655 wild type at t8, rep2
GSE6992	M1655 with deletion in soxR at t0, rep1
GSE6992	M1655 with deletion in soxR at t10, rep1
GSE6992	M1655 with deletion in soxR at t2, rep1
GSE6992	M1655 with deletion in soxR at t4, rep1
GSE6992	M1655 with deletion in soxR at t6, rep1
GSE6992	M1655 with deletion in soxR at t8, rep1
GSE6992	Overnight cultures were inoculated 1:100 into 20ml of EZ Rich Defined Medium (Neidhardt et al., 1974) in 125 ml Erlenmeyer flasks and grown at 37oC and 250 rpm in a reciprocating water bath.
GSE6992	Paraquat was added to growing cultures at a final concentration of 250 ?M. Samples (1.4ml) were taken every 2 minutes following paraquat treatment for the length of the time course, and flash-frozen by immersion of the tubes in liquid nitrogen.  The cells were collected by centrifugation for 1 minute at 13,000 rpm,
GSE6992	The data were analyzed using Robust Multi-Array average as implemented in Bioconductor
GSE6992	Total RNA was isolated using Qiagen RNeasy Mini Kit and treated with DNase I
GSE70507	agitation speed: 1200 rpm
GSE70507	agitation speed: 600 rpm
GSE70507	bacterial cells
GSE70507	Data filtering was done with in-house script with the set value as follows: Removal if % of N nucleotide is more than 10%, if more than 40% of the nucleotide is Q20 or less, if average quality of the reads is less than Q20.
GSE70507	Escherichia coli
GSE70507	Expression of introduced enzymes for 3-HP productionm was induced by 0.05mM IPTG and 50 µM vitamin B12 when the cell reached at the early-exponential growth phase. T
GSE70507	fermentation time: 20h
GSE70507	fermentation time: 30h
GSE70507	fermentation time: 40h
GSE70507	Genome_build: http:
GSE70507	Illumina Casava 1.8.2 software used for basecalling with default parameter.
GSE70507	Read alignment was performed with BWA (version 0.6.2) with default parameter.
GSE70507	RNA-Seq
GSE70507	Sequenced reads were trimmed for adaptor sequence and masked for low-complexity sequence, then mapped to E.coli W3110 whole genome.
GSE70507	SH0003 30h
GSE70507	SH0012 20h
GSE70507	SH0012 30h
GSE70507	Sh0012 40h
GSE70507	SH0012 and SH0003 were fermented in a 5.0L jar-fermenter with a 2.0 working voulume of modified R medium (20g
GSE70507	SH0012 no rpm change
GSE70507	SH0012 no vitamin B12
GSE70507	strain: SH0003
GSE70507	strain: SH0012
GSE70507	Supplementary_files_format_and_content: Excel files include FPKM values for each sample.
GSE70507	The bacterial cells from 5L fermentation were collected at 20h, 30h, 40h and centrifuged for 5min to pellet the cells. The cells then mixed with 500mL of RNA protectant bacterial reagents to stabilize RNA and stored at -80°C until use. Total RNAs were isolated using RNeasy mini kit and were treated with DNase to remove DNA.
GSE70507	The RNA-Seq library was constructed with TruSeq RNA Preparation Kit.
GSE70507	Transcript assembly an quantification was performed using a protocols from Trapnell et al., and Li et al. Fragments Per Kilobases of exon per million (FPKM) were calculated.
GSE70688	Cells grown aerobically to exponential phase (OD600 = 0.8) in LB media at 37C were harvested.
GSE70688	E. coli expressing dr1558 replicate 1
GSE70688	E. coli expressing dr1558 replicate 2
GSE70688	E. coli expressing dr1558 replicate 3
GSE70688	E. coli harboring pRadGro replicate 1
GSE70688	E. coli harboring pRadGro replicate 2
GSE70688	E. coli harboring pRadGro replicate 3
GSE70688	Ec-pR VS Ec-1558 rep1
GSE70688	Ec-pR VS Ec-1558 rep2
GSE70688	Ec-pR VS Ec-1558 rep3
GSE70688	Escherichia coli
GSE70688	Non-treatment
GSE70688	strain information: E. coli harboring empty vector (pRADgro), used as a control strain
GSE70688	strain information: E. coli harboring pRADgro::dr1558
GSE70688	The genes were considered differentially expressed when the logarithmic gene expression ratios had a 2-fold difference in the expression level. The significance of the data was determined using Student’s t test. P-values of less than 0.01 were considered significant.
GSE70688	The genes were filtered by removing the flag-out genes in each experiment. The gene expression was normalized through LOWESS regression for 3 datasets obtained from 3 biological replicates.
GSE70688	Total RNA extracted using RiboEX reagent (GeneAll, Korea), treated with Dnase, and purified using the Rneasy Mini kit (Qiagen, Germany) according to the manufacturer's instructions.
GSE7	0' in minimal medium +0.2% glu, 25 ug total RNA
GSE7	0' in min med +0.2% glu, 25ug total RNA
GSE7	0' minimal + 0.2% glu, 25 ug total RNA
GSE7	0' minimal +02% glu, 25 ug total RNA
GSE7	0' minimal medium + 0.2% glu, 25 ug total
GSE71249	Adaptor Sequences were removed using fastx_clipper. (http:
GSE71249	All samples were processed following NEB’s protocol from the NEBNext® ChIP-Seq library preparation kit.
GSE71249	bacterial cell lysates_input
GSE71249	bacterial cell lysates_RecA-ChIP-seq
GSE71249	Cells were collected by centrifugation and washed three times in ice-cold 1X PBS. The pellet was then re-suspended in 250 μl ChIP buffer (200 mM Tris-HCl (pH 8.0), 600 mM NaCl 4% Triton X, Complete protease inhibitor cocktail EDTA-free (Roche)). Sonication of crosslinked samples was performed using the Diagenode Bioruptor® at 30s intervals for 10 min at high amplitude. After sonication, 350 μl of ChIP buffer was added to each sample, the samples were mixed by gentle pipetting and 100 μl of each lysate was removed and stored as ‘input’. Immunoprecipitation was performed overnight at 4°C using 1
GSE71249	Cells were grown in M9 minimal media supplemented with 0.2% casamino acids, 0.5% glucose 5μM CaCl2 and 1mM MgSO4 at 37°C to and OD600nm of 0.2-0.25
GSE71249	chip antibody: anti-RecA antibody
GSE71249	chip antibody cat.#: ab63797
GSE71249	chip antibody vendor: Abcam
GSE71249	ChIP-Seq
GSE71249	Data collapsed using fastx collapser to remove identical sequencing reads (http:
GSE71249	DL4899
GSE71249	DL4900
GSE71249	DL4900_input
GSE71249	DL5215
GSE71249	DL5322
GSE71249	DL5324
GSE71249	DL5326
GSE71249	DL5328
GSE71249	DL5330
GSE71249	Escherichia coli
GSE71249	Genome_build: Escherichia coli K12 MG1655 NC000913.3
GSE71249	Protein DNA interactions were crosslinked for 10 min at 22.5C with 1% formaldehyde and quenched using glycine to a final concentration of 0.5M
GSE71249	reads were mapped to the E. coli K12 MG1655 (NC000913.3) genome using Novoalign version 2.07  (www.novocraft.com) - Example: (novoalign -f DL4900_clip_clp.fasta -d NC000913.3.nix -r Random > DL4900.novo)
GSE71249	strain details: lacIq lacZχ- cynX::GmR lacZY::χχχ  mhpA::χχχ rph+
GSE71249	strain details: lacIq lacZχ- lacZ::246pal cynX::GmR lacZY::χ  mhpA::χχχ codBχ- prpEχ- mhpCχ- cynXχ- rph+
GSE71249	strain details: lacIq lacZχ- lacZ::246pal cynX::GmR lacZY::χχ  mhpA::χχχ codBχ- prpEχ- mhpCχ- cynXχ- rph+
GSE71249	strain details: lacIq lacZχ- lacZ::246pal cynX::GmR lacZY::χχχ  mhpA::χχχ codBχ- prpEχ- mhpCχ- cynXχ- rph+
GSE71249	strain details: lacIq lacZχ- lacZ::246pal cynX::GmR lacZY::χχχ  mhpA::χχχ rph+
GSE71249	strain details: lacIq lacZχ- lacZ::246pal cynX::GmR lacZY::χχχχ mhpA::χχχ codBχ- prpEχ- mhpCχ- cynXχ- rph+
GSE71249	strain details: lacIq lacZχ- lacZ::246pal cynX::GmR lacZY::χχχχχ  mhpA::χχχ codBχ- prpEχ- mhpCχ- cynXχ- rph+
GSE71249	strain details: lacIq lacZχ- lacZ::246pal cynX::GmR lacZY::χχχχχχ  mhpA::χχχ codBχ- prpEχ- mhpCχ- cynXχ- rph+
GSE71249	strain: K-12 MG1655
GSE71249	Supplementary_files_format_and_content: txt files including count data for the whole genome
GSE71249	yPileup was used to generate count data for the whole genome - Example:  pyPileup.py --file_type=novo -f DL4900.novo --tab=NC000913.3.tab --chr=Wholechom.txt.gz -- ignorestrand
GSE7	15' 10 ug
GSE7	15' 15 ug
GSE7	15'+50ug
GSE71562	Aeration was initiated at 1 l
GSE71562	alignment: STAR 2.4.0i
GSE71562	batch culture
GSE71562	batch culture rep1, 0.5 min
GSE71562	batch culture rep1, 0 min
GSE71562	batch culture rep1, 10 min
GSE71562	batch culture rep1, 1 min
GSE71562	batch culture rep1, 2 min
GSE71562	batch culture rep1, 5 min
GSE71562	batch culture rep2, 0.5 min
GSE71562	batch culture rep2, 0 min
GSE71562	batch culture rep2, 10 min
GSE71562	batch culture rep2, 1 min
GSE71562	batch culture rep2, 2 min
GSE71562	batch culture rep2, 5 min
GSE71562	batch culture rep3, 0.5 min
GSE71562	batch culture rep3, 0 min
GSE71562	batch culture rep3, 10 min
GSE71562	batch culture rep3, 1 min
GSE71562	batch culture rep3, 2 min
GSE71562	batch culture rep3, 5 min
GSE71562	Cell were grown in 3-liter stirred tank bioreactor anaerobically. The growth medium contained Na2H2PO4 (1.1 g
GSE71562	Escherichia coli
GSE71562	gene counting: HTSeq-Count 0.6.0
GSE71562	Genome_build: NC007779.1 (UCSC Archaeal Genome Browser)
GSE71562	replicate: 1
GSE71562	replicate: 2
GSE71562	replicate: 3
GSE71562	RNA libraries were prepared for sequencing using standard Illumina protocols
GSE71562	RNA-Seq
GSE71562	Samples were treated with RNAprotect (Qiagen, Hilden, Germany) and stored at -80°C until preparation. rRNA was removed using RiboZero rRNA Removal Kit (Illumina, San Diego, CA), and sequencing libraries were prepared with TruSeq™ RNA Sample Preparation Kitv2 (Illumina)
GSE71562	strain: K12 W3110
GSE71562	Supplementary_files_format_and_content: The file format is .xlsx. The file contains the raw gene counts of all samples.
GSE71562	time: 0.5 min
GSE71562	time: 0 min
GSE71562	time: 10 min
GSE71562	time: 1 min
GSE71562	time: 2 min
GSE71562	time: 5 min
GSE7	15' in minimal medium +0.2% glu, 25 ug total RNA
GSE7	15' in min med +0.2% glu+50ug
GSE7	15' vs 0' in minimal medium +0.2% glu
GSE71784	agent: control
GSE71784	agent: CORM-401
GSE71784	Agilent Feature Extraction Software (v 10.10.1.1) was used for background subtraction and LOWESS normalization.
GSE71784	Continuous aerobically grown cultures in Evans medium, CORM-401 samples or samples prior to addition of CORM-401
GSE71784	Continuous anaerobically grown cultures in Evans medium, CORM-401 samples or samples prior to addition of CORM-401
GSE71784	culture conditions: aerobic
GSE71784	culture conditions: anaerobic
GSE71784	Escherichia coli str. K-12 substr. MG1655
GSE71784	Slide 46_Aerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 10
GSE71784	Slide 46_Aerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 20
GSE71784	Slide 46_Aerobic culture_CORM-401_biol rep 2_Cy3 2.5 Cy5 0
GSE71784	Slide 46_Aerobic culture_CORM-401_biol rep 2_Cy3 5 Cy5 0
GSE71784	Slide 48_Aerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 2.5
GSE71784	Slide 48_Aerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 40
GSE71784	Slide 48_Aerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 5
GSE71784	Slide 48_Aerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 80
GSE71784	Slide 48_Aerobic culture_CORM-401_biol rep 2_Cy3 10 Cy5 0
GSE71784	Slide 48_Aerobic culture_CORM-401_biol rep 2_Cy3 20 Cy5 0
GSE71784	Slide 48_Aerobic culture_CORM-401_biol rep 2_Cy3 40 Cy5 0
GSE71784	Slide 48_Aerobic culture_CORM-401_biol rep 2_Cy3 80 Cy5 0
GSE71784	Slide 53_Aerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 10
GSE71784	Slide 53_Aerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 20
GSE71784	Slide 53_Aerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 2.5
GSE71784	Slide 53_Aerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 5
GSE71784	Slide 54_Aerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 40
GSE71784	Slide 54_Aerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 80
GSE71784	Slide 54_Aerobic culture_CORM-401_biol rep 1_Cy3 10 Cy5 0
GSE71784	Slide 54_Aerobic culture_CORM-401_biol rep 1_Cy3 20 Cy5 0
GSE71784	Slide 54_Aerobic culture_CORM-401_biol rep 1_Cy3 2.5 Cy5 0
GSE71784	Slide 54_Aerobic culture_CORM-401_biol rep 1_Cy3 40 Cy5 0
GSE71784	Slide 54_Aerobic culture_CORM-401_biol rep 1_Cy3 5 Cy5 0
GSE71784	Slide 54_Aerobic culture_CORM-401_biol rep 1_Cy3 80 Cy5 0
GSE71784	Slide 58_Anaerobic culture_CORM-401_biol rep 1_Cy3 10 Cy5 0
GSE71784	Slide 58_Anaerobic culture_CORM-401_biol rep 1_Cy3 20 Cy5 0
GSE71784	Slide 58_Anaerobic culture_CORM-401_biol rep 1_Cy3 40 Cy5 0
GSE71784	Slide 58_Anaerobic culture_CORM-401_biol rep 1_Cy3 80 Cy5 0
GSE71784	Slide 58_Anaerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 10
GSE71784	Slide 58_Anaerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 20
GSE71784	Slide 58_Anaerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 2.5
GSE71784	Slide 58_Anaerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 5
GSE71784	Slide 59_Anaerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 40
GSE71784	Slide 59_Anaerobic culture_CORM-401_biol rep 2_Cy3 0 Cy5 80
GSE71784	Slide 59_Anaerobic culture_CORM-401_biol rep 2_Cy3 10 Cy5 0
GSE71784	Slide 59_Anaerobic culture_CORM-401_biol rep 2_Cy3 20 Cy5 0
GSE71784	Slide 59_Anaerobic culture_CORM-401_biol rep 2_Cy3 2.5 Cy5 0
GSE71784	Slide 59_Anaerobic culture_CORM-401_biol rep 2_Cy3 40 Cy5 0
GSE71784	Slide 59_Anaerobic culture_CORM-401_biol rep 2_Cy3 5 Cy5 0
GSE71784	Slide 59_Anaerobic culture_CORM-401_biol rep 2_Cy3 80 Cy5 0
GSE71784	Slide 70_Anaerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 10
GSE71784	Slide 70_Anaerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 20
GSE71784	Slide 70_Anaerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 2.5
GSE71784	Slide 70_Anaerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 40
GSE71784	Slide 70_Anaerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 5
GSE71784	Slide 70_Anaerobic culture_CORM-401_biol rep 1_Cy3 0 Cy5 80
GSE71784	Slide 70_Anaerobic culture_CORM-401_biol rep 1_Cy3 2.5 Cy5 0
GSE71784	Slide 70_Anaerobic culture_CORM-401_biol rep 1_Cy3 5 Cy5 0
GSE71784	strain: Wild type strain MG1655
GSE71784	time: 0 min
GSE71784	time: 10 min
GSE71784	time: 20 min
GSE71784	time: 2.5 min
GSE71784	time: 40 min
GSE71784	time: 5 min
GSE71784	time: 80 min
GSE71784	Total RNA extracted using Trizol following manufacturer's instructions
GSE7243	Escherichia coli
GSE7243	K12 WT 3110
GSE7243	MasterPure RNA purification Kit
GSE7243	Overnight culture
GSE7243	phoU_1
GSE7243	phoU_2
GSE7243	phoU_3
GSE7243	phoU gene mutant
GSE7243	phoU gene mutant; minimal medium
GSE7243	The data were analyzed with GCOS 1.4 software.  All probe sets scaling was performed with a target signal value of 500.  No normalization was performed.
GSE7243	wildtype strain; minimal medium
GSE7243	WT3110_1
GSE7243	WT3110_2
GSE7243	WT3110_3
GSE7	30' 10 ug
GSE7	30' 15 ug
GSE7	30'+50ug
GSE7	30' in minimal medium +0.2% glu, 25 ug total RNA
GSE7	30' in min med +0.2% glu+50ug
GSE7	30' vs 0' in minimal medium +0.2% glu
GSE73640	BL21(DE3) HPA 0mM
GSE73640	BL21(DE3) HPA 3mM
GSE73640	BL21(DE3) with 3 mM of heptanoic acid
GSE73640	BL21(DE3) without heptanoic acid
GSE73640	Escherichia coli BL21(DE3)
GSE73640	Escherichia coli str. K-12 substr. MG1655
GSE73640	K12 MG1655 with 10 mM of heptanoic acid
GSE73640	K12 MG1655 without heptanoic acid
GSE73640	metabolic response: BL21(DE3) is very susceptible to heptanoic acid, because several acid resistance systems stay inactive under this stress condition
GSE73640	metabolic response: K12 MG1655 activates various acid resistance systems under heptanoic acid stress
GSE73640	MG1655 HPA 0mM
GSE73640	MG1655 HPA 10mM
GSE73640	strain: BL21(DE3)
GSE73640	strain: K12 MG1655
GSE73640	stress: control
GSE73640	stress: heptanoic acid
GSE73640	The average fluorescence intensity for each spot was calculated and local background was subtracted. All data normalization and selection of fold-changed genes were performed using GeneSpringGX 7.3.1 (Agilent Technology, USA).  Normalization for Agilent one-color method was performed, which is Data transformation : Set measurements less than 5.0 to 5.0 and Per Chip :Normalize to 50th percentage.
GSE73640	Total RNA was extracted using TRIzol (Invitrogen)
GSE73640	When E. coli cells were cultivated to the exponential growth phase (OD600 = 0.5) in Riesenberg medium, 3 or 10 mM heptanoic acid was treated to BL21(DE3) and K-12 MG1655, respectively. After 3 h incubation, the E. coli cells were harvested for transcriptome analysis
GSE73672	aspC KO rep1
GSE73672	aspC KO rep2
GSE73672	aspC KO rep3
GSE73672	Bacteria were harvested with 0.5 Vol of 5% phenol in ethanol and frozen at -80C. Total RNA was extracted from frozen cultures using RNeasy kit (Qiagen).
GSE73672	cysA KO rep1
GSE73672	cysA KO rep2
GSE73672	cysA KO rep3
GSE73672	cysG KO LB rep1
GSE73672	cysG KO LB rep2
GSE73672	cysH KO LB rep1
GSE73672	cysH KO LB rep2
GSE73672	dcd KO LB rep1
GSE73672	dcd KO LB rep2
GSE73672	dcd KO M9 rep1
GSE73672	dcd KO M9 rep2
GSE73672	entF KO rep1
GSE73672	entF KO rep2
GSE73672	entF KO rep3
GSE73672	Escherichia coli BW25113
GSE73672	fadr KO LB rep1
GSE73672	fadr KO LB rep2
GSE73672	fadr KO M9 rep1
GSE73672	fadr KO M9 rep2
GSE73672	fepA KO LB rep1
GSE73672	fepA KO LB rep2
GSE73672	fepA KO M9 rep1
GSE73672	fepA KO M9 rep2
GSE73672	fliY KO rep1
GSE73672	fliY KO rep2
GSE73672	fliY KO rep3
GSE73672	For RNA-Seq analysis, the fastq file produced from the machine was demultiplexed into a separate file for each sample.
GSE73672	For the first batch (from WT_LB_1 to lacA_M9_2), fresh colonies of E. coli cells were taken and inoculated in 1 ml LB and grown for 8 h at 37°C. 20 µL of grown culture was taken and transferred to 3 ml LB
GSE73672	gabT KO rep1
GSE73672	gabT KO rep2
GSE73672	gabT KO rep3
GSE73672	galE KO rep1
GSE73672	galE KO rep2
GSE73672	galE KO rep3
GSE73672	Genome_build: RefSeq NC_000913.3
GSE73672	genotype
GSE73672	HTSeq is used to generate expression count for each gene.
GSE73672	Index sequences accompanying with reads were compared with pre-designed barcodes, allowing two base mismatches at most.
GSE73672	kefB KO rep1
GSE73672	kefB KO rep2
GSE73672	kefB KO rep3
GSE73672	khc KO rep1
GSE73672	khc KO rep2
GSE73672	khc KO rep3
GSE73672	lacA KO LB rep1
GSE73672	lacA KO LB rep2
GSE73672	lacA KO M9 rep1
GSE73672	lacA KO M9 rep2
GSE73672	Library constructed using KAPA Kit.
GSE73672	lplA KO rep1
GSE73672	lplA KO rep2
GSE73672	lplA KO rep3
GSE73672	media: LB
GSE73672	media: M9
GSE73672	mgtA KO rep1
GSE73672	mgtA KO rep2
GSE73672	mgtA KO rep3
GSE73672	mhpD KO rep1
GSE73672	mhpD KO rep2
GSE73672	mhpD KO rep3
GSE73672	Parent LB rep1
GSE73672	Parent LB rep2
GSE73672	Parent M9 rep1
GSE73672	Parent M9 rep2
GSE73672	ppk KO LB rep1
GSE73672	ppk KO LB rep2
GSE73672	ppk KO M9 rep1
GSE73672	ppk KO M9 rep2
GSE73672	putP KO rep1
GSE73672	putP KO rep2
GSE73672	putP KO rep3
GSE73672	rfbA KO rep1
GSE73672	rfbA KO rep2
GSE73672	rfbA KO rep3
GSE73672	RNA-Seq
GSE73672	sdhC KO rep1
GSE73672	sdhC KO rep2
GSE73672	sdhC KO rep3
GSE73672	strain
GSE73672	Supplementary_files_format_and_content: htcount : expression count for each gene and its name.
GSE73672	The low-quality of raw reads were trimmed using Trimmomatic (v0.30) with default settings.
GSE73672	treatment: 0.3% glucose
GSE73672	treatment: 0.4% glucose
GSE73672	Trimmed reads were aligned on most recent reference genome of Escherichia coli (GenBank U00096.3) by using TopHat (v2.0.10) coupled with bowtie (v1.0.0).
GSE73672	trpD KO rep1
GSE73672	trpD KO rep2
GSE73672	trpD KO rep3
GSE73672	ugpC KO rep1
GSE73672	ugpC KO rep2
GSE73672	ugpC KO rep3
GSE73672	Whole cell, aspC KO, M9 and 0.4% glucose
GSE73672	Whole cell, cysA KO, M9 and 0.4% glucose
GSE73672	Whole cell, cysG KO, LB and 0.3% glucose
GSE73672	Whole cell, cysH KO, LB and 0.3% glucose
GSE73672	Whole cell, dcd KO, LB and 0.3% glucose
GSE73672	Whole cell, dcd KO, M9 and 0.3% glucose
GSE73672	Whole cell, entF KO, M9 and 0.4% glucose
GSE73672	Whole cell, fadR KO, LB and 0.3% glucose
GSE73672	Whole cell, fadR KO, M9 and 0.3% glucose
GSE73672	Whole cell, fepA KO, LB and 0.3% glucose
GSE73672	Whole cell, fepA KO, M9 and 0.3% glucose
GSE73672	Whole cell, fliY KO, M9 and 0.4% glucose
GSE73672	Whole cell, gabT KO, M9 and 0.4% glucose
GSE73672	Whole cell, galE KO, M9 and 0.4% glucose
GSE73672	Whole cell, kefB KO, M9 and 0.4% glucose
GSE73672	Whole cell, khc KO, M9 and 0.4% glucose
GSE73672	Whole cell, lacA KO, LB and 0.3% glucose
GSE73672	Whole cell, lacA KO, M9 and 0.3% glucose
GSE73672	Whole cell, lplA KO, M9 and 0.4% glucose
GSE73672	Whole cell, mgtA KO, M9 and 0.4% glucose
GSE73672	Whole cell, mhpD KO, M9 and 0.4% glucose
GSE73672	Whole cell, ppk KO, LB and 0.3% glucose
GSE73672	Whole cell, ppk KO, M9 and 0.3% glucose
GSE73672	Whole cell, putP KO, M9 and 0.4% glucose
GSE73672	Whole cell, rfbA KO, M9 and 0.4% glucose
GSE73672	Whole cell, sdhC KO, M9 and 0.4% glucose
GSE73672	Whole cell, trpD KO, M9 and 0.4% glucose
GSE73672	Whole cell, ugpC KO, M9 and 0.4% glucose
GSE73672	Whole cell, WT, LB and 0.3% glucose
GSE73672	Whole cell, WT, M9 and 0.3% glucose
GSE73672	Whole cell, WT, M9 and 0.4% glucose
GSE73672	Whole cell, wzc KO, LB and 0.3% glucose
GSE73672	Whole cell, wzc KO, M9 and 0.3% glucose
GSE73672	Whole cell, yghD KO, LB and 0.3% glucose
GSE73672	Whole cell, yghD KO, M9 and 0.3% glucose
GSE73672	WT rep1
GSE73672	WT rep2
GSE73672	WT rep3
GSE73672	wzc KO LB rep1
GSE73672	wzc KO LB rep2
GSE73672	wzc KO M9 rep1
GSE73672	wzc KO M9 rep2
GSE73672	yghD KO LB rep1
GSE73672	yghD KO LB rep2
GSE73672	yghD KO M9 rep1
GSE73672	yghD KO M9 rep2
GSE73707	5-azacytidine-treated
GSE73707	Agilent Feature Extract software performed background normalization and LOWESS correction for dye bias. Non-E. coli K-12 probes were removed from the dataset, as the BW25113 strain is a K-12 strain.
GSE73707	Cells were grown in the absence and presence of 0.005 mg
GSE73707	early stationary phase 1
GSE73707	early stationary phase 2
GSE73707	early stationary phase 3
GSE73707	early stationary phase 4
GSE73707	early stationary phase 5
GSE73707	Escherichia coli
GSE73707	Escherichia coli cells were grown in LB at 37oC with shaking at 250 RPM
GSE73707	log phase 1
GSE73707	log phase 2
GSE73707	log phase 3
GSE73707	log phase 4
GSE73707	log phase 5
GSE73707	phase: early stationary phase
GSE73707	phase: log phase
GSE73707	strain: BW25113
GSE73707	Total RNA was isolated with the MasterPure RNA Isolation Kit (Epicentre), enriched for mRNA using the mRNA Prokaryotic mRNA Isolation Kit (Epicentre), and polyadenylated with kit all based on the manufacturer's instructions
GSE73707	untreated
GSE7379	150 minutes growth  in LB
GSE7379	240 minutes growth  in LB
GSE7379	360 minutes growth  in LB
GSE7379	90 minutes growth  in LB
GSE7379	Cells were grown in LB at 37 degrees celsius with shaking for 150 minutes
GSE7379	Cells were grown in LB at 37 degrees celsius with shaking for 240 minutes
GSE7379	Cells were grown in LB at 37 degrees celsius with shaking for 360 minutes
GSE7379	Cells were grown in LB at 37 degrees celsius with shaking for 90 minutes
GSE7379	Escherichia coli
GSE7379	Escherichia coli MG1655 fis::kan grown 150 minutes
GSE7379	Escherichia coli MG1655 fis::kan grown 240 minutes
GSE7379	Escherichia coli MG1655 fis::kan grown 360 minutes
GSE7379	Escherichia coli MG1655 fis::kan grown 90 minutes
GSE7379	fis 150 minutes growth rep1
GSE7379	fis 150 minutes growth rep2
GSE7379	fis 150 minutes growth rep3
GSE7379	fis 240 minutes growth rep1
GSE7379	fis 240 minutes growth rep2
GSE7379	fis 240 minutes growth rep3
GSE7379	fis 360 minutes growth rep1
GSE7379	fis 360 minutes growth rep2
GSE7379	fis 360 minutes growth rep3
GSE7379	fis 90 minutes growth rep1
GSE7379	fis 90 minutes growth rep2
GSE7379	fis 90 minutes growth rep3
GSE7379	fis  Escherichia coli
GSE7379	MasterPure RNA purification Kit per manufacturers protocol
GSE7379	Saturated E. coli cultures were diluted in LB toan OD.of  0.05 OD600, grown at 37 degrees Celsius
GSE7379	The data were analyzed with Microarray Suite version 5.0 (MAS 5.0) using Affymetrix default analysis settings and global scaling as normalization method.
GSE7379	The data were analyzed with Microarray Suite version 5.0 (MAS 5.0) using Affymetrix default analysis settings and global scaling as normalization method.  Data from this sample were collected using Affy Ecoli anti-sense chip (2001; platform ID GPL4940), but because the analysis software failed to recognize the correct platform, we reformatted the data to match the newer (and mostly equivalent) platform GPL199 (Affy Ecoli anti-sense chip version 2, 2002).  Because, however, not all of the probes on the new platform were present on the old platform, data for some probes were unavailable and labeled in the 'remapped' dataset as 'NULL' to indicate they were missing.  While the following data are therefore formatted using ID_REFs that match GPL199, the CEL file contains the raw data (not 'remapped') and thus corresponds to the actual array used (GPL4940, Ecoli antisense chip, 2001).
GSE7380	150 minutes growth  in LB
GSE7380	240 minutes growth  in LB
GSE7380	360 minutes growth  in LB
GSE7380	90 minutes growth  in LB
GSE7380	Cells were grown in LB at 37 degrees celsius with shaking for 150 minutes
GSE7380	Cells were grown in LB at 37 degrees celsius with shaking for 240 minutes
GSE7380	Cells were grown in LB at 37 degrees celsius with shaking for 360 minutes
GSE7380	Cells were grown in LB at 37 degrees celsius with shaking for 90 minutes
GSE7380	Escherichia coli
GSE7380	Escherichia coli MG1655 wt grown 150 minutes
GSE7380	Escherichia coli MG1655 wt grown 240 minutes
GSE7380	Escherichia coli MG1655 wt grown 360 minutes
GSE7380	Escherichia coli MG1655 wt grown 90 minutes
GSE7380	MasterPure RNA purification Kit per manufacturers protocol
GSE7380	Saturated E. coli cultures were diluted in LB to an OD.of  0.05 OD600, grown at 37 degrees Celsius
GSE7380	Saturated E. coli cultures were diluted in LB toan OD.of  0.05 OD600, grown at 37 degrees Celsius
GSE7380	The data were analyzed with Microarray Suite version 5.0 (MAS 5.0) using Affymetrix default analysis settings and global scaling as normalization method.
GSE7380	The data were analyzed with Microarray Suite version 5.0 (MAS 5.0) using Affymetrix default analysis settings and global scaling as normalization method.  Data from this sample were collected using Affy Ecoli anti-sense chip (2001; platform ID GPL4940), but because the analysis software failed to recognize the correct platform, we reformatted the data to match the newer (and mostly equivalent) platform GPL199 (Affy Ecoli anti-sense chip version 2, 2002).  Because, however, not all of the probes on the new platform were present on the old platform, data for some probes were unavailable and labeled in the 'remapped' dataset as 'NULL' to indicate they were missing.  While the following data are therefore formatted using ID_REFs that match GPL199, the CEL file contains the raw data (not 'remapped') and thus corresponds to the actual array used (GPL4940, Ecoli antisense chip, 2001).
GSE7380	wildtype Escherichia coli
GSE7380	wt 150 minutes growth rep1
GSE7380	wt 150 minutes growth rep2
GSE7380	wt 150 minutes growth rep3
GSE7380	wt 240 minutes growth rep1
GSE7380	wt 240 minutes growth rep2
GSE7380	wt 240 minutes growth rep3
GSE7380	wt 360 minutes growth rep1
GSE7380	wt 360 minutes growth rep2
GSE7380	wt 360 minutes growth rep3
GSE7380	wt 90 minutes growth rep1
GSE7380	wt 90 minutes growth rep2
GSE7380	wt 90 minutes growth rep3
GSE73969	All raw FastQ files generated were filtered using FASTX-Toolkit (http:
GSE73969	Enterohemorrhagic Escherichia coli O157:H7 strain EDL933
GSE73969	Escherichia coli O157:H7 str. EDL933
GSE73969	Genome_build: NC_002655.2
GSE73969	genotype: {delta}hns
GSE73969	genotype: wild type
GSE73969	hns_1
GSE73969	hns_2
GSE73969	Illumina Casava1.7 software used for basecalling.
GSE73969	Overnight cultures of bacteria were diluted 1:100 in fresh LB broth and grown to logarithmic phase at an OD600 of about 0.8.
GSE73969	phase: logarithmic phase
GSE73969	Reads per kilobase of exon model per million mapped reads (RPKM) was used as a normalized metric to present the gene expression levels.(Nature methods 2008, 5: 621-628)
GSE73969	RNA extraction was performed using RiboPure-BacteriaTM Bacteria kit according to the manufacturer's protocol (Ambion, Life Technologies). DNase I treatment was applied to eliminate genomic DNA contamination as per the manufacturer's recommendations.
GSE73969	RNA libraries were prepared for sequencing using standard Illumina protocols
GSE73969	RNA-Seq
GSE73969	Supplementary_files_format_and_content: RPKM
GSE73969	The bacteria were centrifuged at 4000×g at 4°C for 5 min and then washed with PBS.
GSE73969	Transcripts evaluation of differential expression were accomplished using MARS (MA-plot-based method with Random sampling model) in DEGseq package.(Bioinformatics 2010, 26: 136-138)
GSE73969	wt_1
GSE73969	wt_2
GSE74809	Bacterial cells
GSE74809	Escherichia coli str. K-12 substr. MG1655
GSE74809	Genome_build: NC_000913.2
GSE74809	genotype: del rpoS
GSE74809	genotype: del rsd
GSE74809	genotype: del rsd; del ssrS
GSE74809	genotype: del ssrS
GSE74809	genotype: Wild-type
GSE74809	growth phase: Early Exponential
GSE74809	growth phase: Late Stationary
GSE74809	growth phase: Mid-Exponential
GSE74809	growth phase: Stationary
GSE74809	growth phase: Transition to Stationary
GSE74809	Libraries for Illumina HiSeq 1000 sequencing using the Truseq kit were prepared using protocols recommended by the manufacturer.
GSE74809	M9 defined medium (0.6% Na2HPO4, 0.3% KH2PO4, 0.05% NaCl, 0.01% NH4Cl, 0.1 mM CaCl2, 1 mM MgSO4, 5 x 10−4% Thiamin) supplemented with 0.5% glucose and 0.1% amino acids was used for RNA-seq experiments.
GSE74809	Overnight cultures in M9 glucose were inoculated into 100 mL fresh M9 glucose to a final OD600 of 0.02. The flasks were incubated at 37 °C with shaking at 200 rpm. Cells were collected by centrifugation at the early exponential (OD600 ~0.3), mid-exponential (OD600 ~0.8), transition to stationary (OD600 ~1.6), stationary (16 hrs, OD600 ~2), and late stationary (48 hrs, OD600 ~1.6) phases of growth.
GSE74809	Raw sequence data obtained in the fastq format were aligned to the genome of E. coli K12 MG1655 using the Burrows-Wheeler matching program BWA. Reads mapping uniquely to the genome were selected and the number of reads mapping to each gene was computed using custom scripts.
GSE74809	RNA-Seq
GSE74809	RNA was extracted using TRIzol (Invitrogen), following the manufacturer's protocol. Total RNA was treated with DNAse I (Invitrogen, Cat No. 18068-015) according to the manufacturer's protocol. Further precipitation of RNA and ribosomal RNA cleanup was achieved by Ambion MICROBExpress bacterial mRNA purification Kit (cat. no. AM1905) according to the manufacturer's protocol. The RNA was finally suspended in 10 μL RNAse free water.
GSE74809	rpoS_EE_1
GSE74809	rpoS_EE_2
GSE74809	rpoS_LS_1
GSE74809	rpoS_LS_2
GSE74809	rpoS_ME_1
GSE74809	rpoS_ME_2
GSE74809	rpoS_S_1
GSE74809	rpoS_S_2
GSE74809	rpoS_TS_1
GSE74809	rpoS_TS_2
GSE74809	rsd_EE_1
GSE74809	rsd_EE_2
GSE74809	rsd_LS_1
GSE74809	rsd_LS_2
GSE74809	rsd_ME_1
GSE74809	rsd_ME_2
GSE74809	rsd_S_1
GSE74809	rsd_S_2
GSE74809	rsdssrS_EE_1
GSE74809	rsdssrS_EE_2
GSE74809	rsdssrS_LS_1
GSE74809	rsdssrS_LS_2
GSE74809	rsdssrS_ME_1
GSE74809	rsdssrS_ME_2
GSE74809	rsdssrS_S_1
GSE74809	rsdssrS_S_2
GSE74809	rsdssrS_TS_1
GSE74809	rsdssrS_TS_2
GSE74809	rsd_TS_1
GSE74809	rsd_TS_2
GSE74809	ssrS_EE_1
GSE74809	ssrS_EE_2
GSE74809	ssrS_LS_1
GSE74809	ssrS_LS_2
GSE74809	ssrS_ME_1
GSE74809	ssrS_ME_2
GSE74809	ssrS_S_1
GSE74809	ssrS_S_2
GSE74809	ssrS_TS_1
GSE74809	ssrS_TS_2
GSE74809	Supplementary_files_format_and_content: Tab-delimited text file; genes in rows and samples in columns; each entry corresponds to the number of reads mapping to the given gene in the given sample.
GSE74809	These  counts were fed into the DESeq package in Bioconductor to estimate differential expression between the mutants and the wildtype.
GSE74809	wt_EE_1
GSE74809	wt_EE_2
GSE74809	wt_LS_1
GSE74809	wt_LS_2
GSE74809	wt_ME_1
GSE74809	wt_ME_2
GSE74809	wt_S_1
GSE74809	wt_S_2
GSE74809	wt_TS_1
GSE74809	wt_TS_2
GSE74810	chip antibody manufacturer
GSE74810	chip antibody: Monoclonal anti-FLAG antibody, Murine  IgG
GSE74810	ChIP-exo reads were aligned using BWA with  default parameters
GSE74810	E. coli and S. Typhimurium cells (at mid-exponential growth phase) were fixed with formaldehyde (1% final concentration) for  20 min at 30°C with shaking. The crosslinking reaction was then quenched by the addition of glycine (0.33M final concentrationg) for 5 minutes at room temperature with gentle mixing.  Cells where then lysed on ice with lysozyme and sonication.
GSE74810	E. coli cells were grown in Kornberg medium (1.1% [wt
GSE74810	Escherichia coli str. K-12 substr. MG1655
GSE74810	Genome_build: NC_000913.3
GSE74810	Genome_build: NC_016856.1
GSE74810	Library strategy: ChIP-exo
GSE74810	OTHER
GSE74810	Peaks on opposing strands were paired with Genetrack (u=0, d=80, b=2, m=mode)
GSE74810	Peaks were called with GeneTrack 1.0.3 (s=5, e=10)
GSE74810	Peconic LLC performed data processing
GSE74810	Samples were used for on-bead enzymatic reactions of the ChIP-exo procedure and Illumina Tru-seq sequencing libraries were construction as described in Rhee and Pugh, 2012
GSE74810	Singleton peaks (standard deviation =0) and peaks without matched peaks on the opposing strand where discarded
GSE74810	strain: MG1655
GSE74810	S. Typhimurium cells were grown in LB (supplemented with 10mM glucose) to mid-exponential phase (OD600 = ~0.6) at 37C and shaking 250rpm
GSE74810	Supplementary_files_format_and_content: Bedgraphs files representing the extracted peak data
GSE74810	Supplementary_files_format_and_content: chromosome chromosomeStartPosition chromosomeStopPosition readCoverage(positive values on + strand, negative on - strand)
GSE74810	UvrY - ChIP-exo
GSE74810	UvrY (Response regulator of the BarA
GSE74836	Bacterial cells
GSE74836	Cells were grown at 37°C, 200 rpm in M9 glucose, for 16 hours (stationary phase).
GSE74836	chip antibody: None
GSE74836	chip antibody: RpoS (Neoclone cat. no. WP009)
GSE74836	ChIP-Seq
GSE74836	Cross-linked cells were harvested by centrifugation, washed thrice with ice-cold TBS (pH 7.5), resuspended in 1 ml lysis buffer [10 mM Tris (pH 8.0), 20% sucrose, 50 mM NaCl, 10 mM EDTA, 20 mg
GSE74836	Escherichia coli str. K-12 substr. MG1655
GSE74836	Files were coverted to .bam format using samtools
GSE74836	Formaldehyde was added to a final concentration of 1%. After incubation for 20 minutes, glycine was added to a final concentration of 0.5 M and incubated for 5 minutes.
GSE74836	Genome_build: NC_000913.2
GSE74836	genotype: MG1655 del ssrS
GSE74836	genotype: MG1655 wild-type
GSE74836	Libraries were prepared for sequencing using standard Illumina protocols
GSE74836	Raw sequence data obtained in the fastq format were aligned to the genome of E. coli K12 MG1655 (NC_000913.2) using the Burrows-Wheeler matching program BWA. Reads mapping uniquely to the genome were selected.
GSE74836	Raw sequence data obtained in the fastq format were aligned to the genome of E. coli K12 MG1655 (NC_000913.2) using the Burrows-Wheeler matching program BWA. Reads mapping uniquely to the genome were selected. Files were coverted to .bam format using samtools. The MACS 2.1.0 software was used to call peaks. Peaks overlapping in both replicates were selected for further analysis.
GSE74836	Raw sequence data obtained in the fastq format were aligned to the genome of E. coli K12 MG1655 (NC_000913.2) using the Burrows-Wheeler matching program BWA. Reads mapping uniquely to the genome were selected. Files were coverted to .bam format using samtools. The MACS 2.1.0 software was used to call peaks. Peaks overlapping in both replicates were selected for further analysis. 
GSE74836	Reads were trimmed for quality using Trimmomatic-0.32 with a cutoff quality score of 20
GSE74836	ssrS_1_input
GSE74836	ssrS_1_IP
GSE74836	Supplementary_files_format_and_content: .narrowPeak files output by macs2, giving peak start and end positions, as well as fold-change, -log10pvalue, -log10qvalue, and relative summit position to peak start
GSE74836	Supplementary_files_format_and_content: .narrowPeak files output by MACS, giving peak start and end positions, as well as fold-change, -log10pvalue, -log10qvalue, and relative summit position to peak start
GSE74836	The MACS 2.1.0 software was used to call peaks.
GSE74836	The MACS2 software was used to call peaks.
GSE74836	wt_1_input
GSE74836	wt_1_IP
GSE74836	wt_2_input
GSE74836	wt_2_IP
GSE74930	Cells were grown aerobically (70% N2, 25% O2, and 5% CO2) or anaerobically (95% N2 and 5% CO2) until mid-log phase (OD600 of ~0.3-0.35) in MOPS minimal glucose media containing 10 µM FeSO4.
GSE74930	Cells were treated with a stop solution of phenol and ethanol (Khodursky et al, Methods in Molecular Biology 2003), spun down, and flash frozen and stored at -80°C.
GSE74930	culture condition: Aerobic cultures
GSE74930	culture condition: Anaerobic cultures
GSE74930	Escherichia coli str. K-12 substr. MG1655
GSE74930	∆fur Aerobic A
GSE74930	∆fur Aerobic B
GSE74930	∆fur Anaerobic A
GSE74930	∆fur Anaerobic B
GSE74930	Fur-minus_cDNA_Aerobic
GSE74930	Fur-minus_cDNA_Anaerobic
GSE74930	Fur-minus_RyhB-minus_cDNA_Aerobic
GSE74930	Fur-minus_RyhB-minus_cDNA_Anaerobic
GSE74930	∆fur ∆ryhB Aerobic A
GSE74930	∆fur ∆ryhB Aerobic B
GSE74930	∆fur ∆ryhB Anaerobic A
GSE74930	∆fur ∆ryhB Anaerobic B
GSE74930	genotype
GSE74930	Raw probe intensities were normalized across all samples using the Robust Multichip Average (RMA) algorithm in the NimbleScan software package (version 2.5).
GSE74930	RMA normalized probe data was uploaded into the Mochiview visualization software where data cooresponding to the plus and minus strands were subtracted to get a strand-specific probe intesenity per base as reported in the processed data files.
GSE74930	∆ryhB Aerobic
GSE74930	∆ryhB Anaerobic
GSE74930	RyhB-minus_cDNA_Aerobic_WIG.txt
GSE74930	RyhB-minus_cDNA_Anaerobic_WIG.txt
GSE74930	Total RNA was extracted using a hot phenol method (Khodursky et al, Methods in Molecular Biology 2003).
GSE74930	Wild-type Aerobic A
GSE74930	Wild-type Aerobic B
GSE74930	Wild-type Anaerobic A
GSE74930	Wild-type Anaerobic B
GSE74930	Wild-type_cDNA_Aerobic
GSE74930	Wild-type_cDNA_Anaerobic
GSE74931	Cultures grown in MOPS minimal glucose media containing 10 µM FeSO4
GSE74931	Custom anti-Fur antibodies were purified over a His6-Fur bound HiTrap NHS-activated HP column (GE Healthcare) as previously described (PMID: 21478858). Western blot analyses showed that the purified antibody was specific for Fur.
GSE74931	Escherichia coli str. K-12 substr. MG1655
GSE74931	∆fur Anaerobic [IP vs nput]
GSE74931	genotype
GSE74931	Input ∆fur Anaerobic
GSE74931	ip antibody: affinity purified anti-Fur antibody
GSE74931	IP ∆fur Anaerobic
GSE74931	NimbleScan software package, version 2.5 (Roche NimbleGen) was used to extract the scanned data, which was subsequently qunatile normalized using the statistical program R. The sample data table contains the log2 ratio of the IP
GSE74931	sample type: input control
GSE74931	Sodium phosphate (1
GSE74932	Aerobic cultures
GSE74932	Anaerobic cultures
GSE74932	Anaerobic, Iron Deficient cultures
GSE74932	Call peaks to and FDR 0.1, MOSAiCs
GSE74932	Cell pellets (from initial 250 mL of culture) were thawed and resuspended in 250 μL of IP buffer (100 mM Tris pH 8, 300 mM NaCl, 1% TritonX-100) and sonicated using a microtip sonicator set at 10% output for 20 second intervals with periods of cooling in between. Cells were then treated for one hour at 4 °C with RNase A (2 ng
GSE74932	Cells were grown aerobically (70% N2, 25% O2, and 5% CO2) or anaerobically (95% N2 and 5% CO2) until mid-log phase (OD600 of ~0.3-0.35).
GSE74932	chip antibody: Custom anti-Fur polyclonal antibody
GSE74932	chip antibody: none
GSE74932	ChIP-Seq
GSE74932	Combined input
GSE74932	Custom anti-Fur antibodies were purified over a His6-Fur bound HiTrap NHS-activated HP column (GE Healthcare) as previously described (PMID: 21478858). Western blot analyses showed that the purified antibody was specific for Fur.
GSE74932	Deconvolute peaks in close proximity, dPeak
GSE74932	DNA samples were submitted to the University of Wisconsin-Madison DNA Sequencing Facility for ChIP-seq library preparation. All libraries were generated using reagents from the Illumina Paired End Sample Preparation Kit (Illumina) and the Illumina protocol “Preparing Samples for ChIP Sequencing of DNA” (Illumina part # 11257047 RevA) as per the manufacturer’s instructions, except products of the ligation reaction were purified by gel electrophoresis using 2% SizeSelect agarose gels (Invitrogen) targeting 50 bp fragments.  After library construction and amplification, quality and quantity were assessed using an Agilent DNA 1000 series chip assay (Agilent) and QuantIT PicoGreen dsDNA Kit (Invitrogen), respectively, and libraries were standardized to 10μM.  Cluster generation was performed using a cBot Single Read Cluster Generation Kit (v4) and placed on the Illumina cBot.  For aerobic and anaerobic replicates A, a single read, 50 bp run was performed, using standard SBS kits (v4) and SCS 2.6 on an Illumina Genome Analyzer IIx. For aerobic and anaerobic replicates B and C, the input, and the anaerobic, iron deficient samples, a single read, 50 bp run was performed, using standard SBS kits (v3) and SCS 1.8.2 on an Illumina HiSeq2000.
GSE74932	Escherichia coli str. K-12 substr. MG1655
GSE74932	Fur IP ChIP-Seq Aerobic A
GSE74932	Fur IP ChIP-Seq Aerobic B
GSE74932	Fur IP ChIP-Seq Aerobic C
GSE74932	Fur IP ChIP-Seq Anaerobic A
GSE74932	Fur IP ChIP-Seq Anaerobic B
GSE74932	Fur IP ChIP-Seq Anaerobic C
GSE74932	Fur IP ChIP-Seq Anaerobic, Iron Deficient A
GSE74932	Fur IP ChIP-Seq Anaerobic, Iron Deficient B
GSE74932	Genome_build: Escherichia coli MG1655 K-12 genome version U00096.2
GSE74932	genotype
GSE74932	growth medium: Combined input
GSE74932	growth medium: MOPS minimal glucose media containing 10 µM FeSO4
GSE74932	growth medium: MOPS minimal glucose media containing 1 µM FeSO4
GSE74932	Input ChIP-Seq
GSE74932	Map reads to theEscherichia coli MG1655 K-12 genome, Bowtie 2
GSE74932	Reformat Illumina files to Sanger format, FASTQ Groomer
GSE74932	Require peaks to be present in at least 2 replicates and conform to a peak shape by visual inspection
GSE74932	Scale data set to 20 million reads
GSE74932	Sodium phosphate (1
GSE74932	Supplementary_files_format_and_content: Processed data files contain the number of reads mapped to each base pair after the total number of reads were scaled to 20 million reads per experiment
GSE7	5' 10 ug
GSE7	5' 15 ug
GSE7	5'+50ug
GSE75641	Bacteria were lyzed with lyzozyme and sonicated to shear DNA. TopoIV-DNA complexes were isolated with antibody .
GSE75641	Basecalls performed using CASAVA version 1.8.2
GSE75641	chip antibody: antiFlag M2
GSE75641	chip antibody: none
GSE75641	ChIP-Seq
GSE75641	ChIP-seq reads were aligned to the E. coli NC_000913 genome using BWA 0.6.2
GSE75641	E. coli MG1655 parC::flag
GSE75641	E. coli MG1655 parE::flag
GSE75641	E. coli were grown in LB or minimal medium supplemented with casaminoacids (0,1%) and succinate (0,1%) until OD 0,2-0,4
GSE75641	Escherichia coli str. K-12 substr. MG1655
GSE75641	For ChIP-seq experiments E. coli culture were fixed with formaldehyde (1% final concentration); for NorfliP experiments TopoIV was crosslinked with Norfloxacin (2µM)
GSE75641	Genome_build: NC_000913
GSE75641	growth conditions: LB growth OD 0,3
GSE75641	growth conditions: LB growth OD 0,5
GSE75641	growth conditions: Minimal Medium A  supplemented with casaminoacids (0,1%) and succinate (0,2%),  OD 0,2 at 40°C
GSE75641	Input ParC-flag 1
GSE75641	Input ParE-flag 1
GSE75641	Input ParE-flag 2
GSE75641	Input ParE-flag G1
GSE75641	Input ParE-flag G2
GSE75641	Input ParE-flag S20min
GSE75641	Input ParE-flag S40min
GSE75641	IP ParC-flag 1
GSE75641	IP ParE-flag 1
GSE75641	IP ParE-flag 2
GSE75641	IP ParE-flag G1
GSE75641	IP ParE-flag G2
GSE75641	IP ParE-flag S20min
GSE75641	IP ParE-flag S40min
GSE75641	Libraries were prepared according to Illumina's instructions accompanying the DNA Sample Kit (FC-104-5001). Briefly, DNA was end-repaired using a combination of T4 DNA polymerase, E. coli DNA Pol I large fragment (Klenow polymerase) and T4 polynucleotide kinase. The blunt, phosphorylated ends were treated with Klenow fragment (32 to 52 exo minus) and dATP to yield a protruding 3- 'A' base for ligation of Illumina's adapters which have a single 'T' base overhang at the 3’ end. After adapter ligation DNA was PCR amplified with Illumina primers for 15 cycles and library fragments of ~250 bp (insert plus adaptor and PCR primer sequences) were band isolated from an agarose gel. The purified DNA was captured on an Illumina flow cell for cluster generation. Libraries were sequenced on the Genome Analyzer following the manufacturer's protocols.
GSE75641	NorflIP Input ParC-flag 1
GSE75641	NorflIP Input ParC-flag 2
GSE75641	NorflIP Input ParE-flag 1
GSE75641	NorflIP IP ParC-flag 1
GSE75641	NorflIP IP ParC-flag 2
GSE75641	NorflIP IP ParE-flag 1
GSE75641	Supplementary_files_format_and_content: Enrichement (IP
GSE75818	bla_0min
GSE75818	bla_10min
GSE75818	bla_15min
GSE75818	bla_1min
GSE75818	bla_2min
GSE75818	bla_4min
GSE75818	bla_6min
GSE75818	bla_8min
GSE75818	Cells were collected as a function of time after rifampicin treatment at the specified times. RNA was extracted using the RNAsnap protocol.
GSE75818	Cells were grown to an OD_600 of 0.4 in Luria Broth Lennox
GSE75818	Cells were treated with rifampicin before sample collection. In some cases, kasugamycin was added 15 minutes before the rifampicin addition.
GSE75818	csv files contain 16 columns of the data, each pair corresponds to the counts from the top (odd numbers) and bottom (even numbers) strand. The first pair corresponds to counts collected at 0 minutes after rifampicin addition. Similarly, the second, third, fourth, fifth, sixth, seventh, and eigth pairs correspond to counts collected at 2, 4, 6, 8, 10, 15, and 20 minutes after rifampicin addition. The ith row in each column corresponds to the number of alignments at the ith base in NC_000913.2.
GSE75818	DNA was removed with Dnase I. rRNA was removed with the gram-negative RiboZero kit. Libraries were prepared with the RNAUltra directional kit from New England Biolabs for total RNA sequencing. For signal peptide fusions, cDNA was constructed using primers that target the signal-peptide-coding
GSE75818	Escherichia coli
GSE75818	Genome_build: NC_000913.2
GSE75818	genotype
GSE75818	lacZ_0min
GSE75818	lacZ_10min
GSE75818	lacZ_15min
GSE75818	lacZ_1min
GSE75818	lacZ_2min
GSE75818	lacZ_4min
GSE75818	lacZ_6min
GSE75818	lacZ_8min
GSE75818	mg1655
GSE75818	mMaple3_0min
GSE75818	mMaple3_10min
GSE75818	mMaple3_15min
GSE75818	mMaple3_1min
GSE75818	mMaple3_2min
GSE75818	mMaple3_4min
GSE75818	mMaple3_6min
GSE75818	mMaple3_8min
GSE75818	MutRep1_0min
GSE75818	MutRep1_10min
GSE75818	MutRep1_15min
GSE75818	MutRep1_20min
GSE75818	MutRep1_2min
GSE75818	MutRep1_4min
GSE75818	MutRep1_6min
GSE75818	MutRep1_8min
GSE75818	MutRep2_0min
GSE75818	MutRep2_10min
GSE75818	MutRep2_15min
GSE75818	MutRep2_20min
GSE75818	MutRep2_2min
GSE75818	MutRep2_4min
GSE75818	MutRep2_6min
GSE75818	MutRep2_8min
GSE75818	neo_0min
GSE75818	neo_10min
GSE75818	neo_15min
GSE75818	neo_1min
GSE75818	neo_2min
GSE75818	neo_4min
GSE75818	neo_6min
GSE75818	neo_8min
GSE75818	phoA_0min
GSE75818	phoA_10min
GSE75818	phoA_15min
GSE75818	phoA_1min
GSE75818	phoA_2min
GSE75818	phoA_4min
GSE75818	phoA_6min
GSE75818	phoA_8min
GSE75818	RNA-Seq
GSE75818	Sequencing reads were aligned to the mg1655 genome (NC_000913.2) or a list of the designed signal peptide fusions using bowtie 0.12.9
GSE75818	Supplementary_files_format_and_content: sam containing aligned sequences
GSE75818	The sigPep.csv file contains the counts for each specific signal peptide fusion to each specific test gene. Entries with SP_spkA
GSE75818	time point: 0 min
GSE75818	time point: 10 min
GSE75818	time point: 15 min
GSE75818	time point: 1 min
GSE75818	time point: 20 min
GSE75818	time point: 2 min
GSE75818	time point: 4 min
GSE75818	time point: 6 min
GSE75818	time point: 8 min
GSE75818	treatment: rifampicin
GSE75818	WTKasRep1_0min
GSE75818	WTKasRep1_15min
GSE75818	WTKasRep1_20min
GSE75818	WTKasRep1_2min
GSE75818	WTKasRep1_4min
GSE75818	WTKasRep1_6min
GSE75818	WTKasRep1_8min
GSE75818	WTKasRep2_0min
GSE75818	WTKasRep2_10min
GSE75818	WTKasRep2_15min
GSE75818	WTKasRep2_20min
GSE75818	WTKasRep2_2min
GSE75818	WTKasRep2_4min
GSE75818	WTKasRep2_6min
GSE75818	WTKasRep2_8min
GSE75818	WTRep1_0min
GSE75818	WTRep1_10min
GSE75818	WTRep1_15min
GSE75818	WTRep1_20min
GSE75818	WTRep1_2min
GSE75818	WTRep1_4min
GSE75818	WTRep1_6min
GSE75818	WTRep1_8min
GSE75818	WTRep2_0min
GSE75818	WTRep2_10min
GSE75818	WTRep2_15min
GSE75818	WTRep2_20min
GSE75818	WTRep2_2min
GSE75818	WTRep2_4min
GSE75818	WTRep2_6min
GSE75818	WTRep2_8min
GSE75988	cDNA of EPEC strain
GSE75988	CIP2G_00000
GSE75988	CIP2G_00045
GSE75988	CIP2G_00090
GSE75988	CIP2G_00135
GSE75988	CIP2G_00180
GSE75988	CIP4G_00000
GSE75988	CIP4G_00045
GSE75988	CIP4G_00090
GSE75988	CIP4G_00135
GSE75988	CIP4G_00180
GSE75988	CIPSG_00000
GSE75988	CIPSG_00045
GSE75988	CIPSG_00090
GSE75988	CIPSG_00135
GSE75988	CIPSG_00180
GSE75988	Escherichia coli
GSE75988	RNA was prepared using the Trizol Reagent and a RiboPure kit (Invitrogen, Carlsbad, CA, USA) following the manufacturer's protocol. RNA integrity was assessed using an Agilent 2100 bioanalyser (Agilent, Palo Alto, CA, USA).
GSE75988	strain: EPEC
GSE75988	The scanned images were analyzed using the Feature Extraction Software (Agilent) with default parameters to obtain background subtracted and spatially detrended Processed Signal intensities.
GSE75988	time point: 0
GSE75988	time point: 135 min
GSE75988	time point: 180 min
GSE75988	time point: 45 min
GSE75988	time point: 90 min
GSE75988	treatment: 2ug
GSE75988	treatment: 4ug
GSE75988	treatment: saline
GSE7	5' in minimal medium +0.2% glu, 25 ug total RNA
GSE7	5' in min med +0.2% glu+50ug
GSE7	5' vs 0' in minimal medium +0.2% glu
GSE7	60' 10 ug
GSE7	60' 15 ug
GSE7	60' + 50 ug
GSE7	60' 50 ug
GSE7	60'+50ug
GSE7	60' in min +.2% glu, 25 ug RNA
GSE7	60' in minimal medium +0.2% glu, 25 ug total RNA
GSE7	60' in min med +0.2% glu+50ug
GSE7	60' vs. 0', 50 ug
GSE7	60' vs 0' in minimal medium +0.2% glu
GSE7	60' vs 0' in minimal medium +0.2% glu, II
GSE76167	Basecalls performed using HCS 2.0.5 and RTA 1.17.20
GSE76167	Escherichia coli
GSE76167	Escherichia coli_control condition
GSE76167	Escherichia coli_nickel condition
GSE76167	Gene expression (based on known genes) was determined using Cufflinks 2.0.2, only PF reads were retained
GSE76167	Genome_build: W3110  (NC_007779)
GSE76167	genotype: wild type
GSE76167	growth phase: log phase
GSE76167	Library preparation were performed with Epicentre ScriptseqTM v2 RNA-Seq Library preparation kit with 50 ng of depleted RNA; Strand orientated RNA-Seq
GSE76167	RNA-Seq
GSE76167	RNA-seq reads were aligned to the W3110 genome  using CASAVA 1.8.2
GSE76167	Rodrigue_10-WT-Ni-3
GSE76167	Rodrigue_1-WT-phiNi-1
GSE76167	Rodrigue_2-WT-Ni-1
GSE76167	Rodrigue_5-WT-Ni-2
GSE76167	Rodrigue_6-WT-phiNi-2
GSE76167	Rodrigue_9-WT-phiNi-3
GSE76167	strain: W3110
GSE76167	Supplementary_files_format_and_content: excel file with coverage and FPKM measurements
GSE76167	Total RNA was extracted using the frozen acid-phenol method described by Maes and Messens (Maes and Messens, 1992) and then treated with RNase-free DNaseI according to the manufacturer’s recommendations (Ambion, USA).
GSE76167	Transcriptomic analyses were carried out after growing bacteria in minimal media supplemented with glucose. Several Ni concentrations and exposure times were assayed. rcnA gene expression was taken as an internal control to arbitrate between the different conditions. rcnA is induced by Ni when cells are overloaded with this ion and must detoxify the cytoplasm by extruding excess metal via the RcnAB efflux system. rcnA induction was maximised after culture incubation for 10 min, and longer periods of incubation lead to a decline in rcnA expression (Fig. S1). For the RNA-Seq experiments, bacteria were grown until O.D600nm = 0.3, were treated with 50 µM NiCl2 for 10 min and were frozen prior to RNA extraction.
GSE76916	DicF rep1
GSE76916	DicF rep2
GSE76916	DicF rep3
GSE76916	E. coli cells were grown in Luria Broth supplemented with 100ug
GSE76916	E. coli cells were grown until mid-exponential phase and treated with 0.5mM isopropyl-β-d-thiogalactopyranoside (IPTG) to induce expression of the empty vector or the small RNA.
GSE76916	Escherichia coli str. K-12 substr. MG1655
GSE76916	Genome_build: K-12 subst. MG1655 genome (NC_000913.3)
GSE76916	genotype: delta dicF, lacIq
GSE76916	Hot phenol RNA extraction as described in Aiba, Adhya and Crombrugge. J. Bio Chem. 1981, 256: p11905-11910
GSE76916	protocol: small RNA DicF
GSE76916	protocol: vector control
GSE76916	Ribosomal RNA was removed from 1 μg of total RNA using Ribozero rRNA Removal Meta-Bacteria Kit (Epicentre Biotechnologies) and the mRNA-enriched fraction was converted to indexed RNA-seq libraries with the ScriptSeq™ v2 RNA-Seq Library Preparation Kit (Epicentre Biotechnologies).
GSE76916	RNA-Seq
GSE76916	Supplementary_files_format_and_content: Excel formatted matrix table containing transcript coordinates, normalized abundance estimates across the biological replicates and fold-changes in gene expression between cells expressing Vector and DicF.
GSE76916	Supplementary_files_format_and_content: Processed-VectorvsDicF-operon.txt: .txt tab delimited file with operons expressed differently between vector and DicF
GSE76916	Supplementary_files_format_and_content: Processed-VectorvsDicF-transcripts.txt: .txt raw output file from Rockhopper
GSE76916	Supplementary_files_format_and_content: Processed-VectorvsDicF-transcripts.xlsx: Excel file with transcription start and stop, expression values of all genes in the E. coli genome in vector and DicF
GSE76916	The program Rockhopper (described in Mc Clure, et al. Nucleic Acids Research. 2013, 41(14)) was used for alignment, normalization, and quantification. Genome_builg: K-12 subst. MG1655 genome (NC_000913.3)
GSE76916	Total RNA from bacterial culture
GSE76916	Vector rep1
GSE76916	Vector rep2
GSE76916	Vector rep3
GSE77008	Bacterial cell pellet
GSE77008	Bacterial culture grown overnight at 37C, given 1% sub-culturing till OD at 600nm was 0.4
GSE77008	Escherichia coli
GSE77008	Images were quantified using Feature Extraction Software ( Agilent). Feature extracted raw data was analyzed using GeneSpring GX Version  software from Agilent. Normalization of the data was done in GeneSpring GX using the 75th percentile shift
GSE77008	MG1655 G181D NusA BR, treated
GSE77008	MG1655 G181D NusA, treated
GSE77008	MG1655 R258C NusA BR, treated
GSE77008	MG1655 R258C NusA, treated
GSE77008	MG1655 WT NusA BR, control
GSE77008	MG1655 WT NusA, control
GSE77008	plasmid: G181D NusA
GSE77008	plasmid: R258C NusA
GSE77008	plasmid: wild type NusA
GSE77008	strain: MG1655
GSE77008	The RNA extraction from the samples was performed by Qiagen RNeasy Mini Kit with DNAse treatment (Cat.No. 74004) as per manufacturer’s protocol.
GSE77008	Treated experimental sets transformed with plasmids containing WT
GSE77009	Bacterial cell pellet
GSE77009	Bacterial culture grown overnight at 37C, given 1% sub-culturing till OD at 600nm was 0.4
GSE77009	Escherichia coli
GSE77009	Images were quantified using Feature Extraction Software ( Agilent). Feature extracted raw data was analyzed using GeneSpring GX Version  software from Agilent. Normalization of the data was done in GeneSpring GX using the 75th percentile shift
GSE77009	MG1655 G181D NusA BR1, treated
GSE77009	MG1655 G181D NusA BR2, treated
GSE77009	MG1655 R258C NusA BR1, treated
GSE77009	MG1655 R258C NusA BR2, treated
GSE77009	MG1655 WT NusA BR1, control
GSE77009	MG1655 WT NusA BR2, control
GSE77009	plasmid: G181D NusA
GSE77009	plasmid: R258C NuSA
GSE77009	plasmid: wild type NusA
GSE77009	strain: MG1655
GSE77009	The RNA extraction from the samples was performed by Qiagen RNeasy Mini Kit with DNAse treatment (Cat.No. 74004) as per manufacturer’s protocol.
GSE77009	Treated experimental sets transformed with plasmids containing WT
GSE77176	Bacterial cell pellet
GSE77176	Bacterial culture grown overnight at 37C, given 1% sub-culturing till OD at 600nm was 0.4
GSE77176	E. coli MG1655, BCM treated-Replicate1
GSE77176	E. coli MG1655, BCM treated-Replicate2
GSE77176	E. coli MG1655, Vector control-Replicate1
GSE77176	E. coli MG1655, Vector control-Replicate2
GSE77176	E. coli MG1655, WT Rho treated-Replicate1
GSE77176	E. coli MG1655, WT Rho treated-Replicate2
GSE77176	Escherichia coli
GSE77176	Images Analysis using Agilent Feature Extraction Software Version 11.5 to obtain raw data.Probe intensities generated from feature extraction raw data were split based on channel type and  analysis was performed.
GSE77176	strain: MG1655
GSE77176	The RNA extraction from the samples was performed by Qiagen RNeasy Mini Kit with DNAse treatment (Cat.No. 74004) as per manufacturer’s protocol.
GSE77176	Treated experimental sets transformed with plasmids containing BCM
GSE77176	treatment: BCM
GSE77176	treatment: vector control
GSE77176	treatment: WT Rho plasmid
GSE77177	Bacterial cell pellet
GSE77177	Bacterial culture grown overnight at 37C, given 1% sub-culturing till OD at 600nm was 0.4
GSE77177	E. coli MG1655 ∆Rac G324D, treated-Replicate1-mutant
GSE77177	E. coli MG1655 ∆Rac G324D, treated-Replicate2-mutant
GSE77177	E. coli MG1655 ∆Rac N340S, treated-Replicate1-mutant
GSE77177	E. coli MG1655 ∆Rac N340S, treated-Replicate2-mutant
GSE77177	E. coli MG1655 ∆Rac WT, control-Replicate1-Wildtype
GSE77177	E. coli MG1655 ∆Rac WT, control-Replicate2-Wildtype
GSE77177	Escherichia coli
GSE77177	genotype: delta-rac
GSE77177	Images Analysis using Agilent Feature Extraction Software Version 11.5 to obtain raw data.Probe intensities generated from feature extraction raw data were split based on channel type and  analysis was performed.
GSE77177	plasmid: G324D Rho mutant
GSE77177	plasmid: N340S Rho mutant
GSE77177	plasmid: WT Rho
GSE77177	strain: MG1655
GSE77177	The RNA extraction from the samples was performed by Qiagen RNeasy Mini Kit with DNAse treatment (Cat.No. 74004) as per manufacturer’s protocol.
GSE77177	Treated experimental sets transformed with plasmids containing Rho (WT
GSE77181	Adaptor Sequences were removed using fastx_clipper. (http:
GSE77181	All samples were processed following NEB’s protocol from the NEBNext® ChIP-Seq library preparation kit.
GSE77181	Bacterial Cell Lysates
GSE77181	Cells were collected by centrifugation and washed three times in ice-cold 1X PBS. The pellet was then re-suspended in 250 μl ChIP buffer (200 mM Tris-HCl (pH 8.0), 600 mM NaCl 4% Triton X, Complete protease inhibitor cocktail EDTA-free (Roche)). Sonication of crosslinked samples was performed using the Diagenode Bioruptor® at 30s intervals for 10 min at high amplitude. After sonication, 350 μl of ChIP buffer was added to each sample, the samples were mixed by gentle pipetting and 100 μl of each lysate was removed and stored as ‘input’. Immunoprecipitation was performed overnight at 4°C using 1
GSE77181	Cells were grown in LB media supplemented with 0.2% arabinose at 37°C to and OD600nm of 0.2-0.25
GSE77181	ChIP-Seq
GSE77181	Data collapsed using fastx collapser to remove identical sequencing reads (http:
GSE77181	DL4184C_ChIP-seq
GSE77181	DL4201C_ChIP-seq
GSE77181	DL4311C_ChIP-seq
GSE77181	DL4312C_ChIP-seq
GSE77181	Escherichia coli
GSE77181	Genome_build: Escherichia coli K12 MG1655 NC000913.3
GSE77181	genotype: delta_recG263::KanR lacZ::χχχ mhpR::χχχ proA::ISceIcs  tsx::ISceIcs  PBAD-sbcDC  lacZ+ cynX::GmR  lacIq  lacZχ-
GSE77181	genotype: delta_recG263::KanR lacZ::χχχ mhpR::χχχ proA::ISceIcs  tsx::ISceIcs  PBAD-sbcDC  lacZ:: pal246 cynX::GmR  lacIq  lacZχ-
GSE77181	genotype: lacZ::χχχ mhpR::χχχ proA::ISceIcs  tsx::ISceIcs  PBAD-sbcDC  lacZ+ cynX::GmR  lacIq  lacZχ-
GSE77181	genotype: lacZ::χχχ mhpR::χχχ proA::ISceIcs  tsx::ISceIcs  PBAD-sbcDC  lacZ:: pal246 cynX::GmR  lacIq  lacZχ-
GSE77181	Protein DNA interactions were crosslinked for 10 min at 22.5C with 1% formaldehyde and quenched using glycine to a final concentration of 0.5M
GSE77181	reads were mapped to the E. coli K12 MG1655 (NC000913.3) genome using Novoalign version 2.07  (www.novocraft.com) - Example: (novoalign -f DL4900_clip_clp.fasta -d NC000913.3.nix -r Random > DL4900.novo)
GSE77181	strain: K-12 MG1655
GSE77181	Supplementary_files_format_and_content: txt files including count data for the whole genome
GSE77181	yPileup was used to generate count data for the whole genome - Example:  pyPileup.py --file_type=novo -f DL4184.novo --tab=NC000913.3.tab --chr=Wholechom.txt -- ignorestrand
GSE77325	A minimal growth medium as described in the study by Ihssen and Egli (2004) was used for all experiments. Bacterial stock cultures were streaked onto agar plates and incubated overnight. One colony was then transferred into 20 ml minimal medium, grown at 37 °C (250 r.p.m.) over night culture (ONC) and served as the inoculum for experiments. For continuous culture experiments we designed and constructed 500 ml bioreactors according to the study by Huwiler et al., (2012) that were half-filled with medium (0.5 g glucose per l) and incubated at 37 °C in a temperature controlled water bath. Before continuous cultivation (dilution rate=0.25), 1–2 ml of the ONC was transferred and grown in batch-mode until reactors became visibly turbid. Subsequently, cells were grown to steady-state (defined as constant optical density over time) and harvested for experimentation. For starvation experiments the medium flow was stopped during steady-state and bacteria were collected after 4 h. To avoid gene-expression signatures of stationary cells from the ONC, batch cultures (1000 ml Erlenmeyer flasks containing 100 ml of pre-warmed medium (1 g glucose per l); 37 °C; 250 r.p.m.)) were inoculated with 5 ml of an exponentially growing pre-culture that derived from the ONC.
GSE77325	Differential expression analysis with DESeq (Anders and Huber 2010)  with the default setting
GSE77325	Escherichia coli
GSE77325	Genome_build: NC_011741 (E.coli strain IAI1), NC_000913.2 (E.coli strain MG1655), TW09308 (E.coli strain TW09308), and TW11588 (E.coli strain TW11588)
GSE77325	growth protocol: Bacteria liquid culture
GSE77325	Harvested cells (4 × 6 ml) were immediately combined with 6 ml RNAlater (Life Technologies, Grand Island, NY, USA), centrifuged for 15 min at 12 000 r.p.m., washed with 1 ml RNAlater (3 min at 15 000 r.p.m.), re-suspended in 0.5 ml RNAlater and stored at −20 °C. For RNA extraction the RiboPure-Bacteria Kit (Life Technologies) was used according to the manufacturer’s instructions. To achieve high RNA yields several reactions for each sample were done in parallel and pooled at the end of the procedure. An additional DNase treatment step with TURBO DNase (Life Technologies) was included to assure no genomic DNA contamination. Messenger RNA was enriched using the RiboMinus Bacteria Kit (Life Technologies) according to the manufacturer’s instructions.
GSE77325	IAI1 batch
GSE77325	IAI1 chemostat
GSE77325	IAI1 starvation
GSE77325	IAI1 transcriptome from batch growth_1
GSE77325	IAI1 transcriptome from batch growth_2
GSE77325	IAI1 transcriptome from chemostat growth_1
GSE77325	IAI1 transcriptome from chemostat growth_2
GSE77325	IAI1 transcriptome from starvation growth_1
GSE77325	IAI1 transcriptome from starvation growth_2
GSE77325	Map RNA-Seq reads to reference genomes using Bowtie  (Langmead et al., 2009) with alignment parameters (-n 2-e 70-l 28 –best)
GSE77325	MG1655 batch
GSE77325	MG1655 chemostat
GSE77325	MG1655 starvation
GSE77325	MG1655 transcriptome from batch growth_1
GSE77325	MG1655 transcriptome from batch growth_2
GSE77325	MG1655 transcriptome from chemostat growth_1
GSE77325	MG1655 transcriptome from chemostat growth_2
GSE77325	MG1655 transcriptome from starvation growth_1
GSE77325	MG1655 transcriptome from starvation growth_2
GSE77325	Quality trimming of 3' end at Read Segment Quality Control Indicator.
GSE77325	Remove non-protein coding counts
GSE77325	RNA quality was confirmed with the Bioanalyzer system (Agilent Technologies, Santa Clara, CA, USA) and sequencing (50 cycles, pooling eight bar-coded samples per lane) was performed on the Illumina HiSeq platform (Illumina, San Diego, CA, USA) at the Research Technology Support Facility (RTSF) at Michigan State University.
GSE77325	RNA-Seq
GSE77325	strain: IAI1
GSE77325	strain: K12 (MG1655)
GSE77325	strain: TW09308
GSE77325	strain: TW11588
GSE77325	Summarize the read count to each annotated gene
GSE77325	Supplementary_files_format_and_content: All in tab-delimited ASCII format. raw_count.txt (pre-normalized read count), normalized_count.txt,  panGeneMap.txt (geneID map between the strains and pangene ID), Gene_annotations.txt (annotation of genes)
GSE77325	treatment: batch growth
GSE77325	treatment: chemostat growth
GSE77325	treatment: starvation growth
GSE77325	TW09308 batch
GSE77325	TW09308 chemostat
GSE77325	TW09308 starvation
GSE77325	TW09308 transcriptome from batch growth_1
GSE77325	TW09308 transcriptome from batch growth_2
GSE77325	TW09308 transcriptome from chemostat growth_1
GSE77325	TW09308 transcriptome from chemostat growth_2
GSE77325	TW09308 transcriptome from starvation growth_1
GSE77325	TW09308 transcriptome from starvation growth_2
GSE77325	TW11588 batch
GSE77325	TW11588 chemostat
GSE77325	TW11588 starvation
GSE77325	TW11588 transcriptome from batch growth_1
GSE77325	TW11588 transcriptome from batch growth_2
GSE77325	TW11588 transcriptome from chemostat growth_1
GSE77325	TW11588 transcriptome from chemostat growth_2
GSE77325	TW11588 transcriptome from starvation growth_1
GSE77325	TW11588 transcriptome from starvation growth_2
GSE77617	All cultures were based on MOPS media with 0.2% glucose (Teknova), with full supplement (Neidhardt et al., 1974) minus methionine. An overnight liquid culture was diluted 400-fold into 200 ml fresh media. The culture was kept in a 1 liter flask at 37°C with aeration until OD420 reached 0.4.
GSE77617	bacteria
GSE77617	Basecalls performed using Casava versions 1.6 or 1.7.
GSE77617	Bowtie alignments against the E. coli genome were converted to wiggle files. For ribosome footprints and mRNA-seq, the position of each alignment is distributed into several nucleotides in the center of each read. For each read, the center residues that are at least 10 nucleotides away from either ends were given the same score, which is weighted by the length of the fragment [Oh et al,. Cell 147, 1295 (2011)]. Scores therefore represent the number of read alignments attributed to each genomic position under each scoring scheme. For DMS-seq, the position of each alignment was the position immediately 5' of the 5' end of the read.
GSE77617	Escherichia coli
GSE77617	Extraction was performed as described previously (Li et al., 2012; Oh et al., 2011). For ribosome profiling, 200 mL of cell culture were filtered rapidly and the resulting cell pellet was flash-frozen in liquid nitrogen and combined with 650 µL of frozen lysis buffer (10 mM MgCl2, 100mM NH4Cl, 20mM Tris-HCl pH 8.0, 0.1% Nonidet P40, 0.4% Triton X-100, 100 U
GSE77617	For in vivo DMS modification, 15 mL of exponentially growing E. coli were incubated with 750 µL DMS for 2 min at 37°C. For kasugamycin (ksg) experiments, ksg was added to a final concentration of 10 mg
GSE77617	Genome_build: NC000913.2
GSE77617	mRNA-seq 37°C in WT with control plasmid
GSE77617	mRNA-seq 37°C in WT with plasmid expressing mini-ORF CUA
GSE77617	mRNA-seq 37°C in WT with plasmid expressing mini-ORF CUG
GSE77617	RNA-Seq
GSE77617	Sequenced reads were trimmed for adaptor sequence.
GSE77617	strain: MG1655 [p-CTRL]
GSE77617	strain: MG1655 [p-CUA]
GSE77617	strain: MG1655 [p-CUG]
GSE77617	Supplementary_files_format_and_content: Wiggle files with two columns: first column containing chromosome positions and second column containing the number of reads mapped to the position (see publication for details).
GSE77617	The remaining reads were aligned using Bowtie v0.12.7 against E. coli MG1655 genome using parameters -v1 -m2 -k1.
GSE77617	The ribosome footprints and fragmented mRNA were ligated to miRNA cloning linker-1 (IDT) using truncated T4 RNA ligase 2 K227Q. The ligated RNA fragments were reverse transribed using the primer 5Phos
GSE77617	treatment: 1mM IPTG
GSE77617	Trimmed reads were sequentially aligned using Bowtie v0.12.7 to E. coli rRNA and noncoding RNA allowing one mismatch. Reads aligning to any of these indices were discarded.
GSE78041	5' linker and poly A-tail removal using READemption
GSE78041	5 ml of cell suspension were added to 0.625 ml of pre-chilled stop solution (5 % phenol
GSE78041	An overnight culture of E. coli O104:H4 strain LB226692 was diluted 1:10,000 in pre-warmed LB medium (10 g
GSE78041	cDNA libraries for the Illumina sequencing platform were constructed by vertis Biotechnology AG, Germany, as described previously (Berezikov et al.,2006), without the RNA size-fractionation step prior to cDNA synthesis. Briefly, RNA samples were polyA-tailed using polyA polymerase. Then, the 5'-PPP termini were converted to 5'-P using tobacco acid pyrophosphatase (TAP) to allow for the ligation of the 5’ end RNA adapter. First-strand cDNA was synthesized by an oligo(dT)-adapter primer and the M-MLV reverse transcriptase. In a PCR-based amplification step using a high fidelity DNA polymerase the cDNA concentration was increased to 20-30 ng
GSE78041	Escherichia coli O104:H4
GSE78041	exponentially growing cells
GSE78041	FastQ quality trimming using FastX (version 0.0.13)  and a cut-off value of 20
GSE78041	Fastq to fasta conversion using FastX  FastX (version 0.0.13)
GSE78041	generation of coverage graphs representing the number of pAA plasmid-associated mapped reads per nucleotide using READemption 0.3.7
GSE78041	Genome_build: NC_018658.1, NC_018659.1, NC_018660.1, NC_018666.1
GSE78041	mapping of non-rRNA and tRNA reads to E. coli O104:H4 chromosome and plasmids using READemption 0.3.7 and segemehl 0.2.0
GSE78041	mapping of reads to E. coli O104:H4 rRNAs and tRNAs using READemption 0.3.7 and segemehl 0.2.0
GSE78041	normalization of graphs to the total number of mapped reads per library using READemption 0.3.7
GSE78041	origin of isolation: patient with hemolytic uremic syndrome (HUS)
GSE78041	outbreak: 2011 outbreak centered in Northern Germany
GSE78041	RNA-Seq
GSE78041	strain: clinical isolate LB226692
GSE78041	Supplementary_files_format_and_content: wig files representing the normalized number of pAA-associated mapped reads per nucleotide. Files contain wiggle-formatted files data for accessions  NC_018658.1, NC_018659.1, NC_018660.1, and NC_018666.1.
GSE78041	TEX-_E. coli O104:H4
GSE78041	TEX+_E. coli O104:H4
GSE78041	Total RNA was extracted using the Trizol reagent (Thermo Fisher Scientific) and the concentration and purity of the samples were determined using Nano Drop. RNA integrity was monitored using the R6K ScreenTape system on the Agilent 2200 TapeStation. gDNA was removed by Turbo DNase (Thermo Fisher Scientific) in the presence of 1U
GSE78756	Cells were harvested from aerobic and anaerobic cultures of seven E. coli strains grown to an OD600 of 0.6 (exponential phase). Cultures were divided into 10 ml aliquots and were immediately mixed with 0.2 volumes of ice-cold STOP solution (95% ethanol, 5% phenol (pH 4.7)). After 20 min incubation on ice, samples were spun down for 10 min at 4˚C and 7000 x g in a centrifuge. Pellets from one aliquot were gently resuspended in RNAProtect (QIAGEN, Germany) to further stabilize the RNA. Remaining samples were mixed with RNAlater (QIAGEN, Germany) and placed at -80˚C for archival storage. Total RNA was extracted using RNeasy Mini kit (QIAGEN, Germany) and on column DNase treatment following the manufacturers’ instructions. The 23S and 16S rRNAs were removed by subtractive hybridization using the MICROBExpress kit (Ambion, USA) with modifications. Compared with the standard protocol, 50% more capture oligonucleotides and magnetic beads were used. 5S rRNAs (120 nt in length) were removed during the total RNA extraction on column. Specifically, ribosomal depletion on total RNA isolated from the E. coli BL21 (DE3) was performed using RiboZero (Gram Negative Bacteria) kit (Epicenter, USA). RNA samples were stored at -80°C.
GSE78756	Crooks_aero
GSE78756	Crooks_anaero
GSE78756	Escherichia coli
GSE78756	Escherichia coli strains E.coli C (DSMZ 4860), E. coli Crooks (DSMZ 1576), E. coli DH5α (DSMZ 6897) E. coli W (DSMZ 1116), E. coli W3110 (DSMZ 5911) were obtained from DSMZ-German Collection of Microorganism and Cell Cultures; E. coli BL21 (DE3) was purchased as competent cells from Agilent (Agilent Technologies Inc., USA), E. coli K-12 MG1655 (ATCC 700926). All strains were cultured in M9 minimal medium (1) containing Na2HPO4 x 7H2O (6.8 g), KH2PO4 (3 g), NaCl (0.5 g), NH4Cl (1 g), MgSO4 (2 mmol), CaCl2 (0.1 mmol), trace elements, Wolf’s vitamin solution (2) and glucose (2 g L-1). Anoxic M9 minimal media with glucose was obtained by flushing solution with oxygen free nitrogen (95%). Overnight cultures from single colonies of each of seven E. coli strains were diluted to a starting optical density (OD600) of 0.01. Cultures were grown in 250 ml flasks or 300 ml oxygen-free sealed bottles containing 50 ml glucose-M9 minimal media in a shaking incubator at 37°C and 250 rpm.
GSE78756	Gene expression data (3 biological replicates per strain) were analyzed in the statistical software program R (www.r-project.org ) using the EdgeR package (3). Data were normalized using the CQN package, which accounts for both gene length and GC content effects (4). Differentially expressed genes were determined by comparing expression values under anaerobic and aerobic conditions. Those genes with adjusted P values less than 0.01 (i.e., false discovery rate less than 1%) were identified as significantly differentially expressed genes. Finally, gene annotations were automatically made using the biomaRt package (5) together with the annotation files available at the Ensembl database (www.ensembl.org) and gene set enrichment analysis (GSEA) was performed using the piano package (6). All R packages used in this study are available in Bioconductor (www.bioconductor.org).
GSE78756	RNA-Seq
GSE78756	strain: Crooks
GSE78756	Supplementary_files_format_and_content: tab-delimited text files include gene expresion values for each Sample
GSE78756	The sequencing libraries were constructed using the TruSeq RNA Sample Preparation kit (Illumina Inc., USA). Each library was prepared with RNA isolated from seven E. coli cultures grown in triplicate to an exponential phase under aerobic and anaerobic conditions. RT-PCR was performed with SuperScript® II One-step RT-PCR reagents (Invitrogen, USA). The libraries were sequenced using the Illumina HiSeq2000 platform with a paired-end protocol and read lengths of 50 nt.  The final concentration of DNA and RNA was measured using a Qubit 2.0 Fluorometer (Invitrogen, USA). The integrity of total RNA, DNA contamination, removal of rRNAs and cDNA library validation were assessed with Agilent 2100 Bioanalyzer (Agilent Technologies, USA).
GSE78814	carbon source: glycerol
GSE78814	carbon source: glycerol + propionate
GSE78814	Cells were grown at 37°C in M4 minimal medium under oxic and anoxic conditions. The minimal medium (1.27 mM K2HPO4, 0.73 mM KH2PO4, 5 mM sodium HEPES, 150 mM NaCl, 9 mM (NH4)2SO4) was supplemented with 0.1 g
GSE78814	Cluster detection and base calling were performed using RTA v1.13 (Illumina), and the quality of the reads was assessed with CASAVA v1.8.1 (Illumina).
GSE78814	delta-rnr mutant_anoxic (NO3)_glycerol
GSE78814	delta-rnr mutant_anoxic (NO3)_glycerol + propionate
GSE78814	delta-rnr mutant_oxic_glycerol
GSE78814	delta-rnr mutant_oxic_glycerol + propionate
GSE78814	d_rnr NO3 1
GSE78814	d_rnr NO3 2
GSE78814	d_rnr NO3 w
GSE78814	d_rnr O2 1
GSE78814	d_rnr O2 2
GSE78814	d_rnr O2 w
GSE78814	Escherichia coli K-12
GSE78814	Gene expression was calculated as reads per gene by determining the number of reads that overlapped with the annotated gene loci using HTSeq (Anders et al., 2015, doi: 10.1093
GSE78814	Genome_build: NC_000913.3 E. coli K12 substr. MG1655
GSE78814	genotype
GSE78814	molecule subtype: total RNA (ribosome-depleted)
GSE78814	No further treatment was applied.
GSE78814	oxic
GSE78814	RNA-Seq
GSE78814	Strand-specific cDNA libraries were prepared from 50 ng of rRNA-depleted samples following the TruSeq RNA protocol (Illumina, San Diego, CA, USA, without purification) with modification of the 2nd strand cDNA synthesis as previously described (Parkhomchuk et al. 2009). The libraries were prepared using multiplex primers to allow simultaneous sequencing in a single lane. Sequencing was performed on a HiSeq1500 using SBS v3 kits (Illumina) to generate paired-end reads of 2 x 50 nucleotides.
GSE78814	Supplementary_files_format_and_content: RPG (reads per gene) files were created using HTSeq, mapping raw reads (fastq format) against the E. coli K12 genome and using a GFF file derived from the annotation of NC_000913.3 available from NCBI.
GSE78814	The sequence data were mapped against the genome sequence of E. coli K12 substr. MG1655 (NCBI accession number NC_000913.3) using Bowtie2 (Langmead and Salzberg, 2012, doi:10.1038
GSE78814	Total RNA was isolated with the RNeasy Protect Bacteria Mini Kit from Qiagen (Hilden, Germany). The isolated RNA was further purified from genomic DNA contaminations using Ambion DNase I treatment following the manufacturer's instructions (DNA-free, Ambion by Life Technologies, Darmstadt, Germany). RNA samples were further subjected to an mRNA enrichment step using the MICROBExpress Kit from Ambion according to the manufacturer`s instructions (Life Technologies, Darmstadt, Germany).
GSE78814	wild type_anoxic (NO3)_glycerol
GSE78814	wild type_anoxic (NO3)_glycerol + propionate
GSE78814	wild type_oxic_glycerol
GSE78814	wild type_oxic_glycerol + propionate
GSE78814	WT NO3 1
GSE78814	WT NO3 2
GSE78814	WT NO3 w
GSE78814	WT O2 1
GSE78814	WT O2 2
GSE78814	WT O2 w
GSE79305	Control, 0.8%butanol,1.5h,replicate 1
GSE79305	Control, 0.8%butanol,1.5h,replicate 2
GSE79305	Control, 0.8%butanol,1.5h,replicate 3
GSE79305	Control109_0.8%Bu_1.5h_rep1
GSE79305	Control109_0.8%Bu_1.5h_rep2
GSE79305	Control109_0.8%Bu_1.5h_rep3
GSE79305	Data was extracted with Agilent Feature Extraction software 10.7 (Agilent) using default parameters (protocol GE1-v1_91) to obtain background subtracted and spatially detrended Processed Signal intensities. Features flagged in Feature Extraction as Feature Non-uniform outliers were excluded.
GSE79305	E. coli strains harboring σ70 mutant B8 and WT were cultured overnight and inoculated (1%) into fresh medium.
GSE79305	Escherichia coli
GSE79305	genotype
GSE79305	Mutant B8_0.8%Bu_1.5h_rep1
GSE79305	Mutant B8_0.8%Bu_1.5h_rep2
GSE79305	Mutant B8_0.8%Bu_1.5h_rep3
GSE79305	Mutant B8, 0.8%butanol,1.5h,replicate 1
GSE79305	Mutant B8, 0.8%butanol,1.5h,replicate 2
GSE79305	Mutant B8, 0.8%butanol,1.5h,replicate 3
GSE79305	n-Butanol (0.8%, v
GSE79305	phenotype: 0.6% n-butanol tolerance
GSE79305	phenotype: 2% n-butanol tolerance
GSE79305	strain: JM109
GSE79305	Total RNA was extracted using Qiagen RNeasy kit (Hilden, Germany) following manufacturer’s instructions and checked for a RIN number to inspect RNA integration by an Agilent Bioanalyzer 2100 (Agilent technologies, Santa Clara, CA, US). Qualified total RNA was further purified by RNeasy mini kit (QIAGEN, GmBH, Germany) and RNase‐Free DNase Set (QIAGEN, GmBH, Germany).
GSE7931	Cells were grown to the stationary phase at 37ºC in Luria-Bertani medium.
GSE7931	Enteroheamorragic E. coli
GSE7931	Escherichia coli
GSE7931	Genomic DNA from O111 strain 10828
GSE7931	Genomic DNA from O111 strain 11109
GSE7931	Genomic DNA from O111 strain 11117
GSE7931	Genomic DNA from O111 strain 11128
GSE7931	Genomic DNA from O111 strain 11619
GSE7931	Genomic DNA from O111 strain 11711
GSE7931	Genomic DNA from O111 strain 11788
GSE7931	Genomic DNA from O111 strain 11845
GSE7931	Genomic DNA from O111 strain 12009
GSE7931	Genomic DNA from O111 strain 13369
GSE7931	Genomic DNA from O111 strain ED71
GSE7931	Genomic DNA from O111 strain PMK5
GSE7931	Genomic DNA from O157 strain 980551
GSE7931	Genomic DNA from O157 strain 980706
GSE7931	Genomic DNA from O157 strain 980938
GSE7931	Genomic DNA from O157 strain 981456
GSE7931	Genomic DNA from O157 strain 981795
GSE7931	Genomic DNA from O157 strain 982243
GSE7931	Genomic DNA from O157 strain 990281
GSE7931	Genomic DNA from O157 strain 990570
GSE7931	Genomic DNA from O26 strain 11044
GSE7931	Genomic DNA from O26 strain 11368
GSE7931	Genomic DNA from O26 strain 11656
GSE7931	Genomic DNA from O26 strain 12719
GSE7931	Genomic DNA from O26 strain 12929
GSE7931	Genomic DNA from O26 strain 13065
GSE7931	Genomic DNA from O26 strain 13247
GSE7931	Genomic DNA from O26 strain ED411
GSE7931	Genomic DNA was purified using the Genomic-tip 100
GSE7931	O103 no.1 (strain 10828) replicate 1
GSE7931	O103 no.1 (strain 10828) replicate 2
GSE7931	O103 no.2 (strain 11117) replicate 1
GSE7931	O103 no.2 (strain 11117) replicate 2
GSE7931	O103 no.3 (strain 11711) replicate 1
GSE7931	O103 no.3 (strain 11711) replicate 2
GSE7931	O103 no.4 (strain 11845) replicate 1
GSE7931	O103 no.4 (strain 11845) replicate 2
GSE7931	O103 no.5 (strain 12009) replicate 1
GSE7931	O103 no.5 (strain 12009) replicate 2
GSE7931	O103 no.6 (strain PMK5) replicate 1
GSE7931	O103 no.6 (strain PMK5) replicate 2
GSE7931	O111 no.1 (strain 11109) replicate 1
GSE7931	O111 no.1 (strain 11109) replicate 2
GSE7931	O111 no.2 (strain 11128) replicate 1
GSE7931	O111 no.2 (strain 11128) replicate 2
GSE7931	O111 no.3 (strain 11619) replicate 1
GSE7931	O111 no.3 (strain 11619) replicate 2
GSE7931	O111 no.4 (strain 11788) replicate 1
GSE7931	O111 no.4 (strain 11788) replicate 2
GSE7931	O111 no.5 (strain 13369) replicate 1
GSE7931	O111 no.5 (strain 13369) replicate 2
GSE7931	O111 no.6 (strain ED71) replicate 1
GSE7931	O111 no.6 (strain ED71) replicate 2
GSE7931	O157 no.2 (strain 980938) replicate 1
GSE7931	O157 no.2 (strain 980938) replicate 2
GSE7931	O157 no.3 (strain 980706) replicate 1
GSE7931	O157 no.3 (strain 980706) replicate 2
GSE7931	O157 no.4 (strain 990281) replicate 1
GSE7931	O157 no.4 (strain 990281) replicate 2
GSE7931	O157 no.5 (strain 980551) replicate 1
GSE7931	O157 no.5 (strain 980551) replicate 2
GSE7931	O157 no.6 (strain 990570) replicate 1
GSE7931	O157 no.6 (strain 990570) replicate 2
GSE7931	O157 no.7 (strain 981456) replicate 1
GSE7931	O157 no.7 (strain 981456) replicate 2
GSE7931	O157 no.8 (strain 982243) replicate 1
GSE7931	O157 no.8 (strain 982243) replicate 2
GSE7931	O157 no.9 (strain 981795) replicate 1
GSE7931	O157 no.9 (strain 981795) replicate 2
GSE7931	O157 strain Sakai
GSE7931	O26 no.1 (strain 11044) replicate 1
GSE7931	O26 no.1 (strain 11044) replicate 2
GSE7931	O26 no.2 (strain 11368) replicate 1
GSE7931	O26 no.2 (strain 11368) replicate 2
GSE7931	O26 no.3 (strain 11656) replicate 1
GSE7931	O26 no.3 (strain 11656) replicate 2
GSE7931	O26 no.4 (strain 12719) replicate 1
GSE7931	O26 no.4 (strain 12719) replicate 2
GSE7931	O26 no.5 (strain 12929) replicate 1
GSE7931	O26 no.5 (strain 12929) replicate 2
GSE7931	O26 no.6 (strain 13065) replicate 1
GSE7931	O26 no.6 (strain 13065) replicate 2
GSE7931	O26 no.7 (strain 13247) replicate 1
GSE7931	O26 no.7 (strain 13247) replicate 2
GSE7931	O26 no.8 (strain ED411) replicate 1
GSE7931	O26 no.8 (strain ED411) replicate 2
GSE7931	Spots with reference signal intensities lower than the local background (LBG)  plus 5 standard deviations or with some spotting abnormalities were removed from analysis. Signal intensities of other spots were corrected by subtracting the LBG.
GSE79509	172mM SCFA replicate 1
GSE79509	172mM SCFA replicate 2
GSE79509	30mM SCFA replicate 1
GSE79509	30mM SCFA replicate 2
GSE79509	30mM SCFA replicate 3
GSE79509	30mM SCFA replicate 4
GSE79509	e. coli subset: enterohemorrhagic E.coli
GSE79509	enterohemorrhagic E. coli_172mM short chain fatty acid mix
GSE79509	enterohemorrhagic E. coli_30mM short chain fatty acid mix
GSE79509	Escherichia coli
GSE79509	Images were quantified and normalized using extraction protocol GE2_107_Sept09 and Agilent Feature Extraction Software (version 10.7.3.1).
GSE79509	N172-1
GSE79509	N172-2
GSE79509	N30-1
GSE79509	N30-2
GSE79509	N30-3
GSE79509	N30-4
GSE79509	overnight bacterial culture in Luria Broth at 37C with shaking
GSE79509	overnight culture subcultured in either of the SCFA mixes (or the sodium chloride controls) at 37C, static with 5%CO2 to OD600 of 1
GSE79509	total RNA extracted using Trizol Extraction Protocol
GSE79509	treated with: 172mM NaCl
GSE79509	treated with: 172mM short chain fatty acid mix
GSE79509	treated with: 30mM NaCl
GSE79509	treated with: 30mM short chain fatty acid mix
GSE79880	Caulobacter crescentus and derivatives were grown at 30°C in PYE (Peptone yeast extract) or LB
GSE79880	DNA libraries were prepared for sequencing using standard Illumina protocols by FASTERIS SA, Switzerland
GSE79880	Escherichia coli MG1655
GSE79880	Escherichia coli str. K-12 substr. MG1655
GSE79880	For REC-Seq (restriction enzyme cleavage–sequencing) 1 ug of genomic DNA from C.  crescentus NA1000 and S. meliloti Rm2011 was cleaved with HinfI, a blocked (5’biotinylated)  specific adaptor was ligated to the ends and the ligated fragments were then sheared to an average size  of 150-400 bp (Fasteris SA, Geneva, CH). Illumina adaptors were then ligated to the sheared ends  followed by deep-sequencing using a Hi-Seq Illumina sequencer, and the (50 bp single end) reads  were quality controlled with FastQC (http:
GSE79880	genome build: NC_000913.3
GSE79880	genotype
GSE79880	GHA507
GSE79880	Library strategy: REC-Seq
GSE79880	OTHER
GSE79880	strain: K12
GSE79880	Supplementary_files_format_and_content: tab delimited text files, with feature annotation, REC_seq score, gene name and description
GSE79880	To remove contaminating sequences, the reads were split according to the HinfI consensus motif (5’-  G^ANTC-3’) considered as a barcode sequence using fastx_toolkit  (http:
GSE7	cy_a4
GSE7	cy_b4
GSE7	cyc1
GSE7	cyc2
GSE7	cyc3
GSE7	cyc4
GSE7	cyd1
GSE7	cyd2
GSE7	cyd3
GSE7	cyd4
GSE7	dnaC genomic DNA, Sau3A, 2 ug
GSE7	Escherichia coli
GSE7	reference 0', min +.2% glu, 25 ug RNA
GSE7	tnaA2trpA46PR9 vs. tnaA2, W3110 min
GSE7	tnaA2trpA46PR9, W3110 min , 30 ug total
GSE7	tnaA2trpR2 vs. tnaA2, W3110 min +Trp 50ug
GSE7	tnaA2trpR2, W3110 min +Trp 50ug
GSE7	tnaA2,W3110 min,30 ug total
GSE7	tnaA2,W3110 minimal +Trp 50ug
GSE7	tnaA2,W3110 min +Trp 50ug
GSE7	trpEA2trpR2 vs. trpEA2, W3110 min +Trp 50ug
GSE7	trpEA2trpR2, W3110 min +Trp 50ug
GSE7	trpEA2,W3110 min +Trp 50ug
GSE7	trpR2+50ug
GSE7	trpR2tnaA2,W3110 minimal +Trp 50ug
GSE7	trpR2tnaA2,W3110 min +Trp 50ug
GSE7	trpR2 +trp vs. -trp, min+.2%glucose, W3110
GSE7	trpR2 vs. wt, min+.2%glucose, W3110
GSE7	W3110 trpR2,min+.2%glucose, 30 ug RNA
GSE7	W3110 trpR2 -trp, 30 ug total RNA
GSE7	W3110 trpR2+trp, 30 ug total RNA
GSE7	W3110 wt, min+.2%glucose, 30 ug RNA
GSE7	W3110 wt-trp, 30 ug total RNA
GSE7	W3110 wt+trp, 30 ug total RNA
GSE7	wt+50ug
GSE7	wt +trp vs. -trp, min+.2%glucose, W3110
GSE80002	At each time point, 15 ml of each culture was mixed with 30 ml of RNAprotect Bacteria Reagent (Qiagen), vortexed for 5s, incubated for 5 min at room temperature, and centrifuged for 10 min at 5000g.  The pellet was processed using a Qiagen RNeasy Midi kit with on-column DNase digestion using Qiagen DNase.  The final elution of RNA from the column was with 160 μl RNase-free water.
GSE80002	At OD630nm = 0.1, the cultures were filtered through 47-mm diameter polycarbonate membrane filter (0.4 µm pore size; Millipore), washed with the same medium without hypoxanthine (Hx), and then resuspended at the same cell density (OD630 = 0.1) in the medium without Hx, and growth was continued as before.  The OD630 was followed closely during the next two hours, and the cells were periodically diluted with fresh, pre-warmed medium without Hx to keep OD between values 0.1 and 0.3 (low-dilution protocol).  Samples were taken for microarray analysis (see below) at 0, 15, 30, 45, 60 and 120 minutes.  In a parallel procedure, the optA1 gpt double mutant was also followed in a near-identical manner using a more highly diluted culture over a six-hour incubation period in the absence of hypoxanthine (high-dilution protocol).  The effectiveness of the latter treatment was followed microscopically by observing the extensive cellular filamentation associated with dGTP starvation.
GSE80002	control strain w
GSE80002	control strain with hypoxanthine
GSE80002	Data was obtained using the GeneChip® Command Console and Expression Console Software (AGCC; Version 3.2 and Expression Console; Version 1.2) using the MAS5 algorithm to generate .CHP files.
GSE80002	Escherichia coli str. K-12 substr. MG1655
GSE80002	gpt_0_Hx Rep1
GSE80002	gpt_0_Hx Rep2
GSE80002	gpt_0_Hx Rep3
GSE80002	gpt_120 (Low Dilution) Rep1
GSE80002	gpt_120 (Low Dilution) Rep2
GSE80002	gpt_120 (Low Dilution) Rep3
GSE80002	gpt_15 (Low Dilution) Rep1
GSE80002	gpt_15 (Low Dilution) Rep2
GSE80002	gpt_15 (Low Dilution) Rep3
GSE80002	gpt_30 (Low Dilution) Rep1
GSE80002	gpt_30 (Low Dilution) Rep2
GSE80002	gpt_30 (Low Dilution) Rep3
GSE80002	gpt_45 (Low Dilution) Rep1
GSE80002	gpt_45 (Low Dilution) Rep2
GSE80002	gpt_45 (Low Dilution) Rep3
GSE80002	gpt_60 (Low Dilution) Rep1
GSE80002	gpt_60 (Low Dilution) Rep2
GSE80002	gpt_60 (Low Dilution) Rep3
GSE80002	gpt strain w
GSE80002	gpt strain with hypoxanthine
GSE80002	optA1_0_Hx Rep1
GSE80002	optA1_0_Hx Rep2
GSE80002	optA1_0_Hx Rep3
GSE80002	optA1_120 (Low Dilution) Rep1
GSE80002	optA1_120 (Low Dilution) Rep2
GSE80002	optA1_120 (Low Dilution) Rep3
GSE80002	optA1_15 (Low Dilution) Rep1
GSE80002	optA1_15 (Low Dilution) Rep2
GSE80002	optA1_15 (Low Dilution) Rep3
GSE80002	optA1_30 (Low Dilution) Rep1
GSE80002	optA1_30 (Low Dilution) Rep2
GSE80002	optA1_30 (Low Dilution) Rep3
GSE80002	optA1_45 (Low Dilution) Rep1
GSE80002	optA1_45 (Low Dilution) Rep2
GSE80002	optA1_45 (Low Dilution) Rep3
GSE80002	optA1_60 (Low Dilution) Rep1
GSE80002	optA1_60 (Low Dilution) Rep2
GSE80002	optA1_60 (Low Dilution) Rep3
GSE80002	optA1_gpt_0_Hx Rep1
GSE80002	optA1_gpt_0_Hx Rep2
GSE80002	optA1_gpt_0_Hx Rep3
GSE80002	optA1_gpt_120 (High Dilution) Rep1
GSE80002	optA1_gpt_120 (High Dilution) Rep2
GSE80002	optA1_gpt_120 (High Dilution) Rep3
GSE80002	optA1_gpt_120 (Low Dilution) Rep1
GSE80002	optA1_gpt_120 (Low Dilution) Rep2
GSE80002	optA1_gpt_120 (Low Dilution) Rep3
GSE80002	optA1_gpt_15 (Low Dilution) Rep1
GSE80002	optA1_gpt_15 (Low Dilution) Rep2
GSE80002	optA1_gpt_15 (Low Dilution) Rep3
GSE80002	optA1_gpt_180 (High Dilution) Rep1
GSE80002	optA1_gpt_180 (High Dilution) Rep2
GSE80002	optA1_gpt_180 (High Dilution) Rep3
GSE80002	optA1_gpt_240 (High Dilution) Rep1
GSE80002	optA1_gpt_240 (High Dilution) Rep2
GSE80002	optA1_gpt_240 (High Dilution) Rep3
GSE80002	optA1_gpt_300 (High Dilution) Rep1
GSE80002	optA1_gpt_300 (High Dilution) Rep2
GSE80002	optA1_gpt_300 (High Dilution) Rep3
GSE80002	optA1_gpt_30 (Low Dilution) Rep1
GSE80002	optA1_gpt_30 (Low Dilution) Rep2
GSE80002	optA1_gpt_30 (Low Dilution) Rep3
GSE80002	optA1_gpt_360 (High Dilution) Rep1
GSE80002	optA1_gpt_360 (High Dilution) Rep2
GSE80002	optA1_gpt_360 (High Dilution) Rep3
GSE80002	optA1_gpt_360 (Low Dilution) Rep1
GSE80002	optA1_gpt_360 (Low Dilution) Rep2
GSE80002	optA1_gpt_360 (Low Dilution) Rep3
GSE80002	optA1_gpt_45 (Low Dilution) Rep1
GSE80002	optA1_gpt_45 (Low Dilution) Rep2
GSE80002	optA1_gpt_45 (Low Dilution) Rep3
GSE80002	optA1_gpt_60 (Low Dilution) Rep1
GSE80002	optA1_gpt_60 (Low Dilution) Rep2
GSE80002	optA1_gpt_60 (Low Dilution) Rep3
GSE80002	optA1 gpt strain w
GSE80002	optA1 gpt strain with hypoxanthine
GSE80002	optA1 strain w
GSE80002	optA1 strain with hypoxanthine
GSE80002	strain: MG1655
GSE80002	The strains were grown exponentially (after initiation by a 1,000-fold dilution from overnight cultures) for ~5 generations at 37°C in Vogel-Bonner (VB) minimal medium supplemented with glucose (0.4%), pantothenic acid (5 µg
GSE80002	WT_0_Hx Rep1
GSE80002	WT_0_Hx Rep2
GSE80002	WT_0_Hx Rep3
GSE80002	WT_120 (Low Dilution) Rep1
GSE80002	WT_120 (Low Dilution) Rep2
GSE80002	WT_120 (Low Dilution) Rep3
GSE80002	WT_15 (Low Dilution) Rep1
GSE80002	WT_15 (Low Dilution) Rep2
GSE80002	WT_15 (Low Dilution) Rep3
GSE80002	WT_30 (Low Dilution) Rep1
GSE80002	WT_30 (Low Dilution) Rep2
GSE80002	WT_30 (Low Dilution) Rep3
GSE80002	WT_45 (Low Dilution) Rep1
GSE80002	WT_45 (Low Dilution) Rep2
GSE80002	WT_45 (Low Dilution) Rep3
GSE80002	WT_60 (Low Dilution) Rep1
GSE80002	WT_60 (Low Dilution) Rep2
GSE80002	WT_60 (Low Dilution) Rep3
GSE80251	Alignment to the E. coli K12 MG1655 genome sequence was performed using TMAP map4 algorithm with 5' and 3' soft-clipping and a minimum seed length of 20 nt
GSE80251	Basecalling was performed by Torrent Suite version 5 software using the default settings.
GSE80251	Briefly, hot phenol-chloroform extraction was done by mixing the cell culture in ½ volume of 99°C lysis solution (2% SDS, 16 mM EDTA, 200 mM NaCl made in RNAse-free H2O) for 10 min. The suspension was extracted twice with 1 volume of 65°C acid phenol
GSE80251	Clindamycin_replicate_1
GSE80251	Clindamycin_replicate_2
GSE80251	Clindamycin_replicate_3
GSE80251	E. coli strain K12
GSE80251	E. coli strain NM580 (genotype MG1655 ermBL-ermB’::LacZ) cells were grown in LB broth (37°C) until OD600 of ~0.3.
GSE80251	Erythromycin_replicate_1
GSE80251	Erythromycin_replicate_2
GSE80251	Erythromycin_replicate_3
GSE80251	Escherichia coli
GSE80251	Genome_build: Escherichia coli str. K-12 substr. MG1655, NCBI Reference Sequence: NC_000913.3
GSE80251	Ion Xpress barcoded libraries were constructed using the Ribo-Zero Magnatic Kit (Gram-negative bacteria, Epicentre )and IonXpress RNA-seq v2 (Life Technologies) kits according to the manufacturer's directions.
GSE80251	RNA-Seq
GSE80251	Supplementary_files_format_and_content: Microsoft Excel File with normalized sequencing coverage of all annotated genes and statistical comparison of expression in antibiotic treated to untreated cells .
GSE80251	The cells were untreated, or treated with  (100µg
GSE80251	The total sequencing base pair coverage for all annotated genes was summed for each sample and normalized to total coverage using bedtools and custom R scripts as described in Wu et al. 2015 PLoS Genetics Nov 6;11(11):e1005655.
GSE80251	treatment: clindamycin
GSE80251	treatment: erythromycin
GSE80251	treatment: untreated
GSE80251	Untreated_replicate_1
GSE80251	Untreated_replicate_2
GSE80251	Untreated_replicate_3
GSE80451	Aerobic 1
GSE80451	Aerobic 2
GSE80451	Aerobic 3
GSE80451	Aerobic and anaerobic cultures were grown in 600 mL aliquots of DM25 and incubated at 37°C with an orbital shaking of 150 RPM and inoculated with 1
GSE80451	Anaerobic 1
GSE80451	Anaerobic 3
GSE80451	Bowtie 2 (Langmead B & Salzberg SL, 2012) was used with default parameters, to remove any sequence reads aligning to ribosomal RNA, transfer RNA and non-coding RNA sequences.
GSE80451	Cultured cells
GSE80451	Differential expression between aerobic and anaerobic environments was identified by using DESeq2 (Love M, Huber W and  Anders S, 2014)
GSE80451	Escherichia coli
GSE80451	Genome_build: Escherichia coli B str. REL606; NC_012967.1
GSE80451	growth environment: Aerobic
GSE80451	growth environment: Anaerobic
GSE80451	growth phase: Stationary phase
GSE80451	RNA libraries were prepared for sequencing using standard Illumina protocols
GSE80451	RNA-Seq
GSE80451	RNA-Seq reads were mapped to the reference genome using EDGE-Pro (Magoc T, Wood D and Salzberg SL, 2013) ) with default parameters
GSE80451	RNA was extracted from harvested cultures using a hot lysis buffer and acid phenol-based extraction method and isopropanol precipitation. Following RNA extraction, Turbo DNase (Ambion, USA) was used to treat the samples as per manufacturer’s instructions. Each sample was split into five 20 μL aliquots and two rounds of DNase treatment were performed on each aliquot. Following DNase treatment, RNA samples were purified using the RNeasy Mini kit (Qiagen, Germany) as per the manufacturer’s instructions. For each sample, the DNase-treated aliquots were pooled together before purification. RNA quality was measured using the Agilent 2100 Bioanalyzer (Agilent Technologies, USA) with the RNA 6000 Nano Chip kit according to the manufacturer’s instructions while RNA was quantified using the Quant-iT RNA Assay kit (Life Technologies) and measured on a Qubit® 2.0 fluorometer. RNA was sequenced on the Illumina HiSeq 2000 platform  at BGI (Shenzen, China).
GSE80451	Sequence data from BGI had been filtered to remove reads containing ≥ 10% unreadable bases, ≥ 20% low quality (≤ Q20) bases, adapter contamination or duplicate read-pairs
GSE80451	strain: REL4536
GSE80451	Supplementary_files_format_and_content: Tab-delimited text files include RPKM values for each sample
GSE80451	The quality of reads was assessed by using FastQC (Andrews S, 2010) and any reads with a quality score ≤  Q28 were trimmed using Trim Galore! (Krueger F, 2013 ).
GSE80827	DMSO_0min_rep1
GSE80827	DMSO_0min_rep2
GSE80827	DMSO_0min_rep3
GSE80827	DMSO_60min_rep1
GSE80827	DMSO_60min_rep2
GSE80827	DMSO_60min_rep3
GSE80827	DMSO_60min_rep4
GSE80827	DMSO treatment, 0 min, replicate 1
GSE80827	DMSO treatment, 0 min, replicate 2
GSE80827	DMSO treatment, 0 min, replicate 3
GSE80827	DMSO treatment, 60 min, replicate 1
GSE80827	DMSO treatment, 60 min, replicate 2
GSE80827	DMSO treatment, 60 min, replicate 3
GSE80827	DMSO treatment, 60 min, replicate 4
GSE80827	Escherichia coli
GSE80827	Raw Microarray data evaluation including preprocessing, normalization, grouping the differentially expressed genes and statistical analyses with Moderated T-test and Bonferroni FWER was carried out with GeneSpring 13.0 Software.
GSE80827	Roemerine_0min_rep1
GSE80827	Roemerine_0min_rep2
GSE80827	Roemerine_0min_rep3
GSE80827	Roemerine_60min_rep1
GSE80827	Roemerine_60min_rep2
GSE80827	Roemerine_60min_rep3
GSE80827	(-)-Roemerine treatment, 0 min, replicate 1
GSE80827	(-)-Roemerine treatment, 0 min, replicate 2
GSE80827	(-)-Roemerine treatment, 0 min, replicate 3
GSE80827	(-)-Roemerine treatment, 60 min, replicate 1
GSE80827	(-)-Roemerine treatment, 60 min, replicate 2
GSE80827	(-)-Roemerine treatment, 60 min, replicate 3
GSE80827	strain: TB1
GSE80827	The pre-culture was the overnight propagated cells in 5 ml of LB medium at 37ºC and 180 rpm. The main bacterial culture was prepared by 1% inoculation from pre-culture when optical densities at 600 nm (i.e., OD600) reached 0.7. Growth was achieved in 50 ml of LB medium.
GSE80827	Total RNA extraction was carried out based on the protocols given in the manual of QIAGEN - RNAprotect Bacteria Reagent Handbook, QIAGEN - RNeasy Mini Kit and QIAGEN - RNase-free DNase set. The concentration of each RNA sample was measured by Qubit® RNA BR Assay Kit (Invitrogen).
GSE80827	When OD600 of the culture reached 0.54±0.06, cells were treated with 100 µg
GSE8	0 min Nov0 ug
GSE8	0 min Nov500 ug
GSE8	1005 fork-blocking strain induced for Tus
GSE8	1005 fork-blocking strain induced for Tus: fork5_2
GSE8	1005 fork-blocking strain induced for Tus: fork5_3
GSE8	1005, LB + 0.2% glucose (tus repressed)
GSE8	1005, LB + 0.4% arabinose, 2.5 hr (tus induced)
GSE8	1005, LB + 0.4% arabinose, 3.5 hr (tus induced)
GSE8	1005, LB + 0.4% arabinose, 90' (tus induced)
GSE81584	BAM files of the resulting assembly data were exported to JMP Genomics (SAS).  TMM normalization and ANOVA analysis of the read samples were conducted in JMP Genomics
GSE81584	Cell pellets were lysed and RNA collected using Qiagen’s RNeasy Plus Mini Kit with Qiagen Bacteria Protect RNA kit.  RNA samples were then treated with DNase (New England Biolabs) for 30 min at 37 °C.
GSE81584	Cells were grown to approximately mid-log phase (OD560 = approximately 0.5) in LB.
GSE81584	Escherichia coli
GSE81584	genotype: mfd-
GSE81584	genotype: Mfd++
GSE81584	genotype: Wildtype
GSE81584	genotype: Wildtype with vector
GSE81584	mfd_1
GSE81584	MFD++_1
GSE81584	mfd_2
GSE81584	MFD++_2
GSE81584	mfd_3
GSE81584	MG1655
GSE81584	MG1655_1
GSE81584	MG1655_2
GSE81584	MG1655_3
GSE81584	MG1655 pCA24N and MG1655 pCA24N-Mfd cells were grown to an OD560 of approximately 0.25 and treated with 100 μM IPTG for 1 hour.
GSE81584	MG1655_vector_1
GSE81584	MG1655_vector_2
GSE81584	Read coverage maps and RPKM data was subsequently generated by Geneious.
GSE81584	RNA libraries were prepared for sequencing using standard Illumina protocols
GSE81584	RNA-Seq
GSE81584	Sequencing reads (approximately 13 to 25 million per sample) were imported into Geneious Pro (Biomatters) and assembled to the reference chromosome MG1655 (GenBank Accession Number 000913.2). The assembly process was set to medium
GSE81974	bacteria grown in LB in vitro
GSE81974	bacteria harvested from blood of chickens
GSE81974	condition: in vitro
GSE81974	condition: in vivo
GSE81974	E058 in vitro, biological rep1
GSE81974	E058 in vitro, biological rep2
GSE81974	E058 in vivo, biological rep1
GSE81974	E058 in vivo, biological rep2
GSE81974	E058 in vivo, biological rep3
GSE81974	Escherichia coli APEC O2
GSE81974	strain: O2
GSE81974	The data were analyzed with Microarray Suite version 5.0 (MAS 5.0) using Affymetrix default analysis settings and global scaling as normalization method. The trimmed mean target intensity of each array was arbitrarily set to 100.
GSE81974	The in vitro bacterial samples were harvested by centrifugation (5000 × g, 10 min, 4 °C) and the pellet was frozen at −70 °C until RNA extraction. The in vivo bacterial samples were harvested with two-step centrifugation. We first centrifuged the collected anticoagulated blood samples at low speed to remove the abundant red and white blood cells and collected the upper serum layer. We then used high-speed centrifugation to precipitate the bacteria from the serum.
GSE81974	To prepare the in vitro samples, APEC strain E058 was grown statically at 37 °C in 10 mL of LB broth until the absorbance at 600 nm (A600) reached 0.4. To prepare the in vivo samples, the bacteria was harvested from cardiac blood  in 1-day-old chickens at 5 hours post infection.
GSE81974	Total RNA from both the in vitro and in vivo samples of APEC E058 was extracted with the RNAiso Plus kit (Takara, Dalian, China) and further purified with NucleoSpin RNA Clean-up (Macherey-Nagel, Germany), according to the manufacturers’ instructions.
GSE8	1 min Nov0 ug
GSE8	1 min Nov500 ug
GSE8	20 min Nov0 ug
GSE8	20 min Nov500 ug
GSE8	20 min Nov50 ug
GSE82341	1.1A
GSE82341	1.1A_Earth_25
GSE82341	1.2A
GSE82341	1.2A_Space_25
GSE82341	1.3A
GSE82341	1.3A_Earth_25
GSE82341	1.4A
GSE82341	1.4A_Space_25
GSE82341	1.5A
GSE82341	1.5A_Earth_50
GSE82341	1.6A
GSE82341	1.6A_Space_50
GSE82341	17.1A
GSE82341	17.1A_Space_25
GSE82341	17.2A
GSE82341	17.2A_Earth_25
GSE82341	17.3A
GSE82341	17.3A_Space_25
GSE82341	17.4A
GSE82341	17.4A_Earth_25
GSE82341	17.5A
GSE82341	17.5A_Space_50
GSE82341	17.6A
GSE82341	17.6A_Space_50
GSE82341	17.8A
GSE82341	17.8A_Earth_50
GSE82341	1.7A
GSE82341	1.7A_Earth_50
GSE82341	18.2A
GSE82341	18.2A_Earth_75
GSE82341	18.3A
GSE82341	18.3A_Space_75
GSE82341	18.4A
GSE82341	18.4A_Earth_75
GSE82341	2.1A
GSE82341	2.1A_Earth_75
GSE82341	2.3A
GSE82341	2.3A_Earth_75
GSE82341	2.4A
GSE82341	2.4A_Space_75
GSE82341	Escherichia coli
GSE82341	Four ml of the bacterial suspension in RNALater II and Medium E growth medium were spun down at 200g for 5 min. The supernatant was discarded and the pellet were resuspended in 200ul PBS and mixed by pipetting. 100ul aliquots were taken out for DNA and RNA extraction from the same sample. RNA extraction was done using Qiagen RNeasy mini kit (Qiagen, Hilden, Germany) with on-column DNase digestion. Final elution was made in 30 μL dH2O. The concentration and integrity of the total RNA was estimated by Quant-iT™ RiboGreen® RNA Assay Kit  (ThermoFisher Scientific, Waltham, MA), and Agilent 2100 Bioanalyzer (Applied Biosystems, Carlsbad, CA), respectively.
GSE82341	Genome_build: Escherichia coli (DH10B)
GSE82341	gentamycin concentration (ug
GSE82341	location: Earth
GSE82341	location: Space
GSE82341	Nineteen hours after experiment start, antibiotic (Gentamicin Sulfate (MP Biomedical, Cat No. 1676045, Santa Ana, CA, USA)) was introducing into the cultures. Antibiotic concentration varied from one sample to the next from 0 to 150 ug
GSE82341	Post-processing of the sequencing reads from RNA-seq experiments for each sample was performed using HudsonAlpha’s unique in-house RNA-seq data analysis pipeline. Briefly, quality control checks on raw sequence data for each sample were performed using FastQC (Babraham Bioinformatics, Cambridge, UK). Data-analysis was performed using the CLC Genomics Workbench (Version 7.5.1, CLC Bio, Aarhus, Denmark). The reference genome Escherichia coli (DH10B) sequence was downloaded from the UCSC genome browser. For read mapping, the following parameters were used: mismatch cost = 2, insertion and deletion cost = 3, length fraction: 0.8, similarity fraction = 0.8, global alignment = no, auto-detect paired distances = yes. Samples were grouped and differential expression of genes was calculated on the basis of fold changes (using the default cut-off ≥ ±2.0) observed in comparisons between defined conditions.
GSE82341	Ribosomal RNA (rRNA) was removed using Ribo-Zero™ Gold (Yeast) kit (Epicenter, Madison, WI) using manufacturer's recommended protocol. Immediately after the rRNA removal the RNA was fragmented and primed for the first strand synthesis using the NEBnext First Strand synthesis module (New England BioLabs Inc., Ipswich, MA). Directional second strand synthesis was performed using NEBNExt Ultra Directional second strand synthesis kit. Following this the samples were taken into standard library preparation protocol using NEBNext® DNA Library Prep Master Mix Set for Illumina® with slight modifications. Briefly, end-repair was done followed by polyA addition and adapter ligation. Post-ligated materials were individually barcoded with primers and amplified through 12 cycles of PCR. Final library quantity was assessed by Quant-iT™ PicoGreen® dsDNA Assay Kit and the library quality was estimated on LabChip® GX (Caliper, PerkinElmer, Waltham, MA). Accurate quantification of the final libraries for sequencing applications was determined using the qPCR-based KAPA Biosystems Library Quantification kit (Kapa Biosystems, Inc., Woburn, MA). Each library was diluted to a final concentration of 12.5 nM and pooled equimolar prior to clustering. Paired-End (PE) sequencing was performed on an Illumina HiSeq2500 sequencer (Illumina, Inc.).
GSE82341	RNA-Seq
GSE82341	Samples were sent to the International Space Station at 4C in FPAs, as described above. Temperature was increased to 37C and 23 hours later, the experiment was started by introducing the inoculum (E. coli ATCC 4157) into the growth medium (Medium E as described in Vogel & Bonner (1956) supplemented with 5 g
GSE82341	strain: ATCC 4157
GSE82341	Supplementary_files_format_and_content: excel file include RPKM values for each Sample
GSE8	2 min Nov10 ug
GSE8	2 min Nov2 ug
GSE8	2 min Nov5 ug
GSE8323	15 min after turning off oxygen
GSE8323	2003, PNAS). To minimize the effect of such contributions, microarray data were
GSE8323	25 min after turning off oxygen
GSE8323	2 min after turning off oxygen
GSE8323	55 min after turning off oxygen
GSE8323	5 min after turning off oxygen
GSE8323	5 min after turning off oxygen first replicate
GSE8323	(B), column (X), and row (Y) number, red foreground (f_r) and background (b_r), green
GSE8323	completely aerobic conditions
GSE8323	corresponding to the same tip. Finally, all the log ratios of the same gene from each slide
GSE8323	E coli, 0 min
GSE8323	E coli, 15 min
GSE8323	E coli, 25 min
GSE8323	E coli, 25 min after turning off oxygen
GSE8323	Ecoli, 2 min
GSE8323	E coli, 2 min after turning off oxygen
GSE8323	E coli, 35 min
GSE8323	E coli, 35 min after turning off oxygen
GSE8323	E coli, 45 min
GSE8323	E coli, 45 min after turning off oxygen
GSE8323	E coli, 55 min
GSE8323	E coli, 5 min
GSE8323	Ecoli, 5 min after turning off oxygen
GSE8323	E coli, 5 min after turning off oxygen first replicate
GSE8323	ecoli_aerobicanaerobic_0min
GSE8323	ecoli_aerobicanaerobic_15min
GSE8323	ecoli_aerobicanaerobic_25min_rep1
GSE8323	ecoli_aerobicanaerobic_25min_rep2
GSE8323	ecoli_aerobicanaerobic_2min
GSE8323	ecoli_aerobicanaerobic_35min
GSE8323	ecoli_aerobicanaerobic_45min
GSE8323	ecoli_aerobicanaerobic_55min_rep1
GSE8323	ecoli_aerobicanaerobic_55min_rep2
GSE8323	ecoli_aerobicanaerobic_5min_Rep1
GSE8323	ecoli_aerobicanaerobic_5min_rep2
GSE8323	Ecoli, completely aerobic conditions
GSE8323	E coli, immediately after turning off oxygen
GSE8323	Epicentre MasterPure RNA isolation Kit, Madison, WI
GSE8323	Escherichia coli
GSE8323	fluorescent labeling and hybridization and scanning of the microarray images (Balazsi et al.
GSE8323	foreground and background, and the median Cy3 (green) foreground and background
GSE8323	foreground (f_g) and background (b_g) intensity. The position of each probe within a block,
GSE8323	further analysis if the foreground intensity of less than 50% of the pixels within the spot
GSE8323	Immediately after turning off oxygen
GSE8323	infinity. These values were eliminated using the find, imag, and isfinite functions in Matlab.
GSE8323	in Microsoft Excel, containing the following information for each of the 14,352 entries: block
GSE8323	intensities, respectively. In some cases, when the intensity of the background was higher
GSE8323	Next, data were normalized, by averaging the log ratios resulting from all spots printed by a
GSE8323	normalized as described before (Tong et al. 2004 BBRC). Briefly, spots were excluded from
GSE8323	of (F_r-B_r)
GSE8323	originate during array printing, as well as during the collection and processing of samples,
GSE8323	P is defined by the pair of integers (X,Y). Log ratios were defined as the base 10 logarithm
GSE8323	print tip, and subtracting the resulting average from all the individual log ratios
GSE8323	than or equal to the intensity of the foreground, the resulting log ratios became complex or
GSE8323	Two color cDNA microarray data are never devoid of spurious technical contributions that
GSE8323	Two color cDNA microarray data are never devoid of spurious technical contributions that originate during array printing, as well as during the collection and processing of samples, fluorescent labeling and hybridization and scanning of the microarray images (Balazsi et al. 2003, PNAS).  To minimize the effect of such contributions, microarray data were normalized as described before (Tong et al. 2004 BBRC). Briefly, spots were excluded from further analysis if the foreground intensity of less than 50% of the pixels within the spot were above 2 standard deviations of the background. We generated expression data tables in Microsoft Excel, containing the following information for each of the 14,352 entries: block (B), column (X), and row (Y) number, red foreground (f_r) and background (b_r), green foreground (f_g) and background (b_g) intensity. The position of each probe within a block, P is defined by the pair of integers (X,Y). Log ratios were defined as the base 10 logarithm of (F_r-B_r)
GSE8323	were above 2 standard deviations of the background. We generated expression data tables
GSE8323	were averaged and listed in a new file.
GSE8	40 min Nov10 ug
GSE8	40 min Nov2 ug
GSE8	40 min Nov5 ug
GSE84255	CAR005
GSE84255	CAR005 strain
GSE84255	Detailed parameters for reads mapping: bowtie2 -x ATCC8739 -1 X_1.fq -2 X_2.fq --no-mixed -p 2 -S X.sam
GSE84255	Escherichia coli ATCC 8739
GSE84255	G4H14
GSE84255	G4H14 strain
GSE84255	Genome_build: ASM1938v1
GSE84255	Illumina Casava1.7 software used for basecalling.
GSE84255	IspG1
GSE84255	IspG1 strain
GSE84255	Reads Per Kilobase of exon per Megabase of library size (RPKM) were calculated using a protocol from Chepelev et al., Nucleic Acids Research, 2009.
GSE84255	RNA libraries were prepared for sequencing using standard Illumina protocols
GSE84255	RNA-Seq
GSE84255	Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to Escherichia coli ATCC8739 genome (GenBank CP000946.1) using Bowtie 2 (version 2.2.5)
GSE84255	Single colonies were inoculated into 15x100 mm tubes containing 4 ml LB, and grown at 30ºC and 250 rpm overnight. 100 μl seed culture was inoculated into a 100 ml flask containing 10 ml LB medium, and grown at 30ºC and 250 rpm for 5 h.
GSE84255	strain: CAR005
GSE84255	strain: G4H14
GSE84255	strain: IspG1
GSE84255	Supplementary_files_format_and_content: [.txt] tab-delimited text file includes RPKM values
GSE84255	Total RNA was isolated by the Trizol-Phenol-Chloroform method. An additional clean-up including the on-column DNase I treatment was performed by using the RNeasy mini kit (Qiagen).
GSE84769	Detailed parameters for reads mapping: bowtie2 -x ATCC8739 -1 X_1.fq -2 X_2.fq --no-mixed -p 2 -S X.sam
GSE84769	E.coli cells
GSE84769	Escherichia coli ATCC 8739
GSE84769	Genome_build: ATCC8739
GSE84769	growth condition: normal condtion (5% w
GSE84769	growth condition: osmotic stress condtion (12% w
GSE84769	Illumina Casava1.7 software used for basecalling.
GSE84769	NZ502_12%Glu
GSE84769	NZ502_5%Glu
GSE84769	Reads Per Kilobase of exon per Megabase of library size (RPKM) were calculated using a protocol from Chepelev et al., Nucleic Acids Research, 2009.
GSE84769	RNA libraries were prepared for sequencing using standard Illumina protocols
GSE84769	RNA-Seq
GSE84769	Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to Escherichia coli ATCC8739 genome (GenBank CP000946.1) using Bowtie 2 (version 2.2.5)
GSE84769	strain: NZ-502 (RpoB mutant)
GSE84769	strain: Suc-T110 (parental strain)
GSE84769	SucT110_12%Glu
GSE84769	SucT110_5%Glu
GSE84769	Supplementary_files_format_and_content: tab-delimited text files include RPKM values for each Sample .
GSE84769	Total RNA was isolated by the Trizol-Phenol-Chloroform method. An additional clean-up including the on-column DNase I treatment was performed by using the RNeasy mini kit (Qiagen).
GSE84830	ChIP-Seq
GSE84830	Escherichia coli
GSE84830	Genome_build: K12 - MG1655
GSE84830	growth condition: Exponential + O2
GSE84830	growth condition: Static + O2
GSE84830	library strategy: ChIP-exo
GSE84830	replicate: 1
GSE84830	replicate: 2
GSE84830	Samples 931, 933, 935 and 937 were aligned with bowtie (V 1.1.2) with parameters  --wrapper basic-0 -q -m 1 -l 55 -k 1 -5 3 -3 40 --best -S -p 24, and samples 1311, 1314, 1317 and 1320 were aligned with bowtie (V 1.1.2) with paramters --wrapper basic-0 -q -m 1 -v 2 --best -p 24 -S
GSE84830	Sig70 in E. coli_exponential aerobic growth_no rifampicin
GSE84830	Sig70 in E. coli, exponential aerobic growth, no rifampicin applied replicate 1 (run 299)
GSE84830	Sig70 in E. coli, exponential aerobic growth, no rifampicin applied replicate 1 (run 423)
GSE84830	Sig70 in E. coli, exponential aerobic growth, no rifampicin applied replicate 2 (run 299)
GSE84830	Sig70 in E. coli, exponential aerobic growth, no rifampicin applied replicate 2 (run 423)
GSE84830	Sig70 in E. coli_exponential aerobic growth_rifampicin
GSE84830	Sig70 in E. coli, exponential aerobic growth, rifampicin applied for 20 minutes, replicate 1 (run 423)
GSE84830	Sig70 in E. coli, exponential aerobic growth, rifampicin applied for 20 minutes, replicate 2 (run 423)
GSE84830	Sig70 in E. coli_static aerobic growth_no rifampicin
GSE84830	Sig70 in E. coli, static aerobic growth, no rifampicin applied replicate 1 (run 299)
GSE84830	Sig70 in E. coli, static aerobic growth, no rifampicin applied replicate 2 (run 299)
GSE84830	Supplementary_files_format_and_content: Each wig file contains the alignd reads of each ChIP-exo sample.
GSE84830	The ChIP-exo experiments were generated by following the steps presented by Rhee and Pugh, 2011.
GSE84830	The samples were sonicated for a total of 16 minutes and 50 uL protein A
GSE84830	treated with: none
GSE84830	treated with: Rifampicin for 20 minutes
GSE8532	E. coli W3110
GSE8532	E. coli W3110 expressing PCK
GSE8532	E. coli W3110 expressing ppc
GSE8532	E. coli W3110 expressing ppc at LB-GlC medium, D=0.1 h-1
GSE8532	E. coli W3110 grown at glucose-minimal medium (IPTG induction) in early log phase (u=0.25 h-1)
GSE8532	E. coli W3110 grown at LB-glucose medium (IPTG induction) in chemostat (D=0.1 h-1)
GSE8532	E. coli W3110 (KCTC 2223)
GSE8532	E. coli W3110 (KCTC 2223) 
GSE8532	E. coli W3110 (KCTC 2223) at LB-GlC medium, D=0.1 h-1
GSE8532	E. coli W3110 with glucose-minimal medium (IPTG induced) at early log phase (u=0.25)
GSE8532	Escherichia coli
GSE8532	PCK_glucose-minimal medium_early log phase
GSE8532	PCK_LB-GlC medium_D=0.1 h-1
GSE8532	PPC_glucose-minimal medium_early log phase
GSE8532	PPC_LB-GlC medium_D=0.1 h-1
GSE8532	Scanned images were analyzed with GenePix Pro 3.0 software (Axon Instruments, Union City, CA) to obtain gene expression ratios. 
GSE8532	Scanned images were analyzed with GenePix Pro 3.0 software (Axon Instruments, Union City, CA) to obtain gene expression ratios. Logged gene expression ratios were normalized by LOWESS regression (Yang et al., 2002) using the GeneSpring GX 7.3 software (Agilent Technologies).
GSE8532	The medium for batch culture was consisted of 11.3 g M9 medium, 0.2 g MgSO4•7H2O, 0.1 g CaCl2, 1 mg thiamine, 10 g NaHCO3 and 9 g glucose, 50 mg ampicillin and 0.1 mmole IPTG per liter.
GSE8532	The medium for continuous culture contained 20 g LB, 9 g glucose, 10 g NaHCO3, 50 mg ampicillin per liter and isopropyl--D-thiogalactopyranoside (IPTG) was supplemented to be 0.1 mM. The initial pH of the medium was set to be pH 7.3 by adding 1 N HCl solution. The inoculation culture was transferred into a 250 mL-fermentor containing 100 mL medium (Small scale multi-chemostat fermentor; Biotron Inc., Bucheon, Korea). The culture was performed at 37 C, 350 rpm with flushing CO2 gas at 20 mL
GSE8532	Transcriptome of cells was prepared using a RNA extraction kit (RNeasy mini kit;Qiagen, Hilden, Germany)
GSE8532	W3110 (KCTC 2223)
GSE8532	W3110 overexpressing pck
GSE85807	BnTR1, 37°C, replicate 1
GSE85807	BnTR1, 37°C, replicate 2
GSE85807	BnTR1, 37°C, replicate 3
GSE85807	BnTR1_37_rep1
GSE85807	BnTR1_37_rep2
GSE85807	BnTR1_37_rep3
GSE85807	BnTR1, 42°C, replicate 1
GSE85807	BnTR1, 42°C, replicate 2
GSE85807	BnTR1, 42°C, replicate 3
GSE85807	BnTR1_42_rep1
GSE85807	BnTR1_42_rep2
GSE85807	BnTR1_42_rep3
GSE85807	Collected cells were lysed using Trizol (Invitrogen), and total RNA was isolated using phenol-chloroform and precipitated with ice cold isopropanol. Then the precipitations were further washed with 70% ethanol and dissolved in RNase-free water. Genomic DNA was removed using RNase-free DNase I. RNA samples were further purified using RNeasy Mini Kits (Qiagen). RNA concentration and quality were determined using A Nanodrop ND 1000 spectrophotometer (Thermo Fisher Scientific, Pittsburgh, PA, USA) and agarose gel electrophoresis. The isolated RNA was stored at −80°C before use.
GSE85807	culture temperature: 37°C
GSE85807	culture temperature: 42°C
GSE85807	E. coli cells with or without BnTR1 were transferred and incubated at 37°C and 42°C for 1 hour, respectively
GSE85807	E. coli Rosetta cells transformed with pET-28a or pET-28a-BnTR1 (OD600nm = 0.6) were induced with 0.1 mM IPTG at 37°C for 1 hour.
GSE85807	Emplty Vector, 37°C, replicate 1
GSE85807	Emplty Vector, 37°C, replicate 2
GSE85807	Emplty Vector, 37°C, replicate 3
GSE85807	Emplty Vector, 42°C, replicate 1
GSE85807	Emplty Vector, 42°C, replicate 2
GSE85807	Emplty Vector, 42°C, replicate 3
GSE85807	EmptyVector_37_rep1
GSE85807	EmptyVector_37_rep2
GSE85807	EmptyVector_37_rep3
GSE85807	EmptyVector_42_rep1
GSE85807	EmptyVector_42_rep2
GSE85807	EmptyVector_42_rep3
GSE85807	Escherichia coli
GSE85807	Raw data were normalized (quantile method), merged and filtered by Feature Extraction Software (Agilent Technologies Inc.). For the sibiling probes (multiple probes to one gene), we used the median indensity for representation.
GSE85807	vector: pET-28a
GSE85807	vector: pET-28a-BnTR1
GSE85914	base calls with quality metrics were generated using the HiSeq 2500 Control software
GSE85914	cells were grown in M9 glucose (0.4% w
GSE85914	∆dapF parent Sample 28
GSE85914	∆dapF parent Sample 47
GSE85914	∆dapF parent Sample 9
GSE85914	dapF suppressor 1-1 Sample 10
GSE85914	dapF suppressor 1-1 Sample 29
GSE85914	dapF suppressor 1-1 Sample 48
GSE85914	dapF suppressor 3-1 Sample 11
GSE85914	dapF suppressor 3-1 Sample 30
GSE85914	dapF suppressor 3-1 Sample 49
GSE85914	∆dgk parent Sample 16
GSE85914	∆dgk parent Sample 35
GSE85914	∆dgk parent Sample 54
GSE85914	dgk suppressor 1-1 Sample 17
GSE85914	dgk suppressor 1-1 Sample 36
GSE85914	dgk suppressor 1-1 Sample 55
GSE85914	dgk suppressor 2-1 Sample 18
GSE85914	dgk suppressor 2-1 Sample 37
GSE85914	dgk suppressor 2-1 Sample 56
GSE85914	dgk suppressor 3-1 Sample 19
GSE85914	dgk suppressor 3-1 Sample 38
GSE85914	dgk suppressor 3-1 Sample 57
GSE85914	∆entC parent Sample 12
GSE85914	∆entC parent Sample 31
GSE85914	∆entC parent Sample 50
GSE85914	entC suppressor 1-1 Sample 13
GSE85914	entC suppressor 1-1 Sample 32
GSE85914	entC suppressor 1-1 Sample 51
GSE85914	entC suppressor 2-1 Sample 14
GSE85914	entC suppressor 2-1 Sample 33
GSE85914	entC suppressor 2-1 Sample 52
GSE85914	entC suppressor 3-1 Sample 15
GSE85914	entC suppressor 3-1 Sample 34
GSE85914	entC suppressor 3-1 Sample 53
GSE85914	Escherichia coli
GSE85914	Escherichia coli cell lysate
GSE85914	Genome_build: E. coli strain BW25113
GSE85914	library construction followed Illumina manufacturer protocol for bacteria using the Nextera XT DNA Library Preparation Kit
GSE85914	∆ppk parent Sample 24
GSE85914	∆ppk parent Sample 43
GSE85914	∆ppk parent Sample 5
GSE85914	ppk suppressor 1-1 Sample 25
GSE85914	ppk suppressor 1-1 Sample 44
GSE85914	ppk suppressor 1-1 Sample 6
GSE85914	ppk suppressor 2-1 Sample 26
GSE85914	ppk suppressor 2-1 Sample 45
GSE85914	ppk suppressor 2-1 Sample 7
GSE85914	ppk suppressor 3-1 Sample 27
GSE85914	ppk suppressor 3-1 Sample 46
GSE85914	ppk suppressor 3-1 Sample 8
GSE85914	RNA-Seq
GSE85914	RNA was isolated using standard Trizol lysis and aqueous extraction, followed by further purification using a Qiagen RNAeasy kit.
GSE85914	sequences were aligned to the parent E. coli strain genome template and transcript levels were quantified for triplicate groups of each primary deletion strain and synthetic rescue (i.e. sup) strain using Rockhopper (version 2.0.3)
GSE85914	strain: BW25113
GSE85914	transcript abundance was quantified using rockhopper
GSE85914	WT- Keio Sample 1
GSE85914	WT- Keio Sample 20
GSE85914	WT- Keio Sample 39
GSE85914	∆zwf parent Sample 2
GSE85914	∆zwf parent Sample 21
GSE85914	∆zwf parent Sample 40
GSE85914	zwf suppressor 1-1 Sample 22
GSE85914	zwf suppressor 1-1 Sample 3
GSE85914	zwf suppressor 1-1 Sample 41
GSE85914	zwf suppressor 1-2 Sample 23
GSE85914	zwf suppressor 1-2 Sample 4
GSE85914	zwf suppressor 1-2 Sample 42
GSE85950	conducted by CeGaT (Tübingen, Germany) according to SOLiD standard protocols for RNA-seq
GSE85950	conversion: Convert SOLiD output to fastq (Galaxy Version 1.0.0); default parameters.
GSE85950	counting: countOverlaps of Iranges; default parameters
GSE85950	culture: 18 h at 37°C
GSE85950	differential expression: Bioconductor package edgeR (version 3.2.3); default parameters
GSE85950	EHEC
GSE85950	EHEC either grown on plain LB plates or LB plates containing Symbioflor within the agar
GSE85950	EHEC plus Symbioflor
GSE85950	Escherichia coli O157:H7 str. EDL933
GSE85950	Genome_build: NC_002655
GSE85950	LB agar plates, 37°C for 18 h
GSE85950	mapping: bowtie (Galaxy Version 1.1.2); 28 nt seed length, maximal two mismatches in the seed, a maximal threshold of 70 for the sum of the quality values at mismatched positions.
GSE85950	medium: LB
GSE85950	normalizing: convert counts in RPKM using Excel
GSE85950	plus Symbioflor
GSE85950	RNA-Seq
GSE85950	scraping bacteria, opening with bead beating, Trizol-based RNA isolation, rRNA depletion with RiboZero, DNA digest, SoLiD seq by CeGaT (Tübingen, Germany)
GSE85950	Supplementary_files_format_and_content: xlsx: logFC and p-value
GSE85950	symbioflor status: without Symbioflor
GSE85950	symbioflor status: with Symbioflor
GSE85950	without Symbioflor
GSE8595	Co-hybridization of E. coli G 1
GSE8595	Co-hybridization of E. coli G 3
GSE8595	Co-hybridization of E. coli G 4
GSE8595	Co-hybridization of E. coli G5 isolate with E. coli K-12 MG1655
GSE8595	Co-hybridization of E. coli G5 isolate with E. coli O157:H7 EDL933
GSE8595	Co-hybridization of E. coli isolate G 3
GSE8595	Co-hybridization of E. coli isolate G 4
GSE8595	Co-hybridization of E. coli O157:H7 EDL933 with E. coli K-12 M1655 #1
GSE8595	Co-hybridization of E. coli O157:H7 EDL933 with E. coli K-12 M1655 #2
GSE8595	control strain K-12 MG1655
GSE8595	control strain O157:H7 EDL933
GSE8595	E. coli G 1
GSE8595	E. coli G4
GSE8595	E. coli G5
GSE8595	E. coli isolate G 1
GSE8595	E. coli isolate G3
GSE8595	E. coli isolate G 3
GSE8595	E. coli isolate G4
GSE8595	E. coli isolate G5
GSE8595	E. coli K-12 MG1655
GSE8595	E. coli O157:H7 EDL933
GSE8595	Escherichia coli
GSE8595	Genomic DNA isolation according to Grimberg et al. Nucleic acids research 1989, 17(21):8893
GSE8595	Isolate G 1
GSE8595	Isolate G 3
GSE8595	Isolate G 4
GSE8595	Isolate G5 of Symbioflor2 probiotic product from Symbiopharm
GSE8595	log2 ratio of isolate
GSE8595	overnight in Luria-Bertani (LB) broth with continuous agitation
GSE8595	overnight in Lurie-Bertani (LB) broth with continuous agitation
GSE86341	Agilent Feature Extraction Software (v 8.5.1.1) was used for background subtraction and LOWESS normalization.
GSE86341	Biological replicates per genotype were incubated at 1 mg
GSE86341	E. coli ATCC 25922 marR deletion+QnrS replicate 1
GSE86341	E. coli ATCC 25922 marR deletion+QnrS replicate 2
GSE86341	E. coli ATCC 25922 QnrS replicate 1
GSE86341	E. coli ATCC 25922 QnrS replicate 2
GSE86341	E. coli ATCC 25922 Ser83Leu+QnrS replicate 1
GSE86341	E. coli ATCC 25922 Ser83Leu+QnrS replicate 2
GSE86341	E. coli ATCC 25922 (wild-type) and EC14, EC19, EC24 (LLQR) isogenic strains were tested to evaluate the global response to relevant fix concentration of ciprofloxacin (1 mg
GSE86341	Escherichia coli ATCC 25922
GSE86341	Exponential cells (DO600=0,4)
GSE86341	genotype
GSE86341	RNA extraction was performed using the RNeasy Mini Kit (Qiagen, Hilden, Germany).
GSE86341	substrain: ATCC 25922
GSE86341	substrain: EC14
GSE86341	substrain: EC19
GSE86341	substrain: EC24
GSE86341	Wild-type E. coli ATCC 25922 replicate 1
GSE86341	Wild-type E. coli ATCC 25922 replicate 2
GSE86632	Bacterial RNA was purified with Qiagen RNeasy mini kit, and the samples with RNA Integrity Number (RIN) >9 were used for labeling
GSE86632	culture media: LB
GSE86632	culture media: LB with 2.5 mM Fumaric acid
GSE86632	EDL933_LB_I
GSE86632	EDL933_LB_II
GSE86632	Escherichia coli O157:H7
GSE86632	GeneSpring GX v.13.1
GSE86632	genotype
GSE86632	O157:H7 EDL933 in LB
GSE86632	O157:H7 EDL933 sdhA in LB
GSE86632	O157:H7 EDL933 sdhA in LB with FA
GSE86632	sdhA_FA_I
GSE86632	sdhA_FA_II
GSE86632	sdhA_FA_III
GSE86632	sdhA_LB_I
GSE86632	sdhA_LB_II
GSE86632	sdhA_LB_III
GSE86632	strain background: EDL933
GSE86632	The overnight cultures of bacteria in LB broth were refreshed with the ratio of 1:100 into fresh LB broth, and incubated at 30℃ with continuous shaking until the absorbance at 590 nm reached 0.5 to 0.6.
GSE86632	The values below 0.01 were set to 0.01. The log2 ratio of the intensity of signal channel to that of control channel was calculated and was then normalized to each slide’s median intensity ratio. The default interpretation mode was set to‘log of ratio’. Each time point was then tested separately for statistical differences using ANOVA at 5% confidence level, in conjunction with Benjamini-Hochberg multiple testing correction.
GSE86632	with
GSE87071	10J.0
GSE87071	11K.60
GSE87071	12L.120
GSE87071	200 bp insert, rRNA depletion
GSE87071	7G.0
GSE87071	biological replicate: Replicate 1
GSE87071	biological replicate: t=0 Replicate 1
GSE87071	biological replicate: t=0 replicate 2
GSE87071	Dividing t=2 hours
GSE87071	E. coli were sampled at times = 0, 1 hour, and 2 hours following release from stationary phase.
GSE87071	Escherichia coli
GSE87071	Genome_build: Escherichia coli MG1655 reference genome (NC_00091313-Feb-2011
GSE87071	Growing  t=1 hour
GSE87071	RNA-Seq
GSE87071	RNA sequences were quality assessed and trimmed using FastQC version 0.10.1 (www.bioinformatics.babraham.ac.uk
GSE87071	RNA was extracted from two biological replicates (30 mL) of each bacterial culture isolated at each time point. The 30 mL culture was aliquoted into three 15 mL tubes containing 5 mL of ice-cold EtOH
GSE87071	RNA was pelleted (14,000 rpm, 5 min, 4°C) and air dried before suspension in 80 µL RNAse free water (Invitrogen) and treatment with TURBO DNAse (Ambion) according to the manufacturer’s instructions. Briefly, 0.1 V of 10 X Turbo DNAse buffer (Ambion) was added to the RNA solution. 1 µL of TURBO DNAse was added to the solution, which was then incubated (30 min, 37 °C). Following incubation, 0.1 V of DNase Inactivation Reagent (Ambion) was added and then incubated (5 min, RT) with occasional mixing. RNA was isolated and transferred into a fresh microfuge tube.  RNA quality tested using the the Agilent RNA 6000 Nano Kit (Agilent Technologies) and quality analysed using the Agilent 2100 Bioanalyzer (Agilent Technologies).
GSE87071	Stationary phase  t=0
GSE87071	Synchronization was achieved by passaging cells through one or two rounds of stationary phase according to Cutler and Evans 1966. Briefly: Individual colonies (LB plate, 37°C, 24 h) were inoculated into M9 media and grown O
GSE87071	time post release: E. coli cells 1 hour following release from Stationary phase  (t=1)
GSE87071	time post release: E. coli cells 2 hour2 following release from Stationary phase  (t=2)
GSE87071	time post release: E. coli cells immediately following release from Stationary phase  t=0
GSE8708	BW25113 hha deletion mutant LB 4hr biofilm cells
GSE8708	BW25113 hha mutant LB glu 15 hr biofilm cells
GSE8708	BW25113 hha mutant LB glu 24 hr biofilm cells
GSE8708	BW25113 hha mutant LB glu 4 hr biofilm cells
GSE8708	BW25113 w
GSE8708	Channel 1
GSE8708	Escherichia coli
GSE8708	MAS 5.0 Expression Analysis Default Setting
GSE8708	RNA extracted from biofilm cells of E. coli K-12 hha mutant after 15 hours of growth at 37C in LB glu with glasswool
GSE8708	RNA extracted from biofilm cells of E. coli K-12 hha mutant after 24 hours of growth at 37C in LB glu with glasswool
GSE8708	RNA extracted from biofilm cells of E. coli K-12 hha mutant after 4 hours of growth at 37C in LB glu with glasswool
GSE8708	RNA extracted from biofilm cells of E. coli K-12 hha mutant after 4 hours of growth at 37C in LB with glasswool
GSE8708	RNA extracted from biofilm cells of E. coli K-12 wild type after 15 hours of growth at 37C in LB glu with glasswool
GSE8708	RNA extracted from biofilm cells of E. coli K-12 wild type after 24 hours of growth at 37C in LB glu with glasswool
GSE8708	RNA extracted from biofilm cells of E. coli K-12 wild type after 4 hours of growth at 37C in LB glu with glasswool.
GSE8708	RNA extracted from biofilm cells of E. coli K-12 wild type after 4 hours of growth at 37C in LB with glasswool.
GSE8708	The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB glu medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) for forming biofilm. After incubation for 15 h at 37°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
GSE8708	The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB glu medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) for forming biofilm. After incubation for 15 h at 37°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104).
GSE8708	“The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) for forming biofilm. After incubation for 15 h at 37°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104).
GSE8708	The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) for forming biofilm. After incubation for 15 h at 37°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
GSE87627	75th percentile shift normalisation and baseline adjusted
GSE87627	agent: 1x CORM2
GSE87627	agent: 1x vehicle
GSE87627	agent: 20x CORM2
GSE87627	agent: 20x vehicle
GSE87627	Cultures were maintained on tryptic soy agar (TSA) (Becton Dickinson, Le Pont Claix, France). Overnight cultures were grown in Difco Luria-Bertani (LB) broth (Lennox; Franklin Lakes, NJ, USA) at 37 °C aerobically on a shaker at 200 rpm. Bacteria (picked from 5-10 colonies) were suspended in 1 ml of PBS, yielding a suspension corresponding to the turbidity of McFarland 0.5, and diluted 1:100 in minimal salt (MS)-medium (~106 CFU
GSE87627	E.coli-1x CORM2-rep1
GSE87627	E.coli-1x CORM2-rep2
GSE87627	E.coli-1x CORM2-rep3
GSE87627	E.coli-1x CORM2-rep4
GSE87627	E.coli-1x vehicle-rep1
GSE87627	E.coli-1x vehicle-rep2
GSE87627	E.coli-1x vehicle-rep3
GSE87627	E.coli-1x vehicle-rep4
GSE87627	E.coli-20x CORM2-rep1
GSE87627	E.coli-20x CORM2-rep2
GSE87627	E.coli-20x CORM2-rep3
GSE87627	E.coli-20x CORM2-rep4
GSE87627	E.coli-20x vehicle-rep1
GSE87627	E.coli-20x vehicle-rep2
GSE87627	E.coli-20x vehicle-rep3
GSE87627	E.coli-20x vehicle-rep4
GSE87627	Escherichia coli
GSE87627	Overnight cultures of ESBL7 from the original isolate, or isolates pre-exposed 20 times to CORM-2 or vehicle, were used to inoculate MS-medium, (OD620) of 0.1, followed by exposure to CORM-2 (250 µM) or vehicle for 30 min at 37 °C.
GSE87627	RNA isolation was performed using an RNeasy mini kit (Qiagen Technologies, Hilden, Germany), according to the manufacturer’s protocol. DNA decontamination treatment was performed using Turbo DNase (Qiagen) and the quantity and purity of the purified RNA samples were determined using a spectrophotometer Nanodrop-1000 (Nanodrop Technologies Inc., Wilmington, DE, USA) by measuring the absorbance (A260, 230, 280) and calculating absorbance ratios (A260
GSE87856	0% rep1
GSE87856	0% rep2
GSE87856	100% rep1
GSE87856	100% rep2
GSE87856	26% rep1
GSE87856	26% rep2
GSE87856	Base calls performed with RTA v1.18.5
GSE87856	Cells were inoculated from frozen cultures into 5 mL of LB, and grown.  5 µL of this overnight culture was diluted into 5 mL of LB with the appropriate concentration of arabinose, and grown for 20h.
GSE87856	E. coli culture
GSE87856	Escherichia coli
GSE87856	Reads were mapped using BWA 0.7.5a
GSE87856	RNA libraries were prepared for sequencing using standard Illumina protocols
GSE87856	RNA-Seq
GSE87856	RNA was purified from 200 µL of overnight culture by pelleting and resuspeding in 500 µL of Trizol at 65°C, followed by purification on a column (Direct-Zol, Zymo Research). Samples received two 30-minute DNase treatments using TURBO DNA-free (Ambion) following the manufacturers instructions. RNA samples were then purified on a column (RNA Clean & Concentrator, Zymo Research). Three samples were prepped from each culture and pooled to generate sufficient RNA.
GSE87856	rpos level: 0%
GSE87856	rpos level: 100%
GSE87856	rpos level: 26%
GSE87856	strain: BW27786 (K-12 derivative)
GSE87856	strain: DMS2545 (K-12 derivative)
GSE87856	strain: DMS2564 (K-12 derivative)
GSE87856	Supplementary_files_format_and_content: A tab deliminited file with counts for each gene.
GSE87856	the first ten base pairs of each read were trimmed using FASTX­Toolkit 0.0.13.
GSE87856	The number read pairs mapped to each gene was counted with HTSeq 0.6.1
GSE8	7 min Nov0 ug
GSE8	7 min Nov500 ug
GSE8	80 min Nov10 ug
GSE8	80 min Nov5 ug
GSE88725	A Linker-1 adapter (IDT) was ligated onto the 3' end of size selected RNA fragments, either ribosome footprints or fragmented total RNA. A cDNA library was created using Superscript III (ThermoFisher). After gel purification of the cDNA library all ssDNA fragments were circularized using CircLigase (Epicentre). For ribosome profiling samples rRNA containing circles were depleted using oligo-biotin  and streptavidin coupled Dynabeads (ThermoFisher) subtraction. A PCR amplification off the circles using HF Phusion (NEB) completed the libraries by adding Illumina Tru-Seq adapters and a unique index for each sample.
GSE88725	All strains were grown shaking at 37°C  in 200mL cultures of MOPS complete-glucose liquid media (unless otherwise annotated) in 1L flasks and cells were harvested at OD(420nm) between 0.4 - 0.6
GSE88725	Cells from each strain were rapidly harvested by filtration and lysate was produced by pulverization of liquid nitrogen cooled samples.
GSE88725	Escherichia coli
GSE88725	Genome_build: NC_000913
GSE88725	OTHER
GSE88725	Reads were aligned to E.coli rRNA and tRNA using Bowtie v.0.12.0 allowing for one mismatch and reads aligning to more than one position in the genome were randomly assigned to one of those positions
GSE88725	Remaining linker-1 reads (CTGTAGGCACCATCAAT) were removed from fastq files using fastx_clipper
GSE88725	RF2*_exp1_mRNA
GSE88725	RF2*_exp1_ribosome
GSE88725	RF2*_exp3_mRNA
GSE88725	RF2*_exp3_ribosome
GSE88725	RF2*∆RF3_exp2_repA_mRNA
GSE88725	RF2*∆RF3_exp2_repA_ribosome
GSE88725	RF2*∆RF3_exp2_repB_mRNA
GSE88725	RF2*∆RF3_exp2_repB_ribosome
GSE88725	RF2*∆RF3_exp3_mRNA
GSE88725	RF2*∆RF3_exp3_ribosome
GSE88725	RF2*∆RF3_exp4_repA_mRNA
GSE88725	RF2*∆RF3_exp4_repA_ribosome
GSE88725	RF2*∆RF3_exp4_repB_mRNA
GSE88725	RF2*∆RF3_exp4_repB_ribosome
GSE88725	∆RF3_exp1_mRNA
GSE88725	∆RF3_exp1_ribosome
GSE88725	∆RF3_exp3_mRNA
GSE88725	∆RF3_exp3_ribosome
GSE88725	∆RF3_minimal_mRNA
GSE88725	∆RF3_minimal_ribosome
GSE88725	RNA-Seq
GSE88725	strain: K12 MG1655
GSE88725	strain: K12 MG1655 deltaprfC
GSE88725	strain: K12 MG1655 prfB-Bstrain allele
GSE88725	strain: K12 MG1655 prfB-Bstrain allele deltaprfC
GSE88725	Supplementary_files_format_and_content: Bedgraph wiggle files were created for each sample and replicate for all reads aligned to the genome after computational rRNA and tRNA subtraction
GSE88725	The aligned reads were converted to BAM files and sorted and indexed using SAMtools
GSE88725	The remaining reads were aligned to genome using Bowtie v.0.12.0 allowing for one mismatch and reads aligning in more than one position in the genome were discarded
GSE88725	whole cell lysate
GSE88725	Whole cell lysates were clarified by brief centrifugation. Ribosome footprints were created using Mnase digestion (45 enzyme units per absorbance unit of lysate at 260nm). Using sucrose gradients the monosome fraction of lysate was isolated and footprints were size selected and converted to a cDNA library. Total RNA was extracted from purified lysate for a simultaneous RNA-seq library production for total RNA samples. Small RNA and ribosomal RNA subtraction was performed in total RNA samples using MEGAClear (ThermoFisher) and MicrobExpress (ThermoFisher) kits. Subtracted total RNA was then subjected to alkaline fragmentation prior to library preparation.
GSE88725	Wiggle files were created by center mapping the reads between 20-40bps. Using a 10bp trim on either side of the read then mapping the read across the remaining location using Plastid.
GSE88725	WT_exp1_mRNA
GSE88725	WT_exp1_ribosome
GSE88725	WT_exp2_mRNA
GSE88725	WT_exp2_ribosome
GSE88725	WT_exp3_mRNA
GSE88725	WT_exp3_ribosome
GSE88725	WT_exp4_mRNA
GSE88725	WT_exp4_ribosome
GSE88725	WT_minimal_mRNA
GSE88725	WT_minimal_ribosome
GSE88835	Culture grown in 14 ml tube
GSE88835	Culture grown in 250 ml Erlenmeyer flask
GSE88835	Cultures were spun down at 4 °C, 15,000 × g for 3 minutes. Supernatants were discarded after centrifugation and cell pellets were flash frozen in liquid nitrogen for storage at -80 °C. Cells were lysed with 1 mg of lysozme (Sigma Aldrich L6871) in 10 mM Tris-HCl (pH 8.0) (USB 75825) supplemented with 0.1 mM EDTA (USB 15694). RNA was extracted with PureLink RNA Mini Kit (Life Technologies) and further purified and concentrated with RNA Clean & Concentrator-5 (Zymo Research) to assure sample quality. The purified RNA samples were analyzed using a Bioanalyzer (Agilent) and Ribo-Zero rRNA Removal Kit for bacteria (Illumina) was used to deplete rRNA from the samples.
GSE88835	Escherichia coli
GSE88835	Flask state 1 (IPTG-
GSE88835	Flask state 2 (IPTG+
GSE88835	Flask state 3 (IPTG-
GSE88835	Flask state 4 (IPTG+
GSE88835	Flask state 5 (IPTG-
GSE88835	Flask state 6 (IPTG+
GSE88835	Flask state 7 (IPTG-
GSE88835	Flask state 8 (IPTG+
GSE88835	Genome_build: NC_010473.1
GSE88835	Individual colonies were inoculated into MOPS EZ Rich Defined Medium (Teknova, CA, M2105) with 0.2% glycerol carbon source and 50 μg
GSE88835	Normalized FPKM values were generated from the raw gene counts by custom scripts that calculated and applied a trimmed mean of M-values (TMM) factor using edgeR version 3.8.6.
GSE88835	Read counts for each host and circuit gene was carried out using the htseq-count command of the HTSeq toolkit with user-defined GFF annotations of the reference sequences and the options '-s reverse -a 10 -m union'.
GSE88835	Reads mapped to reference using BWA versiopn 0.7.4 with default settings
GSE88835	RNA-Seq
GSE88835	strain: NEB 10-beta
GSE88835	Strand specific RNAtag-seq libraries were created by the Broad Technology Labs specialized service facility (SSF) using the standard protocol described in Shishkin et al. Nature Methods 2016.
GSE88835	Supplementary_files_format_and_content: CSV files of raw read counts and normalized gene expression in FPKM units.
GSE88835	Tube state 1 (IPTG-
GSE88835	Tube state 2 (IPTG+
GSE88835	Tube state 3 (IPTG-
GSE88835	Tube state 4 (IPTG+
GSE88835	Tube state 5 (IPTG-
GSE88835	Tube state 6 (IPTG+
GSE88835	Tube state 7 (IPTG-
GSE88835	Tube state 8 (IPTG+
GSE8889	Cells were grown to the stationary phase at 37ºC in Luria-Bertani medium.
GSE8889	Enteroheamorragic E. coli
GSE8889	Enteropathogenic E. coli
GSE8889	Escherichia coli
GSE8889	Genomic DNA from O55:H6 strain ICC219
GSE8889	Genomic DNA from O55:H6 strain ICC221
GSE8889	Genomic DNA from O55:H6 strain ICC222
GSE8889	Genomic DNA from O55:H7 strain st58
GSE8889	Genomic DNA from O55:H7 strain st957
GSE8889	Genomic DNA from O55:H7 strain TB182A
GSE8889	Genomic DNA from O55:H7 strain WC211
GSE8889	Genomic DNA from O55:H7 strain WC416
GSE8889	Genomic DNA was purified using the Genomic-tip 100
GSE8889	O157 strain Sakai
GSE8889	O55:H6 ICC219 replicate 1
GSE8889	O55:H6 ICC219 replicate 2
GSE8889	O55:H6 ICC221 replicate 1
GSE8889	O55:H6 ICC221 replicate 2
GSE8889	O55:H6 ICC222 replicate 1
GSE8889	O55:H6 ICC222 replicate 2
GSE8889	O55:H7 st58 replicate 1
GSE8889	O55:H7 st58 replicate 2
GSE8889	O55:H7 st957 replicate 1
GSE8889	O55:H7 st957 replicate 2
GSE8889	O55:H7 TB182A replicate 1
GSE8889	O55:H7 TB182A replicate 2
GSE8889	O55:H7 WC211 replicate 1
GSE8889	O55:H7 WC211 replicate 2
GSE8889	O55:H7 WC416 replicate 1
GSE8889	O55:H7 WC416 replicate 2
GSE8889	Spots with reference signal intensities lower than the local background (LBG)  plus 5 standard deviations or with some spotting abnormalities were removed from analysis. Signal intensities of other spots were corrected by subtracting the LBG.
GSE88979	A total of two samples were analyzed. ompR-8myc tagged cells were cultured in M9 minimal media with 0.2% glucose. Then cells were treated with 0.3 M of NaCl at mid-log pahse for 30 min with agitation.
GSE88979	chip antibody: anti-myc (Santa Cruz Biotech, sc-28207)
GSE88979	ChIP-exo reads were aligned to the ASM584v2 genome reference sequence using using bowtie v1.0.0 with parameters  -S
GSE88979	ChIP-Seq
GSE88979	ChIP-seq libraries were prepared for sequencing using standard Illumina protocols
GSE88979	Crosslinked cells were then resuspended in 500 ul of lysis buffer (10 mM Tris-HCl (pH 7.5), 100 mM NaCl and 1 mM EDTA) with 40 ul of protease inhibitor cocktail (50 mg in 0.25 ml of DMSO and 0.75 ml of TDW). Cells were lyzed with 1 ul of lysozyme for 30 min at 37oC on a rocker. 0.55 ml of 2X IP buffer (100 mM Tris-HCl (pH 7.5), 200 mM NaCl, 2% Triton X-100 and 1 mM EDTA) were added to the sample, and then was sonicated to fragmentize genomic DNA. 0.3 ml of Wash buffer I (50 mM Tris-HCl (pH 7.5), 140 mM NaCl, 1% Triton X-100 and 1mM EDTA) was added to make the volume up to 1.4 ml. Only 0.7 ml was taken and transfered to a new tube, and 15 ul of Anti-c-myc mouse antibody was added, and the sample was incubated overnight at 4 oC to make Antibody-TF complex. 50 ul of Dynabeads Pan mouse IgG were washed 3 times with bead washing solution (250 mg BSA in 50 ml of PBS), and were added to the sample. Cell lysate with beads were incubated for 6 hours or overnight at 4oC to make Dynabead-antibody-TF complex. The beads were pulled down on a magnet stand, and washed 2 times with wash buffer I and with wash buffer II (50 mM Tris-HCl (pH 7.5), 500 mM NaCl, 1% Triton X-100 and 1mM EDTA), wash buffer III (10 mM Tris-HCl (pH 8.0), 250 mM LiCl, 1% Triton X-100 and 1mM EDTA), and wash buffer IV (10 mM Tris-HCl (pH 8.0), 1mM EDTA). The bead-bound TF-DNA complex was then end-repaired, dA-tailed, and ligated to the first adapter. Adapter-ligated sample was then treated with nick-repair reagent, and was treated with lambda exonuclease and RecJ exonuclease. Then DNA was eluted away from Dynabeads by incubating in 200 ul of elution buffer (50 mM Tris-HCl (pH 8.0), 1% SDS and 1 mM EDTA) at 65oC overnight. Protein was removed by treating 4 ul of protease K and being incubated at 55 oC for 2 hours, and by Phenol-Chloroform-IAA extraction. Purified DNA was used to bulid the second strand synthesis, followed by another dA-tailing, second strand ligation, and 3' overhang removal stpes. Then the sequencing library was amplified with PCR enrichment.
GSE88979	E. coli cells were crosslinked in 1% formaldehyde for 25 minutes at RT on a rocker, then washed 3 times with 50 ml of ice-cold TBS (Tris buffered saline) each time.
GSE88979	Escherichia coli str. K-12 substr. MG1655
GSE88979	For each peak detected with MACE, binding intensity was calculated by averaging read counts from two biological replicates and dividing by background intensity.
GSE88979	Genome_build: ASM584v2
GSE88979	genotype: ompR-8myc
GSE88979	MACE software (https:
GSE88979	OmpR NaCl 1
GSE88979	OmpR NaCl 2
GSE88979	Read count was calculated for each genomic position from sequence alignment, and 95% strongest intensity was used as background intensity.
GSE88979	strain: K-12 MG1655
GSE88979	Supplementary_files_format_and_content: Tab-delimited text files in gff format which has 8 columns: sequence id, source(empty), feature (+
GSE88980	E. coli K-12 MG1655 WT and ΔompR were grown to mid-log phase aerobically at 37°C in M9 minimal media supplemented with 0.2% glucose. Then cells were treated with 0.3 M of NaCl at mid-log pahse for 30 min with agitation.
GSE88980	Escherichia coli str. K-12 substr. MG1655
GSE88980	Fragments Per Kilobase of exon per Megabase of library size (FPKM) were calculated using cufflinks v.1.3.0
GSE88980	Genome_build: NC_000913
GSE88980	genotype: ompR deletion mutant
GSE88980	genotype: WT
GSE88980	RNA libraries were prepared for sequencing using standard Illumina protocols
GSE88980	RNA-Seq
GSE88980	Sequenced reads were mapped onto NC_000913 reference genome sequence using bowtie v1.0.0 with parameters -X 1000 -n 2 -3 3 -S
GSE88980	strain: K-12 MG1655
GSE88980	Supplementary_files_format_and_content: comma-delimited text files include FPKM values for each Sample.
GSE88980	The cell culture was treated with the RNAprotect reagent (Qiagen).
GSE88980	Total RNA isolated from E. coli
GSE88980	Total RNA was extracted using the RNeasy Plus Mini kit (Qiagen Inc., Valencia, CA, USA) and genomic DNA was removed by gDNA Eliminator spin column in the RNeasy Plus Mini Kit. RNA quality and concentration was determined by analysis with a NanoDrop 1000 (Thermo Scientific Inc., Wilmington, DE, USA).
GSE88980	WT NaCl 1
GSE88980	WT NaCl 2
GSE88980	ΔompR NaCl 1
GSE88980	ΔompR NaCl 2
GSE89507	0min minus ciprofloxacin
GSE89507	0min plus ciprofloxacin
GSE89507	30min minus ciprofloxacin
GSE89507	30min plus ciprofloxacin
GSE89507	90min minus ciprofloxacin
GSE89507	90min plus ciprofloxacin
GSE89507	All data was processed using Rockhopper Ver.2.03. Rockhopper is an \automatic\ bacterial RNA-seq analysis tool; for additional information see: McClure, R., et al. (2013). \Computational analysis of bacterial RNA-Seq data.\ Nucleic Acids Res 41(14): e140. The default general parameters were used with the \verbose output\ tab ticked and the \orientation of mate-pair reads\ changed to \rf\.
GSE89507	Clinical isolate, minus ciprofloxacin, 0min
GSE89507	Clinical isolate, minus ciprofloxacin, 30min
GSE89507	Clinical isolate, minus ciprofloxacin, 90min
GSE89507	Clinical isolate, plus ciprofloxacin, 0min
GSE89507	Clinical isolate, plus ciprofloxacin, 30min
GSE89507	Clinical isolate, plus ciprofloxacin, 90min
GSE89507	E. coli ST131 UR40 was treated with ciprofloxacin (2µg
GSE89507	Escherichia coli O25b:H4-ST131
GSE89507	Extraction followed by DNase treatment with TURBO DNA-free kit from Ambion. rRNA depleted using an Illumina Ribo-zero rRNA removal kit. Followed by RNA-seq library prep using an Illumina TruSeq Stranded mRNA Library Prep Kit.
GSE89507	Genome_build: NC_017644.1 (Escherichia coli NA114)
GSE89507	isolate: UR40
GSE89507	RNA-Seq
GSE89507	Supplementary_files_format_and_content: *txt, *xml: These files contain the raw counts, normalized counts, RPKM values, expression values, P-values and Q-values. Each file contains the values for both samples at the indicated timepoint.
GSE89507	The cultures were balanced and grown in CAMHB media at 37 degrees Celsius.
GSE89507	time point: 0min
GSE89507	time point: 30min
GSE89507	time point: 90min
GSE89507	Total RNA was extracted using a Thermo Scientific GeneJET RNA isolation kit.
GSE89507	treatment: ciprofloxacin
GSE89507	treatment: none
GSE8965	Ancestral E. coli B REL606 strain
GSE8965	A pool of 3 E. coli clones forming large colonies when plated on TTagar and derived from E. coli B REL606 after 150 days of seasonal evolution experiment in 18mm test tubes in DMga medium.
GSE8965	A pool of 3 E. coli clones forming small colonies when plated on TTagar and derived from E. coli B REL606 after 150 days of seasonal evolution experiment in 18mm test tubes in DMga medium.
GSE8965	A pool of 3 E. coli clones forming small colonies when plated on TTagar and derived from E. coli B REL606 after 150 days of seasonal evolution experiment in 18mm test tubes in DMga medium. 
GSE8965	A, TP1
GSE8965	A, TP2
GSE8965	A, TP3
GSE8965	A, TP4
GSE8965	Escherichia coli
GSE8965	Frozen bacteria were grown overnight in 18mm test tubes containing DMga medium, 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for 12 hours 37°C, 250rpm. Extraction was performed just after.
GSE8965	Frozen bacteria were grown overnight in 18mm test tubes containing DMga medium, 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for 12hours 37°C, 250rpm. Extraction was performed just after.
GSE8965	Frozen bacteria were grown overnight in 18mm test tubes containing DMga medium, 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for 18 hours 37°C, 250rpm. Extraction was performed just after.
GSE8965	Frozen bacteria were grown overnight in 18mm test tubes containing DMga medium, 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for 18hours 37°C, 250rpm. Extraction was performed just after.
GSE8965	Frozen bacteria were grown overnight in 18mm test tubes containing DMga medium, 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for 3.5 hours 37°C, 250rpm. Extraction was performed just after.
GSE8965	Frozen bacteria were grown overnight in 18mm test tubes containing DMga medium, 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for 4 hours 37°C, 250rpm. Extraction was performed just after.
GSE8965	Frozen bacteria were grown overnight in 18mm test tubes containing DMga medium, 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for 4hours 37°C, 250rpm. Extraction was performed just after.
GSE8965	Frozen bacteria were grown overnight in 18mm test tubes containing DMga medium, 500µL of culture was transferred to 50mL of fresh DMga in 500mL flasks and grown for 7hours 37°C, 250rpm. Extraction was performed just after.
GSE8965	LA_TP1_repl1
GSE8965	LA_TP1_repl2
GSE8965	LA_TP1_repl3
GSE8965	LA_TP1_repl4
GSE8965	LA_TP1_repl5
GSE8965	LA_TP2_repl1
GSE8965	LA_TP2_repl2
GSE8965	LA_TP2_repl3
GSE8965	LA_TP2_repl4
GSE8965	LA_TP2_repl5
GSE8965	LA_TP3_repl1
GSE8965	LA_TP3_repl2
GSE8965	LA_TP3_repl3
GSE8965	LA_TP3_repl4
GSE8965	LA_TP3_repl5
GSE8965	LA_TP4_repl1
GSE8965	LA_TP4_repl2
GSE8965	LA_TP4_repl3
GSE8965	LA_TP4_repl4
GSE8965	LA_TP4_repl5
GSE8965	L, TP1
GSE8965	L, TP2
GSE8965	L, TP3
GSE8965	L, TP4
GSE8965	SA_TP1_repl1
GSE8965	SA_TP1_repl2
GSE8965	SA_TP1_repl3
GSE8965	SA_TP1_repl4
GSE8965	SA_TP1_repl5
GSE8965	SA_TP2_repl1
GSE8965	SA_TP2_repl2
GSE8965	SA_TP2_repl3
GSE8965	SA_TP2_repl4
GSE8965	SA_TP2_repl5
GSE8965	SA_TP3_repl1
GSE8965	SA_TP3_repl2
GSE8965	SA_TP3_repl3
GSE8965	SA_TP3_repl4
GSE8965	SA_TP3_repl5
GSE8965	SA_TP4_repl1
GSE8965	SA_TP4_repl2
GSE8965	SA_TP4_repl3
GSE8965	SA_TP4_repl4
GSE8965	SA_TP4_repl5
GSE8965	Statistical preprocessing steps were conducted with ArrayPipe (version 1.7), a web-based software designed for processing of microarray data (www.pathogenomics.ca
GSE8965	S, TP1
GSE8965	S, TP2
GSE8965	S, TP3
GSE8965	S, TP4
GSE8965	Total RNA was extracted using Qiagen RNeasy Mini Kit. DNA was removed using Ambion DNA-free kit. RNA quality was assessed using 2% agarose gels and OD260
GSE8965	VALUEs are calculated as log2-transformed (test
GSE8	dnaC2 30' at 30 deg, 2 ug gen DNA, pdN6 RT
GSE8	dnaC2 90' at 42 deg, 2 ug gen DNA, pdN6 RT
GSE8	dnaC2 synchrony 30' after shift, print 7 array
GSE8	dnaC fully replicated, 2 ug Sau3AI, pdN6 RT
GSE8	dnaC fully replicated, 2 ug Say3AI, pdN6 RT
GSE8	Escherichia coli
GSE90056	Basecalls performed using Illumina CASAVA.
GSE90056	Cells were induced with arabinose or heat shocked, then harvested and flash frozen.
GSE90056	Cells were lysed in liquid nitrogen, then samples were taken for ribosome footprint extraction.
GSE90056	Cells were lysed in liquid nitrogen, then samples were taken for total RNA.
GSE90056	E. coli cultures
GSE90056	ecoli_k12_30C_f_1
GSE90056	ecoli_k12_30C_f_2
GSE90056	ecoli_k12_30C_f_3
GSE90056	ecoli_k12_30C_m_1
GSE90056	ecoli_k12_30C_m_2
GSE90056	ecoli_k12_30C_m_3
GSE90056	ecoli_k12_42C_10min_f_1
GSE90056	ecoli_k12_42C_10min_f_2
GSE90056	ecoli_k12_42C_10min_f_3
GSE90056	ecoli_k12_42C_10min_m_1
GSE90056	ecoli_k12_42C_10min_m_2
GSE90056	ecoli_k12_42C_10min_m_3
GSE90056	ecoli_k12_42C_20min_f_1
GSE90056	ecoli_k12_42C_20min_f_2
GSE90056	ecoli_k12_42C_20min_f_3
GSE90056	ecoli_k12_42C_20min_m_1
GSE90056	ecoli_k12_42C_20min_m_2
GSE90056	ecoli_k12_42C_20min_m_3
GSE90056	ecoli_k12_pBAD_30C_f_1
GSE90056	ecoli_k12_pBad_30C_f_2
GSE90056	ecoli_k12_pBAD_30C_f_3
GSE90056	ecoli_k12_pBAD_30C_f_4
GSE90056	ecoli_k12_pBAD_30C_m_1
GSE90056	ecoli_k12_pBAD_30C_m_2
GSE90056	ecoli_k12_pBAD_30C_m_3
GSE90056	ecoli_k12_pBAD_30C_m_4
GSE90056	ecoli_k12_pBADsigma32I54N_30C_f_1
GSE90056	ecoli_k12_pBADsigma32I54N_30C_f_2
GSE90056	ecoli_k12_pBADsigma32I54N_30C_m_1
GSE90056	ecoli_k12_pBADsigma32I54N_30C_m_2
GSE90056	ecoli_k12_pBADsigma32wt_30C_f_1
GSE90056	ecoli_k12_pBADsigma32wt_30C_f_2
GSE90056	ecoli_k12_pBADsigma32wt_30C_f_3
GSE90056	ecoli_k12_pBADsigma32wt_30C_m_1
GSE90056	ecoli_k12_pBADsigma32wt_30C_m_2
GSE90056	ecoli_k12_pBADsigma32wt_30C_m_3
GSE90056	E. coli were grown in defined rich media at 30C.
GSE90056	Escherichia coli str. K-12 substr. MG1655
GSE90056	Genome_build: NC_000913.2
GSE90056	growth temperature: 30C
GSE90056	heat shock time: 0min
GSE90056	heat shock time: 10min
GSE90056	heat shock time: 20min
GSE90056	heat shock time: None
GSE90056	induction: 0.2% arabinose
GSE90056	induction: None
GSE90056	Library strategy: Ribo-Seq
GSE90056	OTHER
GSE90056	plasmid: None
GSE90056	plasmid: pBAD
GSE90056	plasmid: pBADsigma32I54N
GSE90056	plasmid: pBADsigma32wt
GSE90056	Polysomes were digested with MNase, monosomes were purified by sucrose gradient ultracentrifugation, and the resulting mRNA fragments were extracted with phenol chloroform and gel-purified.
GSE90056	Reads were aligned to the MG1655 genome with Bowtie.
GSE90056	Reads were trimmed and adaptors removed using the fastx_toolkit.
GSE90056	replicate: 1
GSE90056	replicate: 2
GSE90056	replicate: 3
GSE90056	replicate: 4
GSE90056	RNA-Seq
GSE90056	RNA was dephosphorylated, ligated to an adaptor, reverse transcribed, circularized then amplified with Illumina adaptors and barcodes.
GSE90056	Supplementary_files_format_and_content: ecoli_heatshock_normalizedcounts.txt: Tab-delimited text file has EdgeR-normalized counts per kilobase million for each E. coli gene (EcoCyc gene names).
GSE90056	Supplementary_files_format_and_content: ecoli_heatshock_rawcounts.txt: Tab-delimited text file has raw read counts per kilobase million for each E. coli gene (EcoCyc gene names).
GSE90056	The number of reads at each position in the genome was counted using in-house Python scripts.
GSE90056	The number of reads mapping to each gene was counted and normalized using EdgeR.
GSE90056	Total RNA was extracted with phenol chloroform and alkaline fragmented, then fragments (20-40 nt) were gel-purified.
GSE90056	treatment temperature: 30C
GSE90056	treatment temperature: 42C
GSE90485	All data analysis was performed using Rockhopper (McClure et al., 2013) and Escherichia coli str. K-12 substr. MG1655 as the reference genome.
GSE90485	Blue_1
GSE90485	Blue_2
GSE90485	Data were visualized in the Rockhopper IGV genome browser (McClure et al., 2013) and TreeView 3.0 (Saldana et al., 2004).
GSE90485	Escherichia coli
GSE90485	Genome_build: ASM584v2
GSE90485	growth protocol: Log-phase culture (LB broth, Miller formulation) inoculated with one blue colony and grown for 5 hr at 37 degrees celsius
GSE90485	growth protocol: Log-phase culture (LB broth, Miller formulation) inoculated with one pale colony and grown for 5 hr at 37 degrees celsius
GSE90485	Log-phase cultures (LB broth, Miller formulation) inoculated with either blue or pale colonies were grown for 5 hr at 37 degrees celsius.  Cells were pelleted by centrifugation and flash frozen on dry ice.
GSE90485	Pale_1
GSE90485	Pale_3
GSE90485	parent strain: BW27785
GSE90485	phenotype: Blue colony-color (prion-containing)
GSE90485	phenotype: Pale colony-color (prion-lacking)
GSE90485	Purified total RNA was depleted of rRNA using a Ribo-Zero (Bacteria) rRNA Removal Kit (Illumina).  cDNA libraries were constructed and sequenced on an Illumina NextSeq 500 sequencer at the Harvard Biopolymers Facility.
GSE90485	RNA-Seq
GSE90485	Specifically, data were treated as two experiments constituting either two (\blue\ cell transcriptomes) or three (\pale\ cell transcriptomes) biological replicates.
GSE90485	Supplementary_files_format_and_content: Tab-delimited text file includes Rockhopper (McClure et al., 2013) normalized transcript abundance measurements (Expression), transcript abundance ratios (Expression Ratio), and qValues (qValue) for raw data that were treated as two experiments constituting either two (\blue\ cell transcriptomes; Blue_1.fastq, Blue_2.fastq) or three (\pale\ cell transcriptomes; Pale_1.fastq, Pale_2.fastq, Pale_3.fastq) biological replicates.  Gene annotation, gene product description, and strand information is also included.
GSE90485	Total RNA extracted from Rho prion-containing cells
GSE90485	Total RNA extracted from Rho prion-lacking cells
GSE90485	Total RNA was extracted from cell pellets with TRI Reagent (MRC).  RNA was precipitated, resuspended in DNase Reaction Buffer (Invitrogen) for 30 min at room temperature.  DNase-treated samples were subsequently purified with an Rneasy Plus Mini Kit (Qiagen).
GSE90743	chemostat STR culture
GSE90743	chemostat STR culture STR  reference 1, rep1
GSE90743	chemostat STR culture STR reference 1 , rep2
GSE90743	chemostat STR culture STR  reference 2, rep1
GSE90743	chemostat STR culture STR reference 2 , rep2
GSE90743	chemostat STR culture STR  reference 3, rep1
GSE90743	chemostat STR culture STR reference 3 , rep2
GSE90743	chemostat STR-PFR culture
GSE90743	chemostat STR-PFR culture PFR P1 120min, rep1
GSE90743	chemostat STR-PFR culture PFR P1 120min, rep2
GSE90743	chemostat STR-PFR culture PFR P1 25min, rep1
GSE90743	chemostat STR-PFR culture PFR P1 25min, rep2
GSE90743	chemostat STR-PFR culture PFR P1 28h, rep1
GSE90743	chemostat STR-PFR culture PFR P1 28h, rep2
GSE90743	chemostat STR-PFR culture PFR P3 120min, rep1
GSE90743	chemostat STR-PFR culture PFR P3 120min, rep2
GSE90743	chemostat STR-PFR culture PFR P3 25min, rep1
GSE90743	chemostat STR-PFR culture PFR P3 25min, rep2
GSE90743	chemostat STR-PFR culture PFR P3 28h, rep1
GSE90743	chemostat STR-PFR culture PFR P3 28h, rep2
GSE90743	chemostat STR-PFR culture PFR P5 10min, rep1
GSE90743	chemostat STR-PFR culture PFR P5 10min, rep2
GSE90743	chemostat STR-PFR culture PFR P5 120min, rep1
GSE90743	chemostat STR-PFR culture PFR P5 120min, rep2
GSE90743	chemostat STR-PFR culture PFR P5 210min, rep1
GSE90743	chemostat STR-PFR culture PFR P5 210min, rep2
GSE90743	chemostat STR-PFR culture PFR P5 25h, rep1
GSE90743	chemostat STR-PFR culture PFR P5 25h, rep2
GSE90743	chemostat STR-PFR culture PFR P5 25min, rep1
GSE90743	chemostat STR-PFR culture PFR P5 25min, rep2
GSE90743	chemostat STR-PFR culture PFR P5 26h, rep2
GSE90743	chemostat STR-PFR culture PFR P5 28h, rep1
GSE90743	chemostat STR-PFR culture PFR P5 28h, rep2
GSE90743	chemostat STR-PFR culture PFR P5 330min, rep2
GSE90743	chemostat STR-PFR culture PFR P5 45min, rep1
GSE90743	chemostat STR-PFR culture PFR P5 45min, rep2
GSE90743	chemostat STR-PFR culture PFR P5 5min, rep1
GSE90743	chemostat STR-PFR culture PFR P5 5min, rep2
GSE90743	chemostat STR-PFR culture PFR P5 75min, rep2
GSE90743	chemostat STR-PFR culture STR 10min, rep1
GSE90743	chemostat STR-PFR culture STR 10min, rep2
GSE90743	chemostat STR-PFR culture STR 120min, rep1
GSE90743	chemostat STR-PFR culture STR 120min, rep2
GSE90743	chemostat STR-PFR culture STR 210min, rep1
GSE90743	chemostat STR-PFR culture STR 210min, rep2
GSE90743	chemostat STR-PFR culture STR 25h, rep1
GSE90743	chemostat STR-PFR culture STR 25h, rep2
GSE90743	chemostat STR-PFR culture STR 25min, rep1
GSE90743	chemostat STR-PFR culture STR 25min, rep2
GSE90743	chemostat STR-PFR culture STR 26h, rep1
GSE90743	chemostat STR-PFR culture STR 26h, rep2
GSE90743	chemostat STR-PFR culture STR 28h, rep1
GSE90743	chemostat STR-PFR culture STR 28h, rep2
GSE90743	chemostat STR-PFR culture STR 330min, rep1
GSE90743	chemostat STR-PFR culture STR 330min, rep2
GSE90743	chemostat STR-PFR culture STR 45min, rep1
GSE90743	chemostat STR-PFR culture STR 45min, rep2
GSE90743	chemostat STR-PFR culture STR 5min, rep1
GSE90743	chemostat STR-PFR culture STR 5min, rep2
GSE90743	chemostat STR-PFR culture STR 75min, rep1
GSE90743	chemostat STR-PFR culture STR 75min, rep2
GSE90743	E. coli K12 substrain W3110 was used in this study. Bioreactor cultivations were performed using a two-compartment bioreactor system consisting of an STR (3L) with a recycle loop (PFR)  in defined medium at pH7 and 37°C. Bioreactor cultivations were carried out with a minimal medium containing (per liter) 19.0 g glucose, 1.0 g NaH2PO4.· 2 H2O, 2.6 g K2HPO4, 3.8 g (NH4)2SO4, and a trace element solution (0.11 g Na3C6H5O7, 0.00835 g FeCl3· 6 H2O, 0.00009 g ZnSO4· 7 H2O, 0.00005 g MnSO4· H2O, 0.0008 g CuSO4· 5 H2O, 0.00009 g CoCl2· 6 H2O, 0.0044 g CaCl2· 2 H2O, 0.1 g MgSO4· 7 H2O). The STR-PFR was operated as a chemostat with ammonia as the growth-limiting substrate. First, a reference steady state (µ=0.2 h−1) was established in the STR and sampled three times during a 16 h period following establishment of the steady state. Then, the PFR was added and samples for RNA-sequencing were aquired.
GSE90743	Escherichia coli
GSE90743	First, ribosomal RNA was depleted from 1 μg of total RNA using the Ribo-ZeroTM Magnetic Kit (Bacteria) (Epicentre, Madison, WI, USA). Next, mRNA libraries were prepared using the TruSeq mRNA Library Prep Kit (Illumina, San Diego, CA, USA). mRNA libraries were prepared for sequencing using standard Illumina protocols.
GSE90743	Genome_build: ASM1024v1 (NCBI E. coli K12 subst. W3110 genome (GenBank: AP009048.1))
GSE90743	HTseq-derived raw count data were used as input after a non-specific filtering step that removed residual rRNAs and tRNAs  and low coverage genes with fewer than 2 counts per million (16-20 reads) in more than 25% of the dataset.
GSE90743	Raw counts were derived for each gene based on the respective annotations available from UCSC genome browser (http:
GSE90743	replicate: 1
GSE90743	replicate: 2
GSE90743	RNA-Seq
GSE90743	sample port: PFR P1
GSE90743	sample port: PFR P3
GSE90743	sample port: PFR P5
GSE90743	sample port: STR
GSE90743	Sampling by directly placing the culture sample into RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany), following short centrifugation the pellet was stored at −70°C.
GSE90743	Sequenced reads were trimmed for adaptor sequence using Cutadapt v. 1.8.3, then mapped to E. coli K12 substr. W3110 whole genome from NCBI (GenBank: AP009048.1) using the RNA-seq aligner STAR v.2.4.2a.
GSE90743	strain: K12 W3110
GSE90743	Supplementary_files_format_and_content: xlsx file format includes raw gene counts for each sample before and after filtering for low coverage genes
GSE90743	The bcl2fastq Conversion Software v. 1.8.4 from Illumina (http:
GSE90743	The RNeasy mini kit, with on column RNase-Free DNase I treatment, (both Qiagen, Hilden, Germany) was used for total RNA isolation (RNA ≥ 200 bases), according to the manufacturer’s protocol. RNA quality was determined by a Lab-on-a-Chip-System Bioanalyzer 2100 (Agilent, Boeblingen, Germany).
GSE90743	time: 0-15h
GSE90743	time: 0-16h
GSE90743	time: 0-2h
GSE90743	time: 10min
GSE90743	time: 120min
GSE90743	time: 210min
GSE90743	time: 25h
GSE90743	time: 25min
GSE90743	time: 26h
GSE90743	time: 28h
GSE90743	time: 330min
GSE90743	time: 45min
GSE90743	time: 5min
GSE90743	time: 75min
GSE9	0', before UV treatment, 25 ug total RNA, 2 ug pdN6
GSE9	0' lexA, before UV 25 ug total RNA, 2 ug pdN6
GSE9	0' wt, before UV treatment, 25 ug total RNA, 2 ug pdN6
GSE91001	ATCACG-D1
GSE91001	CGATGT-D2
GSE91001	DGE analysis used a false-discovery rate (FDR) of 0.10.
GSE91001	Differential gene expression (DGE) was then performed on fragments per kilobase mapped (FPKM) values in Cufflinks’ Cuffdiff package (version 0.0.7).
GSE91001	Escherichia coli
GSE91001	For the whole-transcriptome analysis, sequencing was verified using FASTQC (version 0.11.2) to confirm base-call quality in each indexed file.
GSE91001	Genome_build: FM180568
GSE91001	Genome_build: FM180569
GSE91001	Genome_build: FM180570
GSE91001	genotype
GSE91001	Incubation and RNA harvesting were carried out for all samples simultaneously and under RNase-free conditions to minimize biological variability in gene expression between each sample. Bacterial concentrations were equalized to the same density (by OD600).
GSE91001	Indices corresponding to the same sample were merged, and then uploaded to a cloud-based variant of Galaxy named RNA23 Rocket
GSE91001	LB (5 ml) was inoculated by a frozen stock of WT or perC-mutant strain and incubated at 37°C with 225 rpm shaking. Flasks containing low-glucose DMEM were inoculated 1:100 with the overnight culture and incubated at 37°C with 225 rpm shaking to mid-exponential phase (OD600 0.3-0.5).
GSE91001	Mapped reads were quality checked with SAMstat (version 1.08), and transcripts were assembled in Cufflinks (version 2.0.2)
GSE91001	Resulting mRNA was reverse-transcribed to cDNA libraries via SuperScript III First Strand reverse transcription kit (Invitrogen, Carlsbad, CA, 18080051) as per the manufacturer’s instructions. The cDNA libraries were multiplexed to distinguish replicates from one another, barcoded for sequencing, and then amplified with random hexamers for 15 PCR cycles. Transcripts were sequenced for 50 bases in single-end fashion within one lane of an Illumina Hiseq 2000 flow cell. This yielded roughly 30 million reads per sample.
GSE91001	RNA-Seq
GSE91001	Samples were diluted 1:1 in RNA Protect (Qiagen, Carlsbad, CA) to inhibit RNase activity and then centrifuged (5000 x g, 10 min). Pellets were resuspended in TE
GSE91001	source: Bustamante et al., 2011
GSE91001	strain: JPEP22
GSE91001	Subsequent data visualizations were performed in R (version 3.1.2) using the cummeRbund package (version 3.0)
GSE91001	Supplementary_files_format_and_content: bedgraph: Data presented in a 4 column BED format, of which the first column is the chromosome, the second column is the start position of the chromosome, the third column is the end position, and the fourth column is the fragments per kilobase mapped (FPKM) for that sample. Chromosome positions are specified as 0-relative. The first chromosome position is 0. The last position in a chromosome of length N would be N - 1. Only positions specified have data. Positions not specified do not have data and will not be graphed. All positions specified in the input data are in numerical order.
GSE91001	Supplementary_files_format_and_content: tabular: Tabular data that informs the excel spreadsheet. The data are averaged across the three samples per strain. Both averaged strain data are presented for each gene on the same line. Data contain gene ID, gene number, locus, fragments per kilobase mapped (FPKM) for WT and mutant strains, log2(fold-change) relative epxression of WT over mutant strains, test-statistic, p-value, q-value, and significance analyzed via the cummeRbund package in R whereby a q-value of <0.05 is considered significant.
GSE91001	Supplementary_files_format_and_content: xls: The data are averaged across the three samples per strain. Both averaged strain data are presented for each gene on the same line. Excel spreadsheet containing gene ID, gene number, locus, fragments per kilobase mapped (FPKM) for WT and mutant strains, log2(fold-change) relative epxression of WT over mutant strains, test-statistic, p-value, q-value, and significance analyzed via the cummeRbund package in R whereby a q-value of <0.05 is considered significant.
GSE91001	TTAGGC-D3
GSE91001	Using Bowtie2 (version 2.0.2), sequenced reads were mapped to an EPEC O127:H6 reference genome (EMBL
GSE91001	Whole bacterial cell RNA transcriptome
GSE9	10min after UVtreatment 1', 40J, MG1655 in Davis+0.4%glu
GSE9	10min UV treated cells, 25 ug total RNA
GSE9203	Cells treated with bacterial protect reagent and freeze at -70 C
GSE9203	E. coli grow in LB rich medium to OD600=2.4
GSE9203	Escherichia coli
GSE9203	Genotype: E. coli K12
GSE9203	RNA samples were extracted via Invitrogen RNAeasy Kit and treated with DNaseI to remove all DNA
GSE9203	The data were analyzed with Microarray Suite version 5.0 (MAS 5.0) using Affymetrix default analysis settings and global scaling as normalization method. The trimmed mean target intensity of each array was arbitrarily set to 100.
GSE9203	W3110  lsrK mutants
GSE9203	W3110 lsrK mutants
GSE9203	W3110 lsrK mutants, biological rep1
GSE9203	W3110 lsrK mutants, biological rep2
GSE9203	W3110 lsrR  mutants
GSE9203	W3110 lsrR mutants, biological rep1
GSE9203	W3110 lsrR mutants, biological rep2
GSE9203	W3110 wild type
GSE9203	W3110 wild type, biological rep1
GSE9203	W3110 wild type, biological rep2
GSE9	20min after UVtreatment 1', 40J, MG1655 in Davis+0.4%glu
GSE9	20min untreatedcells, 25 ug total RNA
GSE9	20min UV treated cells, 25 ug total RNA
GSE9	20min UVtreatment control, MG1655 in Davis+0.4%glu
GSE92255	antibody: Monoclonal ANTI-FLAG M2 antibody (F3165) -Sigma
GSE92255	background: crp mutant background, fis flag tag
GSE92255	background: fis mutant background, crp flag tag
GSE92255	background: wild type, crp flag tag
GSE92255	background: wild type, fis flag tag
GSE92255	BAM files of each ChIP biological replicate and the input replicate samples were used in the MACS peak calling program with the -f BAMPE parameter
GSE92255	Cells were fixed in the required growth phase in formaldehyde, quenched, washed and lysed. Fragmented DNA - protein complex were pulled using the monoclonal flag tag antibody. The complex was then washed, reverse cross-linked and obtained DNA purified using Qiagen min elute PCR purification kit.
GSE92255	Cells were inoculated from overnight culture in rich Lysogeny broth at 37 degrees in aerobic conditions.
GSE92255	ChIP-Seq
GSE92255	crp.ee.chipseq
GSE92255	crp.ee.input
GSE92255	crp.me.chipseq
GSE92255	crp.me,input
GSE92255	crp.me.input
GSE92255	crpmutant.fis.ee.chipseq
GSE92255	crpmutant.fis.ee.input
GSE92255	crpmutant.fis.me.chipseq
GSE92255	crpmutant.fis.me.input
GSE92255	Escherichia coli str. K-12 substr. MG1655
GSE92255	fis.ee.chipseq
GSE92255	fis.ee.input
GSE92255	fis.me.chipseq
GSE92255	fis.me.input
GSE92255	fismutant.crp.ee.chipseq
GSE92255	fismutant.crp.ee.input
GSE92255	fismutant.crp.me.chipseq
GSE92255	fismutant.crp.me.input
GSE92255	Genome_build: NC000913.2
GSE92255	growth phase: Early exponential
GSE92255	growth phase: Mid exponential
GSE92255	SAM files thus obtained were converted to BAM files using samtools view command
GSE92255	Samples were aligned to the E. coli K 12 MG1655 reference sequence (version NC000913.2), using BWA (version 0.5) WITH -q 30 parameter for trimming of reads below PHRED quality score of 30.
GSE92255	Supplementary_files_format_and_content: peaks.bed
GSE92255	Truseq ChIP kit was used for the library preparation. DNA was end repaired and adapters were ligated. After ligation, purify ligation products and then amplify.
GSE92601	BGI inhouse software “filter_fq” for basecalling and trimming
GSE92601	Duplicate O
GSE92601	E. coli MG1655 
GSE92601	Escherichia coli str. K-12 substr. MG1655
GSE92601	Genome_build:  NC_000913
GSE92601	induction: induced 50 µM IPTG
GSE92601	ORF1_1
GSE92601	ORF1_1_IPTG
GSE92601	ORF1_2
GSE92601	ORF1_2_IPTG
GSE92601	Read-mapping was done with soap2.21. Mapping towards genes was done by the following parameters -m 0 -x 1000 -s 28 -l 32 -v 5 -r 2 -p 3
GSE92601	replicates: ORF1 replicate 1 
GSE92601	replicates: ORF1 replicate 2 
GSE92601	replicates: Svi3-3 replicate 1 
GSE92601	replicates: Svi3-3 replicate 2 
GSE92601	replicates: WT replicate 1 
GSE92601	replicates: WT replicate 2 
GSE92601	RNA-Seq
GSE92601	Supplementary_files_format_and_content: The columns in the processed files are the following in order:  GeneID, Length, ORF1_1_mapped_reads(7655775), ORF1_1_IPTG_mapped_reads(7178582), ORF1_2_mapped_reads(7706927), ORF1_2_IPTG_mapped_reads(7070827), Svi3_3_1_mapped_reads(8018710), Svi3_3_1_IPTG_mapped_reads(8299205), Svi3_3_2_mapped_reads(7313736), Svi3_3_2_IPTG_mapped_reads(8344539), WT1_IPTG_mapped_reads(8074159), WT2_IPTG_mapped_reads(8103887), ORF1_1_coverage, ORF1_1_IPTG_coverage, ORF1_2_coverage, ORF1_2_IPTG_coverage, Svi3_3_1_coverage, Svi3_3_1_IPTG_coverage, Svi3_3_2_coverage, Svi3_3_2_IPTG_coverage, WT1_IPTG_coverage, WT2_IPTG_coverage, ORF1_1_rpkm, ORF1_1_IPTG_rpkm, ORF1_2_rpkm, ORF1_2_IPTG_rpkm, Svi3_3_1_rpkm, Svi3_3_1_IPTG_rpkm, Svi3_3_2_rpkm, Svi3_3_2_IPTG_rpkm, WT1_IPTG_rpkm, WT2_IPTG_rpkm, Symbol (gene name), Description, KEGG Orthology, GO Component, GO Function, and GO Process
GSE92601	Svi3_3_1
GSE92601	Svi3_3_1_IPTG
GSE92601	Svi3_3_2
GSE92601	Svi3_3_2_IPTG
GSE92601	The cells for RNA extraction were immediately mixed with RNA Protect Bacterial reagent® (Qiagen) and processed by the RNAeasy Mini Kit (Qiagen) according to the manufacturers instructions. The cells for whole cell proteomics were chilled in ice-slush, pelleted at 14000 rpm, 4°C and the media was aspirated.  The cells were washed with 3×1.5 mL PBS with pelleting at as above in between. The final pellet was stored at -80°C until being shipped to the Proteomics Core Facility at University of Gothenburg for processing. The RNA was shipped to BGI for total RNA sequencing.
GSE92601	The gene expression values were calculated as RPKM (reads per kilobase transcriptome per million mapped reads) by the inhouse BGI pipeline.
GSE92601	The pCA24N,-gfp
GSE92601	TruSeq
GSE92601	WT1_IPTG
GSE92601	WT2_IPTG
GSE93125	An o
GSE93125	E. coli TolC cells were grown o
GSE93125	Eco_TolC_0min_A
GSE93125	Eco_TolC_0min_B
GSE93125	Eco_TolC_15min_Carolacton_A
GSE93125	Eco_TolC_15min_Carolacton_B
GSE93125	Eco_TolC_15min_control_A
GSE93125	Eco_TolC_15min_control_B
GSE93125	Eco_TolC_30min_Carolacton_A
GSE93125	Eco_TolC_30min_Carolacton_B
GSE93125	Eco_TolC_30min_control_A
GSE93125	Eco_TolC_30min_control_B
GSE93125	Eco_TolC_5min_Carolacton_A
GSE93125	Eco_TolC_5min_Carolacton_B
GSE93125	Eco_TolC_5min_control_A
GSE93125	Eco_TolC_5min_control_B
GSE93125	Escherichia coli
GSE93125	Genome_build: CP018801 (https:
GSE93125	genotype: TolC defective (TolC-)
GSE93125	Libraries of RNA fractions were constructed with the ScriptSeq V2 RNA-Seq Library Prep Kit (Illumina) according to the manufacturers guidelines.
GSE93125	planktonic cells
GSE93125	Raw read counts of transcripts were obtained by aligning samples 1-14 to the reference genome and counting mapped reads per feature using Rockhopper v2.0.3.
GSE93125	RNA-Seq
GSE93125	Sequenced reads were trimmed for adaptor sequences using FastQC v0.11.2.
GSE93125	Supplementary_files_format_and_content: The tab-delimited text files include raw read values for each time-point for both biol. replicates of control and Carolacton-treated samples as obtained from Rockhopper. A FASTA file on the series record contains the transcript sequences.
GSE93125	time point (minutes): 0
GSE93125	time point (minutes): 15
GSE93125	time point (minutes): 30
GSE93125	time point (minutes): 5
GSE93125	Total cellular RNAs were extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturers protocol. Residual DNA in the fractions was digested by addition of 27 Kunitz units Dnase I (Qiagen), and absence of DNA verified by Polymerase chain reaction (PCR). mRNA enrichment was conducted using the Ribo-Zero kit for Gram-negative bacteria (epicentre). RNA quality control of the RNA extracts, as well as the successful mRNA enrichment, was conducted by using an Agilent 2100 Bioanalyzer.
GSE93125	treatment: 0.5 µg
GSE93125	treatment: none
GSE93506	antibody: anti-FLAG mAb
GSE93506	antibody vendor
GSE93506	Basecalls performed using CASAVA version 1.8
GSE93506	Cells were grown in LB media with 1mM IPTG at 37 °C with shaking for 2 hours
GSE93506	ChIP-Seq
GSE93506	CsiR_ChIPSeq
GSE93506	CsiR_RNASeq
GSE93506	Culture cells
GSE93506	Escherichia coli K-12
GSE93506	For chromatin immunoprecipitation, cells were fixed with formaldehyde and glycine and sheared via sonication. Sheared DNA from lysate was immunoprecipitated (IP) out using an anti-FLAG mAb (Sigma). DNA was washed with IPP150 buffer and purified via ProteinaseK digestion and Qiaquick PCR purification kit (Qiagen - Cat. No. 28106).
GSE93506	For total RNA extraction, cells were pelleted in 4 °C.
GSE93506	Genome_build: U00096.2 (GenBank)
GSE93506	Nac_ChIPSeq
GSE93506	Nac_RNASeq
GSE93506	NtrC_ChIPSeq
GSE93506	OmpR_ChIPSeq
GSE93506	Peak calling was done using SPAT
GSE93506	Reads were aligned to GenBank ID U00096.2
GSE93506	RNA-Seq
GSE93506	R scripts (Bioconductor GenomicRanges) and custom scripts were used to calculate RPKMs. Fold-change was calculated as ratio of RPKMs after TF induction to control experiment.
GSE93506	strain: MG1655
GSE93506	Supplementary_files_format_and_content: .xlsx files contain peak region locations and gene expression value for ChIP-Seq and RNA-Seq respectively
GSE93506	The appropriate protocols were performed using standard Illumina procedures
GSE93506	Total RNA extraction was done using TRIzol reagent and DNAse digested. RNA purfication was carried out using Rneasy spin columns
GSE93506	transcription factor: CsiR
GSE93506	transcription factor: Nac
GSE93506	transcription factor: NtrC
GSE93506	transcription factor: OmpR
GSE9	40min after UVtreatment 1, 40J, MG1655 in Davis+0.4%glu
GSE9	40min untreatedcells, 25 ug total RNA
GSE94117	batch: 10
GSE94117	batch: 11
GSE94117	batch: 12
GSE94117	batch: 13
GSE94117	batch: 14
GSE94117	batch: 15
GSE94117	batch: 16
GSE94117	batch: 17
GSE94117	batch: 18
GSE94117	batch: 19
GSE94117	batch: 20
GSE94117	batch: 21
GSE94117	batch: 22
GSE94117	batch: 23
GSE94117	batch: 24
GSE94117	batch: 25
GSE94117	batch: 26
GSE94117	batch: 27
GSE94117	batch: 7
GSE94117	batch: 8
GSE94117	batch: 9
GSE94117	bowtie2-build final_reference_seqs
GSE94117	carbon source: gluconate
GSE94117	carbon source: glucose
GSE94117	carbon source: glycerol
GSE94117	carbon source: lactate
GSE94117	convert back to sorted.sam with samtools
GSE94117	convert bowtie output .sam to .bam with samtools
GSE94117	Escherichia coli B str. REL606
GSE94117	exponential culture
GSE94117	Genome_build: reference sequence is REL606
GSE94117	get raw counts for reads mapped with htseq-count
GSE94117	gluconate_growth: MURI_091
GSE94117	gluconate_growth: MURI_092
GSE94117	gluconate_growth: MURI_093
GSE94117	gluconate_growth: MURI_094
GSE94117	gluconate_growth: MURI_095
GSE94117	gluconate_growth: MURI_096
GSE94117	glucose_time_course: MURI_016
GSE94117	glucose_time_course: MURI_017
GSE94117	glucose_time_course: MURI_018
GSE94117	glucose_time_course: MURI_019
GSE94117	glucose_time_course: MURI_020
GSE94117	glucose_time_course: MURI_021
GSE94117	glucose_time_course: MURI_022
GSE94117	glucose_time_course: MURI_023
GSE94117	glucose_time_course: MURI_024
GSE94117	glucose_time_course: MURI_025
GSE94117	glucose_time_course: MURI_026
GSE94117	glucose_time_course: MURI_027
GSE94117	glucose_time_course: MURI_028
GSE94117	glucose_time_course: MURI_029
GSE94117	glucose_time_course: MURI_030
GSE94117	glucose_time_course: MURI_031
GSE94117	glucose_time_course: MURI_032
GSE94117	glucose_time_course: MURI_033
GSE94117	glucose_time_course: MURI_097
GSE94117	glucose_time_course: MURI_098
GSE94117	glucose_time_course: MURI_099
GSE94117	glucose_time_course: MURI_100
GSE94117	glucose_time_course: MURI_101
GSE94117	glucose_time_course: MURI_102
GSE94117	glucose_time_course: MURI_103
GSE94117	glucose_time_course: MURI_104
GSE94117	glucose_time_course: MURI_105
GSE94117	glycerol_time_course: MURI_034
GSE94117	glycerol_time_course: MURI_035
GSE94117	glycerol_time_course: MURI_036
GSE94117	glycerol_time_course: MURI_037
GSE94117	glycerol_time_course: MURI_038
GSE94117	glycerol_time_course: MURI_039
GSE94117	glycerol_time_course: MURI_040
GSE94117	glycerol_time_course: MURI_041
GSE94117	glycerol_time_course: MURI_042
GSE94117	glycerol_time_course: MURI_043
GSE94117	glycerol_time_course: MURI_044
GSE94117	glycerol_time_course: MURI_045
GSE94117	glycerol_time_course: MURI_046
GSE94117	glycerol_time_course: MURI_047
GSE94117	glycerol_time_course: MURI_048
GSE94117	glycerol_time_course: MURI_049
GSE94117	glycerol_time_course: MURI_050
GSE94117	glycerol_time_course: MURI_052
GSE94117	glycerol_time_course: MURI_053
GSE94117	glycerol_time_course: MURI_054
GSE94117	glycerol_time_course: MURI_055
GSE94117	glycerol_time_course: MURI_056
GSE94117	glycerol_time_course: MURI_057
GSE94117	glycerol_time_course: MURI_058
GSE94117	glycerol_time_course: MURI_059
GSE94117	growth phase: exponential
GSE94117	growth phase: late_stationary
GSE94117	growth phase: stationary
GSE94117	growth time (hours): 10
GSE94117	growth time (hours): 14
GSE94117	growth time (hours): 168
GSE94117	growth time (hours): 24
GSE94117	growth time (hours): 26
GSE94117	growth time (hours): 27
GSE94117	growth time (hours): 28
GSE94117	growth time (hours): 29
GSE94117	growth time (hours): 3
GSE94117	growth time (hours): 336
GSE94117	growth time (hours): 4
GSE94117	growth time (hours): 48
GSE94117	growth time (hours): 5
GSE94117	growth time (hours): 5.5
GSE94117	growth time (hours): 6
GSE94117	growth time (hours): 6.5
GSE94117	growth time (hours): 7
GSE94117	growth time (hours): 8
GSE94117	growth time (hours): 9
GSE94117	Illumina Ribozero rRNA removal followed by NEB Next RNA library Prep set.
GSE94117	lactate_growth: MURI_085
GSE94117	lactate_growth: MURI_086
GSE94117	lactate_growth: MURI_087
GSE94117	lactate_growth: MURI_088
GSE94117	lactate_growth: MURI_089
GSE94117	lactate_growth: MURI_090
GSE94117	late stationary culture
GSE94117	map trimmed reads to reference sequence in indexes file with bowtie2
GSE94117	mg+2 (levels): baseMg
GSE94117	mg+2 (levels): highMg
GSE94117	mg+2 (levels): lowMg
GSE94117	mg+2 (mm): 0.005
GSE94117	mg+2 (mm): 0.01
GSE94117	mg+2 (mm): 0.02
GSE94117	mg+2 (mm): 0.04
GSE94117	mg+2 (mm): 0.08
GSE94117	mg+2 (mm): 0.8
GSE94117	mg+2 (mm): 200
GSE94117	mg+2 (mm): 400
GSE94117	mg+2 (mm): 50
GSE94117	mg+2 (mm): 8
GSE94117	MgSO4_stress_high: MURI_106
GSE94117	MgSO4_stress_high: MURI_107
GSE94117	MgSO4_stress_high: MURI_108
GSE94117	MgSO4_stress_high: MURI_109
GSE94117	MgSO4_stress_high: MURI_110
GSE94117	MgSO4_stress_high: MURI_111
GSE94117	MgSO4_stress_high: MURI_112
GSE94117	MgSO4_stress_high: MURI_113
GSE94117	MgSO4_stress_high: MURI_114
GSE94117	MgSO4_stress_high: MURI_115
GSE94117	MgSO4_stress_high: MURI_116
GSE94117	MgSO4_stress_high: MURI_117
GSE94117	MgSO4_stress_high: MURI_118
GSE94117	MgSO4_stress_high: MURI_119
GSE94117	MgSO4_stress_high: MURI_120
GSE94117	MgSO4_stress_high: MURI_121
GSE94117	MgSO4_stress_high: MURI_122
GSE94117	MgSO4_stress_high: MURI_123
GSE94117	MgSO4_stress_high: MURI_124
GSE94117	MgSO4_stress_high: MURI_125
GSE94117	MgSO4_stress_high: MURI_126
GSE94117	MgSO4_stress_high: MURI_127
GSE94117	MgSO4_stress_high: MURI_128
GSE94117	MgSO4_stress_high: MURI_129
GSE94117	MgSO4_stress_high: MURI_130
GSE94117	MgSO4_stress_high: MURI_131
GSE94117	MgSO4_stress_high: MURI_132
GSE94117	MgSO4_stress_high: MURI_133
GSE94117	MgSO4_stress_high: MURI_134
GSE94117	MgSO4_stress_high: MURI_135
GSE94117	MgSO4_stress_high: MURI_136
GSE94117	MgSO4_stress_high: MURI_137
GSE94117	MgSO4_stress_high: MURI_138
GSE94117	MgSO4_stress_high: MURI_139
GSE94117	MgSO4_stress_high: MURI_140
GSE94117	MgSO4_stress_high: MURI_141
GSE94117	MgSO4_stress_low: MURI_142
GSE94117	MgSO4_stress_low: MURI_143
GSE94117	MgSO4_stress_low: MURI_144
GSE94117	MgSO4_stress_low: MURI_145
GSE94117	MgSO4_stress_low: MURI_146
GSE94117	MgSO4_stress_low: MURI_147
GSE94117	MgSO4_stress_low: MURI_148
GSE94117	MgSO4_stress_low: MURI_149
GSE94117	MgSO4_stress_low: MURI_150
GSE94117	MgSO4_stress_low: MURI_151
GSE94117	MgSO4_stress_low: MURI_152
GSE94117	MgSO4_stress_low: MURI_153
GSE94117	MgSO4_stress_low: MURI_154
GSE94117	MgSO4_stress_low: MURI_155
GSE94117	MgSO4_stress_low: MURI_156
GSE94117	MgSO4_stress_low: MURI_157
GSE94117	MgSO4_stress_low: MURI_158
GSE94117	MgSO4_stress_low: MURI_159
GSE94117	MgSO4_stress_low: MURI_160
GSE94117	MgSO4_stress_low: MURI_161
GSE94117	MgSO4_stress_low: MURI_162
GSE94117	MgSO4_stress_low: MURI_163
GSE94117	MgSO4_stress_low: MURI_164
GSE94117	MgSO4_stress_low: MURI_165
GSE94117	MgSO4_stress_low: MURI_166
GSE94117	MgSO4_stress_low: MURI_167
GSE94117	MgSO4_stress_low: MURI_168
GSE94117	MgSO4_stress_low: MURI_169
GSE94117	MgSO4_stress_low: MURI_170
GSE94117	MgSO4_stress_low: MURI_171
GSE94117	na+1 (levels): baseNa
GSE94117	na+1 (levels): highNa
GSE94117	na+1 (mm): 100
GSE94117	na+1 (mm): 200
GSE94117	na+1 (mm): 300
GSE94117	na+1 (mm): 5
GSE94117	NaCl_stress: MURI_061
GSE94117	NaCl_stress: MURI_063
GSE94117	NaCl_stress: MURI_064
GSE94117	NaCl_stress: MURI_065
GSE94117	NaCl_stress: MURI_066
GSE94117	NaCl_stress: MURI_067
GSE94117	NaCl_stress: MURI_068
GSE94117	NaCl_stress: MURI_069
GSE94117	NaCl_stress: MURI_070
GSE94117	NaCl_stress: MURI_071
GSE94117	NaCl_stress: MURI_072
GSE94117	NaCl_stress: MURI_073
GSE94117	NaCl_stress: MURI_074
GSE94117	NaCl_stress: MURI_075
GSE94117	NaCl_stress: MURI_076
GSE94117	NaCl_stress: MURI_077
GSE94117	NaCl_stress: MURI_079
GSE94117	NaCl_stress: MURI_080
GSE94117	NaCl_stress: MURI_081
GSE94117	NaCl_stress: MURI_082
GSE94117	NaCl_stress: MURI_083
GSE94117	NaCl_stress: MURI_084
GSE94117	RNA-Seq
GSE94117	RNAsnap followed by purification through Zymo RNA clean and concentrator.
GSE94117	stationary culture
GSE94117	Supplementary_files_format_and_content: txt files including count numbers of RNA's and quality control were generated
GSE94117	trim adaptors on raw reads and moved trimmed reads to trimmed_reads with flexbar
GSE94342	BW25113
GSE94342	Data were normalized using the LOWESS algorithm and analyzed for statistical significance using the MeV package
GSE94342	EJW3, BW25113 rpoC K370_A396dup
GSE94342	EJW3 in M9 Replicate 1
GSE94342	EJW3 in M9 Replicate 2
GSE94342	EJW3 in M9 supplemented with 0.6 M NaCl Replicate 1
GSE94342	EJW3 in M9 supplemented with 0.6 M NaCl Replicate 2
GSE94342	Escherichia coli
GSE94342	EYG1 in M9 Replicate 1
GSE94342	EYG1 in M9 Replicate 2
GSE94342	EYG1, MG1655 rpoC K370_A396dup
GSE94342	EYG in M9 supplemented with 0.6 M NaCl Replicate 1
GSE94342	EYG in M9 supplemented with 0.6 M NaCl Replicate 2
GSE94342	genotype: rpoC K370_A396dup mutant
GSE94342	genotype: Wild-type strain
GSE94342	Grown in glucose M9 media with or without supplementation of 0.6 M NaCl
GSE94342	MG1655
GSE94342	protocol: M9
GSE94342	protocol: M9 supplemented with 0.6 M NaCl
GSE94342	Samples were grown to mid exponential phase (OD approx 0.5). Cultures were then quickly chilled to ≤ 4 ºC on dry ice
GSE94342	strain: BW25113
GSE94342	strain: MG1655
GSE9434	control strain
GSE9434	Escherichia coli
GSE9434	L-threonine producing strain
GSE9434	L-threonine producing strain vs control strain
GSE9434	The mean signal intensity values of the duplicate spots were averaged and then normalized by the global normalization method. The genes showing the p-values lower than 0.05 were considered to be significant.
GSE9434	using RNeasy Mini Kit
GSE9434	W3110 (lacI-deleted) strain harboring pKK223-3
GSE94978	ATCC2
GSE94978	ATCC3
GSE94978	Broiler Fecal
GSE94978	Escherichia coli
GSE94978	first strand cDNA was performed by the use of SuperScriptII and the second strand cDNA synthesis was done before end-pair and dA-tailing
GSE94978	Following \TruSeq RNA Sample Preparation Guide\.
GSE94978	Genome_build: UCSC mm10
GSE94978	Human
GSE94978	No treatment
GSE94978	Reads longer than 25 nt and ≤ 2 N (ambiguous nucleotides) were preserved.
GSE94978	RNA-Seq
GSE94978	RNA-Seq of E. coli were done using blind and fit-only parameter in DE-Seq pakage
GSE94978	Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence using FASTX-Toolkit  version 0.0.13 and Perl version 5.8.8
GSE94978	strain: E. coli ATCC 25922
GSE94978	strain: Poultry E. coli Virulent and multidrug resistant
GSE94978	Strains were harvested in MH broth at log phase
GSE94978	Supplementary_files_format_and_content: tab-delimited text files include normalized FPKM values and raw fragment counts for each Sample
GSE94978	Total RNAs were extracted from the bacterial isolates using TRIzol
GSE94978	Using blind and fit-only parameter in DE-Seq pakage, expressions of genes in all samples were changed to count per gene, using RNA-Seq protocol on Illumina HiSeq2500 platform
GSE94984	biomass collected in the transition between exponential to stationary phase
GSE94984	EHEC in LB Experiment 1 [RIBO-Seq]
GSE94984	EHEC in LB Experiment 1 [RNA-Seq]
GSE94984	EHEC in LB Experiment 2 [RIBO-Seq]
GSE94984	EHEC in LB Experiment 2 [RNA-Seq]
GSE94984	Escherichia coli O157:H7 str. EDL933
GSE94984	Genome_build: NC_002655
GSE94984	growth media: LB medium
GSE94984	Illumina fastq files were submitted to the galaxy pipeline => grooming => mapping to NC_002655 using bowtie2 (default but seed 19 nt & zero mismatches within seed)
GSE94984	LB medium, 180 rpm shaking, at 37°C, between exponential and stationary phase
GSE94984	Library strategy: RIBO-seq
GSE94984	ligation, rt-PCR, PCR
GSE94984	OTHER
GSE94984	RNA-Seq
GSE94984	Supplementary_files_format_and_content: Reads, RPKM, and RCV mapped to NC_002655 (RCV = Ribosomal Coverage Value = RPKM-footprint over RPKM-transcription)
GSE94984	Trizol for RNAseq, gradient centrifugation => RNase digestions => Trizol => gel extraction for RIBOseq
GSE94984	Truseq Small RNA
GSE95310	Escherichia coli
GSE95310	Genome_build: NC_018220 and NC_000913
GSE95310	MG1655_LB
GSE95310	MG1655_LB1
GSE95310	MG1655_LB2
GSE95310	RNA libraries were prepared for sequencing using standard Illumina protocols
GSE95310	RNA-Seq
GSE95310	Single colonies of P. putida strain DOT-T1E and E. coli MG1655 were grown overnight in Luria–Bertani (LB) medium at 30°C. Overnight cultures were diluted to a starting OD600 of 0.01 in the same medium and 50 ml aliquots were disposed in separate 250 ml Erlenmeyer flasks and incubated with shaking at 200 rpm. When cultures reached exponential phase (0.5 at OD600), antibiotics were added at sub-lethal concentrations to the culture medium to reach a final concentration of 1 µg
GSE95310	strain: MG1655
GSE95310	Supplementary_files_format_and_content: CoK12_LB.xlsx: Average expression values of reads related with MG1655 strain in samples Co-culture_LB1 and LB2
GSE95310	Supplementary_files_format_and_content: CoT1E_LB.xlsx: Average expression values of reads related with DOT-T1E strain in samples Co-culture_LB1 and LB2
GSE95310	Supplementary_files_format_and_content: K12_LB.xlsx: Average of expression values of samples MG1655_LB1 and LB2
GSE95310	Supplementary_files_format_and_content: T1E_LB.xlsx: Average of expression values of samples DOT-T1E_LB1 and LB2
GSE95310	Supplementary_files_format_and_content: tab-delimited text files include the average of the expression values obtained in Rockhopper for the replicates of each condition
GSE95310	We use Rockhopper for alignment and the complete analysis of data
GSE95318	Adapters trimmed with Cutadapt (v1.12)
GSE95318	Aligned to NC_000913.3 with bwa version 0.7.7
GSE95318	bacterial cells
GSE95318	Cells were grown to exponential phase in Lysogeny broth, 37oC with shaking
GSE95318	Cells were harvested after the addition of rifampicin  (250 μg
GSE95318	Count reads aligned to each base IGVtools (version 2.3.71), window size = 1
GSE95318	Escherichia coli
GSE95318	Gave a pseudocount of 0.01 to all values of 0
GSE95318	Genome_build: NC_000913.3
GSE95318	genotype
GSE95318	Index and sort alignments with samtools version 1.2
GSE95318	Normalized decay values with average of stable genes ssrA, ssrS, and rnpB
GSE95318	RNA-Seq
GSE95318	rnc-_time0
GSE95318	rnc-_time10
GSE95318	rnc-_time20
GSE95318	rnc-_time2.5
GSE95318	rnc-_time5
GSE95318	rnc-_time7.5
GSE95318	rRNA reduction with EpiCentre Ribo-Zero Gram Negative Ribosomal RNA reduction kit (2.5ug) & TruSeq RNA Library Prep
GSE95318	strain: MG1693
GSE95318	strain: SK4455
GSE95318	Supplementary_files_format_and_content: In the .txt files the first column is the coordinate of the base corresponding to NC_000913.3 and the second column is the number of normalized reads at that position. All 0 values were given a pseudocount of 0.01. Counts are normalized so that the averages of ssrA, ssrS, and rnpB are stable throughout the decay from 0 to 20 minutes
GSE95318	time point: time0
GSE95318	time point: time10
GSE95318	time point: time20
GSE95318	time point: time2.5
GSE95318	time point: time5
GSE95318	time point: time7.5
GSE95318	Total RNA was extracted and DNase-treated according to published protocols (Khodurksy A, Bernstein J, Peter B, Rhodius V, Wendisch V, Zimmer D. Escherichia coli Spotted Double-Strand DNA Microarrays)
GSE95318	WTA_time0
GSE95318	WTA_time10
GSE95318	WTA_time20
GSE95318	WTA_time2.5
GSE95318	WTA_time5
GSE95318	WTA_time7.5
GSE95318	WTB_time0
GSE95318	WTB_time2.5
GSE95318	WTB_time7.5
GSE95567	10 pmol of a pre-adenylated (rApp) adapter were ligated to 1 μg of nascent (or mature) RNA in a reaction volume of 20 μl, using 400 U T4 RNA Ligase 2, Deletion Mutant (Epicentre, cat. LR2D11310K) in the presence of 20% PEG-8000, by incubation at 25°C for 2 hours. Reaction clean-up was performed using RNA Clean & Concentrator™-5 columns, and RNA was eluted in 20 μl of Fragmentation buffer [65 mM Tris pH 8.3; 100 mM KCl; 5 mM MgCl2]. RNA was fragmented by incubation at 95°C for 8 minutes. Fragmented RNA was purified using RNA Clean & Concentrator™-5 columns, and eluted in 5.5 μl of nuclease-free water. RNA was heat-denatured at 70°C for 5 minutes, and reverse transcription was carried out in a final volume of 10 μl, in the presence of 0.5 mM dNTPs, 5 pmol of RT primer, 20 U RNaseOUT™ Recombinant Ribonuclease Inhibitor (Invitrogen, cat. 10777-019), and 100 U SuperScript® III Reverse Transcriptase (Invitrogen, cat. 18080-044), by incubation at 50°C for 50 minutes. Template RNA was degraded by adding 1 μl of 1 M NaOH, and incubating at 95°C for 5 minutes. Reaction clean-up was performed using RNA Clean & Concentrator™-5 columns, and cDNA was eluted in 6 μl nuclease-free water. cDNA fragments were resolved on a 10% TBE-Urea polyacrylamide gel, and a gel slice corresponding to fragments in the range 40-150 nt was cut. DNA was recovered by passive diffusion in Diffusion buffer for 16 hours at 37°C with moderate shaking. cDNA was precipitated by addition of 1 ml Isopropanol, and 2 μl Glycogen (20 μg
GSE95567	10 pmol of a pre-adenylated (rApp) adapter were ligated to 1 μg of nascent RNA (either total, or rRNA-depleted using Ribo-Zero rRNA Removal Kit (Illumina, cat. MRZB12424)) in a reaction volume of 20 μl, using 400 U T4 RNA Ligase 2, Deletion Mutant in the presence of 20% PEG-8000, by incubation at 25°C for 2 hours. Reaction clean-up was performed using RNA Clean & Concentrator™-5 columns, and RNA was eluted in 5.5 μl nuclease-free water. RNA was heat-denatured at 70°C for 5 minutes, and reverse transcription was carried out in a final volume of 10 μl, in the presence of 0.5 mM dNTPs, 5 pmol of RT primer, 20 U RNaseOUT™ Recombinant Ribonuclease Inhibitor, and 100 U SuperScript® III Reverse Transcriptase, by incubation at 50°C for 50 minutes. Template RNA was degraded by adding 1 μl of 1 M NaOH, and incubating at 95°C for 5 minutes. Reaction clean-up was performed using RNA Clean & Concentrator™-5 columns, and cDNA was eluted in 6 μl nuclease-free water. cDNA fragments were resolved on a 10% TBE-Urea polyacrylamide gel, and three gel slices corresponding to fragments in the ranges of 40-200 nt, 200-400 nt, and 400-600 nt were cut. DNA was recovered by passive diffusion in Diffusion buffer for 16 hours at 37°C with moderate shaking. cDNA was precipitated by addition of 1 ml Isopropanol, and 2 μl Glycogen (20 μg
GSE95567	10 pmol of a pre-adenylated (rApp) adapter were ligated to rnpB nascent RNA in a reaction volume of 20 μl, using 400 U T4 RNA Ligase 2, Deletion Mutant in the presence of 20% PEG-8000, by incubation at 25°C for 2 hours. Reaction clean-up was performed using RNA Clean & Concentrator™-5 columns, and RNA was eluted in 5.5 μl nuclease-free water. RNA was heat-denatured at 70°C for 5 minutes, and reverse transcription was carried out in a final volume of 10 μl, in the presence of 0.5 mM dNTPs, 5 pmol of RT primer, 20 U RNaseOUT™ Recombinant Ribonuclease Inhibitor, and 100 U SuperScript® III Reverse Transcriptase, by incubation at 50°C for 50 minutes. Template RNA was degraded by adding 1 μl of 1 M NaOH, and incubating at 95°C for 5 minutes. Reaction clean-up was performed using RNA Clean & Concentrator™-5 columns, and cDNA was eluted in 6 μl nuclease-free water. cDNA fragments were resolved on a 10% TBE-Urea polyacrylamide gel, and a gel slice corresponding to fragments in the range of 40-300 nt was cut. DNA was recovered by passive diffusion in Diffusion buffer for 16 hours at 37°C with moderate shaking. cDNA was precipitated by addition of 1 ml Isopropanol, and 2 μl Glycogen (20 μg
GSE95567	2 μg of RNA from the cytoplasmic fraction were diluted in 20 μl of Fragmentation buffer, and fragmented by incubation at 95°C for 5 minutes. Fragmented RNA was purified using RNA Clean & Concentrator™-5 columns. End repair of RNA fragments was performed in a final volume of 20 μl, in the presence of 20 U T4 Polynucleotide Kinase (NEB, cat. M0201L), and 20 U SUPERase• In™ RNase Inhibitor, by incubation at 37°C for 1 hour. End-repaired RNA was purified again using RNA Clean & Concentrator™-5 columns, and eluted in 6 μl of nuclease-free water. 6 μl of 2X RNA Loading Dye were added to end-repaired RNA. RNA was heated to 95°C for 2 minutes, and immediately placed on ice. Samples were resolved on a 10% TBE-Urea polyacrylamide gel, and a gel slice corresponding to fragments above 200 nt was cut. The gel slice was crushed by centrifugation through a punctured 0.5 ml tube, and resuspended in 500 μl of Diffusion buffer supplemented with 60 U SUPERase• In™ RNase Inhibitor, then rotated at 4°C for 16 hours to allow passive diffusion of RNA fragments into buffer. RNA was precipitated by addition of 1 ml Isopropanol, and 2 μl Glycogen (20 μg
GSE95567	3'-end RNA-seq, Cytosolic fraction
GSE95567	3'-end RNA-seq, Cytosolic fraction, Replicate #1
GSE95567	3'-end RNA-seq, Cytosolic fraction, Replicate #2
GSE95567	3'-end RNA-seq, Nucleoid fraction
GSE95567	3'-end RNA-seq, Nucleoid fraction, Replicate #1
GSE95567	3'-end RNA-seq, Nucleoid fraction, Replicate #2
GSE95567	A single colony of Escherichia coli was inoculated into 250 ml of LB medium without antibiotics, and grown at 37C with shaking (150 RPM) for approximately 4 hours, until OD600 was ~0.3 (log phase). EDTA was then added to a final concentration of 1 mM, and incubated for additional 5 minutes to make bacteria permeable to Actinomycin D. Actinomycin D was then added to a final concentration of 5  g
GSE95567	DMS-seq (Ribo- RNA)
GSE95567	DMS-seq (Total RNA)
GSE95567	Each bacteria pellet from a 25 ml culture (OD600 ~0.3) was homogeneously resuspended in 200 µl of Buffer A [10 mM Tris pH 8.0; 20% Sucrose; 100 mM NaCl] supplemented with 200 U SUPERase• In™ RNase Inhibitor, by pipetting. 50 µl of Buffer B [50 mM EDTA; 120 mM Tris pH 8.0] supplemented with 1 µl Ready-Lyse™ Lysozyme Solution (Epicentre, cat. R1810M) were added dropwise, and the vial was gently tilted 5 times to ensure homogenous mixing. The sample was then incubated 1 minute at room temperature. 250 µl of Buffer C [0.5% Tween-20: 0.4% NaDOC; 2 M NaCl; 10 mM EDTA] were immediately added dropwise. The sample was then incubated 5 minutes at room temperature. At this stage the solution clears considerably without increasing its viscosity, and nucleoid becomes visible. Using a cut P1000 pipette tip, the whole sample was gently layered on the top of a 5-30% w
GSE95567	Escherichia coli
GSE95567	FastQ files were examined using the FastQC tool. All the relevant SPET-seq data (nascent RNA) analysis and normalization steps were performed using a custom wrapper built on top of the RNA Framework13. Briefly, reads were clipped from 3’ adapter sequences using Cutadapt v1.10, discarding reads shorter than 15 nucleotides. Escherichia coli str. K-12 substr. MG1655 (GenBank: U00096.2) was used as the reference genome to extract transcripts’ sequences. Forward and reverse reads were independently mapped to the reference transcriptome using Bowtie v1.1.2, by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes (parameters: -n 2 -m 7 -a --best --strata -5 5 [--norc for forward reads, --nofw for reverse reads]). Forward and reverse mapped reads were then re-paired. Using reverse read mapping positions (corresponding to RNA Polymerase positions along gene), forward reads were split into separate SAM files for each transcription intermediate. When analysis was performed in deciles of transcription, genes were split into 10 equally sized deciles, and reads belonging to transcription intermediates falling in the same decile were pooled. SAM files were then passed to the rf-count tool of the RNA Framework to generate RT-stop counts (RC) files. Resulting RC files were normalized using the rf-norm tool of the RNA Framework in 50 nt sliding windows, with a 25 nt offset (parameters: -sm 2 -nm 2 -ec 0 -mc 0 -n 50 -nw 50 -wo 25). Mapping of DMS-seq data (mature RNA) was performed by using the rf-count tool (parameters: -cl 15 -bm 7 -ba -b5 5). Resulting RC files were normalized using the rf-norm tool (parameters: -sm 2 -nm 2 -ec 50 -mc 50 -n 50 -nw 50 -wo 25). The rf-norm tool generates a XML file for each transcript (or for each transcription intermediate
GSE95567	FastQ files were examined using the FastQC tool. All the relevant SPET-seq data (nascent RNA) analysis and normalization steps were performed using a custom wrapper built on top of the RNA Framework13. Briefly, reads were clipped from 3’ adapter sequences using Cutadapt v1.10, discarding reads shorter than 15 nucleotides. Forward and reverse reads were independently mapped to the RNase P (rnpB) gene using Bowtie v1.1.2, by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes (parameters: -n 2 -m 7 -a --best --strata -5 5 [--norc for forward reads, --nofw for reverse reads]). Forward and reverse mapped reads were then re-paired. Using reverse read mapping positions (corresponding to RNA Polymerase positions along gene), forward reads were split into separate SAM files for each transcription intermediate. SAM files were then passed to the rf-count tool of the RNA Framework to generate RT-stop counts (RC) files, that were then normalized using the rf-norm tool.
GSE95567	FastQ files were examined using the FastQC tool. Reads were clipped from 3’ adapter sequences using Cutadapt v1.10, discarding reads shorter than 15 nucleotides. Escherichia coli str. K-12 substr. MG1655 (GenBank: U00096.2) was used as the reference genome. Reads were mapped to the reference genome using Bowtie v1.1.2, by allowing up to 7 mapping positions to enable mapping to the 7 E. coli rRNA genes (parameters: -n 2 -m 7 -a --best --strata -5 5).
GSE95567	Genome_build: U00096.2
GSE95567	In vitro transcription reactions were performed in a final volume of 50 µl. Each reaction contained 2 µl E. coli RNA Polymerase Holoenzyme (NEB, cat. M0551S), 5 µl E. coli RNA Polymerase Buffer (10X), 1 µl SUPERase• In™ RNase Inhibitor (Ambion, cat. AM2696), and 500 ng template DNA. Reactions were incubated at 37°C for 5 minutes to allow formation of the RNA Polymerase-DNA binary complex. Transcription was started by addition of 1 µl NTPs (25 mM each), and incubated at 37°C for 5 minutes. Transcription was stopped by addition of 1 µl DNase I (50 U
GSE95567	library strategy: 3'-end RNA-seq
GSE95567	library strategy: DMS-seq
GSE95567	library strategy: SPET-seq
GSE95567	molecule subtype: In vitro synthesized RNase P (rnpB) RNA
GSE95567	molecule subtype: Total RNA (Cytosolic fraction)
GSE95567	molecule subtype: Total RNA (Nucleoid fraction)
GSE95567	OTHER
GSE95567	RNA-Seq
GSE95567	RNA was purified on RNA Clean & Concentrator™-5 columns following manufacturer’s instructions, and eluted in 6 μl of nuclease-free water. 6 μl of 2X RNA Loading Dye (ThermoScientific, cat. R0641) were added to purified RNA. Both DMS treated and untreated samples were heated at 95°C for 2 minutes, and immediately placed on ice. Samples were resolved on a 10% TBE-Urea polyacrylamide gel, and a gel slice ranging from 50 nt to the full-length product was cut. Gel slices were crushed by centrifugation through a punctured 0.5 ml tube, and resuspended in 500 μl of Diffusion buffer [500 mM Ammonium acetate; 0.05% SDS] supplemented with 60 U SUPERase• In™ RNase Inhibitor, then rotated at 4°C for 16 hours to allow passive diffusion of RNA fragments into buffer. RNA was precipitated by addition of 1 ml Isopropanol, and 2 μl Glycogen (20 μg
GSE95567	rnpB SPET-seq (in vitro)
GSE95567	SPET-seq (Ribo- RNA)
GSE95567	SPET-seq (Ribo- RNA), Replicate #1
GSE95567	SPET-seq (Ribo- RNA), Replicate #2
GSE95567	SPET-seq (Total RNA)
GSE95567	strain: K-12
GSE95567	substr: MG1655
GSE95567	Supplementary_files_format_and_content: DMS-seq data (pooled Total and Ribo- RNA) is provided in the form of RNA Framework's (http:
GSE95567	Supplementary_files_format_and_content: Mapped reads were rescaled to a size of 10 bp, and BEDGraph files were generated using the genomeCoverageBed utility of the BEDTools suite.
GSE95567	Supplementary_files_format_and_content: SPET-seq data is provided in the form of RNA Framework's (http:
GSE95567	Supplementary_files_format_and_content: SPET-seq data (pooled Total and Ribo- RNA from both replicates) is provided in the form of RNA Framework's (http:
GSE95575	10A_MG+PMA_t60
GSE95575	10B_MG+PMA_t60
GSE95575	10C_MG+PMA_t60
GSE95575	1A_MG_t0
GSE95575	1B_MG_t0
GSE95575	1C_MG_t0
GSE95575	2A_MG_t10
GSE95575	2B_MG_t10
GSE95575	2C_MG_t10
GSE95575	3A_MG_t30
GSE95575	3B_MG_t30
GSE95575	3C_MG_t30
GSE95575	4A_MG_t60
GSE95575	4B_MG_t60
GSE95575	4C_MG_t60
GSE95575	5A_MG+Hg_t10
GSE95575	5B_MG+Hg_t10
GSE95575	5C_MG+Hg_t10
GSE95575	6A_MG+Hg_t30
GSE95575	6B_MG+Hg_t30
GSE95575	6C_MG+Hg_t30
GSE95575	7A_MG+Hg_t60
GSE95575	7B_MG+Hg_t60
GSE95575	7C_MG+Hg_t60
GSE95575	8A_MG+PMA_t10
GSE95575	8B_MG+PMA_t10
GSE95575	8C_MG+PMA_t10
GSE95575	9A_MG+PMA_t30
GSE95575	9B_MG+PMA_t30
GSE95575	9C_MG+PMA_t30
GSE95575	E. coli
GSE95575	Escherichia coli str. K-12 substr. MG1655
GSE95575	For each biological RNA-Seq replicate E coli K-12 MG1655 was subcultured from cyrostorage on Luria-Bertani (LB) agar overnight at 37°C. A half-dozen well-isolated colonies were used to inoculate a 20 ml starter culture in Neidhardt MOPS Minimal Medium (NM3) (Neidhardt et al., 1974, J Bacteriol) (0.2% final glucose concentration) supplemented with 20 mg
GSE95575	Forward- and reverse-read mate-pairs were assembled and aligned to the Escherichia coli MG1655 K-12 genome using Bowtie2 (Langmead and Salzberg, 2012, Nat Methods). SAMtools (Li et al., 2009, Bioinformatics) was used to convert Bowtie2 output (.bam file) to SAM format.
GSE95575	Genome_build: ASM584v2 (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf )
GSE95575	Mapped read counts were analyzed for differential expression (false discovery rate of < 0.01, fold-change > 2) using the baySeq package in R (Hardcastle and Kelly, 2010, BMC Bioinformatics). Within baySeq, two-way comparisons using quantile normalization were made for all three biological replicate transcriptomes over time for HgCl2 exposure or PMA exposure versus the unexposed control.
GSE95575	One cell pellet from each condition and sampling time was thawed on ice; total RNA was isolated by RNAsnap™ (Stead et al., 2012, Nucleic Acids Res). DNA contamination was removed by two treatments with Turbo-DNase (Ambion; Life Technologies). Ribosomal RNA depletion was performed with the Ribo-Zero™ rRNA removal kit for Gram-negative bacteria (Epicentre) and concentrated using RNA Clean and Concentrator™ -5 columns (Zymo Research) following the manufacturer’s instructions.
GSE95575	Quality control processing of sequence data was performed using Galaxy (https:
GSE95575	RNA-Seq
GSE95575	Supplementary_files_format_and_content: raw read counts as determined by HTseq-Count, provided in .csv format
GSE95575	The number of sequence reads that aligned to features in annotation file (Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.24.gtf from http:
GSE95575	The quality and quantity of rRNA-depleted RNA was assessed on a 2100 Bioanalyzer RNA pico chip (Agilent Technologies) using manufacturer’s recommendations. Next generation sequencing (NGS) libraries were prepared using the Kapa biosystems NGS stranded library prep kit for RNA-Seq with dual indexed Illumina adapters. The mode library insert size was ~150 bp, as determined by high sensitivity NGS fragment analysis kit for Fragment Analyzer™ (Advanced Analytical Technologies) using manufacturer’s instructions. Quantification of each library was done by qPCR and all 30 libraries were pooled in equal concentrations.
GSE95575	treatment: MG1655 + 3µM HgCl2 at t10
GSE95575	treatment: MG1655 + 3µM HgCl2 at t30
GSE95575	treatment: MG1655 + 3µM HgCl2 at t60
GSE95575	treatment: MG1655 + 3µM PMA at t10
GSE95575	treatment: MG1655 + 3µM PMA at t30
GSE95575	treatment: MG1655 + 3µM PMA at t60
GSE95575	treatment: MG1655 - unexposed at t0
GSE95575	treatment: MG1655 - unexposed at t10
GSE95575	treatment: MG1655 - unexposed at t30
GSE95575	treatment: MG1655 - unexposed at t60
GSE95575	When cultures reached OD595 ≈ 0.470 (~ 200 min), two cultures were made 3 µM mercuric chloride (HgCl2) or 3 µM phenylmercuric-acetate (PMA) and the third was left as an unexposed control. Duplicate 1 ml aliquots of each culture were collected at 0 (unexposed control only), 10, 30, 60 min after mercurial exposure and immediately centrifuged at 21 krpm, for 3 min at 4°C. Spent medium was aspirated and cell pellets were frozen at -70°C within 5 min after collection.
GSE9	5min after UVtreatment 1, 40J, MG1655 in Davis+0.4%glu
GSE9	5min untreatedcells, 25 ug total RNA
GSE9	60min after UVtreatment 1, 40J, MG1655 in Davis+0.4%glu
GSE9	60min untreatedcells, 25 ug total RNA
GSE9	60min UV treated cells, 25 ug total RNA
GSE9	60min UVtreatment control, MG1655 in Davis+0.4%glu
GSE96551	Bacteria cells
GSE96551	Basecalls performed using CASAVA version 1.8.2
GSE96551	Escherichia coli
GSE96551	Genome_build: CP009273.1
GSE96551	MT_12h_rep1
GSE96551	MT_12h_rep2
GSE96551	MT_24h_rep1
GSE96551	MT_24h_rep2
GSE96551	MT_48h_rep1
GSE96551	MT_48h_rep2
GSE96551	MT_6h_rep1
GSE96551	MT_6h_rep2
GSE96551	product: Butanol
GSE96551	Quantification of gene expression and analysis of gene differential expression were performed using Fragment Per Kilo bases per Million reads (FPKM) value based rsem software version 1.2.4 and edgeR version 3.4.2 (Bioconductor), respectively
GSE96551	RNA libraries were prepared for sequencing using standard Illumina protocols.
GSE96551	RNA-Seq
GSE96551	Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to CP009273.1 whole genome using bowtie2
GSE96551	strain: BW25113
GSE96551	Supplementary_files_format_and_content: Excel file include FPKM values of different genes for each sample
GSE96551	Total RNAs were isolated using TRIzol reagent, followed by clean-up and DNase I treatment with QIAGEN RNeasy mini kit. Illumina TruSeq RNA Sample Prep Kit (Cat#FC-122-1001) was used for the construction of sequencing libraries.
GSE96551	WT_12h_rep1
GSE96551	WT_12h_rep2
GSE96551	WT_24h_rep1
GSE96551	WT_24h_rep2
GSE96551	WT_48h_rep1
GSE96551	WT_48h_rep2
GSE96551	WT_6h_rep1
GSE96551	WT_6h_rep2
GSE96573	cell culture
GSE96573	Escherichia coli
GSE96573	evolved 1min rep6
GSE96573	evolved 1min rep8
GSE96573	evolved 5min rep6
GSE96573	evolved 5min rep8
GSE96573	evolved 9min rep6
GSE96573	evolved 9min rep7
GSE96573	Fragmentation and reverse transcription of RNA with random primers was carried out using the NEB First Strand Synthesis Module (New England Biolabs). Second strand synthesis was done with the NEBNext Ultra Directional RNA Second Strand Synthesis Module (New England Biolabs), then purified with 1.7x AMPURE Bead XP (Beckman Coulter). DNA end repair was carried out with the NEBNext end repair module, dA-tailing used the NEBNext dA-Tailing Module and adapter ligation used the NEBNext Quick Ligation module (New England Biolabs). PCR amplification was carried out for 10 rounds of synthesis using the NEBNext High-Fidelity PCR Master Mix with NEBNext USER Enzyme (New England Biolabs), samples were purified with 1.0x AMPURE Bead XP (Beckman Coulter). Library quality was verified on a Bio-Analyzer DNA chip (Agilent).
GSE96573	Genome_build: U00096.3 (E. coli K12) and NC_001604.1 (T7), excluding ribosomal genes, and with recoded gene 10 sequence (Bull, 2012, PMCID: PMC3457771) in place of wild-type sequence for analysis of recoded and evolved strains
GSE96573	infection: T7
GSE96573	pseudoalignment and quantitation with kallisto v0.42.5 with parameters --single -l 450 -s 250
GSE96573	RNA-Seq
GSE96573	RNA was isolated using Trizol reagent (Thermo Fisher Scientific)
GSE96573	Supplementary_files_format_and_content: tab-delimitted text files contain TPM (transcripts per million) values for each sample
GSE96573	t7 genotype: evolved, codon-deoptimized gene 10
GSE96573	t7 genotype: wild-type gene 10
GSE96573	t7 strain: evolved
GSE96573	t7 strain: wild type
GSE96573	time: 1 min post-infection
GSE96573	time: 5 min post-infection
GSE96573	time: 9 min post-infection
GSE96573	WT 1min rep7
GSE96573	WT 9min rep7
GSE96573	WT 9min rep8
GSE9671	3XSCOTS cDNA 24 h post-infection
GSE9671	3XSCOTS cDNA in RPMI medium
GSE9671	3XSCOTS cDNA obtained 24 h post-infection
GSE9671	3XSCOTS cDNA obtained 2h post-infection
GSE9671	3XSCOTS cDNA obtained 8h post-infection
GSE9671	3XSCOTS cDNA obtained 8h post-infection 
GSE9671	3XSCOTS cDNA obtained after 8h post-infection
GSE9671	3XSCOTS cDNA obtained in RPMI 
GSE9671	3XSCOTS cDNA obtained in RPMI medium
GSE9671	After backgroud correction and total intensity normalization, ratio to reference were calculated and log base 2 transformed
GSE9671	EDL933 24 h post infection in THP-1 humans cells
GSE9671	EDL933 8h post-infection in THP-1 human cells
GSE9671	EDL933 8h post THP-1 infection
GSE9671	EDL933 cDNA 24 h post-infcetion of THP-1 human cells
GSE9671	EDL933 cDNA obtained 24 h post- infection of THP-1 human cells
GSE9671	EDL933 cDNA obtained 24h post-infection of THP-1 human cells
GSE9671	EDL933 from overnight culture in LB broth
GSE9671	EDL933 genomic DNA
GSE9671	EDL933 genomic DNA 
GSE9671	EDL933 genommic DNA
GSE9671	EDL933 infection of THP-1 cells, recovered 2 h post-infection
GSE9671	EDL933 infection of THP-1 cells, recovered 2h post-infection
GSE9671	EDL933 in humans macrophages 8h post-infection
GSE9671	EDL933 in RPMI medium
GSE9671	EDL933 in THP-1 cells 8h post-infection
GSE9671	Escherichia coli
GSE9671	Genomic DNA E. coli EDL933
GSE9671	Genomic DNA from EDL933
GSE9671	Genomic DNA of EDL933
GSE9671	Genomic DNA was extracted by standard phenol-chloroform method (Sambrook, J, Molecular Cloning, 3rd Edition)
GSE9671	Reference DNA genomic DNA
GSE9671	Reference genomic DNA
GSE9671	REference genomic DNA
GSE9671	RPMI 1A, Microarray #1 first duplicate
GSE9671	RPMI 1B, Microarray #1 second replicate
GSE9671	RPMI 2A, Microarray #2, first replicate
GSE9671	RPMI 2B, Microarray #2 second replicate
GSE9671	T24 THP-1 infection, Microarray #1 first replicate
GSE9671	T24 THP-1 infection, Microarray #1 second replicate
GSE9671	T24 THP-1 infection, Microarray #2 first replicate
GSE9671	T24 THP-1 infection, Microarray #2 second replicate
GSE9671	T2 THP-1 infection, Microarray #1 first replicate
GSE9671	T2 THP-1 infection, Microarray #1 second replicate
GSE9671	T2 THP-1 infection, Microarray #2 first replicate
GSE9671	T2 THP-1 infection, Microarray #2 second replicate
GSE9671	T8 THP-1 infection, Microarray #1 first replicate
GSE9671	T8 THP-1 infection, Microarray #1 second replicate
GSE9671	T8 THP-1 infection, Microarray #2 first replicate
GSE9671	T8 THP-1 infection, Microarray #2 second replicate
GSE9671	TRIzol reagent (Gibco BRL) was used according to the manufacturer instruction. RNA was treated with DNase (Ambion). RNA sample was converted to cDNA in 5 independent reverse-transcription reactions as described previously (Graham, J. 1999. PNAS 96:11554-559). Bacterial transcript were purified from host transcript by using 3 round of the SCOTS procedure (Daigle, F. 2002. Methods Enzymol. 358:108-122).
GSE96955	Data were analyzed with RMA (Robust Multiarray Analysis) using Affymetrix default analysis settings and global scaling as normalization method.
GSE96955	E. coli CRP N strain_acetate_exponential phase_repl1
GSE96955	E. coli CRP N strain_acetate_exponential phase_repl2
GSE96955	E. coli CRP N strain_acetate_stationary phase_repl1
GSE96955	E. coli CRP N strain_acetate_stationary phase_repl2
GSE96955	E. coli CRP N strain_glucose_exponential phase_repl1
GSE96955	E. coli CRP N strain_glucose_exponential phase_repl2
GSE96955	E. coli CRP N strain_glucose_stationary phase_repl1
GSE96955	E. coli CRP N strain_glucose_stationary phase_repl2
GSE96955	E. coli CRP N strain grown in acetate batch minimal media, cells were harvested at exponential phase, biological rep1
GSE96955	E. coli CRP N strain grown in acetate batch minimal media, cells were harvested at exponential phase, biological rep2
GSE96955	E. coli CRP N strain grown in acetate batch minimal media, cells were harvested at stationary phase, biological rep1
GSE96955	E. coli CRP N strain grown in acetate batch minimal media, cells were harvested at stationary phase, biological rep2
GSE96955	E. coli CRP N strain grown in glucose batch minimal media, cells were harvested at exponential phase, biological rep1
GSE96955	E. coli CRP N strain grown in glucose batch minimal media, cells were harvested at exponential phase, biological rep2
GSE96955	E. coli CRP N strain grown in glucose batch minimal media, cells were harvested at stationary phase, biological rep1
GSE96955	E. coli CRP N strain grown in glucose batch minimal media, cells were harvested at stationary phase, biological rep2
GSE96955	E. coli CRP Q strain_acetate_exponential phase_repl1
GSE96955	E. coli CRP Q strain_acetate_exponential phase_repl2
GSE96955	E. coli CRP Q strain_acetate_stationary phase_repl1
GSE96955	E. coli CRP Q strain_acetate_stationary phase_repl2
GSE96955	E. coli CRP Q strain_glucose_exponential phase_repl1
GSE96955	E. coli CRP Q strain_glucose_exponential phase_repl2
GSE96955	E. coli CRP Q strain_glucose_stationary phase_repl1
GSE96955	E. coli CRP Q strain_glucose_stationary phase_repl2
GSE96955	E. coli CRP Q strain grown in acetate batch minimal media, cells were harvested at exponential phase, biological rep1
GSE96955	E. coli CRP Q strain grown in acetate batch minimal media, cells were harvested at exponential phase, biological rep2
GSE96955	E. coli CRP Q strain grown in acetate batch minimal media, cells were harvested at stationary phase, biological rep1
GSE96955	E. coli CRP Q strain grown in acetate batch minimal media, cells were harvested at stationary phase, biological rep2
GSE96955	E. coli CRP Q strain grown in glucose batch minimal media, cells were harvested at exponential phase, biological rep1
GSE96955	E. coli CRP Q strain grown in glucose batch minimal media, cells were harvested at exponential phase, biological rep2
GSE96955	E. coli CRP Q strain grown in glucose batch minimal media, cells were harvested at stationary phase, biological rep1
GSE96955	E. coli CRP Q strain grown in glucose batch minimal media, cells were harvested at stationary phase, biological rep2
GSE96955	E. coli CRP R strain_acetate_exponential phase_repl1
GSE96955	E. coli CRP R strain_acetate_exponential phase_repl2
GSE96955	E. coli CRP R strain_acetate_stationary phase_repl1
GSE96955	E. coli CRP R strain_acetate_stationary phase_repl2
GSE96955	E. coli CRP R strain_glucose_exponential phase_repl1
GSE96955	E. coli CRP R strain_glucose_exponential phase_repl2
GSE96955	E. coli CRP R strain_glucose_stationary phase_repl1
GSE96955	E. coli CRP R strain_glucose_stationary phase_repl2
GSE96955	E. coli CRP R strain grown in acetate batch minimal media, cells were harvested at exponential phase, biological rep1
GSE96955	E. coli CRP R strain grown in acetate batch minimal media, cells were harvested at exponential phase, biological rep2
GSE96955	E. coli CRP R strain grown in acetate batch minimal media, cells were harvested at stationary phase, biological rep1
GSE96955	E. coli CRP R strain grown in acetate batch minimal media, cells were harvested at stationary phase, biological rep2
GSE96955	E. coli CRP R strain grown in glucose batch minimal media, cells were harvested at exponential phase, biological rep1
GSE96955	E. coli CRP R strain grown in glucose batch minimal media, cells were harvested at exponential phase, biological rep2
GSE96955	E. coli CRP R strain grown in glucose batch minimal media, cells were harvested at stationary phase, biological rep1
GSE96955	E. coli CRP R strain grown in glucose batch minimal media, cells were harvested at stationary phase, biological rep2
GSE96955	E. coli Wild type_acetate_exponential phase_repl1
GSE96955	E. coli Wild type_acetate_exponential phase_repl2
GSE96955	E. coli Wild type_acetate_stationary phase_repl1
GSE96955	E. coli Wild type_acetate_stationary phase_repl2
GSE96955	E. coli Wild type and its mutants were grown in M9 minimal medium with 10mM glucose or 30mM acetate as sole carbon source. Samples for RNA extraction were taken in middle exponential phase (OD600≈0.5) and in stationary phase (OD600≈1.5)
GSE96955	E. coli Wild type_glucose_exponential phase_repl1
GSE96955	E. coli Wild type_glucose_exponential phase_repl2
GSE96955	E. coli Wild type_glucose_stationary phase_repl1
GSE96955	E. coli Wild type_glucose_stationary phase_repl2
GSE96955	E. coli wt grown in acetate batch minimal media, cells were harvested at exponential phase, biological rep1
GSE96955	E. coli wt grown in acetate batch minimal media, cells were harvested at exponential phase, biological rep2
GSE96955	E. coli wt grown in acetate batch minimal media, cells were harvested at stationary phase, biological rep1
GSE96955	E. coli wt grown in acetate batch minimal media, cells were harvested at stationary phase, biological rep2
GSE96955	E. coli wt grown in glucose batch minimal media, cells were harvested at exponential phase, biological rep1
GSE96955	E. coli wt grown in glucose batch minimal media, cells were harvested at exponential phase, biological rep2
GSE96955	E. coli wt grown in glucose batch minimal media, cells were harvested at stationary phase, biological rep1
GSE96955	E. coli wt grown in glucose batch minimal media, cells were harvested at stationary phase, biological rep2
GSE96955	Escherichia coli K-12
GSE96955	genotyp
GSE96955	Total RNA extraction using Vantage™ RNA Purification Kit (Origene, Rockville, MD, USA) was performed according with the manufacter instructions.  Purity and concentration of isolated RNA were assessed in a NanoDrop One spectrophotometer (Thermo Scientific Incorporated, WI, USA). Quality was evaluated by microfluidic capillary electrophoresis on an Agilent 2100 Bioanalyzer (Agilent Technologies, Inc, USA).
GSE97406	Adpater sequences were clipped with CutAdapt
GSE97406	AR1-
GSE97406	Base calls were made using MiSeq Reporter v. 2.6.2.1
GSE97406	Cell pellets were lysed in Tissue and Cell lysis solution (EpiCentre) and proteinase K. RNA was isolated and DNase treated using the RNeasy Kit (Qiagen) using the manufacturer’s protocol. The amount of total RNA in each sample was quantified using the Qubit 2.0 Flurometer (Life Technologies) and quality was assessed using the RNA6000 Nano Chip on the Bioanalyzer 2100 (Agilent).
GSE97406	Cells were grown in TB7 supplemented with 22 mM glucose until OD600 ~1.8.
GSE97406	Differential expression testing between sample groups was performed in Rstudio (v. 1.0.36) using DESeq2 (v.1.14.1)
GSE97406	Escherichia coli
GSE97406	Genome_build: Escherichia coli str. K-12 substr. MG1655
GSE97406	genotype
GSE97406	growth phase: Late exponential
GSE97406	K100Q
GSE97406	K100Q rep 1
GSE97406	K100Q rep 2
GSE97406	K100Q rep 3
GSE97406	K100R
GSE97406	K100R rep 1
GSE97406	K100R rep 2
GSE97406	K100R rep 3
GSE97406	Low quality reads were trimmed with CutAdapt
GSE97406	Mapped reads were counted using the Python package HTSeq (v. 0.6.1) using the following parameters; htseq-count -m union -r pos -i gene_name -a 10
GSE97406	media: Tryptone broth buffered to pH 7 supplemented with 22 mM glucose
GSE97406	RNA-Seq
GSE97406	rRNA depletion, fragmentation, reverse transcription, tagging, barcoding, limited cycle PCR (Illumina)
GSE97406	ScriptSeq v2 Complete Kit (EpiCentre)
GSE97406	strain: K-12
GSE97406	Supplementary_files_format_and_content: Comma separated value files include log-fold changes and associated p-values for each comparison made
GSE97406	Supplementary_files_format_and_content: text files containing gene counts output by htseq-count
GSE97406	The resulting reads were mapped to the reference genome of Escherichia coli str. K-12 substr. MG1655 using Tophat2 using the following parameters, --GTF --library type fr-secondstrand
GSE97406	WT rep 1
GSE97406	WT rep 2
GSE97406	WT rep 3
GSE9755	Affymetrix Microarray Suite 5.0
GSE9755	Dilution rate = 0.14
GSE9755	E.coli_0%tannin_#2
GSE9755	E.coli_0%tannin_#8
GSE9755	E.coli_1%tannin_#3
GSE9755	e.coli_1%tannin_#5
GSE9755	Escherichia coli
GSE9755	Escherichia coli BW13711 grown anaerobically in continuous culture in MOPS medium plus 0.4% glucose with 1% Acacia mearnsii condensed tannins. 
GSE9755	Escherichia coli BW13711 grown anaerobically in continuous culture in MOPS medium plus 0.4% glucose without Acacia mearnsii condensed tannins. 
GSE9755	Escherichia coli BW13711 grown anaerobically in continuous culture in MOPS medium plus 0.4% glucose without Acacia mearnsii condensed tannins.  
GSE9755	Escherichia coli continous culture without tannins
GSE9755	Escherichia coli continuous culture with 1% tannins
GSE9755	Escherichia coli with 1% tannins
GSE9755	Incubation temperature = 37C
GSE9755	pH = 5.3
GSE9755	pH = 5.7
GSE9755	Promega RNase-free DNase
GSE9755	Qiagen Rneasy mini kit
GSE98660	50 bp single-end reads, were mapped to the genome with using bowtie2(Langmead and Salzberg, 2012) using default parameters. Alignments with bowtie2 mapping quality values lower than 40 were not retained for further analysis, leaving 128,413,654 and 76,508,335 reads.
GSE98660	E. coli 3' RACE Rep1
GSE98660	E. coli 3' RACE Rep2
GSE98660	Escherichia coli
GSE98660	Genome_build: NC_000913.3
GSE98660	In order to distinguish between 3’ ends of transient products of RNA metabolism and stable 3’ ends, we developed an algorithm to call coverage peaks. The algorithm will be discussed in detail in an upcoming manuscript, and the scripts used are available upon request from the authors. In short, positions in the E. coli genome were considered in descending order of coverage and assigned a p-value based on a Poisson distribution parameterized by the mean coverage of all covered bases in the genome. Peaks were rejected if their p-values exceeded 1e-4 or if there existed a >10-bp window containing the peak in which all positions were within 2-fold coverage of the peak position. Parameters were chosen based on analysis of annotated 3’ ends as well as qualitative analysis of peaks. This resulted in 20,019 peaks.
GSE98660	RNA-Seq
GSE98660	strain: K12 MG1655
GSE98660	Supplementary_files_format_and_content: BIGWIG file containing coverage tracks from 3' RACE data
GSE98660	Supplementary_files_format_and_content: GFF file containing 3' end annotations
GSE98660	total DNaseI treated RNA was depleted of ribosomal RNA using the Ribo-Zero™ RNA removal kit for Gram-negative bacteria (Epicentre). A 3' RNA adapter, based on the Illumina multiplexing adapter sequence (Oligonucleotide sequences © 2007-2014 Illumina, Inc. All rights reserved) blocked at the 3' end with an inverted dT (5'-GAUCGGAAGAGCACACGUCU[idT]-3'), was phosphorylated at the 5' end using T4 PNK (New England Biolabs) per the manufacturer’s protocol. The 3' RNA adapter was ligated to the 3' ends of the rRNA depleted RNA using T4 RNA ligase I (New England Biolabs). 1.5 mg of RNA was incubated at 20°C for 6 hours in 1X T4 RNA ligase reaction buffer with 1 mM ATP, 30 µM 3' RNA adapter, 10 % DMSO, 10 U of T4 RNA ligase I, and 40 U of RNasin (Promega) in a 20 ml reaction. RNA was then fragmented in equivalents of 100 ng using the RNA fragmentation reagents (Ambion®) per the manufacturer’s protocol at 70°C for 3 min and subsequently phosphorylated at the 5' ends using T4 PNK (New England Biolabs) per the manufacturer’s protocol to allow for ligation of the 5' adapter. RNA was size-selected (≈ 150-300 nt) and purified over a denaturing 8 % polyacrylamide
GSE98660	Total RNA was isolated using the hot phenol method as described in (Lybecker et al., 2014).
GSE98890	0x58 replicate 2 state 1 (IPTG-
GSE98890	0x58 replicate 2 state 2 (IPTG+
GSE98890	0x58 replicate 2 state 3 (IPTG-
GSE98890	0x58 replicate 2 state 4 (IPTG+
GSE98890	0x58 replicate 2 state 5 (IPTG-
GSE98890	0x58 replicate 2 state 6 (IPTG+
GSE98890	0x58 replicate 2 state 7 (IPTG-
GSE98890	0x58 replicate 2 state 8 (IPTG+
GSE98890	0x58 replicate 3 state 1 (IPTG-
GSE98890	0x58 replicate 3 state 2 (IPTG+
GSE98890	0x58 replicate 3 state 3 (IPTG-
GSE98890	0x58 replicate 3 state 4 (IPTG+
GSE98890	0x58 replicate 3 state 5 (IPTG-
GSE98890	0x58 replicate 3 state 6 (IPTG+
GSE98890	0x58 replicate 3 state 7 (IPTG-
GSE98890	0x58 replicate 3 state 8 (IPTG+
GSE98890	Control pAN1201 replicate 1 (IPTG-
GSE98890	Control pAN1201 replicate 2 (IPTG-
GSE98890	Culture grown in 14 ml tube
GSE98890	Cultures were spun down at 4 °C, 15,000 × g for 3 minutes. Supernatants were discarded after centrifugation and cell pellets were flash frozen in liquid nitrogen for storage at -80 °C. Cells were lysed with 1 mg of lysozme (Sigma Aldrich L6871) in 10 mM Tris-HCl (pH 8.0) (USB 75825) supplemented with 0.1 mM EDTA (USB 15694). RNA was extracted with PureLink RNA Mini Kit (Life Technologies) and further purified and concentrated with RNA Clean & Concentrator-5 (Zymo Research) to assure sample quality. The purified RNA samples were analyzed using a Bioanalyzer (Agilent) and Ribo-Zero rRNA Removal Kit for bacteria (Illumina) was used to deplete rRNA from the samples.
GSE98890	Escherichia coli
GSE98890	Genome_build: NC_010473.1
GSE98890	Individual colonies were inoculated into MOPS EZ Rich Defined Medium (Teknova, CA, M2105) with 0.2% glycerol carbon source and 50 μg
GSE98890	Normalized FPKM values were generated from the raw gene counts by custom scripts that calculated and applied a trimmed mean of M-values (TMM) factor using edgeR version 3.8.6.
GSE98890	Read counts for each host and circuit gene was carried out using the htseq-count command of the HTSeq toolkit with user-defined GFF annotations of the reference sequences and the options '-s reverse -a 10 -m union'.
GSE98890	Reads mapped to reference using BWA versiopn 0.7.4 with default settings
GSE98890	RNA-Seq
GSE98890	strain: NEB 10-beta
GSE98890	Strand specific RNAtag-seq libraries were created by the Broad Technology Labs specialized service facility (SSF) using the standard protocol described in Shishkin et al. Nature Methods 2016.
GSE98890	Supplementary_files_format_and_content: CSV files of raw read counts and normalized gene expression in FPKM units.
GSE9923	BW25113 luxS LB 30C free-living cells 100 uM AI2 3h
GSE9923	BW25113 luxS LB 30C free-living cells no AI2 for 3h
GSE9923	BW25113 luxS LB 37C free-living cells 100 uM AI2 3h
GSE9923	BW25113 luxS LB 37C free-living cells no AI2 3h
GSE9923	BW25113 sdiA LB 30C OD 4.0 free-living cells
GSE9923	BW25113 sdiA mutant LB with 1 mM indole 7-h 30C biofilm cell
GSE9923	BW25113 sdiA mutant LB with DMF 7-h 30C biofilm cell
GSE9923	BW25113 tnaA Biofilm 100 uM indole 7h LB 30C
GSE9923	BW25113 tnaA Biofilm 100 uM indole 7h LB 37C
GSE9923	BW25113 tnaA Biofilm DMF 7h LB 37C
GSE9923	BW25113 tnaA LB 30C biofilm cells with DMF 7h
GSE9923	BW25113 w
GSE9923	Channel 1
GSE9923	Escherichia coli
GSE9923	MAS 5.0 Expression Analysis Default Setting
GSE9923	MAS 5.0 Expression Analysis Default Setting.
GSE9923	RNA extracted from biofilm cells of E. coli K-12 BW25113 tnaA mutant after 7 hours of growth in LB with glasswool and 100 uM indole at 37ºC
GSE9923	RNA extracted from biofilm cells of E. coli K-12 BW25113 tnaA mutant after 7 hours of growth in LB with glasswool and DMF at 30ºC
GSE9923	RNA extracted from biofilm cells of E. coli K-12 BW25113 tnaA mutant after 7 hours of growth in LB with glasswool and DMF at 37ºC
GSE9923	RNA extracted from biofilm cells of E. coli K-12 BW25113 tnaA mutant after 7 hours of growth in LB with glasswool and with 100 uM indole at 30ºC
GSE9923	RNA extracted from biofilm cells of E. coli K-12 BW25113 w
GSE9923	RNA extracted from biofilm cells of E. coli K-12 sdiA mutant after 7 hours of growth in LB with glasswool at 30ºC with 1 mM indole presence.
GSE9923	RNA extracted from biofilm cells of E. coli K-12 sdiA mutant after 7 hours of growth in LB with glasswool at 30ºC with DMF presence.
GSE9923	RNA extracted from free living cells of E. coli K-12 BW25113 luxS mutant (when growth to OD600 0.5 at 30ºC in LB, 100 uM AI2 was added in and 3-h further incubation was applied)
GSE9923	RNA extracted from free living cells of E. coli K-12 BW25113 luxS mutant (when growth to OD600 0.5 at 30ºC in LB, no AI2 was added in and 3-h further incubation was applied)
GSE9923	RNA extracted from free living cells of E. coli K-12 BW25113 luxS mutant (when growth to OD600 0.5 at 37ºC in LB, 100 uM AI2 was added in and 3-h further incubation was applied)
GSE9923	RNA extracted from free living cells of E. coli K-12 BW25113 luxS mutant (when growth to OD600 0.5 at 37ºC in LB, no AI2 was added in and 3-h further incubation was applied)
GSE9923	RNA extracted from free living cells of E. coli K-12 BW25113 sdiA mutant when growth to OD600 4.0 at 30ºC in LB
GSE9923	RNA extracted from free living cells of E. coli K-12 BW25113 wild type when growth to OD600 4.0 at 30ºC in LB
GSE9923	RNA extracted from suspension cells of E. coli K-12 BW25113 w
GSE9923	The overnight culture (0.25 ml) was used to inoculate 25 ml of fresh LB medium. After incubation at 30°C with shaking (250 rpm) to OD600 0.5, 100 uM AI-2 was added in. after further 3-h incubation, 2.0 ml of cell culture was removed and cells were pelleted and frozen in -80C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
GSE9923	The overnight culture (0.25 ml) was used to inoculate 25 ml of fresh LB medium. After incubation at 30°C with shaking (250 rpm) to OD600 0.5, no AI-2 was added in. after further 3-h incubation, 2.0 ml of cell culture was removed and cells were pelleted and frozen in -80C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
GSE9923	The overnight culture (0.25 ml) was used to inoculate 25 ml of fresh LB medium. After incubation at 30°C with shaking (250 rpm) to OD600 4.0, 2.0 ml of cell culture was removed and cells were pelleted and frozen in -80C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
GSE9923	The overnight culture (0.25 ml) was used to inoculate 25 ml of fresh LB medium. After incubation at 37°C with shaking (250 rpm) to OD600 0.5, 100 uM AI-2 was added in. after further 3-h incubation, 2.0 ml of cell culture was removed and cells were pelleted and frozen in -80C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
GSE9923	The overnight culture (0.25 ml) was used to inoculate 25 ml of fresh LB medium. After incubation at 37°C with shaking (250 rpm) to OD600 0.5, no AI-2 was added in. after further 3-h incubation, 2.0 ml of cell culture was removed and cells were pelleted and frozen in -80C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
GSE9923	The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium. After incubation at 30°C with shaking (250 rpm) for 7 hours, 2.0 ml of cell culture was removed from suspension part and cells were pelleted and frozen in -80C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
GSE9923	The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) and 1 mM indole for forming biofilm. After incubation for 7 h at 30°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104).
GSE9923	The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) and DMF for forming biofilm. After incubation for 7 h at 30°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
GSE9923	The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) and DMF for forming biofilm. After incubation for 7 h at 30°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104).
GSE9923	The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) and DMF for forming biofilm. After incubation for 7 h at 37°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
GSE9923	The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) and with 100 uM indole for forming biofilm. After incubation for 7 h at 30°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
GSE9923	The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) and with 100 uM indole for forming biofilm. After incubation for 7 h at 37°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
GSE9923	The overnight culture (2.5 ml) was used to inoculate 250 ml of fresh LB medium with 10 g of submerged glass wool (Corning Glass Works, Corning, NY) for forming biofilm. After incubation for 7 h at 30°C with shaking (250 rpm), the glass wool was carefully and quickly removed and rinsed with 100 ml of sterile 0.85% NaCl solution at 0°C. Biofilm cells were removed by sonicating the glass wool in 200 ml of sterile 0.85% NaCl solution at 0°C. After breaking the cells with a bead beater, and the total RNA was isolated with Qiagen RNeasy mini Kit (Cat# 74104)
GSE99661	10_ESBL019 Filamented Repl 3
GSE99661	11_ESBL019 Transition Repl 3
GSE99661	12_ESBL019  Reverted Repl 3
GSE99661	13_ESBL019 Coliform Repl 4
GSE99661	14_ESBL019 Filamented Repl 4
GSE99661	15_ESBL019 Transition Repl 4
GSE99661	16_ESBL019  Reverted Repl 4
GSE99661	1_ESBL019 Coliform Repl 1
GSE99661	2_ESBL019 Filamented Repl 1
GSE99661	3_ESBL019 Transition Repl 1
GSE99661	4_ESBL019  Reverted Repl 1
GSE99661	5_ESBL019 Coliform Repl 2
GSE99661	6_ESBL019 Filamented Repl 2
GSE99661	75th percentile shift normalisation and baseline adjusted
GSE99661	7_ESBL019 Transition Repl 2
GSE99661	8_ESBL019  Reverted Repl 2
GSE99661	9_ESBL019 Coliform Repl 3
GSE99661	ESBL019 Coliform
GSE99661	ESBL019 Filamented
GSE99661	ESBL019  Reverted
GSE99661	ESBL019 Transition
GSE99661	Escherichia coli
GSE99661	Four morphologic states of ESBL019 were used during the experiments. A first ESBL019 morphological state was prepared by resuspension of ESBL019 in cell culture medium (CCM) without ceftibuten supplementation prior to its inoculation of primary human bladder epithelial cells (HBEP) (designated; ESBL019 Coliform). A second ESBL019 morphological state was prepared by resuspension in CCM and then used to inoculate HBEP cells with ceftibuten supplementation (480ng
GSE99661	morphology: Coliform
GSE99661	morphology: Filamented
GSE99661	morphology: Reverted (reverted back from a Filamented shape into a coli shape)
GSE99661	morphology: Transition (from Coli into Filamented)
GSE99661	RNA isolation was performed using an RNeasy mini kit (Qiagen Technologies, Hilden, Germany), according to the manufacturer’s protocol. DNA decontamination treatment was performed using Turbo DNase (Qiagen) and the quantity and purity of the purified RNA samples were determined using a spectrophotometer Nanodrop-1000 (Nanodrop Technologies Inc., Wilmington, DE, USA) by measuring the absorbance (A260, 230, 280) and calculating absorbance ratios (A260
GSE99661	strain: beta-lactamase (ESBL)-producing UPEC (ESBL019)
GSE99661	The E. coli isolate ESBL019 was originally isolated from a patient at Örebro University hospital, Sweden and was maintained on tryptic soy agar (TSA) (Becton Dickinson, Le Pont Claix, France). ESBL019 was grown in Luria broth (Difco Laboratories, Detroit, MI, USA) overnight on shake at 200 rpm 37 °C prior to experiments. The bacteria were resuspended in sterile phosphate buffered saline prior to inoculation of CnT-21 cell culture medium (CCM) with or without ceftibuten (480 ng
GSE9	Escherichia coli
GSE9	lexA 10' after UV vs. 0', MG1655
GSE9	lexA 10 min after UV treatment, 25 ug total RNA, 2 ug pdN6
GSE9	lexA 20' after NOuv vs. 0', MG1655
GSE9	lexA 20' after UV vs. 0', MG1655
GSE9	lexA 20 min after NOuv, 25 ug total RNA, 2 ug pdN6
GSE9	lexA 20 min after UV treatment, 25 ug total RNA, 2 ug pdN6
GSE9	lexA 40' after UV vs. 0', MG1655
GSE9	lexA 40 min after UV treatment, 25 ug total RNA, 2 ug pdN6
GSE9	lexA 5' after UV vs. 0', MG1655
GSE9	lexA 5 min after UV treatment, 25 ug total RNA, 2 ug pdN6
GSE9	lexA 60' after NOuv vs. 0', MG1655
GSE9	lexA 60' after UV vs. 0', MG1655
GSE9	lexA 60 min after NOuv, 25 ug total RNA, 2 ug pdN6
GSE9	lexA 60 min after UV treatment, 25 ug total RNA, 2 ug pdN6
GSE9	lexA vs. wt, before UV treatment, MG1655
GSE9	untreated cells, 25 ug total RNA