29468196	 The RNA polymerase (RNAP) of Escherichia coli K-12 is a complex enzyme consisting of the core enzyme with the subunit structure α2ββ'ω and one of the σ subunits with promoter recognition properties. The smallest subunit, omega (the rpoZ gene  product), participates in subunit assembly by supporting the folding of the largest subunit, β', but its functional role remains unsolved except for its involvement in ppGpp binding and stringent response. As an initial approach for elucidation of its functional role, we performed in this study ChIP-chip (chromatin immunoprecipitation with microarray technology) analysis of wild-type  and rpoZ-defective mutant strains. The altered distribution of RpoZ-defective RNAP was identified mostly within open reading frames, in particular, of the genes inside prophages. For the genes that exhibited increased or decreased distribution of RpoZ-defective RNAP, the level of transcripts increased or decreased, respectively, as detected by reverse transcription-quantitative PCR (qRT-PCR). In parallel, we analyzed, using genomic SELEX (systemic evolution of ligands by exponential enrichment), the distribution of constitutive promoters that are recognized by RNAP RpoD holoenzyme alone and of general silencer H-NS within prophages. Since all 10 prophages in E. coli K-12 carry only a small number of promoters, the altered occupancy of RpoZ-defective RNAP and of transcripts might represent transcription initiated from as-yet-unidentified host promoters. The genes that exhibited transcription enhanced by RpoZ-defective RNAP are located in the regions of low-level H-NS binding. By using phenotype microarray (PM) assay, alterations of some phenotypes were detected for the rpoZ-deleted mutant, indicating the involvement of RpoZ in regulation of some genes. Possible mechanisms of altered distribution of RNAP inside prophages are discussed. IMPORTANCE The 91-amino-acid-residue small-subunit omega (the rpoZ gene product) of Escherichia coli RNA polymerase plays a structural role in the formation of RNA polymerase (RNAP) as a chaperone in folding the largest subunit  (β', of 1,407 residues in length), but except for binding of the stringent signal ppGpp, little is known of its role in the control of RNAP function. After analysis of genomewide distribution of wild-type and RpoZ-defective RNAP by the ChIP-chip method, we found alteration of the RpoZ-defective RNAP inside open reading frames, in particular, of the genes within prophages. For a set of the genes that exhibited altered occupancy of the RpoZ-defective RNAP, transcription  was found to be altered as observed by qRT-PCR assay. All the observations here described indicate the involvement of RpoZ in recognition of some of the prophage genes. This study advances understanding of not only the regulatory role of omega subunit in the functions of RNAP but also the regulatory interplay between prophages and the host E. coli for adjustment of cellular physiology to a variety of environments in nature. 
29448635	 In this paper, whole-bacteria SELEX (WB-SELEX) strategy was adopted to isolate specific aptamers against Vibrio parahaemolyticus. Round selection for V. parahaemolyticus was conducted 11 rounds, including two negative selection rounds. It was determined through real-time PCR amplification and post-SELEX experiment. The selected aptmers had high binding property and specificity to V.  parahaemolyticus. Of 28 aptamers tested, VPCA-apta#1 had the highest binding affinity compared to other aptamer candidates obtained. To detect V. parahaemolyticus, aptamer based SPR biosensor platform was constructed and pathogenic bacteria sensing was conducted in two steps. The first step was to construct 5'-biotinylated VPCA-apta#1 binding probe. The second step was to incubate V. parahaemolyticus and test microbes in functionalized SA sensor chip in parallel. Our platform showed significant activity for detecting and discriminating V. parahaemolyticus from other enteric species such as Escherichia coli, Listeria monocytogenes, Sigella sonnei, and Vibrio fischeri. This is the first report on the use of whole-SELEX to isolate DNA aptamers specific for V. parahaemolyticus. We demonstrated the feasibility of using aptamer platform for the detection of V. parahaemolyticus in various food supplies. It might be used in multiple points of care for diagnosing Vibriosis. 
29242148	 The rapid detection of foodborne pathogens is critical to ensure food safety. The objective of this study is to select aptamers specifically bound to Escherichia coli O157:H7 using the whole-bacterium SELEX (Systematic Evolution of Ligands by  Exponential Enrichment) and apply the selected aptamer to a QCM (quartz crystal microbalance) sensor for rapid and sensitive detection of target bacteria. A total of 19 rounds of selection against live E. coli O157:H7 and 6 rounds of counter selection against a mixture of Staphylococcus aureus, Listeria monocytogenes, and Salmonella Typhimurium, were performed. The aptamer pool from  the last round was cloned and sequenced. One sequence S1 that appeared 16 times was characterized and a dissociation constant (Kd) of 10.30nM was obtained. Subsequently, a QCM aptasensor was developed for the rapid detection of E. coli O157:H7. The limit of detection (LOD) and the detection time of the aptasensor was determined to be 1.46×103 CFU/ml and 50min, respectively. This study demonstrated that the ssDNA aptamer selected by the whole-bacterium SELEX possessed higher sensitivity than previous work and the potential use of the constructed QCM aptasensor in rapid screening of foodborne pathogens. 
29087459	 The genome of Escherichia coli K-12 contains ten cryptic phages, altogether constituting about 3.6% of the genome in sequence. Among more than 200 predicted  genes in these cryptic phages, 14 putative transcription factor (TF) genes exist, but their regulatory functions remain unidentified. As an initial attempt to make a breakthrough for understanding the regulatory roles of cryptic phage-encoded TFs, we tried to identify the regulatory function of CP4-6 cryptic prophage-encoded YagI with unknown function. After SELEX screening, YagI was found to bind mainly at a single site within the spacer of bidirectional transcription units, yagA (encoding another uncharacterized TF) and yagEF (encoding 2-keto-3-deoxy gluconate aldolase, and dehydratase, respectively) within this prophage region. YagEF enzymes are involved in the catabolism of xylose downstream from xylonate. We then designated YagI as XynR (regulator of xylonate catabolism), one of the rare single-target TFs. In agreement with this predicted regulatory function, the activity of XynR was suggested to be controlled by xylonate. Even though low-affinity binding sites of XynR were identified in the E. coli K-12 genome, they all were inside open reading frames,  implying that the regulation network of XynR is still fixed within the CR4-6 prophage without significant influence over the host E. coli K-12. 
28904250	 The model organism, Escherichia coli, contains a total of more than 4,500 genes,  but the total number of RNA polymerase (RNAP) core enzyme or the transcriptase is only about 2,000 molecules per genome. The regulatory targets of RNAP are, however, modulated by changing its promoter selectivity through two-steps of protein-protein interplay with 7 species of the sigma factor in the first step, and then 300 species of the transcription factor (TF) in the second step. Scientists working in the field of prokaryotic transcription in Japan have made considerable contributions to the elucidation of genetic frameworks and regulatory modes of the genome transcription in E. coli K-12. This review summarizes the findings by this group, first focusing on three sigma factors, the stationary-phase sigma RpoS, the heat-shock sigma RpoH, and the flagellar-chemotaxis sigma RpoF, as examples. It also presents an overview of the current state of the systematic research being carried out to identify the regulatory functions of all TFs from a single and the same bacterium E. coli K-12, using the genomic SELEX and PS-TF screening systems. All these studies have been undertaken with the aim of understanding the genome regulation in E. coli K-12 as a whole. 
28818557	 Escherichia coli (E. coli) O157:H7 is a foodborne pathogen that causes symptoms in humans. Its rapid identification should be considered to avoid toxic effects of the pathogen. In this study, systematic evolution of ligands by exponential enrichment using whole cells (Cell-SELEX) method was used for recognizing E. coli strain, O157 by single-stranded DNA library of aptamer. Nine rounds of cell-selex procedure were applied using O157, as a whole-cell target, with O42, K12, Top10,  DH5α E. coli cells, Shigella flexneri and Salmonella typhi as counterparts. The specific interaction between selected DNA aptamers and targeted cell was assessed. After applying six rounds of SELEX for selection of DNA aptamers, the candidate sequences were obtained. Finally, specific aptamer was selected as an ideal aptamer for detection and capturing of E. coli O157. Dissociation constant  of the selected aptamer were calculated (107.6 ± 67.8 pM). In addition, the secondary structure prediction and cross reactivity assays were performed. The isolated aptamer efficiency was confirmed and it was shown that the new DNA aptamer sequence has the ability to use for detection. This specific O157:H7 aptamer have the potential for application as a diagnostic ligand and could be used for detection of the related food borne diseases. 
28800583	 Dps is a multifunctional homododecameric protein that oxidizes Fe2+ ions accumulating them in the form of Fe2O3 within its protein cavity, interacts with  DNA tightly condensing bacterial nucleoid upon starvation and performs some other functions. During the last two decades from discovery of this protein, its ferroxidase activity became rather well studied, but the mechanism of Dps interaction with DNA still remains enigmatic. The crucial role of lysine residues in the unstructured N-terminal tails led to the conventional point of view that Dps binds DNA without sequence or structural specificity. However, deletion of dps changed the profile of proteins in starved cells, SELEX screen revealed genomic regions preferentially bound in vitro and certain affinity of Dps for artificial branched molecules was detected by atomic force microscopy. Here we report a non-random distribution of Dps binding sites across the bacterial chromosome in exponentially growing cells and show their enrichment with inverted repeats prone to form secondary structures. We found that the Dps-bound regions overlap with sites occupied by other nucleoid proteins, and contain overrepresented motifs typical for their consensus sequences. Of the two types of genomic domains with extensive protein occupancy, which can be highly expressed or transcriptionally silent only those that are enriched with RNA polymerase molecules were preferentially occupied by Dps. In the dps-null mutant we, therefore, observed a differentially altered expression of several targeted genes and found suppressed transcription from the dps promoter. In most cases this can  be explained by the relieved interference with Dps for nucleoid proteins exploiting sequence-specific modes of DNA binding. Thus, protecting bacterial cells from different stresses during exponential growth, Dps can modulate transcriptional integrity of the bacterial chromosome hampering RNA biosynthesis  from some genes via competition with RNA polymerase or, vice versa, competing with inhibitors to activate transcription. 
28728009	 We report a novel fabrication method of functionalised Bridged Rebar Graphene (BRG) onto newly designed nanostructured aptasensor for label free impedimetric sensing of pathogenic bacteria E. coli O78:K80:H11. The chemical facilitated unscrolling of MWCNT and subsequent bridging with terephthalaldehyde (TPA) to form 3D-hierarchical BRG nanoconstruct exhibited synergistic effect by combining  enhanced electrical properties and facile chemical functionality for stable bio-interface. The bacteria-DNA interactions were captured on BRG nanostructured  electrode by using specific anti-E.coli DNA aptamer (Kd~ 14nM), screened by new in-situ developed SELEX method using phenylboronic acid on microtitre plate. The  developed nanostructured aptasensor demonstrated a low detection limit and sensitivity of ~ 101cfu/mL towards E. coli O78:K80:H11 with a dynamic response range from 101 to 106cfu/mL in water, juice and milk samples. 
28666008	 The promoter selectivity of Escherichia coli RNA polymerase (RNAP) is determined  by the sigma subunit. The model prokaryote Escherichia coli K-12 contains seven species of the sigma subunit, each recognizing a specific set of promoters. For identification of the "constitutive promoters" that are recognized by each RNAP holoenzyme alone in the absence of other supporting factors, we have performed the genomic SELEX screening in vitro for their binding sites along the E. coli K-12 W3110 genome using each of the reconstituted RNAP holoenzymes and a collection of genome DNA segments of E. coli K-12. The whole set of constitutive  promoters for each RNAP holoenzyme was then estimated based on the location of RNAP-binding sites. The first successful screening of the constitutive promoters  was achieved for RpoD (σ70), the principal sigma for transcription of growth-related genes. As an extension, we performed in this study the screening of constitutive promoters for four minor sigma subunits, stationary-phase specific RpoS (σ38), heat-shock specific RpoH (σ32), flagellar-chemotaxis specific RpoF (σ28) and extra-cytoplasmic stress-response RpoE (σ24). The total number of constitutive promoters were: 129~179 for RpoS; 101~142 for RpoH; 34~41  for RpoF; and 77~106 for RpoE. The list of constitutive promoters were compared with that of known promoters identified in vivo under various conditions and using varieties of E. coli strains, altogether allowing the estimation of "inducible promoters" in the presence of additional supporting factors. 
28648779	 In search for RNA signals that modulate transcription via direct interaction with RNA polymerase (RNAP), we deep sequenced an E. coli genomic library enriched for  RNAP-binding RNAs. Many natural RNAP-binding aptamers, termed RAPs, were mapped to the genome. Over 60% of E. coli genes carry RAPs in their mRNA. Combining in vitro and in vivo approaches, we characterized a subset of inhibitory RAPs (iRAPs) that promote Rho-dependent transcription termination. A representative iRAP within the coding region of the essential gene, nadD, greatly reduces its transcriptional output in stationary phase and under oxidative stress, demonstrating that iRAPs control gene expression in response to changing environment. The mechanism of iRAPs involves active uncoupling of transcription and translation, making nascent RNA accessible to Rho. iRAPs encoded in the antisense strand also promote gene expression by reducing transcriptional interference. In essence, our work uncovers a broad class of cis-acting RNA signals that globally control bacterial transcription. 
28543037	 The ability to design and construct combinatorial synthetic metabolic pathways has far exceeded our capacity for efficient screening and selection of the resulting microbial strains. The need for high-throughput rapid screening techniques is of upmost importance for the future of synthetic biology and metabolic engineering. Here we describe the development of an RNA riboswitch-based biosensor module with dual fluorescent reporters, and demonstrate a high-throughput flow cytometry-based screening method for identification of naringenin over producing Escherichia coli strains in co-culture. Our efforts helped identify a number of key operating parameters that affect biosensor performance, including the selection of promoter and linker elements within the sensor-actuator domain, and the effect of host strain, fermentation time, and growth medium on sensor dynamic range. The resulting biosensor demonstrates a high correlation between specific fluorescence of the biosensor strain and naringenin titer produced by the second member of the synthetic co-culture system. This technique represents a novel application for synthetic microbial co-cultures and can be expanded from naringenin to any metabolite if a suitable riboswitch is identified. The co-culture technique presented here can be applied to a variety of target metabolites in combination with the SELEX approach for aptamer design. Due to the compartmentalization of the two genetic constructs responsible for production and detection into separate cells and application as independent modules of a synthetic microbial co-culture  we have subsequently reduced the need for re-optimization of the producer module  when the biosensor is replaced or removed. Biotechnol. Bioeng. 2017;114: 2235-2244. © 2017 Wiley Periodicals, Inc. 
28513559	 In this paper, a Whole-Bacteria SELEX (WB-SELEX) strategy was adopted to isolate  specific aptamers against Shigella sonnei. Real-time PCR amplification and post-SELEX experiment revealed that the selected aptmers possessed a high binding affinity and specificity for S. sonnei. Of the 21 aptamers tested, the C(t) values of the SS-3 and SS-4 aptamers (Ct = 13.89 and Ct = 12.23, respectively) had the lowest value compared to other aptamer candidates. The SS-3 and SS-4 aptamers also displayed a binding affinity (KD) of 39.32 ± 5.02 nM and 15.89 ± 1.77 nM, respectively. An aptamer-based fluorescent biosensor assay was designed  to detect and discriminate S. sonnei cells using a sandwich complex pair of SS-3  and SS-4. The detection of S. sonnei by the aptamer based fluorescent biosensor platform consisted of three elements: (1) 5'amine-SS-4 modification in a 96-well  type microtiter plate surface (N-oxysuccinimide, NOS) as capture probes; (2) the  incubation with S. sonnei and test microbes in functionalized 96 assay wells in parallel; (3) the readout of fluorescent activity using a Cy5-labeled SS-3 aptamer as the detector. Our platform showed a significant ability to detect and  discriminate S. sonnei from other enteric species such as E. coli, Salmonella typhimurium and other Shigella species (S. flexneri, S. boydii). In this study, we demonstrated the feasibility of an aptamer sensor platform to detect S. sonnei in a variety of foods and pave the way for its use in diagnosing shigellosis through multiple, portable designs. 
28272554	 Conventional cell-SELEX aims to isolate aptamers to a single unique target bacteria species. We propose a method to isolate single-stranded DNA aptamers that have broad reactivity to multiple bacterial targets belonging to different genera. The key of the proposed method is that targets of interest are changed sequentially at each SELEX round. The general scheme was examined using six bacteria from different genera, Escherichia coli, Enterobacter aerogenes, Klebsiella pneumoniae, Citrobacter freundii, Bacillus subtilis, and Staphylococcus epidermidis (four gram-negative and two gram-positive bacteria). In the first round of SELEX, the DNA library was incubated with E. coli and amplicons bound to E. coli were separated. The amplicons were sequentially separated by incubation with E. aerogenes, K. pneumoniae, C. freundii, B. subtilis, and S. epidermidis at each SELEX. The amplicons obtained using the last bacterial species were incubated again with the first bacterial species and this  loop was repeated two more times. We refer to this method as sequential toggle cell-SELEX (STC-SELEX). The isolated aptamers had dissociation constants of 9.22-38.5 nM and had no affinity to other bacteria that were not included in STC-SELEX. These results demonstrate the potential to isolate aptamers with broad affinity to bacterial taxa in different genera. 
28224267	 BACKGROUND: Human epidermal growth factor receptor 2 (Her2, an orphan receptor of ErbB family) is considered as an important biomarker as it plays a key role in the development and progression of aggressive types of breast, ovarian, stomach and gastric cancer. In the present study, we developed novel DNA aptamers against the extra-cellular domain (ECD) of Her2 protein for detection of Her2-positive carcinomas. METHODS: We cloned and expressed Her2-ECD protein in E. coli system. After purification, the protein was used as a bait for screening of specific DNA aptamer candidate from a pool of 1014-15 random oligonucleotides through in vitro Systematic Evaluation of Ligands by Exponential Enrichment (SELEX) process. The aptamer-protein binding kinetics was elucidated by isothermal calorimetry. The specificity of FAM-labelled ECD_Apt1 towards Her2-positive cell lines was estimated by FACS and immunofluorescence assay. The specificity of the candidate  was also verified with the tissue samples of breast cancer patients by immunohistochemistry process. RESULTS: Among four selected candidates, ECD_Apt1 (having minimum ∆G = -3.24) showed the highest binding affinity (K d = 6.33 ± 0.86 nM) to Her2-ECD protein. The aptamer-protein sandwich assay showed a linear rise in chemiluminescence (at  490 nm wavelength) in the dynamic range of 100-700 nM ECD_Apt1 with a detection limit of 12.5 ± 2.5 ng/mL. Biotinylated ECD_Apt1 showed stronger cytoplasmic staining in Her2-positive breast cancer cell lines (SKBR3) compared to Her2-negative cells (MDA MB 231, MCF7). In paraffin-embedded breast cancer tissue sections, it showed specific and selective localization in the cytoplasmic niche  of malignant duct cancer cells without any cross-reactivity to fibroblasts, inflammatory cells and adipocytes. CONCLUSIONS: Binding assays, cytochemical and histochemical studies support ECD_Apt1 as a potential theranostic agent for Her2-positive carcinomas. ECD_Apt1  could be an effective low-cost alternative to conventional anti-Her2 antibody in  solid phase immunoassays for cancer diagnosis and related applications. 
28009914	 In an effort to expand the binding and recognition capabilities of aptamers, a nucleoside triphosphate modified with a phenol that mimics the side chain of tyrosine was used in the selection of DNA aptamers against live bacteria. Of multiple modified aptamers that were isolated against Escherichia coli DH5α cells, one aptamer displays high selectivity and affinity for the target cells and is greatly enriched for phenol-modified dU nucleotides (dUy, 47.5%). When the same sequences are synthesized with TTP, no binding is observed. Taken together,  these findings highlight the value of using modified nucleotide triphosphates in  aptamer selections and portends success in SELEX against an array of whole cells  as targets. 
28005933	 Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order) and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX  screening of promoters recognized by RNA polymerase (RNAP) holoenzyme containing  RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of  all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon), within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons are expressed independent of rRNA synthesis under specific conditions where further synthesis of ribosomes is not needed. 
27871171	 Escherichia coli are important indicator organisms, used routinely for the monitoring of water and food safety. For quick, sensitive and real-time detection of E. coli we developed a 2'F modified RNA aptamer Ec3, by Cell-SELEX. The 31 nucleotide truncated Ec3 demonstrated improved binding and low nano-molar affinity to E. coli. The aptamer developed by us out-performs the commercial antibody and aptamer used for E. coli detection. Ec3(31) aptamer based E. coli detection was done using three different detection formats and the assay sensitivities were determined. Conventional Ec3(31)-biotin-streptavidin magnetic  separation could detect E. coli with a limit of detection of 1.3 × 106 CFU/ml. Although, optical analytic technique, biolayer interferometry, did not improve the sensitivity of detection for whole cells, a very significant improvement in the detection was seen with the E. coli cell lysate (5 × 104 CFU/ml). Finally we  developed Electrochemical Impedance Spectroscopy (EIS) gap capacitance biosensor  that has detection limits of 2 × 104 CFU/mL of E. coli cells, without any labeling and signal amplification techniques. We believe that our developed method can step towards more complex and real sample application. 
27435271	 YbaO is an uncharacterized AsnC-family transcription factor of Escherichia coli.  In both Salmonella enterica and Pantoea ananatis, YbaO homologues were identified to regulate the adjacent gene encoding cysteine desulfhydrase for detoxification  of cysteine. Using the genomic SELEX (systematic evolution of ligands by exponential enrichment) screening system, we identified the yhaOM operon, located far from the ybaO gene on the E. coli genome, as a single regulatory target of YbaO. In both gel shift assay in vitro and reporter and Northern blot assays in vivo, YbaO was found to regulate the yhaOM promoter. The growth of mutants lacking either ybaO or its targets yhaOM was delayed in the presence of cysteine, indicating involvement of these genes in cysteine detoxification. In the major pathway of cysteine degradation, hydrogen sulfide is produced in wild-type E. coli, but its production was not observed in each of the ybaO, yhaO and yhaM mutants. The yhaOM promoter was activated in the presence of cysteine, implying the role of cysteine in activation of YbaO. Taken together, we propose that YbaO  is the cysteine-sensing transcriptional activator of the yhaOM operon, which is involved in the detoxification of cysteine. We then propose the naming of ybaO as decR (regulator of detoxification of cysteine). 
27112147	 Genomic SELEX (systematic evolution of ligands by exponential enrichment) screening was performed for identification of the binding site of YbiH, an as yet uncharacterized TetR-family transcription factor, on the Escherichia coli genome. YbiH was found to be a unique single-target regulator that binds in vitro within  the intergenic spacer located between the divergently transcribed ybiH-ybhGFSR and rhlE operons. YbhG is an inner membrane protein and YbhFSR forms a membrane-associated ATP-binding cassette (ABC) transporter while RhlE is a ribosome-associated RNA helicase. Gel shift assay and DNase footprinting analyses indicated one clear binding site of YbiH, including a complete palindromic sequence of AATTAGTT-AACTAATT. An in vivo reporter assay indicated repression of  the ybiH operon and activation of the rhlE operon by YbiH. After phenotype microarray screening, YbiH was indicated to confer resistance to chloramphenicol  and cefazoline (a first-generation cephalosporin). A systematic survey of the participation of each of the predicted YbiH-regulated genes in the antibiotic sensitivity indicated involvement of the YbhFSR ABC-type transporter in the sensitivity to cefoperazone (a third-generation cephalosporin) and of the membrane protein YbhG in the control of sensitivity to chloramphenicol. Taken together with the growth test in the presence of these two antibiotics and in vitro transcription assay, it was concluded that the hitherto uncharacterized YbiH regulates transcription of both the bidirectional transcription units, the ybiH-ybhGFSR operon and the rhlE gene, which altogether are involved in the control of sensitivity to cefoperazone and chloramphenicol. We thus propose to rename YbiH as CecR (regulator of cefoperazone and chloramphenicol sensitivity). 
27104834	 Escherichia coli is a bacterial species found ubiquitously in the intestinal flora of animals, although pathogenic variants cause major public health problems. Aptamers are short oligonucleotides that bind to targets with high affinity and specificity, and have great potential for use in diagnostics and therapy. We used cell-based Systematic Evolution of Ligands by EXponential enrichment (cell-SELEX) to isolate four single stranded DNA (ssDNA) aptamers that bind strongly to E. coli cells (ATCC generic strain 25922), with Kd values in the nanomolar range. Fluorescently labeled aptamers label the surface of E. coli cells, as viewed by fluorescent microscopy. Specificity tests with twelve different bacterial species showed that one of the aptamers-called P12-31-is highly specific for E. coli. Importantly, this aptamer binds to Meningitis/sepsis associated E. coli (MNEC) clinical isolates, and is the first aptamer described with potential for use in the diagnosis of MNEC-borne pathologies. 
26843427	 Bacterial genomes are transcribed by DNA-dependent RNA polymerase (RNAP), which achieves gene selectivity through interaction with sigma factors that recognize promoters, and transcription factors (TFs) that control the activity and specificity of RNAP holoenzyme. To understand the molecular mechanisms of transcriptional regulation, the identification of regulatory targets is needed for all these factors. We then performed genomic SELEX screenings of targets under the control of each sigma factor and each TF. Here we describe the assembly of 156 SELEX patterns of a total of 116 TFs performed in the presence and absence of effector ligands. The results reveal several novel concepts: (i) each TF regulates more targets than hitherto recognized; (ii) each promoter is regulated  by more TFs than hitherto recognized; and (iii) the binding sites of some TFs are located within operons and even inside open reading frames. The binding sites of  a set of global regulators, including cAMP receptor protein, LeuO and Lrp, overlap with those of the silencer H-NS, suggesting that certain global regulators play an anti-silencing role. To facilitate sharing of these accumulated SELEX datasets with the research community, we compiled a database, 'Transcription Profile of Escherichia coli' (www.shigen.nig.ac.jp/ecoli/tec/). 
26573804	 Fluorescence-activated cell sorting (FACS) was exploited to isolate Escherichia coli cells that were highly fluorescent due to the expression of RNA aptamers that induce fluorescence of 3,5-difluoro-4-hydroxybenzylidene imidazolinone. Two  different aptamers, named ZT-26 and ZT-324, were identified by this method and compared to the fluorescence-signaling properties of Spinach, a previously reported RNA aptamer. Aptamer ZT-26 exhibits significantly enhanced fluorescence  over Spinach only in vitro. However, aptamer ZT-324 is 36% brighter than Spinach  when expressed in E. coli. The FACS-based selection strategy presented here is attractive for deriving fluorescent RNA aptamers that function in cells as it directly selects for cells with a high level of fluorescence due to the expression of the RNA aptamer. 
26541162	 Tuberculosis (TB) remains to be a major global health problem, with about 9 million new cases and 1.4 million deaths in 2011. For the control of tuberculosis as well as other infectious diseases, WHO recommended "ASSURED" (Affordable, Sensitive, Specific, User-friendly, Rapid and robust, Equipment-free, and Deliverable to the end user) diagnostic tools that can easily be maintained and used in developing countries. Aptamers are promising tools for developing point-of-care diagnostic assays for TB. In this study, ssDNA aptamers that recognize Mycobacterium tuberculosis H37Ra were selected by systematic evolution  of ligands by exponential enrichment (SELEX). For this purpose, two different selection protocols, ultrafiltration and centrifugation, were applied. A total of 21 TB specific aptamers were selected. These aptamers exhibited "G-rich" regions  on the 3' terminus of the aptamers, including a motif of "TGGGG," "GTGG," or "CTGG." Binding capability of selected aptamers were investigated by quantitative PCR and Mtb36 DNA aptamer was found the most specific aptamer to M. tuberculosis  H37Ra. The dissociation constant (K d) of Mtb36 aptamer was calculated as 5.09 ± 1.43 nM in 95% confidence interval. Relative binding ratio of Mtb36 aptamer to M. tuberculosis H37Ra over Mycobacterium bovis and Escherichia coli was also determined about 4 times and 70 times more, respectively. Mtb36 aptamer  is highly selective for M. tuberculosis, and it can be used in an aptamer-based biosensor for the detection of M. tuberculosis. 
26427325	 Immobilized metal ion affinity chromatography (IMAC) is widely used for the purification of many different His6-tagged recombinant proteins. On the one hand, it is a powerful technique but on the other hand it has its disadvantages. In this report, we present the development of a unique ssDNA aptamer for the purification of His3-tagged recombinant proteins. Our study shows that stability  of the His3-tag/H3T aptamer complex can be controlled by the sodium ion concentration. Based on this feature, we demonstrate that H3T aptamer resin was successfully employed for the purification of three out of four tested His3-tagged recombinant proteins from an E. coli total protein extract using imidazole-free buffers. Finally, we show that the purity of His3-tagged proteins  is superior when purified with the help of the H3T aptamer in comparison with Ni-NTA resin. 
26332955	 The two-component system (TCS) is a sophisticated bacterial signal transduction system for regulation of genome transcription in response to environmental conditions. The EnvZ-OmpR system is one of the well-characterized TCS of Escherichia coli, responding to changes in environmental osmolality. Regulation has largely focused on the differential expression of two porins, OmpF and OmpC,  which transport small molecules across the outer membrane. Recently, it has become apparent that OmpR serves a more global regulatory role and regulates additional targets. To identify the entire set of regulatory targets of OmpR, we  performed the genomic SELEX screening of OmpR-binding sites along the E. coli genome. As a result, more than 30 novel genes have been identified to be under the direct control of OmpR. One abundant group includes the genes encoding a variety of membrane-associated transporters that mediate uptake or efflux of small molecules, while another group encodes a set of transcription regulators, raising a concept that OmpR is poised to control a diverse set of responses by altering downstream transcriptional regulators. 
26175046	 In order to gain deeper insight into the functions and dynamics of RNA in cells,  the development of methods for imaging multiple RNAs simultaneously is of paramount importance. Here, we describe a modular approach to image RNA in living cells using an RNA aptamer that binds to dinitroaniline, an efficient general contact quencher. Dinitroaniline quenches the fluorescence of different fluorophores when directly conjugated to them via ethylene glycol linkers by forming a non-fluorescent intramolecular complex. Since the binding of the RNA aptamer to the quencher destroys the fluorophore-quencher complex, fluorescence increases dramatically upon binding. Using this principle, a series of fluorophores were turned into fluorescent turn-on probes by conjugating them to dinitroaniline. These probes ranged from fluorescein-dinitroaniline (green) to TexasRed-dinitroaniline (red) spanning across the visible spectrum. The dinitroaniline-binding aptamer (DNB) was generated by in vitro selection, and was found to bind all probes, leading to fluorescence increase in vitro and in living cells. When expressed in E. coli, the DNB aptamer could be labelled and visualized with different-coloured fluorophores and therefore it can be used as a genetically encoded tag to image target RNAs. Furthermore, combining contact-quenched fluorogenic probes with orthogonal DNB (the quencher-binding RNA aptamer) and SRB-2 aptamers (a fluorophore-binding RNA aptamer) allowed dual-colour imaging of two different fluorescence-enhancing RNA tags in living cells, opening new avenues for studying RNA co-localization and trafficking. 
28348809	 Leucine-responsive regulatory protein (Lrp) is a transcriptional regulator for the genes involved in transport, biosynthesis and catabolism of amino acids in Escherichia coli. In order to identify the whole set of genes under the direct control of Lrp, we performed Genomic SELEX screening and identified a total of 314 Lrp-binding sites on the E. coli genome. As a result, the regulation target of Lrp was predicted to expand from the hitherto identified genes for amino acid  metabolism to a set of novel target genes for utilization of amino acids for protein synthesis, including tRNAs, aminoacyl-tRNA synthases and rRNAs. Northern  blot analysis indicated alteration of mRNA levels for at least some novel targets, including the aminoacyl-tRNA synthetase genes. Phenotype MicroArray of the lrp mutant indicated significant alteration in utilization of amino acids and peptides, whilst metabolome analysis showed variations in the concentration of amino acids in the lrp mutant. From these two datasets we realized a reverse correlation between amino acid levels and cell growth rate: fast-growing cells contain low-level amino acids, whilst a high level of amino acids exists in slow-growing cells. Taken together, we propose that Lrp is a global regulator of  transcription of a large number of the genes involved in not only amino acid transport and metabolism, but also amino acid utilization. 
26080079	 Human noroviruses (NoV) are the leading cause of acute viral gastroenteritis worldwide. Significant antigenic diversity of NoV strains has limited the availability of broadly reactive ligands for design of detection assays. The purpose of this work was to produce and characterize single stranded (ss)DNA aptamers with binding specificity to human NoV using an easily produced NoV target-the P domain protein. Aptamer selection was done using SELEX (Systematic Evolution of Ligands by EXponential enrichment) directed against an Escherichia coli-expressed and purified epidemic NoV GII.4 strain P domain. Two of six unique aptamers (designated M1 and M6-2) were chosen for characterization. Inclusivity testing using an enzyme-linked aptamer sorbent assay (ELASA) against a panel of 14 virus-like particles (VLPs) showed these aptamers had broad reactivity and exhibited strong binding to GI.7, GII.2, two GII.4 strains, and GII.7 VLPs. Aptamer M6-2 exhibited at least low to moderate binding to all VLPs tested. Aptamers significantly (p<0.05) bound virus in partially purified GII.4 New Orleans outbreak stool specimens as demonstrated by ELASA and aptamer magnetic capture (AMC) followed by RT-qPCR. This is the first demonstration of human NoV P domain protein as a functional target for the selection of nucleic acid aptamers  that specifically bind and broadly recognize diverse human NoV strains. 
25841381	 Anthrax toxin excreted by Bacillus anthracis is the key causative agent of infectious anthrax disease. In the present study, we targeted the binding of PA to the ATR/TEM8 Von Willebrand factor type A (VWA) domain, which we cloned into Escherichia coli and purified to homogeneity under denaturing conditions. To develop an anthrax toxin inhibitor, we selected and identified short single strand RNA aptamers (approximately 30mer) consisting of different sequences of nucleic acids with a high binding affinity in the 100 nanomolar range against the recombinant ATR/TEM8 VWA domain using systematic evolution of ligands by exponential enrichment (SELEX). Five candidate aptamers were further characterized by several techniques including secondary structural analysis. The  inhibitor efficiency (IC50) of one of the aptamers toward anthrax toxin was approximately 5μM in macrophage RAW 264.7 cells, as determined from cytotoxicity  analysis by MTT assay. We believe that the candidate aptamers should be useful for blocking the binding of PA to its receptor in order to neutralize anthrax toxin. 
25790494	 The binding site(s) on the Escherichia coli genome was determined for an uncharacterized AraC/XylS superfamily transcription factor YeaM by using the in vitro genomic SELEX screening system. The only one clear binding target of YeaM was found to locate in the spacer between the divergently transcribed yeaM and yeaN genes. After the phenotype microarray analysis, the major facilitator superfamily transporter YeaN was found to confer E. coli the resistance to 2-nitroimidazole, the antibacterial and antifungal antibiotic, suggesting that YeaN plays a role in 2-nitromidazole efflux. Purified YeaM bound to three sites within this yeaM-yeaN spacer region. Several lines of in vitro and in vivo evidence indicate that YeaM regulates transcription of both the yeaM gene itself  and the yeaNO operon. Taken together we propose to rename yeaN to nimT (nitroimidazole transporter) and yeaM to nimR (regulator of nimT). 
25590973	 As a major human pathogen in the Listeria genus, Listeria monocytogenes causes the bacterial disease listeriosis, which is a serious infection caused by eating  food contaminated with the bacteria. We have developed an aptamer-based sandwich  assay (ABSA) platform that demonstrates a promising potential for use in pathogen detection using aptamers as analytical bioconjugates. The whole-bacteria SELEX (WB-SELEX) strategy was adopted to generate aptamers with high affinity and specificity against live L. monocytogenes. Of the 35 aptamer candidates tested, LMCA2 and LMCA26 reacted to L. monocytogenes with high binding, and were consequently chosen as sensing probes. The ABSA platform can significantly enhance the sensitivity by employing a very specific aptamer pair for the sandwich complex. The ABSA platform exhibited a linear response over a wide concentration range of L. monocytogenes from 20 to 2×10(6) CFU per mL and was closely correlated with the following relationship: y=9533.3x+1542.3 (R(2)=0.99). Our proposed ABSA platform also provided excellent specificity for the tests to distinguish L. monocytogenes from other Listeria species and other bacterial genera (3 Listeria spp., 4 Salmonella spp., 2 Vibrio spp., 3 Escherichia coli and 3 Shigella spp.). Improvements in the sensitivity and specificity have not only facilitated the reliable detection of L. monocytogenes at extremely low concentrations, but also allowed for the development of a 96-well plate-based routine assay platform for multivalent diagnostics. 
25568260	 YedVW is one of the uncharacterized two-component systems (TCSs) of Escherichia coli. In order to identify the regulation targets of YedVW, we performed genomic  SELEX (systematic evolution of ligands by exponential enrichment) screening using phosphorylated YedW and an E. coli DNA library, and identified YedW-binding sites within three intergenic spacers, yedW-hiuH, cyoA-ampG and cusR-cusC, along the E. coli genome. Using a reporter assay system, we found that transcription of hiuH,  encoding 5-hydroxyisourate hydrolase, was induced at high concentrations of either Cu(2+) or H₂O₂. Cu(2+)-dependent expression of hiuH was observed in the yedWV knockout mutant, but was reduced markedly in the cusRS-null mutant. However, H₂O₂-induced hiuH expression was observed in the cusRS-null mutant, but  not in the yedWV-null mutant. Gel mobility shift and DNase I footprinting analyses showed binding of both YedW and CusR to essentially the same sequence within the hiuH promoter region. Taken together, we concluded that YedVW and CusSR formed a unique cooperative TCS pair by recognizing and regulating the same targets, but under different environmental conditions - YedVW played a role in H₂O₂ response regulation, whilst CusSR played a role in Cu(2+) response regulation. 
25406449	 Sulfur makes up 1 % of the dry mass of bacteria, and it is an abundant element (0.1 %) on earth. Sulfur in the environment is, however, mostly in oxidized forms and inaccessible to living organisms. At present, the entire assimilation pathway of external sulfur to sulfur-containing biomolecules and its regulation in Escherichia coli remain poorly understood, except for the metabolic pathway of cysteine synthesis, the first-step metabolite of sulfur assembly. During the search for regulation targets of uncharacterized transcription factors by Genomic SELEX screening, we found that the hitherto uncharacterized YdcN regulates a set  of genes involved in the utilization of sulfur, including the generation of sulfate and its reduction, the synthesis of cysteine, the synthesis of enzymes containing Fe-S as cofactors, and the modification of tRNA with use of sulfur-containing substrates. Taking these findings together, we propose renaming YdcN as SutR (regulator of sulfur utilization). 
25337688	 Genetically encoded fluorescent ribonucleic acids (RNAs) have diverse applications, including imaging RNA trafficking and as a component of RNA-based sensors that exhibit fluorescence upon binding small molecules in live cells. These RNAs include the Spinach and Spinach2 aptamers, which bind and activate the fluorescence of fluorophores similar to that found in green fluorescent protein.  Although additional highly fluorescent RNA-fluorophore complexes would extend the utility of this technology, the identification of novel RNA-fluorophore complexes is difficult. Current approaches select aptamers on the basis of their ability to bind fluorophores, even though fluorophore binding alone is not sufficient to activate fluorescence. Additionally, aptamers require extensive mutagenesis to efficiently fold and exhibit fluorescence in living cells. Here we describe a platform for rapid generation of highly fluorescent RNA-fluorophore complexes that are optimized for function in cells. This procedure involves selection of aptamers on the basis of their binding to fluorophores, coupled with fluorescence-activated cell sorting (FACS) of millions of aptamers expressed in Escherichia coli. Promising aptamers are then further optimized using a FACS-based directed evolution approach. Using this approach, we identified several novel aptamers, including a 49-nt aptamer, Broccoli. Broccoli binds and activates the fluorescence of (Z)-4-(3,5-difluoro-4-hydroxybenzylidene)-1,2-dimethyl-1H-imidazol-5(4H)-one. Broccoli shows robust folding and green fluorescence in cells, and increased fluorescence relative to Spinach2. This reflects, in part, improved folding in the presence of low cytosolic magnesium concentrations. Thus, this novel fluorescence-based selection approach simplifies the generation of aptamers that  are optimized for expression and performance in living cells. 
25185503	 Peptidoglycan is a highly complex and essential macromolecule of bacterial outer  cell wall; it is a heteropolymer made up of linear glycan strands cross-linked by peptides. Peptidoglycan has a particular composition which makes it a possible target for specific bacterial recognition. Aptamers are single-stranded DNA or RNA oligonucleotides that bind to target molecules with high affinity and specificity. Aptamers can be labeled with different radioisotopes and possess several properties that make them suitable for molecular imaging. The purpose of  this study was to obtain aptamers for use as radiopharmaceutical in bacterial infection diagnosis. Two aptamers (Antibac1 and Antibac2) against peptidoglycan were selected through the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) methodology. The dissociation constant (Kd) for Antibac1 was 0.415 + 0.047 μM and for Antibac2 was 1.261 + 0.280 μM. These aptamers labeled with (32)P showed high affinity for Staphylococcus aureus cells. The binding to S. aureus and Escherichia coli in vitro were significantly higher than for Candida albicans and human fibroblasts, demonstrating their specificity for bacterial cells. These results point Antibac1 and Antibac2 as promising tools for bacterial infections identification. 
25096391	 Salmonella enterica subsp. enterica ser. enteritidis and Salmonella enterica subsp. enterica ser. typhimurium are the most common and severe food-borne pathogens responsible for causing salmonellosis in humans and animals. The development of an early and ultra-sensitive detection system is the first critical step in controlling this disease. To accomplish this, we used the cell systematic evolution of ligands by exponential enrichment (Cell-SELEX) technique  to identify single-stranded DNA (ssDNA) aptamers to be used as detection probes that can specifically bind to S. enteritidis and S. typhimurium. A total of 12 target-specific ssDNA aptamers were obtained through ten rounds of Cell-SELEX under stringent selection conditions, and negative selection further enhanced the selectivity among these aptamers. Aptamer specificity was investigated using the  gram-negative bacteria E. coli and P. aeruginosa and was found to be much higher  towards S. enteritidis and S. typhimurium. Importantly, three candidate aptamers  demonstrated higher binding affinities and the dissociation constants (Kd) were found to be in the range of nanomolar to submicromolar levels. Furthermore, individual aptamers were conjugated onto polyvalent directed aptamer polymer, which led to 100-fold increase in binding affinity compared to the individual aptamers alone. Taken together, this study reports the identification of higher affinity and specificity ssDNA aptamers (30mer), which may be useful as capture and detection probes in biosensor-based detection systems for salmonellosis. 
25035238	 For whole-cell aptamers selection, cells surface situation has great impact on single-stranded (ssDNA) binding and aptamers selection. In this work, both Lactobacillus acidophilus and Escherichia coli as well as their protoplasts were  as cells targets, their interaction with ssDNA library were evaluated based on capillary zone electrophoresis (CZE) and affinity capillary electrophoresis (ACE) with UV and LIF detection. Our results demonstrated that protoplasts without cells wall had apparently stronger interaction with ssDNA library than bacteria,  the protoplasts-ssDNA complex could be observed clearly with CZE-LIF. Furthermore, E. coli pretreated by four organic solvents (methanol, ethanol, formaldehyde and glutaraldehyde) showed binding difference with ssDNA library, which could be identified with ACE-UV. Binding constants indicated the interaction of E. coli with ssDNA library were in the order of E. coli protoplasts>methanol (ethanol) treated E. coli>formaldehyde (glutaraldehyde) treated E. coli≈E. coli. Above results suggest that cells surface situation determines their binding affinity with ssDNA, which should be considered in whole-cell aptamers selection and aptamers further application. Capillary electrophoresis is a preferable technique for interaction evaluation of composite targets binding with ssDNA library. 
25008464	 In order to better control nosocomial infections, and facilitate the most prudent and effective use of antibiotics, improved strategies for the rapid detection and identification of problematic bacterial pathogens are required. DNA aptamers have much potential in the development of diagnostic assays and biosensors to address  this important healthcare need, but further development of aptamers targeting common pathogens, and the strategies used to obtain specific aptamers are required. Here we demonstrate the application of a quantitative PCR (qPCR) controlled Cell-SELEX process, coupled with downstream secondary-conformation-based aptamer profiling. We used this approach to identify and select DNA aptamers targeted against uropathogenic Escherichia coli, for which specific aptamers are currently lacking, despite the prevalence of these infections. The use of qPCR to monitor the Cell-SELEX process permitted a minimal number of SELEX cycles to be employed, as well as the cycle-by-cycle optimisation of standard PCR amplification of recovered aptamer pools at each round. Identification of useful aptamer candidates was also facilitated by profiling of  secondary conformations and selection based on putative aptamer secondary structure. One aptamer selected this way (designated EcA5-27), displaying a guanine-quadruplex sequence motif, was shown to have high affinity and specificity for target cells, and the potential to discriminate between distinct  strains of E. coli, highlighting the possibility for development of aptamers selectively recognising pathogenic strains. Overall, the identified aptamers hold much potential for the development of rapid diagnostic assays for nosocomial urinary tract infections caused by E. coli. 
24839553	 Infection with Shiga toxin- (Stx-) producing E. coli causes life threatening hemolytic uremic syndrome (HUS), a leading cause of acute renal failure in children. Of the two antigenically distinct toxins, Stx1 and Stx2, Stx2 is more firmly linked with the development of HUS. In the present study, selective evolution of ligands by exponential enrichment (SELEX) was used in an attempt to  identify RNA aptamers against Stx1 and Stx2. After 5 rounds of selection, significant enrichment of aptamer pool was obtained against Stx2, but not against Stx1, using a RNA aptamer library containing 56 random nucleotides (N56). Characterization of individual aptamer sequences revealed that six unique RNA aptamers (mA/pC, mB/pA, mC, mD, pB, and pD) recognized Stx2 in a filter binding assay. None of these aptamers bound Stx1. Aptamers mA/pC, mB/pA, mC, and mD, but  not pB and pD, partially blocked binding of Alexa 488-labeled Stx2 with HeLa cells in a flow cytometry assay. However, none of the aptamers neutralized Stx2-mediated cytotoxicity and death of HeLa cells. 
24837290	 The expression pattern of the Escherichia coli genome is controlled in part by regulating the utilization of a limited number of RNA polymerases among a total of its approximately 4,600 genes. The distribution pattern of RNA polymerase changes from modulation of two types of protein-protein interactions: the interaction of core RNA polymerase with seven species of the sigma subunit for differential promoter recognition and the interaction of RNA polymerase holoenzyme with about 300 different species of transcription factors (TFs) with regulatory functions. We have been involved in the systematic search for the target promoters recognized by each sigma factor and each TF using the newly developed Genomic SELEX system. In parallel, we developed the promoter-specific (PS)-TF screening system for identification of the whole set of TFs involved in regulation of each promoter. Understanding the regulation of genome transcription also requires knowing the intracellular concentrations of the sigma subunits and  TFs under various growth conditions. This report describes the intracellular levels of 65 species of TF with known function in E. coli K-12 W3110 at various phases of cell growth and at various temperatures. The list of intracellular concentrations of the sigma factors and TFs provides a community resource for understanding the transcription regulation of E. coli under various stressful conditions in nature. 
24814025	 cAMP receptor protein (CRP) is the best characterized global regulator of Escherichia coli. After genomic SELEX screening, a total of minimum 378 promoters have been identified as its regulation targets on the E. coli genome. Among a number of promoters carrying two CRP-binding sites, several promoters carry two CRP-binding sites, one upstream but another downstream of transcription initiation sites. The regulatory role of downstream CRP site remains unsolved. Using the pck gene encoding phosphoenolpyruvate carboxykinase as a model promoter, we analyzed the role of CRP-associated downstream of the transcription  initiation site. Gel shift assay and AFM observation indicate that CRP binds to both the promoter-distal site (CRP box-1) at -90.5 and the site (CRP box-2) at +13.5 downstream of transcription initiation site. The binding affinity is higher for CRP box-1. Roles of two CRP sites were examined using in vitro transcription  assay and in vivo reporter assay. In both cases, transcription repression was observed in the presence of high concentrations of CRP. Taken together, we propose that cAMP-CRP associated at downstream CRP box-2 plays as a repressor for pck transcription only in the presence of high levels of cAMP-CRP. 
24763818	 Nucleic acid aptamers have long demonstrated the capacity to bind cells with high affinity so that they have been utilized to diagnose various important pathogens. In this study, a DNA aptamer library was on initial efforts developed to act as a specific reporter for rapid detection of enter toxigenic Escherichia coli (ETEC)  K88 combined with immuno-magnetic separation (IMS). During a Whole-cell Systematic Evolution of Ligands by Exponential Enrichment (CELL-SELEX) procedure, the last selection pool against ETEC K88, which is named "DNA aptamer library" here, was selected and subsequently identified by flow cytometric analysis and confocal imaging. A K88 monoclonal antibody (mAb) with high affinity (K(aff): 1.616 ± 0.033 × 10(8) M(-1)) against K88 fimbrial protein was prepared, biotinylated and conjugated to streptavidin-coated magnetic beads (MBs). After the bacteria were effectively captured and enriched from the complex sample by immuno-magnetic beads (IMBs), 5'-FITC modified aptamer library was directly bound to target cells as a specific reporter for its detection. The detection system showed clearly high specificity and sensitivity with the detection limit of 1.1 × 10(3) CFU/ml in pure culture and 2.2 × 10(3) CFU/g in artificially contaminated fecal sample. The results also indicated that fluorophore-lablled DNA aptamer library as specific reporter could generate more reliable signals than individual aptamer with best affinity against target cells and implied it would have great applied potential in directly reporting bacteria from complex samples combined with IMS technology. 
24645791	 In Gram-negative bacteria, N-acylhomoserine lactone (HSL) is used as a signal in  cell-cell communication and quorum sensing (QS). The model prokaryote Escherichia coli lacks the system of HSL synthesis, but is capable of monitoring HSL signals  in environment. Transcription factor SdiA for cell division control is believed to play a role as a HSL sensor. Using a collection of 477 species of chemically synthesized HSL analogues, we identified three synthetic signal molecules (SSMs)  that bind in vitro to purified SdiA. After SELEX-chip screening of SdiA-binding DNA sequences, a striking difference was found between these SSMs in the pattern  of regulation target genes on the E. coli genome. Based on Northern blot analysis in vivo, a set of target genes were found to be repressed by SdiA in the absence  of effectors and derepressed by the addition of SSMs. Another set of genes were,  however, expressed in the absence of effector ligands but repressed by the addition of SSMs. Taken together, we propose that the spectrum of taget gene selection by SdiA is modulated in multiple modes depending on the interacting HSL-like signal molecules. 
24603758	 The promoter selectivity of Escherichia coli RNA polymerase is determined by the  sigma subunit with promoter recognition activity. The model prokaryote Escherichia coli contains seven species of the sigma subunit, each recognizing a  specific set of promoters. The major sigma subunit, sigma-70 encoded by rpoD, plays a major role in transcription of growth-related genes. Concomitant with the increase in detection of promoters functioning in vivo under various stressful conditions, the variation is expanding in the consensus sequence of RpoD promoters. In order to identify the canonical sequence of "constitutive promoters" that are recognized by the RNA polymerase holoenzyme containing RpoD sigma in the absence of supporting transcription factors, an in vitro mixed transcription assay was carried out using a whole set of variant promoters, each  harboring one base replacement, within the model promoter with the conserved -35  and -10 sequences of RpoD promoters. The consensus sequences, TTGACA(-35) and TATAAT(-10), were identified to be ideal for the maximum level of open complex formation and the highest rate of promoter opening, respectively. For identification of the full range of constitutive promoters on the E. coli genome, a total of 2,701 RpoD holoenzyme-binding sites were identified by Genomic SELEX screening, and using the reconfirmed consensus promoter sequence, a total of maximum 669 constitutive promoters were identified, implying that the majority of hitherto identified promoters represents the TF-dependent "inducible promoters".  One unique feature of the constitutive promoters is the high level of promoter sequence conservation, about 85% carrying five-out-of-six agreements with -35 or  -10 consensus sequence. The list of constitutive promoters provides the community resource toward estimation of the inducible promoters that operate under various  stressful conditions in nature. 
24356773	 Genetically encoded fluorescent sensors can be valuable tools for studying the abundance and flux of molecules in living cells. We recently developed a novel class of sensors composed of RNAs that can be used to detect diverse small molecules and untagged proteins. These sensors are based on Spinach, an RNA mimic of GFP, and they have successfully been used to image several metabolites and proteins in living bacteria. Here we discuss the generation and optimization of these Spinach-based sensors, which, unlike most currently available genetically encoded reporters, can be readily generated to any target of interest. We also provide a detailed protocol for imaging ADP dynamics in living Escherichia coli after a change from glucose-containing medium to other carbon sources. The entire procedure typically takes ∼4 d including bacteria transformation and image analysis. The majority of this protocol is applicable to sensing other metabolites and proteins in living bacteria. 
24280049	 Microbial cells have many binding moieties on their surface for binding to their  specific bioreceptors. The whole-cell SELEX process enables the isolation of various aptamers that can bind to different components on the cell surface such as proteins, polysaccharides, or flagella with high affinity and specificity. Here, we examine the binding capacity of an aptamer mixture (aptamer cocktail) composed of various combinations of 3 different DNA aptamers isolated from Escherichia coli and compare it with one of the single aptamers using fluorescence-tagged aptamers. The aptamer mixtures showed higher fluorescence signal than did any single aptamer used, which suggests that use of aptamer mixtures can enhance the sensitivity of detection of microbial cells. To further  evaluate this effect, the signal enhancement and improvement of sensitivity provided by combinatorial use of aptamers were examined in an electrochemical detection system. With regard to current decreases, the aptamer cocktail immobilized on gold electrodes performed better than a single aptamer immobilized on gold electrodes did. Consequently, the detection limit achieved using the aptamers individually was approximately 18 times that when the 3 aptamers were used in combination. These results support the use of aptamer cocktails for detection of complex targets such as E. coli with enhanced sensitivity. 
23978634	 Conventional methods for detection of infective organisms, such as Salmonella, are complicated and require multiple steps, and the need for rapid detection has  increased. Biosensors show great potential for rapid detection of pathogens. In turn, aptamers have great potential for biosensor assay development, given their  small size, ease of synthesis and labeling, lack of immunogenicity, a lower cost  of production than antibodies, and high target specificity. In this study, ssDNA  aptamers specific to Salmonella Typhimurium were obtained by a whole bacterium-based systematic evolution of ligands by exponential enrichment (SELEX) procedure and applied to probing S. Typhimurium. After 10 rounds of selection with S. Typhimurium as the target and Salmonella Enteritidis, Escherichia coli and Staphylococcus aureus as counter targets, the highly enriched oligonucleic acid pool was sorted using flow cytometry. In total, 12 aptamer candidates from different families were sequenced and grouped. Fluorescent analysis demonstrated  that aptamer C4 had particularly high binding affinity and selectivity; this aptamer was then further characterized. 
23913318	 ModE is the molybdate-sensing transcription regulator that controls the expression of genes related to molybdate homeostasis in Escherichia coli. ModE is activated by binding molybdate and acts as both an activator and a repressor. By  genomic systematic evolution of ligands by exponential enrichment (SELEX) screening and promoter reporter assays, we have identified a total of nine operons, including the hitherto identified modA, moaA, dmsA, and napF operons, of which six were activated by ModE and three were repressed. In addition, two promoters were newly identified and direct transcription of novel genes, referred to as morA and morB, located on antisense strands of yghW and torY, respectively. The morA gene encodes a short peptide, MorA, with an unusual initiation codon. Surprisingly, overexpression of the morA 5' untranslated region exhibited an inhibitory influence on colony formation of E. coli K-12. 
23707622	 To regulate stress responses and virulence, bacteria use small regulatory RNAs (sRNAs). These RNAs can up or down regulate target mRNAs through base pairing by  influencing ribosomal access and RNA decay. A large class of these sRNAs, called  trans-encoded sRNAs, requires the RNA binding protein Hfq to facilitate base pairing between the regulatory RNA and its target mRNA. The resulting network of  regulation is best characterized in Escherichia coli and Salmonella typhimurium,  but the importance of Hfq dependent sRNA regulation is recognized in a diverse population of bacteria. In this review we present the approaches and methods used to discover Hfq binding RNAs, characterize their interactions and elucidate their functions. 
23651393	 Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK  operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD  and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this  ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides  and its salvage pathway. 
23568752	 Proteus mirabilis is a prominent cause of catheter-associated urinary tract infections (CAUTIs) among patients undergoing long-term bladder catheterization.  There are currently no effective means of preventing P. mirabilis infections, and strategies for prophylaxis and rapid early diagnosis are urgently required. Aptamers offer significant potential for development of countermeasures against P. mirabilis CAUTI and are an ideal class of molecules for the development of diagnostics and therapeutics. Here we demonstrate the application of Cell-SELEX to identify DNA aptamers that show high affinity for P. mirabilis. While the aptamers identified displayed high affinity for P. mirabilis cells in dot blotting assays, they also bound to other uropathogenic bacteria. To improve aptamer specificity for P. mirabilis, an in silico maturation (ISM) approach was  employed. Two cycles of ISM allowed the identification of an aptamer showing 36%  higher specificity, evaluated as a ratio of binding signal for P. mirabilis to that for Escherichia coli (also a cause of CAUTI and the most common urinary tract pathogen). Aptamers that specifically recognize P. mirabilis would have diagnostic and therapeutic values and constitute useful tools for studying membrane-associated proteins in this organism. 
23494620	 Alternative ligands such as nucleic acid aptamers can be used for pathogen capture and detection and offer advantages over antibodies, including reduced cost, ease of production and modification, and improved stability. DNA aptamers demonstrating binding specificity to Salmonella enterica serovar Typhimurium were identified by whole-cell-systematic evolution of ligands by exponential enrichment (SELEX) beginning with a combinatorial library of biotin-labeled single stranded DNA molecules. Aptamer specificity was achieved using whole-cell  counter-SELEX against select non-Salmonella genera. Aptamers binding to Salmonella were sorted, cloned, sequenced, and characterized for binding efficiency. Out of 18 candidate aptamers screened, aptamer S8-7 showed relatively high binding affinity with an apparent dissociation constant (K d value) of 1.73 ± 0.54 μM and was selected for further characterization. Binding exclusivity analysis of S8-7 showed low apparent cross-reactivity with other foodborne bacteria including Escherichia coli O157: H7 and Citrobacter braakii and moderate cross-reactivity with Bacillus cereus. Aptamer S8-7 was successfully used as a ligand for magnetic capture of serially diluted Salmonella Typhimurium cells, followed by downstream detection using qPCR. The lower limit of detection of the  aptamer magnetic capture-qPCR assay was 10(2)-10(3) CFU equivalents of Salmonella Typhimurium in a 290-μl sample volume. Mean capture efficiency ranged from 3.6 to 12.6 %. Unique aspects of the study included (a) the use of SELEX targeting whole cells; (b) the application of flow cytometry for aptamer pool selection, thereby  favoring purification of ligands with both high binding affinity and targeting abundant cell surface moieties; and (c) the use of pre-labeled primers that circumvented the need for post-selection ligand labeling. Taken together, this study provides proof-of-concept that biotinylated aptamers selected by whole-cell SELEX can be used in a qPCR-based capture-detection platform for Salmonella Typhimurium. 
23357235	 Aptamers are powerful capturing probes against various targets such as proteins,  small organic compounds, metal ions, and even cells. In this study, we isolated and characterized single-stranded DNA (ssDNA) aptamers against Escherichia coli.  A total of 28 ssDNAs were isolated after 10 rounds of selection using a bacterial cell-SELEX (systematic evolution of ligands by exponential enrichment) process. Other bacterial species (Klebsiella pneumoniae, Citrobacter freundii, Enterobacter aerogenes, and Staphylococcus epidermidis) were used for counter selection to enhance the selectivity of ssDNA aptamers against E. coli. Finally,  four ssDNA aptamers showed high affinity and selectivity to E. coli, The dissociation constants (K(d)) of these four ssDNA aptamers to E. coli were estimated to range from 12.4 to 25.2 nM. These aptamers did not bind to other bacterial species, including four counter cells, but they showed affinity to different E. coli strains. The binding of these four aptamers to E. coli was observed directly by fluorescence microscopy. 
23301696	 Peptidoglycan (PG), also designated as murein, forms a skeletal mesh within the periplasm of bacterial membrane. PG is a metabolically stable cell architecture in Escherichia coli, but under as yet ill-defined conditions, a portion of PG is  degraded, of which both amino sugar and peptide moieties are either recycled or used as self-generated nutrients for cell growth. At present, the control of PG degradation remains uncharacterized. Using the Genomic SELEX screening system, we identified an uncharacterized transcription factor YcjZ is a repressor of the expression of the initial step enzymes for PG peptide degradation. Under nutrient starvation, the genes encoding the enzymes for PG peptide degradation are derepressed so as to generate amino acids but are tightly repressed at high osmotic conditions so as to maintain the rigid membrane for withstanding the turgor. Taken together, we propose to rename YcjZ as PgrR (regulator of peptide glycan recycling). 
23233451	 The FixJ/LuxR family transcription factor CsgD is a master regulator of biofilm formation in Escherichia coli. Previously, we identified more than 10 transcription factors that participate in regulation of the csgD promoter. After  genomic SELEX screening of regulation targets, an uncharacterized TetR-type transcription factor YbjK was found to be involved in regulation of the csgD promoter. In addition, a number of stress-response genes were found to be under the direct control of YbjK. Taken together, we propose to rename it to RcdA (regulator of csgD). One unique feature of RcdA is its mode of DNA binding. Gel shift, DNase-I footprinting, and atomic force microscopic (AFM) analyses indicated that RcdA is a DNA-binding protein with a high level of cooperativity,  with which it covers the entire surface of probe DNA through protein-protein interaction and moreover it induces the formation of aggregates of DNA-RcdA complexes. 
23075417	 The development of an aptamer-based viability impedimetric sensor for bacteria (AptaVISens-B) is presented. Highly specific DNA aptamers to live Salmonella typhimurium were selected via the cell-systematic evolution of ligands by exponential enrichment (SELEX) technique. Twelve rounds of selection were performed; each comprises a positive selection step against viable S. typhimurium and a negative selection step against heat killed S. typhimurium and a mixture of related pathogens, including Salmonella enteritidis, Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, and Citrobacter freundii to ensure the species specificity of the selected aptamers. The DNA sequence showing the highest binding affinity to the bacteria was further integrated into an impedimetric sensor via self-assembly onto a gold nanoparticle-modified screen-printed carbon electrode (GNP-SPCE). Remarkably, this aptasensor is highly selective and can successfully detect S. typhimurium down to 600 CFU mL(-1) (equivalent to 18 live cells in 30 μL of assay volume) and distinguish it from other Salmonella species, including S. enteritidis and S. choleraesuis. This report is envisaged to open a new venue for the aptamer-based viability sensing of a variety of microorganisms, particularly viable but nonculturable (VBNC) bacteria, using a rapid, economic, and label-free electrochemical platform. 
22996052	 To expand the chemical array available for DNA sequences in the context of in vitro selection, I present herein the synthesis of five nucleoside triphosphate analogues containing side chains capable of organocatalysis. The synthesis involved the coupling of L-proline-containing residues (dU(tP)TP and dU(cP)TP), a dipeptide (dU(FP)TP), a urea derivative (dU(Bpu)TP), and a sulfamide residue (dU(Bs)TP) to a suitably protected common intermediate, followed by triphosphorylation. These modified dNTPs were shown to be excellent substrates for the Vent (exo(-)) and Pwo DNA polymerases, as well as the Klenow fragment of  E. coli DNA polymerase I, although they were only acceptable substrates for the 9°N(m) polymerase. All of the modified dNTPs, with the exception of dU(Bpu)TP, were readily incorporated into DNA by the polymerase chain reaction (PCR). Modified oligonucleotides efficiently served as templates for PCR for the regeneration of unmodified DNA. Thermal denaturation experiments showed that these modifications are tolerated in the major groove. Overall, these heavily modified dNTPs are excellent candidates for SELEX. 
22971146	 The development of an aptamer-based impedimetric sensor for typing of bacteria (AIST-B) is presented. Highly specific DNA aptamers to Salmonella enteritidis were selected via Cell-SELEX technique. Twelve rounds of selection were performed; each comprises a positive selection step against S. enteritidis and a  negative selection step against a mixture of related pathogens, including Salmonella typhimurium, Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, and Citrobacter freundii, to ensure the species-specificity of the selected aptamers. After sequencing of the pool showing the highest binding affinity to S. enteritidis, a DNA sequence of high affinity to the bacteria was integrated into an impedimetric sensor via self-assembly onto a gold nanoparticles-modified screen-printed carbon electrode (GNPs-SPCE). Remarkably, this aptasensor is highly selective and can successfully detect S. enteritidis down to 600 CFU mL(-1) (equivalent to 18 CFU in 30 μL assay volume) in 10 min and distinguish it from other Salmonella species, including S. typhimurium and S. choleraesuis. This report is envisaged to open a new venue for the aptamer-based  typing of a variety of microorganisms using a rapid, economic, and label-free electrochemical platform. 
22688431	 Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses each  and every year. Prevention of such outbreaks and minimization of the impact of an ongoing epidemic place an ever-increasing demand for analytical methods that can  accurately identify culprit pathogens at the earliest stage. Although there is a  large array of effective methods for pathogen detection, none of them can satisfy all the following five premier requirements embodied for an ideal detection method: high specificity (detecting only the bacterium of interest), high sensitivity (capable of detecting as low as a single live bacterial cell), short  time-to-results (minutes to hours), great operational simplicity (no need for lengthy sampling procedures and the use of specialized equipment), and cost effectiveness. For example, classical microbiological methods are highly specific but require a long time (days to weeks) to acquire a definitive result.(1) PCR- and antibody-based techniques offer shorter waiting times (hours to days), but they require the use of expensive reagents and/or sophisticated equipment.(2-4) Consequently, there is still a great demand for scientific research towards developing innovative bacterial detection methods that offer improved characteristics in one or more of the aforementioned requirements. Our laboratory is interested in examining the potential of DNAzymes as a novel class of molecular probes for biosensing applications including bacterial detection.(5) DNAzymes (also known as deoxyribozymes or DNA enzymes) are man-made single-stranded DNA molecules with the capability of catalyzing chemical reactions.(6-8) These molecules can be isolated from a vast random-sequence DNA pool (which contains as many as 10(16) individual sequences) by a process known as "in vitro selection" or "SELEX" (systematic evolution of ligands by exponential enrichment).(9-16) These special DNA molecules have been widely examined in recent years as molecular tools for biosensing applications.(6-8) Our laboratory has established in vitro selection procedures for isolating RNA-cleaving fluorescent DNAzymes (RFDs; Fig. 1) and investigated the use of RFDs as analytical tools.(17-29) RFDs catalyze the cleavage of a DNA-RNA chimeric substrate at a single ribonucleotide junction (R) that is flanked by a fluorophore (F) and a quencher (Q). The close proximity of F and Q renders the uncleaved substrate minimal fluorescence. However, the cleavage event leads to the separation of F and Q, which is accompanied by significant increase of fluorescence intensity. More recently, we developed a method of isolating RFDs for bacterial detection.(5) These special RFDs were isolated to "light up" in the presence of the crude extracellular mixture (CEM) left behind by a specific type  of bacteria in their environment or in the media they are cultured (Fig. 1). The  use of crude mixture circumvents the tedious process of purifying and identifying a suitable target from the microbe of interest for biosensor development (which could take months or years to complete). The use of extracellular targets means the assaying procedure is simple because there is no need for steps to obtain intracellular targets. Using the above approach, we derived an RFD that cleaves its substrate (FS1; Fig. 2A) only in the presence of the CEM produced by E. coli  (CEM-EC).(5) This E. coli-sensing RFD, named RFD-EC1 (Fig. 2A), was found to be strictly responsive to CEM-EC but nonresponsive to CEMs from a host of other bacteria (Fig. 3). Here we present the key experimental procedures for setting up E. coli detection assays using RFD-EC1 and representative results. 
22442305	 The BasS-BasR two-component system is known as an iron- and zinc-sensing transcription regulator in Escherichia coli, but so far only a few genes have been identified to be under the direct control of phosphorylated BasR. Using Genomic SELEX (systematic evolution of ligands by exponential enrichment) screening, we have identified a total of at least 38 binding sites of phosphorylated BasR on the E. coli genome, and based on the BasR-binding sites, have predicted more than 20 novel targets of regulation. By DNase I footprint analysis for high-affinity BasR-binding sites, a direct repeat of a TTAAnnTT sequence was identified as the BasR box. Transcription regulation in vivo of the  target genes was confirmed after Northern blot analysis of target gene mRNAs from both wild-type E. coli and an otherwise isogenic basR deletion mutant. The BasR regulon can be classified into three groups of genes: group 1 includes the genes  for the formation and modification of membrane structure; group 2 includes genes  for modulation of membrane functions; and group 3 includes genes for stress-response cell functions, including csgD, the master regulator of biofilm formation. 
22166202	 Escherichia coli (E. coli) O157:H7 is a major foodborne pathogen that causes life-threatening symptoms in humans worldwide. To rapidly and properly identify the pathogen and avoid its toxic effects, ligands which can directly and specifically bind to the virulent E. coli O157:H7 serotype should be identified.  In this study, a RNA aptamer-based ligand which can specifically distinguish the  pathogen E. coli O157:H7 from others was developed by a subtractive cell-SELEX method. To this end, an RNA library was first incubated with the E. coli K12 strain, and the RNAs binding to the strain were discarded. The precluded RNAs were then used for the selection of O157:H7-specific aptamers. After 6 rounds of  the subtractive cell-SELEX process, the selected aptamer was found to specifically bind to the O157:H7 serotype, but not to the K12 strain. This was evidenced by aptamer-immobilized ELISA, real-time PCR analysis, or an aptamer-linked precipitation experiment. Importantly, the isolated RNA aptamer that distinguishes between the virulent serotype and the nonpathogenic strain specifically bound to an O157:H7-specific lipopolysaccharide which includes the O antigen. This novel O157:H7-specific aptamer could be of potential application as a diagnostic ligand against the pathogen-related food borne illness. 
22058017	 The entrance of influenza virus into host cells is facilitated by the attachment  of the globular region of viral hemagglutinin to the sialic acid receptors on host cell surfaces. In this study, we have cloned the cDNA fragment encoding the  entire globular region (residues 101-257) of hemagglutinin of the H9N2 type avian influenza virus (A/ck/Korea/ms96/96). The protein segment (denoted as the H9 peptide), which was expressed and purified in E. coli, was used for the immunization of BALB/c mice to obtain the anti-H9 antiserum. To identify specific DNA aptamers with high affinity to H9 peptide, we conducted the SELEX method; 19  aptamers were newly isolated. A random mixture of these aptamers showed an increased level of binding affinity to the H9 peptide. The sequence alignment analysis of these aptamers revealed that 6 aptamers have highly conserved consensus sequences. Among these, aptamer C7 showed the highest similarity to the consensus sequences. Therefore, based on the C7 aptamer, we synthesized a new modified aptamer designated as C7-35M. This new aptamer showed strong binding capability to the viral particles. Furthermore, it could prevent MDCK cells from  viral infection by strong binding to the viral particles. These results suggest that our aptamers can recognize the hemagglutinin protein of avian influenza virus and inhibit the binding of the virus to target receptors required for the penetration of host cells. 
22053080	 Bacterial Hfq is a protein that plays an important role in the regulation of genes in cooperation with sRNAs. Escherichia coli Hfq (EcHfq) has two or more sites that bind RNA(s) including U-rich and/or the poly(A) tail of mRNA. However, functional and structural information about Bacillus subtilis Hfq (BsHfq) including the RNA sequences that specifically bind to it remain unknown. Here, we describe RNA aptamers including fragment (AG)(3)A that are recognized by BsHfq and crystal structures of the BsHfq-(AG)(3)A complex at 2.2 Å resolution. Mutational and structural studies revealed that the RNA fragment binds to the distal site, one of the two binding sites on Hfq, and identified amino acid residues that are critical for sequence-specific interactions between BsHfq and (AG)(3)A. In particular, R32 appears to interact with G bases in (AG)(3)A. Poly(A) also binds to the distal site of EcHfq, but the overall RNA structure and protein-RNA interaction patterns engaged in the R32 residues of BsHfq-(AG)(3)A differ from those of EcHfq-poly(A). These findings provide novel insight into how the Hfq homologue recognizes RNA. 
22039053	 Most uncomplicated urinary tract infections (UTIs) are caused by uropathogenic Escherichia coli (UPEC). Both motility and adherence are integral to UTI pathogenesis, yet they represent opposing forces. Therefore, it is logical to reciprocally regulate these functions. In UPEC strain CFT073, PapX, a non-structural protein encoded by one of the two pap operons encoding P fimbria adherence factor, represses flagella-mediated motility and is a putative member of the winged helix transcription factor family. The mechanism of this repression, however, is not understood. papX is found preferentially in more virulent UPEC isolates, being significantly more prevalent in pyelonephritis strains (53% of isolates) than in asymptomatic bacteriuria (32%) or fecal/commensal (12.5%) strains. To examine PapX structure-function, we generated papX linker insertion and site-directed mutants, which identified two key residues for PapX function (Lys(54) and Arg(127)) within domains predicted by modeling with I-TASSER software to be important for dimerization and DNA binding, respectively. To determine the PapX binding site in the CFT073 genome, systematic evolution of ligands by exponential enrichment (SELEX) in conjunction with high throughput sequencing was utilized for the first time to determine a novel binding site for a bacterial transcription factor. This method identified a 29-bp binding site within the flhDC promoter (TTACGGTGAGTTATTTTAACTGTGCGCAA), centered  410 bp upstream of the flhD translational start site. Gel shift experiments demonstrated that PapX binds directly to this site to repress transcription of flagellar genes. 
21883529	 LeuO, the regulator of leucine biosynthesis operon of Escherichia coli, is involved in the regulation of as yet unspecified genes affecting the stress response and pathogenesis expression. To get insights into the regulatory role(s) of LeuO, Genomic SELEX screening has been performed to identify the whole set of  its regulation targets. A total of 140 LeuO-binding sites were identified on the  E. coli genome, of which as many as 133 (95%) were found to contain the binding sites of H-NS, the universal silencer of stress-response genes, supporting the concept that LeuO plays an antagonistic role with anti-silencing activity. Western blot analysis indicated that H-NS predominates in growing phase; however, after prolonged culture for 1 week, H-NS decreased instead LeuO increased, supporting the anti-silencing role of LeuO. In concert with this model, a set of  stress-response genes including cryptic chaperone/usher-type fimbriae operons are under the control of antagonistic interplay between LeuO and H-NS. Confocal laser scanning microscopic observation in flow-chambers showed that the mutants lacking leuO and some fimbriae genes are defective in biofilm formation or form altered biofilm architecture. Taken together we propose that LeuO is a major player in antagonistic interplay against the universal silencer H-NS. 
21839093	 Using a recombinant, T=1 Satellite Tobacco Necrosis Virus (STNV)-like particle expressed in Escherichia coli, we have established conditions for in vitro disassembly and reassembly of the viral capsid. In vivo assembly is dependent on  the presence of the coat protein (CP) N-terminal region, and in vitro assembly requires RNA. Using immobilised CP monomers under reassembly conditions with "free" CP subunits, we have prepared a range of partially assembled CP species for RNA aptamer selection. SELEX directed against the RNA-binding face of the STNV CP resulted in the isolation of several clones, one of which (B3) matches the STNV-1 genome in 16 out of 25 nucleotide positions, including across a statistically significant 10/10 stretch. This 10-base region folds into a stem-loop displaying the motif ACAA and has been shown to bind to STNV CP. Analysis of the other aptamer sequences reveals that the majority can be folded into stem-loops displaying versions of this motif. Using a sequence and secondary structure search motif to analyse the genomic sequence of STNV-1, we identified 30 stem-loops displaying the sequence motif AxxA. The implication is that there are many stem-loops in the genome carrying essential recognition features for binding STNV CP. Secondary structure predictions of the genomic RNA using Mfold showed that only 8 out of 30 of these stem-loops would be formed in the lowest-energy structure. These results are consistent with an assembly mechanism  based on kinetically driven folding of the RNA. 
21673794	 CRP (cAMP receptor protein), the global regulator of genes for carbon source utilization in the absence of glucose, is the best-studied prokaryotic transcription factor. A total of 195 target promoters on the Escherichia coli genome have been proposed to be under the control of cAMP-bound CRP. Using the newly developed Genomic SELEX screening system of transcription factor-binding sequences, however, we have identified a total of at least 254 CRP-binding sites. Based on their location on the E. coli genome, we predict a total of at least 183 novel regulation target operons, altogether with the 195 hitherto known targets,  reaching to the minimum of 378 promoters as the regulation targets of cAMP-CRP. All the promoters selected from the newly identified targets and examined by using the lacZ reporter assay were found to be under the control of CRP, indicating that the Genomic SELEX screening allowed to identify the CRP targets with high accuracy. Based on the functions of novel target genes, we conclude that CRP plays a key regulatory role in the whole processes from the selective transport of carbon sources, the glycolysis-gluconeogenesis switching to the metabolisms downstream of glycolysis, including tricarboxylic acid (TCA) cycle, pyruvate dehydrogenase (PDH) pathway and aerobic respiration. One unique regulation mode is that a single and the same CRP molecule bound within intergenic regions often regulates both of divergently transcribed operons. 
21627466	 In this study, the first group of single-stranded DNA aptamers that are highly specific to enterotoxigenic Escherichia coli (ETEC) K88 was obtained from an enriched oligonucleotide pool by the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) procedure, during which the K88 fimbriae protein was used as the target and bovine serum albumin as counter targets. These aptamers were applied successfully in the detection of ETEC K88. They were then grouped under different families based on the similarity of their secondary structure and the homology of their primary sequence. Four sequences from different families were deliberately chosen for further characterization by fluorescence analysis. Having the advantage of high sensitivity, fluorescence photometry was selected as single-stranded DNA quantification method during the SELEX process. Aptamers with the highest specificity and affinity were analyzed to evaluate binding ability with E. coli. Since ETEC K88 is the only type of bacterium that expressed abundant K88 fimbriae, the selected aptamers against the K88 fimbriae protein were able to specifically identify ETEC K88 among other bacteria. This method of  detecting ETEC K88 by aptamers can also be applied to bacteria other than ETEC K88. 
21601088	 Synthetic riboswitches have emerged as useful tools for controlling gene expression to reprogram cellular behavior. However, advancing beyond proof-of-principle experiments requires the ability to quickly generate new synthetic riboswitches from RNA libraries. In this chapter, we provide a step-by-step overview of the process of obtaining synthetic riboswitches for use  in Escherichia coli, starting from a randomized RNA library. 
21115656	 Cra (catabolite repressor activator) is a global regulator of the genes for carbon metabolism in Escherichia coli. To gain insights into the regulatory roles of Cra, attempts were made to identify the whole set of regulation targets using  an improved genomic SELEX (systematic evolution of ligands by exponential enrichment) system. Surprisingly, a total of 164 binding sites were identified for Cra, 144 (88%) of which were newly identified. The majority of known targets  were included in the SELEX chip pattern. The promoters examined by the lacZ reporter assay in vivo were all regulated by Cra. These two lines of evidence indicate that a total of as many as 178 promoters are under the control of Cra. The majority of Cra targets are the genes coding for the enzymes involved in central carbon metabolism, covering all the genes for the enzymes involved in glycolysis and metabolism downstream of glycolysis, including the tricarboxylic acid (TCA) cycle and aerobic respiration. Taken together, we propose that Cra plays a key role in balancing the levels of the enzymes for carbon metabolism. 
20809562	 We report here a new small molecule fluorogen and RNA aptamer pair for RNA labeling. The small-molecule fluorogen is designed on the basis of fluorescently  quenched sulforhodamine dye. The SELEX (Systematic Evolution of Ligands by EXponential enrichment) procedure and fluorescence screening in E. coli have been applied to discover the aptamer that can specifically activate the fluorogen with micromolar binding affinity. The systematic mutation and truncation study on the  aptamer structure determined the minimum binding domain of the aptamer. A series  of rationally modified fluorogen analogues have been made to probe the interacting groups of fluorogen with the aptamer. These results led to the design of a much improved fluorogen ASR 7 that displayed a 33-fold increase in the binding affinity for the selected aptamer in comparison to the original ASR 1 and an 88-fold increase in the fluorescence emission after the aptamer binding. This  study demonstrates the value of combining in vitro SELEX and E. coli fluorescence screening with rational modifications in discovering and optimizing new fluorogen-RNA aptamer labeling pairs. 
20545348	 The importance and pervasiveness of naturally occurring regulation of RNA function in biology is increasingly being recognized. A common mechanism uses inducible protein-RNA interactions to shape diverse aspects of cellular RNA fate. Recapitulating this regulatory mode in cells using a novel set of protein-RNA interactions is appealing given the potential to subsequently modulate RNA biology in a manner decoupled from endogenous cellular physiology. Achieving this outcome, however, has previously proven challenging. Here, we describe a ligand-responsive protein-RNA interaction module, which can be used to target a specific RNA for subsequent regulation. Using the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) method, RNA aptamers binding to the bacterial Tet Repressor protein (TetR) with low- to subnanomolar affinities were obtained.  This interaction is reversibly controlled by tetracycline in a manner analogous to the interaction of TetR with its cognate DNA operator. Aptamer minimization and mutational analyses support a functional role for two conserved sequence motifs in TetR binding. As an initial illustration of using this system to achieve protein-based regulation of RNA function in living cells, insertion of a  TetR aptamer into the 5'-UTR of a reporter mRNA confers post-transcriptionally regulated, ligand-inducible protein synthesis in E. coli. Altogether, these results define and validate an inducible protein-RNA interaction module that incorporates desirable aspects of a ubiquitous mechanism for regulating RNA function in Nature and can be used as a foundational interaction for functionally and reversibly controlling the multiple fates of RNA in cells. 
20491932	 The vast majority of experimental data have been accumulated on the transcription regulation of individual genes within a single model prokaryote, Escherichia coli, which form the well-established on-off switch model of transcription by DNA-binding regulatory proteins. After the development of modern high-throughput  experimental systems such as microarray analysis of whole genome transcription and the Genomic SELEX search for the whole set of regulation targets by transcription factors, a number of E. coli promoters are now recognized to be under the control of multiple transcription factors, as in the case of eukaryotes. The number of regulation targets of a single transcription factor has also been found to be more than hitherto recognized, ranging up to hundreds of promoters, genes or operons for several global regulators. The multifactor promoters and the multitarget transcription factors can be assembled into complex networks of transcription regulation, forming hierarchical networks. 
20348540	 An unexpectedly high number of regulatory RNAs have been recently discovered that fine-tune the function of genes at all levels of expression. We employed Genomic  SELEX, a method to identify protein-binding RNAs encoded in the genome, to search for further regulatory RNAs in Escherichia coli. We used the global regulator protein Hfq as bait, because it can interact with a large number of RNAs, promoting their interaction. The enriched SELEX pool was subjected to deep sequencing, and 8865 sequences were mapped to the E. coli genome. These short sequences represent genomic Hfq-aptamers and are part of potential regulatory elements within RNA molecules. The motif 5'-AAYAAYAA-3' was enriched in the selected RNAs and confers low-nanomolar affinity to Hfq. The motif was confirmed  to bind Hfq by DMS footprinting. The Hfq aptamers are 4-fold more frequent on the antisense strand of protein coding genes than on the sense strand. They were enriched opposite to translation start sites or opposite to intervening sequences between ORFs in operons. These results expand the repertoire of Hfq targets and also suggest that Hfq might regulate the expression of a large number of genes via interaction with cis-antisense RNAs. 
20161784	 BACKGROUND: SELEX is a well established in vitro selection tool to analyze the structure of ligand-binding nucleic acid sequences called aptamers. Genomic SELEX transforms SELEX into a tool to discover novel, genomically encoded RNA or DNA sequences binding a ligand of interest, called genomic aptamers. Concerns have been raised regarding requirements imposed on RNA sequences undergoing SELEX selection. METHODOLOGY/PRINCIPAL FINDINGS: To evaluate SELEX and assess the extent of these  effects, we designed and performed a Neutral SELEX experiment omitting the selection step, such that the sequences are under the sole selective pressure of  SELEX's amplification steps. Using high-throughput sequencing, we obtained thousands of full-length sequences from the initial genomic library and the pools after each of the 10 rounds of Neutral SELEX. We compared these to sequences obtained from a Genomic SELEX experiment deriving from the same initial library,  but screening for RNAs binding with high affinity to the E. coli regulator protein Hfq. With each round of Neutral SELEX, sequences became less stable and changed in nucleotide content, but no sequences were enriched. In contrast, we detected substantial enrichment in the Hfq-selected set with enriched sequences having structural stability similar to the neutral sequences but with significantly different nucleotide selection. CONCLUSIONS/SIGNIFICANCE: Our data indicate that positive selection in SELEX acts independently of the neutral selective requirements imposed on the sequences. We  conclude that Genomic SELEX, when combined with high-throughput sequencing of positively and neutrally selected pools, as well as the gnomic library, is a powerful method to identify genomic aptamers. 
20156994	 A systematic search was performed for DNA-binding sequences of YgiP, an uncharacterized transcription factor of Escherichia coli, by using the Genomic SELEX. A total of 688 YgiP-binding loci were identified after genome-wide profiling of SELEX fragments with a high-density microarray (SELEX-chip). Gel shift and DNase-I footprinting assays indicated that YgiP binds to multiple sites along DNA probes with a consensus GTTNATT sequence. Atomic force microscope observation indicated that at low concentrations, YgiP associates at various sites on DNA probes, but at high concentrations, YgiP covers the entire DNA surface supposedly through protein-protein contact. The intracellular concentration of YgiP is very low in growing E. coli cells under aerobic conditions, but increases more than 100-fold to the level as high as the major nucleoid proteins under anaerobic conditions. An E. coli mutant lacking ygiP showed retarded growth under anaerobic conditions. High abundance and large number of binding sites together indicate that YgiP is a nucleoid-associated protein with both architectural and regulatory roles as the nucleoid proteins Fis and IHF. We then propose that YgiP is a novel nucleoid protein of E. coli under anaerobiosis and propose to rename it Dan (DNA-binding protein under anaerobic conditions). 
19633077	 The asc operon of Escherichia coli is one of the cryptic genetic systems for beta-D-galactoside utilization as a carbon source. The ascFB genes for beta-D-galactoside transport and catabolism are repressed by the AscG regulator.  After genomic SELEX screening, AscG was found to recognize and bind the consensus palindromic sequence TGAAACC-GGTTTCA. AscG binding was detected at two sites upstream of the ascFB promoter and at three sites upstream of the prpBC operon for propionate catabolism. In an ascG-disrupted mutant, transcription of ascFB was enhanced, in agreement with the repressor model of AscG. This repression was  indicated to be due to interference of binding of cyclic AMP-CRP to the CRP box,  which overlaps with the AscG-binding site 1, as well as binding of RNA polymerase to the promoter. Under conditions of steady-state E. coli growth in a rich medium, the intracellular level of AscG stayed constant at a level supposedly leading to tight repression of the ascFB operon. The level of prpR, encoding the  activator of prpBCDE, was also increased in the absence of AscG, indicating the involvement of AscG in repression of prpR. Taken together, these data suggest a metabolic link through interplay between the asc and prp operons. 
19496624	 The transactivating responsive (TAR) element is a RNA hairpin located in the 5' untranslated region of HIV-1 mRNA. It is essential for full-length transcription  of the retroviral genome and therefore for HIV-1 replication. Hairpin aptamers that generate highly stable and specific complexes with TAR were previously identified, thus decreasing the level of TAR-dependent expression in cultured cells [Kolb, G., et al. (2006) RNA Biol. 3, 150-156]. We performed genomic SELEX  against TAR using a human RNA library to identify human transcripts that might interact with the retroviral genome through loop-loop interactions and potentially contribute to the regulation of TAR-mediated processes. We identified a genomic aptamer termed a1 that folds as a hairpin with an apical loop complementary to five nucleotides of the TAR hexanucleotide loop. Surface plasmon resonance experiments performed on a truncated or mutated version of the a1 aptamer, in the presence of the Rop protein of Escherichia coli, indicate the formation of a highly stable a1-TAR kissing complex. The 5' ACCCAG loop of a1 constitutes a new motif of interaction with the TAR loop. 
19468044	 The DNA-binding mode of archaeal feast/famine-regulatory proteins (FFRPs), i.e. paralogs of the Esherichia coli leucine-responsive regulatory protein (Lrp), was  studied. Using the method of systematic evolution of ligands by exponential enrichment (SELEX), optimal DNA duplexes for interacting with TvFL3, FL10, FL11 and Ss-LrpB were identified as TACGA[AAT/ATT]TCGTA, GTTCGA[AAT/ATT]TCGAAC, CCGAAA[AAT/ATT]TTTCGG and TTGCAA[AAT/ATT]TTGCAA, respectively, all fitting into the form abcdeWWWedcba. Here W is A or T, and e.g. a and a are bases complementary to each other. Apparent equilibrium binding constants of the FFRPs  and various DNA duplexes were determined, thereby confirming the DNA-binding specificities of the FFRPs. It is likely that these FFRPs recognize DNA in essentially the same way, since their DNA-binding specificities were all explained by the same pattern of relationship between amino-acid positions and base positions to form chemical interactions. As predicted from this relationship, when Gly36 of TvFL3 was replaced by Thr, the b base in the optimal  DNA duplex changed from A to T, and, when Thr36 of FL10 was replaced by Ser, the  b base changed from T to G/A. DNA-binding characteristics of other archaeal FFRPs, Ptr1, Ptr2, Ss-Lrp and LysM, are also consistent with the relationship. 
19429622	 LeuO, a LysR family transcription factor, exists in a wide variety of bacteria of the family Enterobacteriaceae and is involved in the regulation of as yet unidentified genes affecting the stress response and pathogenesis expression. Using genomic screening by systematic evolution of ligands by exponential enrichment (SELEX) in vitro, a total of 106 DNA sequences were isolated from 12 different regions of the Escherichia coli genome. All of the SELEX fragments formed complexes in vitro with purified LeuO. After Northern blot analysis of the putative target genes located downstream of the respective LeuO-binding sequence, a total of nine genes were found to be activated by LeuO, while three genes were  repressed by LeuO. The LeuO target gene collection included several multidrug resistance genes. A phenotype microarray assay was conducted to identify the gene(s) responsible for drug resistance and the drug species that are under the control of the LeuO target gene(s). The results described herein indicate that the yjcRQP operon, one of the LeuO targets, is involved in sensitivity control against sulfa drugs. We propose to rename the yjcRQP genes the sdsRQP genes (sulfa drug sensitivity determinant). 
19105805	 BACKGROUND: Characterizing transcription factor binding motifs is a common bioinformatics task. For transcription factors with variable binding sites, we need to get many suboptimal binding sites in our training dataset to get accurate estimates of free energy penalties for deviating from the consensus DNA sequence. One procedure to do that involves a modified SELEX (Systematic Evolution of Ligands by Exponential Enrichment) method designed to produce many such sequences. RESULTS: We analyzed low stringency SELEX data for E. coli Catabolic Activator Protein (CAP), and we show here that appropriate quantitative analysis improves our ability to predict in vitro affinity. To obtain large number of sequences required for this analysis we used a SELEX SAGE protocol developed by Roulet et al. The sequences obtained from here were subjected to bioinformatic analysis. The resulting bioinformatic model characterizes the sequence specificity of the protein more accurately than those sequence specificities predicted from previous analysis just by using a few known binding sites available in the literature. The consequences of this increase in accuracy for prediction of in vivo binding sites (and especially functional ones) in the E. coli genome are also discussed. We measured the dissociation constants of several putative CAP binding sites by EMSA (Electrophoretic Mobility Shift Assay) and compared the affinities to the bioinformatics scores provided by methods like the weight matrix method and QPMEME (Quadratic Programming Method of Energy Matrix Estimation) trained on known binding sites as well as on the new sites from SELEX SAGE data. We also checked predicted genome sites for conservation in the related species S. typhimurium. We found that bioinformatics scores based on SELEX SAGE data does better in terms of prediction of physical binding energies as well as in detecting functional sites. CONCLUSION: We think that training binding site detection algorithms on datasets  from binding assays lead to better prediction. The improvements in accuracy came  from the unbiased nature of the SELEX dataset rather than from the number of sites available. We believe that with progress in short-read sequencing technology, one could use SELEX methods to characterize binding affinities of many low specificity transcription factors. 
19049862	 Sensitive and specific pre-analytical sample processing methods are needed to enhance our ability to detect and quantify food borne pathogens from complex food and environmental samples. In this study, DNA aptamers were selected and evaluated for the capture and detection of Salmonella enterica serovar. Typhimurium. A total of 66 candidate sequences were enriched against S. Typhimurium outer membrane proteins (OMPs) with counter-selection against Escherichia coli OMPs and lipopolysaccharides (LPS). Specificity of the selected  aptamers was evaluated by gel-shift analysis against S. Typhimurium OMP. Five Salmonella-specific aptamer candidates were selected for further characterization. A dilution-to-extinction capture protocol using pure cultures of S. Typhimurium further narrowed the field to two candidates (aptamers 33 and 45) which showed low-end detection limits of 10-40CFU. DNase protection assays applied to these aptamers confirmed sequence-specific binding to S. Typhimurium OMP preparations, while South-Western blot analysis combined with mass spectrometry identified putative membrane proteins as targets for aptamer binding. Aptamer 33 was bound to magnetic beads and used for the capture of S. Typhimurium seeded into whole carcass chicken rinse samples, followed by detection using quantitative real-time RT-PCR. In a pull-down assay format, detection limits were 10(1)-10(2)CFU S. Typhimurium/9mL rinsate, while in a recirculation format, detection limits were 10(2)-10(3)CFU/25mL rinsate. Reproducible detection at <10(1)S. typhimurium CFU/g was also achieved in spike-and-recovery experiments using bovine feces. The pull-down analysis using aptamer 33 was validated on 3 naturally infected chicken litter samples confirming their applicability in the field. This study demonstrates the applicability of Salmonella specific aptamers for pre-analytical sample processing as applied to food and environmental sample matrices. 
19040357	 Epidermal growth factor receptor variant III (EGFRvIII) is a glycoprotein uniquely expressed in glioblastoma, but not in normal brain tissues. To develop targeted therapies for brain tumors, we selected RNA aptamers against the histidine-tagged EGFRvIII ectodomain, using an Escherichia coli system for protein expression and purification. Representative aptamer E21 has a dissociation constant (Kd) of 33x10(-9) m, and exhibits high affinity and specificity for EGFRvIII in ELISA and surface plasmon resonance assays. However,  selected aptamers cannot bind the same protein expressed from eukaryotic cells because glycosylation, a post-translational modification present only in eukaryotic systems, significantly alters the structure of the target protein. By  transfecting EGFRvIII aptamers into cells, we find that membrane-bound, glycosylated EGFRvIII is reduced and the percentage of cells undergoing apoptosis is increased. We postulate that transfected aptamers can interact with newly synthesized EGFRvIII, disrupt proper glycosylation, and reduce the amount of mature EGFRvIII reaching the cell surface. Our work establishes the feasibility of disrupting protein post-translational modifications in situ with aptamers. This finding is useful for elucidating the function of proteins of interest with  various modifications, as well as dissecting signal transduction pathways. 
18759112	 DNA aptamers were developed against lipopolysaccharide (LPS) from E. coli O111:B4 and shown to bind both LPS and E. coli by a colorimetric enzyme-based microplate  assay. The polyclonal aptamers were coupled to human C1qrs protein either directly using a bifunctional linker or indirectly using biotinylated aptamers and a streptavidin-C1qrs complex. Both systems significantly reduced colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10x dilutions of the bacteria in the presence of human serum; it was diluted 1: 10(3) in order to avoid significant bacterial lysis by the competing alternate pathway  of complement activation. A number of candidate DNA aptamer sequences were cloned and sequenced from the anti-LPS aptamer library for future screening of antibacterial or "antibiotic" potential and to aid in eventual development of an  alternative therapy for antibiotic-resistant bacterial infections. 
18567656	 N-ethylmaleimide (NEM) has been used as a specific reagent of Cys modification in proteins and thus is toxic for cell growth. On the Escherichia coli genome, the nemA gene coding for NEM reductase is located downstream of the gene encoding an  as-yet-uncharacterized transcription factor, YdhM. Disruption of the ydhM gene results in reduction of nemA expression even in the induced state, indicating that the two genes form a single operon. After in vitro genomic SELEX screening,  one of the target recognition sequences for YdhM was identified within the promoter region for this ydhM-nemA operon. Both YdhM binding in vitro to the ydhM promoter region and transcription repression in vivo of the ydhM-nemA operon by YdhM were markedly reduced by the addition of NEM. Taken together, we propose that YdhM is the repressor for the nemA gene, thus hereafter designated NemR. The repressor function of NemR was inactivated by the addition of not only NEM but also other Cys modification reagents, implying that Cys modification of NemR renders it inactive. This is an addition to the mode of controlling activity of transcription factors by alkylation with chemical agents. 
17919280	 Using the genomic SELEX, a total of six Escherichia coli DNA fragments have been  identified, which formed complexes with transcription factor RutR. The RutR regulon was found to include a large number of genes encoding components for not  only degradation of pyrimidines but also transport of glutamate, synthesis of glutamine, synthesis of pyrimidine nucleotides and arginine, and degradation of purines. DNase I footprinting indicated that RutR recognizes a palindromic sequence of TTGACCAnnTGGTCAA. The RutR box in P1 promoter of carAB encoding carbamoyl phosphate synthetase, a key enzyme of pyrimidine synthesis, overlaps with the PepA (CarP) repressor binding site, implying competition between RutR and PepA. Adding either uracil or thymine abolished RutR binding in vitro to the  carAB P1 promoter. Accordingly, in the rutR-deletion mutant or in the presence of uracil, the activation in vivo of carAB P1 promoter was markedly reduced. Northern blot analysis of the RutR target genes indicated that RutR represses the Gad system genes involved in glutamate-dependent acid resistance and allantoin degradation. Altogether we propose that RutR is the pyrimidine sensor and the master regulator for a large set of the genes involved in the synthesis and degradation of pyrimidines. 
17869523	 A covalently modified heteroconjugate between linezolid and neomycin B leads to an enhanced and more specific binding affinity to hairpin RNA targets in comparison to neomycin B itself. This heteroconjugate was used as a lure to select linezolid-specific hairpin RNA from an Escherichia coli genome RNA. The selected RNA obtained after eight cycles not only has typical stem-loop structures but also includes known sequences of the linezolid binding site. The results of RNA footprinting show that the binding site of the heteroconjugate encompasses both stem and loop regions, suggesting that the possible binding site for linezolid is in the terminal loop. In addition, findings from application of  a surface plasmon resonance assay clearly demonstrate that linezolid binds to selected hairpin RNA in a highly specific manner with a low millimolar affinity.  The results suggest that heteroconjugates might represent a generally useful approach in studies aimed at uncovering loop-specific RNA binding ligands that would be otherwise difficult to identify owing to their weak affinities. 
17557822	 The folA gene was identified as a new member of the TyrR regulon by genomic SELEX. Binding of TyrR to two sites in folA activated its transcription. Mutations in the N-terminal or central domain of TyrR, the alpha subunit of RNA polymerase, or integration host factor all abolished activation of the folA promoter. 
17526692	 Csr (carbon storage regulation) of Escherichia coli is a global regulatory system that consists of CsrA, a homodimeric RNA binding protein, two noncoding small RNAs (sRNAs; CsrB and CsrC) that function as CsrA antagonists by sequestering this protein, and CsrD, a specificity factor that targets CsrB and CsrC for degradation by RNase E. CsrA inhibits translation initiation of glgC, cstA, and pgaA by binding to their leader transcripts and preventing ribosome binding. Translation inhibition is thought to contribute to the observed mRNA destabilization. Each of the previously known target transcripts contains multiple CsrA binding sites. A position-specific weight matrix search program was developed using known CsrA binding sites in mRNA. This search tool identified a potential CsrA binding site that overlaps the Shine-Dalgarno sequence of hfq, a gene that encodes an RNA chaperone that mediates sRNA-mRNA interactions. This putative CsrA binding site matched the SELEX-derived binding site consensus sequence in 8 out of 12 positions. Results from gel mobility shift and footprint  assays demonstrated that CsrA binds specifically to this site in the hfq leader transcript. Toeprint and cell-free translation results indicated that bound CsrA  inhibits Hfq synthesis by competitively blocking ribosome binding. Disruption of  csrA caused elevated expression of an hfq'-'lacZ translational fusion, while overexpression of csrA inhibited expression of this fusion. We also found that hfq mRNA is stabilized upon entry into stationary-phase growth by a CsrA-independent mechanism. The interaction of CsrA with hfq mRNA is the first example of a CsrA-regulated gene that contains only one CsrA binding site. 
17513468	 The pyruvate dehydrogenase (PDH) multienzyme complex plays a key role in the metabolic interconnection between glycolysis and the citric acid cycle. Transcription of the Escherichia coli genes for all three components of the PDH complex in the pdhR-aceEF-lpdA operon is repressed by the pyruvate-sensing PdhR,  a GntR family transcription regulator, and derepressed by pyruvate. After a systematic search for the regulation targets of PdhR using genomic systematic evolution of ligands by exponential enrichment (SELEX), we have identified two novel targets, ndh, encoding NADH dehydrogenase II, and cyoABCDE, encoding the cytochrome bo-type oxidase, both together forming the pathway of respiratory electron transport downstream from the PDH cycle. PDH generates NADH, while Ndh and CyoABCDE together transport electrons from NADH to oxygen. Using gel shift and DNase I footprinting assays, the PdhR-binding site (PdhR box) was defined, which includes a palindromic consensus sequence, ATTGGTNNNACCAAT. The binding in  vitro of PdhR to the PdhR box decreased in the presence of pyruvate. Promoter assays in vivo using a two-fluorescent-protein vector also indicated that the newly identified operons are repressed by PdhR and derepressed by the addition of pyruvate. Taken together, we propose that PdhR is a master regulator for controlling the formation of not only the PDH complex but also the respiratory electron transport system. 
17468243	 RstBA, a two-component regulatory system of Escherichia coli with an unidentified regulatory function, is under the control of a Mg(2+)-sensing PhoQP two-component system. In order to identify the network of transcription regulation downstream of RstBA, we isolated a set of RstA-binding sequences from the E. coli genome by  using the genomic SELEX system. A gel mobility shift assay indicated the binding  of RstA to two SELEX DNA fragments, one including the promoter region of asr (acid shock RNA) and another including the promoter for csgD (a regulator of the  curli operon). Using a DNase I footprinting assay, we determined the RstA-binding sites (RstA boxes) with the consensus sequence TACATNTNGTTACA. Transcription of the asr gene was induced 10- to 60-fold either in low-pH (pH 4.5) LB medium or in low-phosphate minimal medium as detected by promoter assay. The acid-induced in vivo transcription of asr was reduced after the deletion of rstA. In vivo transcription of the asr promoter was observed only in the presence of RstA. In agreement with the PhoQP-RstBA network, the addition of Mg(2+) led to a severe reduction of the asr promoter activity, and the disruption of phoP also reduced the asr promoter activity, albeit to a lesser extent. These observations altogether indicate that RstA is an activator of asr transcription. In contrast,  transcription of csgD was repressed by overexpression of RstA, indicating that RstA is a repressor for csgD. With these data taken together, we conclude that the expression of both asr and csgD is under the direct control of the PhoQP-RstBA signal relay cascade. 
17207772	 We identified the 1.6-kb region of Thermus thermophilus plasmid pTT8 capable of autonomous replication, which shows a significant sequence similarity to the replicon regions of the ColE2-related plasmids. We showed the requirement of DNA  polymerase I for pTT8 replication. The putative rep gene coding for the replication initiator protein, Rep, similar to those of the ColE2-related plasmids was cloned into an expression vector. The 6xHis-Rep protein expressed in Escherichia coli was successfully purified by stepwise denaturing with urea and refolding in the presence of glycerol on Ni-resin. We identified the nucleotide sequence recognized by the pTT8 Rep protein by the SELEX experiment using the purified protein, and proposed the existence of the third origin of pTT8 replication different from those predicted previously. 
17169986	 Despite the fact that cold shock domain proteins (CSDPs) and glycine-rich RNA-binding proteins (GRPs) have been implicated to play a role during the cold adaptation process, their importance and function in eukaryotes, including plants, are largely unknown. To understand the functional role of plant CSDPs and GRPs in the cold response, two CSDPs (CSDP1 and CSDP2) and three GRPs (GRP2, GRP4 and GRP7) from Arabidopsis thaliana were investigated. Heterologous expression of CSDP1 or GRP7 complemented the cold sensitivity of BX04 mutant Escherichia coli that lack four cold shock proteins (CSPs) and is highly sensitive to cold stress, and resulted in better survival rate than control cells during incubation at low  temperature. In contrast, CSDP2 and GRP4 had very little ability. Selective evolution of ligand by exponential enrichment (SELEX) revealed that GRP7 does not recognize specific RNAs but binds preferentially to G-rich RNA sequences. CSDP1 and GRP7 had DNA melting activity, and enhanced RNase activity. In contrast, CSDP2 and GRP4 had no DNA melting activity and did not enhance RNAase activity. Together, these results indicate that CSDPs and GRPs help E.coli grow and survive better during cold shock, and strongly imply that CSDP1 and GRP7 exhibit RNA chaperone activity during the cold adaptation process. 
17150737	 We carried out an in vitro selection of RNA aptamers that bind to Escherichia coli release factor 1 (E. coli RF1). The selected aptamer (class II) showed an apparent dissociation constant of nM range. The binding of the class II aptamer with E. coli RF1 is highly specific (orthogonal), allowing selective inhibition of RF1 activity in the E. coli translation system. 
16527537	 The meaning of the word affinity in the context of protein separation has undergone evolutionary changes over the years. The exploitation of molecular recognition phenomenon is no longer limited to affinity chromatography modes. Affinity based separations today include precipitation, membrane based purification and two-phase/three-phase extractions. Apart from the affinity ligands, which have biological relationship (in vivo) with the target protein, a  variety of other ligands are now used in the affinity based separations. These include dyes, chelated metal ions, peptides obtained by phage display technology, combinatorial synthesis, ribosome display methods and by systematic evolution of  ligands by exponential enrichment (SELEX). Molecular modeling techniques have also facilitated the designing of biomimetic ligands. Fusion proteins obtained by recombinatorial methods have emerged as a powerful approach in bioseparation. Overexpression in E. coli often result in inactive and insoluble inclusion bodies. A number of interesting approaches are used for simultaneous refolding and purification in such cases. Proteomics also needs affinity chromatography to  reduce the complexity of the system before analysis by electrophoresis and mass spectrometry are made. At industrial level, validation, biosafety and process hygiene are also important aspects. This overview looks at these evolving paradigms and various strategies which utilize affinity phenomenon for protein separations. 
16131593	 The global Csr regulatory system controls bacterial gene expression post-transcriptionally. CsrA of Escherichia coli is an RNA binding protein that plays a central role in repressing several stationary phase processes and activating certain exponential phase functions. CsrA regulates translation initiation of several genes by binding to the mRNA leaders and blocking ribosome  binding. CsrB and CsrC are noncoding regulatory RNAs that are capable of sequestering CsrA and antagonizing its activity. Each of the known target transcripts contains multiple CsrA binding sites, although considerable sequence  variation exists among these RNA targets, with GGA being the most highly conserved element. High-affinity RNA ligands containing single CsrA binding sites were identified from a combinatorial library using systematic evolution of ligands by exponential enrichment (SELEX). The SELEX-derived consensus was determined as RUACARGGAUGU, with the ACA and GGA motifs being 100% conserved and  the GU sequence being present in all but one ligand. The majority (51/55) of the  RNAs contained GGA in the loop of a hairpin within the most stable predicted structure, an arrangement similar to several natural CsrA binding sites. Strikingly, the identity of several nucleotides that were predicted to form base  pairs in each stem were 100% conserved, suggesting that primary sequence information was embedded within the base-paired region. The affinity of CsrA for  several selected ligands was measured using quantitative gel mobility shift assays. A mutational analysis of one selected ligand confirmed that the conserved ACA, GGA, and GU residues were critical for CsrA binding and that RNA secondary structure participates in CsrA-RNA recognition. 
16115199	 Cra (or FruR), a global transcription factor with both repression and activation  activities, controls a large number of the genes for glycolysis and gluconeogenesis. To get insights into the entire network of transcription regulation of the E. coli genome by Cra, we isolated a set of Cra-binding sequences using an improved method of genomic SELEX. From the DNA sequences of 97 independently isolated DNA fragments by SELEX, the Cra-binding sequences were identified in a total of ten regions on the E. coli genome, including promoters of six known genes and four hitherto-unidentified genes. All six known promoters  are repressed by Cra, but none of the activation-type promoters were cloned after two cyles of SELEX, because the Cra-binding affinity to the repression-type promoters is higher than the activation-type promoters, as determined by the quantitative gel shift assay. Of a total of four newly identified Cra-binding sequences, two are associated with promoter regions of the gapA (glyceraldehyde 3-phosphate dehydrogenase) and eno (enolase) genes, both involved in sugar metabolism. The regulation of newly identified genes by Cra was confirmed by the  in vivo promoter strength assay using a newly developed TFP (two-fluorescent protein) vector for promoter assay or by in vitro transcription assay in the presence of Cra protein. 
15101820	 Tomato (Lycopersicon esculantum) ASR1 (abscisic acid stress ripening protein), a  small plant-specific protein whose cellular mode of action defies deduction based on its sequence or homology analyses, is one of numerous plant gene products with unknown biological roles that become over-expressed under water- and salt-stress  conditions. Steady-state cellular levels of tomato ASR1 mRNA and protein are transiently increased following exposure of plants to poly(ethylene glycol), NaCl or abscisic acid. Western blot and indirect immunofluorescence analysis with anti-ASR1 antibodies demonstrated that ASR1 is present both in the cytoplasmic and nuclear subcellular compartments; approx. one-third of the total ASR1 protein could be detected in the nucleus. Nuclear ASR1 is a chromatin-bound protein, and  can be extracted with 1 M NaCl, but not with 0.5% Triton X-100. ASR1, overexpressed in Escherichia coli and purified to homogeneity, possesses zinc-dependent DNA-binding activity. Competitive-binding experiments and SELEX (systematic evolution of ligands by exponential enrichment) analysis suggest that ASR1 binds at a preferred DNA sequence. 
12324455	 Regulation of messenger RNA stability by AU-rich elements is an important means of regulating genes induced by growth factors and cytokines. Nup475 (also known as tristetraprolin, or TIS11) is the prototype for a family of zinc-binding Cys(3)His motif proteins required for proper regulation of tumor necrosis factor  mRNA stability in macrophages. We developed an Escherichia coli expression system to produce soluble Nup475 protein in quantity to study its RNA binding properties. Nup475 protein bound a tumor necrosis factor AU-rich element over a broad range of pH and salt concentrations by RNA gel shift. This binding was inhibited by excess zinc metal, providing a potential mechanism for previous reports of zinc stabilization of AU-rich element (ARE) containing messenger RNAs. Immobilized Nup475 protein was used to select its optimal binding site by RNA SELEX and revealed a strong preference for the extended sequence UUAUUUAUU, rather than a simple AUUUA motif. These findings were confirmed by site-directed  mutagenesis of the tumor necrosis factor ARE and RNA gel shifts on c-fos, interferon-gamma, and interferon-beta ARE fragments. A weaker binding activity toward adenine-rich sites, such as a poly(A) tail RNA fragment, can partially disrupt the Nup475-tumor necrosis factor AU-rich element complex. 
9813115	 A major mode of gene regulation occurs via the binding of specific proteins to specific DNA sequences. The availability of complete bacterial genome sequences offers an unprecedented opportunity to describe networks of such interactions by  correlating existing experimental data with computational predictions. Of the 240 candidate Escherichia coli DNA-binding proteins, about 55 have DNA-binding sites  identified by DNA footprinting. We used these sites to construct recognition matrices, which we used to search for additional binding sites in the E. coli genomic sequence. Many of these matrices show a strong preference for non-coding  DNA. Discrepancies are identified between matrices derived from natural sites and those derived from SELEX (Systematic Evolution of Ligands by Exponential enrichment) experiments. We have constructed a database of these proteins and binding sites, called DPInteract (available at http://arep.med.harvard.edu/dpinteract). 
8652576	 T4 RegB endonuclease specifically cleaves at -GGAG- sites in several early T4 messages, rendering them nonfunctional. Not all -GGAG- sites are processed equally by RegB; those found at the Shine-Dalgarno sequences and in intercistronic regions are processed with higher efficiency than the -GGAG- sites located in coding regions. The low activity of RegB observed in vitro is enhanced by 1-2 orders of magnitude by the Escherichia coli ribosomal protein S1. We have  used SELEX (systematic evolution of ligands by exponential enrichment) on a combinatorial RNA library to obtain molecules that are specifically cleaved by T4 RegB endonuclease in the presence of S1. The sequences obtained contain the required -GGAG- tetranucleotide and were unusually enriched in adenosine and cytosine nucleotides. No consensus structure or sequence motif other than -GGAG-  was conserved among the selected molecules. The majority of the RNAs are entirely dependent on S1 for RegB-catalyzed cleavage; however, a few RNAs are found to be  S1 independent but are cleaved by RegB with much lower rates. 
8568875	 The SELEX procedure was used to study the recognition between the E. coli methionine repressor (MetJ) and its DNA binding sites. DNA ligands with high affinity for either the holo-repressor or apo-repressor were isolated from a pool of molecules randomized over 20 base-pairs. Among 90 DNA ligands selected by holo-repressor binding, roughly 90% contain variations of two tandem, perfect eight base-pair Met-boxes, which are the consensus deduced from natural met operators. Base-pairs that are important, for specific interactions with the protein are highly conserved. The data also reveal the importance of the non-contacted operator base-pairs in facilitating the conformational changes in the operator which must occur for repressor binding. There are also effects due to the sequences of the base-pairs immediately flanking the operator site. DNA ligands selected by apo-repressor share a very similar, but not identical, consensus with that selected by holo-repressor, suggesting that the corepressor does not greatly alter the specificity of repressor binding.