1. mSystems. 2018 Feb 13;3(1). pii: e00172-17. doi: 10.1128/mSystems.00172-17.
eCollection 2018 Jan-Feb.

Altered Distribution of RNA Polymerase Lacking the Omega Subunit within the
Prophages along the Escherichia coli K-12 Genome.

Yamamoto K(1)(2), Yamanaka Y(2), Shimada T(2)(3), Sarkar P(1)(4), Yoshida M(1),
Bhardwaj N(4), Watanabe H(1), Taira Y(1), Chatterji D(4), Ishihama A(2).

Author information: 
(1)Department of Frontier Bioscience, Hosei University, Tokyo, Japan.
(2)Micro-Nano Technology Research Center, Hosei University, Tokyo, Japan.
(3)Meiji University, School of Agriculture, Kawasaki, Kanagawa, Japan.
(4)Indian Institute of Science, Molecular Biophysics Unit, Bangalore, India.

The RNA polymerase (RNAP) of Escherichia coli K-12 is a complex enzyme consisting
of the core enzyme with the subunit structure α2ββ'ω and one of the σ subunits
with promoter recognition properties. The smallest subunit, omega (the rpoZ gene 
product), participates in subunit assembly by supporting the folding of the
largest subunit, β', but its functional role remains unsolved except for its
involvement in ppGpp binding and stringent response. As an initial approach for
elucidation of its functional role, we performed in this study ChIP-chip
(chromatin immunoprecipitation with microarray technology) analysis of wild-type 
and rpoZ-defective mutant strains. The altered distribution of RpoZ-defective
RNAP was identified mostly within open reading frames, in particular, of the
genes inside prophages. For the genes that exhibited increased or decreased
distribution of RpoZ-defective RNAP, the level of transcripts increased or
decreased, respectively, as detected by reverse transcription-quantitative PCR
(qRT-PCR). In parallel, we analyzed, using genomic SELEX (systemic evolution of
ligands by exponential enrichment), the distribution of constitutive promoters
that are recognized by RNAP RpoD holoenzyme alone and of general silencer H-NS
within prophages. Since all 10 prophages in E. coli K-12 carry only a small
number of promoters, the altered occupancy of RpoZ-defective RNAP and of
transcripts might represent transcription initiated from as-yet-unidentified host
promoters. The genes that exhibited transcription enhanced by RpoZ-defective RNAP
are located in the regions of low-level H-NS binding. By using phenotype
microarray (PM) assay, alterations of some phenotypes were detected for the
rpoZ-deleted mutant, indicating the involvement of RpoZ in regulation of some
genes. Possible mechanisms of altered distribution of RNAP inside prophages are
discussed. IMPORTANCE The 91-amino-acid-residue small-subunit omega (the rpoZ
gene product) of Escherichia coli RNA polymerase plays a structural role in the
formation of RNA polymerase (RNAP) as a chaperone in folding the largest subunit 
(β', of 1,407 residues in length), but except for binding of the stringent signal
ppGpp, little is known of its role in the control of RNAP function. After
analysis of genomewide distribution of wild-type and RpoZ-defective RNAP by the
ChIP-chip method, we found alteration of the RpoZ-defective RNAP inside open
reading frames, in particular, of the genes within prophages. For a set of the
genes that exhibited altered occupancy of the RpoZ-defective RNAP, transcription 
was found to be altered as observed by qRT-PCR assay. All the observations here
described indicate the involvement of RpoZ in recognition of some of the prophage
genes. This study advances understanding of not only the regulatory role of omega
subunit in the functions of RNAP but also the regulatory interplay between
prophages and the host E. coli for adjustment of cellular physiology to a variety
of environments in nature.

DOI: 10.1128/mSystems.00172-17 
PMCID: PMC5811629
PMID: 29468196 


2. J Nanosci Nanotechnol. 2018 Mar 1;18(3):1599-1605. doi: 10.1166/jnn.2018.14212.

Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic
Bacteria Vibrio parahaemolyticus.

Ahn JY(1), Lee KA(1), Lee MJ(1), Sekhon SS(1), Rhee SK(1), Cho SJ(1), Ko JH(2),
Lee L(2), Han J(2), Kim SY(3), Min J(4), Kim YH(1).

Author information: 
(1)School of Biological Sciences, Chungbuk National University 1 Chungdae-Ro,
Seowon-Gu, Cheongju 28644, South Korea.
(2)College of Veterinary Medicine, Western University of Health Sciences, Pomona 
CA 91766, USA.
(3)Department of Food Science and Biotechnology, Shin Ansan University, 135,
Sinansandaehak-ro, Danwon-Gu, Ansan 425-792, South Korea.
(4)Department of Bioprocess Engineering, Chonbuk National University, 567
Baekje-daero, Deokjin-Gu Jeonju, Jeonbuk 54896, South Korea.

In this paper, whole-bacteria SELEX (WB-SELEX) strategy was adopted to isolate
specific aptamers against Vibrio parahaemolyticus. Round selection for V.
parahaemolyticus was conducted 11 rounds, including two negative selection
rounds. It was determined through real-time PCR amplification and post-SELEX
experiment. The selected aptmers had high binding property and specificity to V. 
parahaemolyticus. Of 28 aptamers tested, VPCA-apta#1 had the highest binding
affinity compared to other aptamer candidates obtained. To detect V.
parahaemolyticus, aptamer based SPR biosensor platform was constructed and
pathogenic bacteria sensing was conducted in two steps. The first step was to
construct 5'-biotinylated VPCA-apta#1 binding probe. The second step was to
incubate V. parahaemolyticus and test microbes in functionalized SA sensor chip
in parallel. Our platform showed significant activity for detecting and
discriminating V. parahaemolyticus from other enteric species such as Escherichia
coli, Listeria monocytogenes, Sigella sonnei, and Vibrio fischeri. This is the
first report on the use of whole-SELEX to isolate DNA aptamers specific for V.
parahaemolyticus. We demonstrated the feasibility of using aptamer platform for
the detection of V. parahaemolyticus in various food supplies. It might be used
in multiple points of care for diagnosing Vibriosis.

DOI: 10.1166/jnn.2018.14212 
PMID: 29448635 


3. J Biotechnol. 2018 Jan 20;266:39-49. doi: 10.1016/j.jbiotec.2017.12.011. Epub
2017 Dec 12.

Whole-bacterium SELEX of DNA aptamers for rapid detection of E.coli O157:H7 using
a QCM sensor.

Yu X(1), Chen F(2), Wang R(3), Li Y(4).

Author information: 
(1)Cell and Molecular Biology Program, University of Arkansas, Fayetteville, AR, 
72701, USA.
(2)Rice Research Center, Shenyang Agricultural University, Shenyang, China.
(3)Department of Biological & Agricultural Engineering, University of Arkansas,
Fayetteville, AR, 72701, USA.
(4)Cell and Molecular Biology Program, University of Arkansas, Fayetteville, AR, 
72701, USA; Department of Biological & Agricultural Engineering, University of
Arkansas, Fayetteville, AR, 72701, USA; Center of Excellence for Poultry Science,
University of Arkansas, Fayetteville, AR, 72701, USA. Electronic address:
yanbinli@uark.edu.

The rapid detection of foodborne pathogens is critical to ensure food safety. The
objective of this study is to select aptamers specifically bound to Escherichia
coli O157:H7 using the whole-bacterium SELEX (Systematic Evolution of Ligands by 
Exponential Enrichment) and apply the selected aptamer to a QCM (quartz crystal
microbalance) sensor for rapid and sensitive detection of target bacteria. A
total of 19 rounds of selection against live E. coli O157:H7 and 6 rounds of
counter selection against a mixture of Staphylococcus aureus, Listeria
monocytogenes, and Salmonella Typhimurium, were performed. The aptamer pool from 
the last round was cloned and sequenced. One sequence S1 that appeared 16 times
was characterized and a dissociation constant (Kd) of 10.30nM was obtained.
Subsequently, a QCM aptasensor was developed for the rapid detection of E. coli
O157:H7. The limit of detection (LOD) and the detection time of the aptasensor
was determined to be 1.46×103 CFU/ml and 50min, respectively. This study
demonstrated that the ssDNA aptamer selected by the whole-bacterium SELEX
possessed higher sensitivity than previous work and the potential use of the
constructed QCM aptasensor in rapid screening of foodborne pathogens.

Copyright © 2017 Elsevier B.V. All rights reserved.

DOI: 10.1016/j.jbiotec.2017.12.011 
PMID: 29242148 


4. FEMS Microbiol Lett. 2017 Dec 1;364(22). doi: 10.1093/femsle/fnx220.

Regulatory role of XynR (YagI) in catabolism of xylonate in Escherichia coli
K-12.

Shimada T(1)(2), Momiyama E(3), Yamanaka Y(1)(3), Watanabe H(3), Yamamoto
K(1)(3), Ishihama A(1)(3).

Author information: 
(1)Research Center for Micro-Nano Technology, Hosei University, Kajino-cho 3-7-2,
Koganei, Tokyo 184-0003, Japan.
(2)School of Agriculture, Meiji University, Tama-ku, Kawasaki, Kanagawa 214-8571,
Japan.
(3)Department of Frontier Bioscience, Hosei University, Kajino-cho 3-7-2,
Koganei, Tokyo 184-0003, Japan.

The genome of Escherichia coli K-12 contains ten cryptic phages, altogether
constituting about 3.6% of the genome in sequence. Among more than 200 predicted 
genes in these cryptic phages, 14 putative transcription factor (TF) genes exist,
but their regulatory functions remain unidentified. As an initial attempt to make
a breakthrough for understanding the regulatory roles of cryptic phage-encoded
TFs, we tried to identify the regulatory function of CP4-6 cryptic
prophage-encoded YagI with unknown function. After SELEX screening, YagI was
found to bind mainly at a single site within the spacer of bidirectional
transcription units, yagA (encoding another uncharacterized TF) and yagEF
(encoding 2-keto-3-deoxy gluconate aldolase, and dehydratase, respectively)
within this prophage region. YagEF enzymes are involved in the catabolism of
xylose downstream from xylonate. We then designated YagI as XynR (regulator of
xylonate catabolism), one of the rare single-target TFs. In agreement with this
predicted regulatory function, the activity of XynR was suggested to be
controlled by xylonate. Even though low-affinity binding sites of XynR were
identified in the E. coli K-12 genome, they all were inside open reading frames, 
implying that the regulation network of XynR is still fixed within the CR4-6
prophage without significant influence over the host E. coli K-12.

© FEMS 2017. All rights reserved. For permissions, please e-mail:
journals.permissions@oup.com.

DOI: 10.1093/femsle/fnx220 
PMID: 29087459  [Indexed for MEDLINE]


5. J Gen Appl Microbiol. 2018 Jan 15;63(6):311-324. doi: 10.2323/jgam.2017.01.002.
Epub 2017 Sep 12.

Building a complete image of genome regulation in the model organism Escherichia 
coli.

Ishihama A(1).

Author information: 
(1)Research Institute of Micro-Nano Technology, Hosei University.

The model organism, Escherichia coli, contains a total of more than 4,500 genes, 
but the total number of RNA polymerase (RNAP) core enzyme or the transcriptase is
only about 2,000 molecules per genome. The regulatory targets of RNAP are,
however, modulated by changing its promoter selectivity through two-steps of
protein-protein interplay with 7 species of the sigma factor in the first step,
and then 300 species of the transcription factor (TF) in the second step.
Scientists working in the field of prokaryotic transcription in Japan have made
considerable contributions to the elucidation of genetic frameworks and
regulatory modes of the genome transcription in E. coli K-12. This review
summarizes the findings by this group, first focusing on three sigma factors, the
stationary-phase sigma RpoS, the heat-shock sigma RpoH, and the
flagellar-chemotaxis sigma RpoF, as examples. It also presents an overview of the
current state of the systematic research being carried out to identify the
regulatory functions of all TFs from a single and the same bacterium E. coli
K-12, using the genomic SELEX and PS-TF screening systems. All these studies have
been undertaken with the aim of understanding the genome regulation in E. coli
K-12 as a whole.

DOI: 10.2323/jgam.2017.01.002 
PMID: 28904250 


6. Anal Biochem. 2017 Nov 1;536:36-44. doi: 10.1016/j.ab.2017.08.005. Epub 2017 Aug 
14.

DNA aptamer identification and characterization for E. coli O157 detection using 
cell based SELEX method.

Amraee M(1), Oloomi M(2), Yavari A(1), Bouzari S(1).

Author information: 
(1)Department of Molecular Biology, Pasteur Institute of Iran, Pasteur Ave.,
Tehran 13164, Iran.
(2)Department of Molecular Biology, Pasteur Institute of Iran, Pasteur Ave.,
Tehran 13164, Iran. Electronic address: manaoloomi@yahoo.com.

Escherichia coli (E. coli) O157:H7 is a foodborne pathogen that causes symptoms
in humans. Its rapid identification should be considered to avoid toxic effects
of the pathogen. In this study, systematic evolution of ligands by exponential
enrichment using whole cells (Cell-SELEX) method was used for recognizing E. coli
strain, O157 by single-stranded DNA library of aptamer. Nine rounds of cell-selex
procedure were applied using O157, as a whole-cell target, with O42, K12, Top10, 
DH5α E. coli cells, Shigella flexneri and Salmonella typhi as counterparts. The
specific interaction between selected DNA aptamers and targeted cell was
assessed. After applying six rounds of SELEX for selection of DNA aptamers, the
candidate sequences were obtained. Finally, specific aptamer was selected as an
ideal aptamer for detection and capturing of E. coli O157. Dissociation constant 
of the selected aptamer were calculated (107.6 ± 67.8 pM). In addition, the
secondary structure prediction and cross reactivity assays were performed. The
isolated aptamer efficiency was confirmed and it was shown that the new DNA
aptamer sequence has the ability to use for detection. This specific O157:H7
aptamer have the potential for application as a diagnostic ligand and could be
used for detection of the related food borne diseases.

Copyright © 2017 Elsevier Inc. All rights reserved.

DOI: 10.1016/j.ab.2017.08.005 
PMID: 28818557  [Indexed for MEDLINE]


7. PLoS One. 2017 Aug 11;12(8):e0182800. doi: 10.1371/journal.pone.0182800.
eCollection 2017.

The nucleoid protein Dps binds genomic DNA of Escherichia coli in a non-random
manner.

Antipov SS(1)(2)(3)(4), Tutukina MN(1)(5)(6)(7), Preobrazhenskaya EV(1),
Kondrashov FA(5)(6)(8), Patrushev MV(4), Toshchakov SV(4), Dominova I(4),
Shvyreva US(1), Vrublevskaya VV(9), Morenkov OS(9), Sukharicheva NA(1), Panyukov 
VV(7)(10), Ozoline ON(1)(2)(7).

Author information: 
(1)Department of Functional Genomics and Cellular Stress, Institute of Cell
Biophysics of Russian Academy of Sciences, Pushchino, Moscow Region, Russian
Federation.
(2)Department of Cell Biology, Pushchino State Institute of Natural Sciences,
Pushchino, Moscow Region, Russian Federation.
(3)Department of Biophysics and Biotechnology, Voronezh State University,
Voronezh, Russian Federation.
(4)Department of Genomics of Microorganisms, Immanuel Kant Baltic Federal
University, Kaliningrad, Russian Federation.
(5)Bioinformatics and Genomics Programme, Centre for Genomic Regulation (CRG)
Barcelona, Spain.
(6)Department of Evolutionary Genomics, Universitat Pompeu Fabra (UPF),
Barcelona, Spain.
(7)Department of Structural and Functional Genomics,-Pushchino Research Center of
the Russian Academy of Sciences, Pushchino, Moscow Region, Russian Federation.
(8)Institució Catalana de Recerca i Estudis Avançats (ICREA), 23 Pg. Lluís
Companys, Barcelona, Spain.
(9)Department of Cell Culture and Cell Engeneering, Institute of Cell Biophysics 
of Russian Academy of Sciences, Pushchino, Moscow Region, Russian Federation.
(10)Department of Bioinformatics, Institute of Mathematical Problems of
Biology-the Branch of Keldysh Institute of Applied Mathematics of Russian Academy
of Sciences, Pushchino, Moscow Region, Russian Federation.

Dps is a multifunctional homododecameric protein that oxidizes Fe2+ ions
accumulating them in the form of Fe2O3 within its protein cavity, interacts with 
DNA tightly condensing bacterial nucleoid upon starvation and performs some other
functions. During the last two decades from discovery of this protein, its
ferroxidase activity became rather well studied, but the mechanism of Dps
interaction with DNA still remains enigmatic. The crucial role of lysine residues
in the unstructured N-terminal tails led to the conventional point of view that
Dps binds DNA without sequence or structural specificity. However, deletion of
dps changed the profile of proteins in starved cells, SELEX screen revealed
genomic regions preferentially bound in vitro and certain affinity of Dps for
artificial branched molecules was detected by atomic force microscopy. Here we
report a non-random distribution of Dps binding sites across the bacterial
chromosome in exponentially growing cells and show their enrichment with inverted
repeats prone to form secondary structures. We found that the Dps-bound regions
overlap with sites occupied by other nucleoid proteins, and contain
overrepresented motifs typical for their consensus sequences. Of the two types of
genomic domains with extensive protein occupancy, which can be highly expressed
or transcriptionally silent only those that are enriched with RNA polymerase
molecules were preferentially occupied by Dps. In the dps-null mutant we,
therefore, observed a differentially altered expression of several targeted genes
and found suppressed transcription from the dps promoter. In most cases this can 
be explained by the relieved interference with Dps for nucleoid proteins
exploiting sequence-specific modes of DNA binding. Thus, protecting bacterial
cells from different stresses during exponential growth, Dps can modulate
transcriptional integrity of the bacterial chromosome hampering RNA biosynthesis 
from some genes via competition with RNA polymerase or, vice versa, competing
with inhibitors to activate transcription.

DOI: 10.1371/journal.pone.0182800 
PMCID: PMC5553809
PMID: 28800583  [Indexed for MEDLINE]


8. Biosens Bioelectron. 2017 Dec 15;98:486-493. doi: 10.1016/j.bios.2017.07.004.
Epub 2017 Jul 5.

Bridged Rebar Graphene functionalized aptasensor for pathogenic E. coli
O78:K80:H11 detection.

Kaur H(1), Shorie M(1), Sharma M(1), Ganguli AK(2), Sabherwal P(3).

Author information: 
(1)Institute of Nano Science & Technology, Mohali 160062, India.
(2)Institute of Nano Science & Technology, Mohali 160062, India. Electronic
address: ashokganguliiitd@gmail.com.
(3)Institute of Nano Science & Technology, Mohali 160062, India. Electronic
address: psnanobiotech@gmail.com.

We report a novel fabrication method of functionalised Bridged Rebar Graphene
(BRG) onto newly designed nanostructured aptasensor for label free impedimetric
sensing of pathogenic bacteria E. coli O78:K80:H11. The chemical facilitated
unscrolling of MWCNT and subsequent bridging with terephthalaldehyde (TPA) to
form 3D-hierarchical BRG nanoconstruct exhibited synergistic effect by combining 
enhanced electrical properties and facile chemical functionality for stable
bio-interface. The bacteria-DNA interactions were captured on BRG nanostructured 
electrode by using specific anti-E.coli DNA aptamer (Kd~ 14nM), screened by new
in-situ developed SELEX method using phenylboronic acid on microtitre plate. The 
developed nanostructured aptasensor demonstrated a low detection limit and
sensitivity of ~ 101cfu/mL towards E. coli O78:K80:H11 with a dynamic response
range from 101 to 106cfu/mL in water, juice and milk samples.

Copyright © 2017 Elsevier B.V. All rights reserved.

DOI: 10.1016/j.bios.2017.07.004 
PMID: 28728009 


9. PLoS One. 2017 Jun 30;12(6):e0179181. doi: 10.1371/journal.pone.0179181.
eCollection 2017.

The whole set of the constitutive promoters recognized by four minor sigma
subunits of Escherichia coli RNA polymerase.

Shimada T(1)(2), Tanaka K(2), Ishihama A(1).

Author information: 
(1)Research Center for Micro-Nano Technology, Hosei University, Koganei, Tokyo,
Japan.
(2)Laboratory for Chemistry and Life Science, Institute of Innovative Research,
Tokyo Institute of Technology, Nagatsuda, Yokohama, Japan.

The promoter selectivity of Escherichia coli RNA polymerase (RNAP) is determined 
by the sigma subunit. The model prokaryote Escherichia coli K-12 contains seven
species of the sigma subunit, each recognizing a specific set of promoters. For
identification of the "constitutive promoters" that are recognized by each RNAP
holoenzyme alone in the absence of other supporting factors, we have performed
the genomic SELEX screening in vitro for their binding sites along the E. coli
K-12 W3110 genome using each of the reconstituted RNAP holoenzymes and a
collection of genome DNA segments of E. coli K-12. The whole set of constitutive 
promoters for each RNAP holoenzyme was then estimated based on the location of
RNAP-binding sites. The first successful screening of the constitutive promoters 
was achieved for RpoD (σ70), the principal sigma for transcription of
growth-related genes. As an extension, we performed in this study the screening
of constitutive promoters for four minor sigma subunits, stationary-phase
specific RpoS (σ38), heat-shock specific RpoH (σ32), flagellar-chemotaxis
specific RpoF (σ28) and extra-cytoplasmic stress-response RpoE (σ24). The total
number of constitutive promoters were: 129~179 for RpoS; 101~142 for RpoH; 34~41 
for RpoF; and 77~106 for RpoE. The list of constitutive promoters were compared
with that of known promoters identified in vivo under various conditions and
using varieties of E. coli strains, altogether allowing the estimation of
"inducible promoters" in the presence of additional supporting factors.

DOI: 10.1371/journal.pone.0179181 
PMCID: PMC5493296
PMID: 28666008  [Indexed for MEDLINE]


10. Mol Cell. 2017 Jul 6;67(1):30-43.e6. doi: 10.1016/j.molcel.2017.05.025. Epub 2017
Jun 22.

Natural RNA Polymerase Aptamers Regulate Transcription in E. coli.

Sedlyarova N(1), Rescheneder P(2), Magán A(1), Popitsch N(3), Rziha N(1), Bilusic
I(1), Epshtein V(4), Zimmermann B(5), Lybecker M(6), Sedlyarov V(7), Schroeder
R(8), Nudler E(9).

Author information: 
(1)Department of Biochemistry and Cell Biology, Max F. Perutz Laboratories,
University of Vienna, Dr. Bohrgasse 9/5, 1030 Vienna, Austria.
(2)Center for Integrative Bioinformatics Vienna, Max F. Perutz Laboratories,
University of Vienna & Medical University of Vienna, 1030 Vienna, Austria.
(3)Children's Cancer Research Institute, St. Anna Kinderkrebsforschung, 1090
Vienna, Austria.
(4)Department of Biochemistry and Molecular Pharmacology, New York University
School of Medicine, New York, NY 10016, USA.
(5)Department of Molecular Evolution and Development, University of Vienna,
Althanstrasse 14, 1090 Vienna, Austria.
(6)University of Colorado, 1420 Austin Bluffs Parkway, Colorado Springs, CO
80918, USA.
(7)CeMM Research Center for Molecular Medicine of the Austrian Academy of
Sciences, 1090 Vienna, Austria.
(8)Department of Biochemistry and Cell Biology, Max F. Perutz Laboratories,
University of Vienna, Dr. Bohrgasse 9/5, 1030 Vienna, Austria. Electronic
address: renee.schroeder@univie.ac.at.
(9)Department of Biochemistry and Molecular Pharmacology, New York University
School of Medicine, New York, NY 10016, USA; Howard Hughes Medical Institute, New
York University School of Medicine, New York, NY 10016, USA. Electronic address: 
evgeny.nudler@nyumc.org.

In search for RNA signals that modulate transcription via direct interaction with
RNA polymerase (RNAP), we deep sequenced an E. coli genomic library enriched for 
RNAP-binding RNAs. Many natural RNAP-binding aptamers, termed RAPs, were mapped
to the genome. Over 60% of E. coli genes carry RAPs in their mRNA. Combining
in vitro and in vivo approaches, we characterized a subset of inhibitory RAPs
(iRAPs) that promote Rho-dependent transcription termination. A representative
iRAP within the coding region of the essential gene, nadD, greatly reduces its
transcriptional output in stationary phase and under oxidative stress,
demonstrating that iRAPs control gene expression in response to changing
environment. The mechanism of iRAPs involves active uncoupling of transcription
and translation, making nascent RNA accessible to Rho. iRAPs encoded in the
antisense strand also promote gene expression by reducing transcriptional
interference. In essence, our work uncovers a broad class of cis-acting RNA
signals that globally control bacterial transcription.

Copyright © 2017 Elsevier Inc. All rights reserved.

DOI: 10.1016/j.molcel.2017.05.025 
PMCID: PMC5535762 [Available on 2018-07-06]
PMID: 28648779  [Indexed for MEDLINE]


11. Biotechnol Bioeng. 2017 Oct;114(10):2235-2244. doi: 10.1002/bit.26340. Epub 2017 
Jun 5.

Naringenin-responsive riboswitch-based fluorescent biosensor module for
Escherichia coli co-cultures.

Xiu Y(1)(2)(3), Jang S(4), Jones JA(3)(5), Zill NA(3), Linhardt RJ(3), Yuan Q(1),
Jung GY(4)(6), Koffas MAG(3).

Author information: 
(1)State Key Laboratory of Chemical Resource Engineering, Beijing University of
Chemical Technology, Beijing, China.
(2)Beijing Key Laboratory of Bioactive Substances and Functional Food, Beijing
Union University, Beijing, China.
(3)Department of Chemical and Biological Engineering, Center for Biotechnology
and Interdisciplinary Studies, Rensselaer Polytechnic Institute, Troy, New York.
(4)Department of Chemical Engineering, Pohang University of Science and
Technology, Pohang, Gyeongbuk, Korea.
(5)Department of Chemistry, Hamilton College, Clinton, New York.
(6)School of Interdisciplinary Bioscience and Bioengineering, Pohang University
of Science and Technology, Pohang, Gyeongbuk, Korea.

The ability to design and construct combinatorial synthetic metabolic pathways
has far exceeded our capacity for efficient screening and selection of the
resulting microbial strains. The need for high-throughput rapid screening
techniques is of upmost importance for the future of synthetic biology and
metabolic engineering. Here we describe the development of an RNA
riboswitch-based biosensor module with dual fluorescent reporters, and
demonstrate a high-throughput flow cytometry-based screening method for
identification of naringenin over producing Escherichia coli strains in
co-culture. Our efforts helped identify a number of key operating parameters that
affect biosensor performance, including the selection of promoter and linker
elements within the sensor-actuator domain, and the effect of host strain,
fermentation time, and growth medium on sensor dynamic range. The resulting
biosensor demonstrates a high correlation between specific fluorescence of the
biosensor strain and naringenin titer produced by the second member of the
synthetic co-culture system. This technique represents a novel application for
synthetic microbial co-cultures and can be expanded from naringenin to any
metabolite if a suitable riboswitch is identified. The co-culture technique
presented here can be applied to a variety of target metabolites in combination
with the SELEX approach for aptamer design. Due to the compartmentalization of
the two genetic constructs responsible for production and detection into separate
cells and application as independent modules of a synthetic microbial co-culture 
we have subsequently reduced the need for re-optimization of the producer module 
when the biosensor is replaced or removed. Biotechnol. Bioeng. 2017;114:
2235-2244. © 2017 Wiley Periodicals, Inc.

© 2017 Wiley Periodicals, Inc.

DOI: 10.1002/bit.26340 
PMID: 28543037  [Indexed for MEDLINE]


12. Molecules. 2017 May 17;22(5). pii: E825. doi: 10.3390/molecules22050825.

Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent
Biosensor Platform.

Song MS(1), Sekhon SS(2), Shin WR(3), Kim HC(4), Min J(5), Ahn JY(6), Kim YH(7).

Author information: 
(1)School of Biological Sciences, Chungbuk National University, 1 Chungdae-Ro,
Seowon-Gu, Cheongju 28644, Korea. smst04@nate.com.
(2)School of Biological Sciences, Chungbuk National University, 1 Chungdae-Ro,
Seowon-Gu, Cheongju 28644, Korea. simranjeet261@gmail.com.
(3)School of Biological Sciences, Chungbuk National University, 1 Chungdae-Ro,
Seowon-Gu, Cheongju 28644, Korea. aomaya91@nate.com.
(4)Technology Transfer Center, Korea Research Institute of Bioscience &
Biotechnology, 125 Gwahak-Ro, Yuseong-Gu, Daejeon 34141, Korea. hcgimm@gmail.com.
(5)Department of Bioprocess Engineering, Chonbuk National University, 567
Baekje-daero, Deokjin-Gu Jeonju, Jeonbuk 54896, Korea. jihomin@chonbuk.ac.kr.
(6)School of Biological Sciences, Chungbuk National University, 1 Chungdae-Ro,
Seowon-Gu, Cheongju 28644, Korea. jyahn@chungbuk.ac.kr.
(7)School of Biological Sciences, Chungbuk National University, 1 Chungdae-Ro,
Seowon-Gu, Cheongju 28644, Korea. kyh@chungbuk.ac.kr.

In this paper, a Whole-Bacteria SELEX (WB-SELEX) strategy was adopted to isolate 
specific aptamers against Shigella sonnei. Real-time PCR amplification and
post-SELEX experiment revealed that the selected aptmers possessed a high binding
affinity and specificity for S. sonnei. Of the 21 aptamers tested, the C(t)
values of the SS-3 and SS-4 aptamers (Ct = 13.89 and Ct = 12.23, respectively)
had the lowest value compared to other aptamer candidates. The SS-3 and SS-4
aptamers also displayed a binding affinity (KD) of 39.32 ± 5.02 nM and 15.89 ±
1.77 nM, respectively. An aptamer-based fluorescent biosensor assay was designed 
to detect and discriminate S. sonnei cells using a sandwich complex pair of SS-3 
and SS-4. The detection of S. sonnei by the aptamer based fluorescent biosensor
platform consisted of three elements: (1) 5'amine-SS-4 modification in a 96-well 
type microtiter plate surface (N-oxysuccinimide, NOS) as capture probes; (2) the 
incubation with S. sonnei and test microbes in functionalized 96 assay wells in
parallel; (3) the readout of fluorescent activity using a Cy5-labeled SS-3
aptamer as the detector. Our platform showed a significant ability to detect and 
discriminate S. sonnei from other enteric species such as E. coli, Salmonella
typhimurium and other Shigella species (S. flexneri, S. boydii). In this study,
we demonstrated the feasibility of an aptamer sensor platform to detect S. sonnei
in a variety of foods and pave the way for its use in diagnosing shigellosis
through multiple, portable designs.

DOI: 10.3390/molecules22050825 
PMID: 28513559  [Indexed for MEDLINE]

Conflict of interest statement: The authors declare no conflict of interest.


13. Sci Rep. 2017 Mar 8;7:43641. doi: 10.1038/srep43641.

Broadly reactive aptamers targeting bacteria belonging to different genera using 
a sequential toggle cell-SELEX.

Song MY(1), Nguyen D(2), Hong SW(2)(3), Kim BC(1)(2).

Author information: 
(1)Center for Environment, Health and Welfare Research, Korea Institute of
Science and Technology (KIST), Seoul 02792, Republic of Korea.
(2)Department of Energy and Environmental Engineering, University of Science and 
Technology (UST), Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792, Republic of
Korea.
(3)Center for Water Resources Cycle Research, Korea Institute of Science and
Technology (KIST), Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792, Republic of
Korea.

Conventional cell-SELEX aims to isolate aptamers to a single unique target
bacteria species. We propose a method to isolate single-stranded DNA aptamers
that have broad reactivity to multiple bacterial targets belonging to different
genera. The key of the proposed method is that targets of interest are changed
sequentially at each SELEX round. The general scheme was examined using six
bacteria from different genera, Escherichia coli, Enterobacter aerogenes,
Klebsiella pneumoniae, Citrobacter freundii, Bacillus subtilis, and
Staphylococcus epidermidis (four gram-negative and two gram-positive bacteria).
In the first round of SELEX, the DNA library was incubated with E. coli and
amplicons bound to E. coli were separated. The amplicons were sequentially
separated by incubation with E. aerogenes, K. pneumoniae, C. freundii, B.
subtilis, and S. epidermidis at each SELEX. The amplicons obtained using the last
bacterial species were incubated again with the first bacterial species and this 
loop was repeated two more times. We refer to this method as sequential toggle
cell-SELEX (STC-SELEX). The isolated aptamers had dissociation constants of
9.22-38.5 nM and had no affinity to other bacteria that were not included in
STC-SELEX. These results demonstrate the potential to isolate aptamers with broad
affinity to bacterial taxa in different genera.

DOI: 10.1038/srep43641 
PMCID: PMC5341558
PMID: 28272554 


14. Clin Transl Oncol. 2017 Aug;19(8):976-988. doi: 10.1007/s12094-017-1629-y. Epub
2017 Feb 21.

Selection of DNA aptamers for extra cellular domain of human epidermal growth
factor receptor 2 to detect HER2 positive carcinomas.

Sett A(1), Borthakur BB(2), Bora U(3)(4).

Author information: 
(1)Bioengineering Research Laboratory, Department of Biosciences and
Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam, 781039,
India.
(2)Department of Surgical Oncology, Dr. B. Borooah Cancer Institute, Guwahati,
Assam, 781016, India.
(3)Bioengineering Research Laboratory, Department of Biosciences and
Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam, 781039,
India. ubora@iitg.ernet.in.
(4)Mugagen Laboratories Pvt. Ltd., Technology Incubation Centre, Indian Institute
of Technology Guwahati, Guwahati, Assam, 781039, India. ubora@iitg.ernet.in.

BACKGROUND: Human epidermal growth factor receptor 2 (Her2, an orphan receptor of
ErbB family) is considered as an important biomarker as it plays a key role in
the development and progression of aggressive types of breast, ovarian, stomach
and gastric cancer. In the present study, we developed novel DNA aptamers against
the extra-cellular domain (ECD) of Her2 protein for detection of Her2-positive
carcinomas.
METHODS: We cloned and expressed Her2-ECD protein in E. coli system. After
purification, the protein was used as a bait for screening of specific DNA
aptamer candidate from a pool of 1014-15 random oligonucleotides through in vitro
Systematic Evaluation of Ligands by Exponential Enrichment (SELEX) process. The
aptamer-protein binding kinetics was elucidated by isothermal calorimetry. The
specificity of FAM-labelled ECD_Apt1 towards Her2-positive cell lines was
estimated by FACS and immunofluorescence assay. The specificity of the candidate 
was also verified with the tissue samples of breast cancer patients by
immunohistochemistry process.
RESULTS: Among four selected candidates, ECD_Apt1 (having minimum ∆G = -3.24)
showed the highest binding affinity (K d = 6.33 ± 0.86 nM) to Her2-ECD protein.
The aptamer-protein sandwich assay showed a linear rise in chemiluminescence (at 
490 nm wavelength) in the dynamic range of 100-700 nM ECD_Apt1 with a detection
limit of 12.5 ± 2.5 ng/mL. Biotinylated ECD_Apt1 showed stronger cytoplasmic
staining in Her2-positive breast cancer cell lines (SKBR3) compared to
Her2-negative cells (MDA MB 231, MCF7). In paraffin-embedded breast cancer tissue
sections, it showed specific and selective localization in the cytoplasmic niche 
of malignant duct cancer cells without any cross-reactivity to fibroblasts,
inflammatory cells and adipocytes.
CONCLUSIONS: Binding assays, cytochemical and histochemical studies support
ECD_Apt1 as a potential theranostic agent for Her2-positive carcinomas. ECD_Apt1 
could be an effective low-cost alternative to conventional anti-Her2 antibody in 
solid phase immunoassays for cancer diagnosis and related applications.

DOI: 10.1007/s12094-017-1629-y 
PMID: 28224267 


15. Org Biomol Chem. 2017 Mar 1;15(9):1980-1989. doi: 10.1039/c6ob02451c.

Whole cell-SELEX of aptamers with a tyrosine-like side chain against live
bacteria.

Renders M(1), Miller E(1), Lam CH(1), Perrin DM(1).

Author information: 
(1)Chemistry Department, University of British Columbia, 2036 Main Mall,
Vancouver, BC V6T 1Z1, Canada. dperrin@chem.ubc.ca.

In an effort to expand the binding and recognition capabilities of aptamers, a
nucleoside triphosphate modified with a phenol that mimics the side chain of
tyrosine was used in the selection of DNA aptamers against live bacteria. Of
multiple modified aptamers that were isolated against Escherichia coli DH5α
cells, one aptamer displays high selectivity and affinity for the target cells
and is greatly enriched for phenol-modified dU nucleotides (dUy, 47.5%). When the
same sequences are synthesized with TTP, no binding is observed. Taken together, 
these findings highlight the value of using modified nucleotide triphosphates in 
aptamer selections and portends success in SELEX against an array of whole cells 
as targets.

DOI: 10.1039/c6ob02451c 
PMID: 28009914  [Indexed for MEDLINE]


16. PLoS One. 2016 Dec 22;11(12):e0163057. doi: 10.1371/journal.pone.0163057.
eCollection 2016.

Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA
Composite Operon in Escherichia coli.

Takada H(1), Shimada T(1)(2), Dey D(3), Quyyum MZ(3), Nakano M(4), Ishiguro A(1),
Yoshida H(5), Yamamoto K(1)(6), Sen R(3), Ishihama A(1)(6).

Author information: 
(1)Research Center for Micro-Nano Technology, Hosei University, Koganei, Tokyo,
Japan.
(2)Laboratory for Chemistry and Life Science, Tokyo Institute of Technology,
Nagatsuda, Yokohama, Japan.
(3)Centre for DNA Fingerprinting and Diagnostics, Hyderabad, India.
(4)Institute for Virus Research, Kyoto University, Sakyo-ku, Kyoto, Japan.
(5)Department of Physics, Osaka Medical College, Takatsuki, Osaka, Japan.
(6)Department of Frontier Bioscience, Hosei University, Koganei, Tokyo, Japan.

Escherichia coli contains seven rRNA operons, each consisting of the genes for
three rRNAs (16S, 23S and 5S rRNA in this order) and one or two tRNA genes in the
spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3'
proximal region. All of these rRNA and tRNA genes are transcribed from two
promoters, P1 and P2, into single large precursors that are afterward processed
to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX 
screening of promoters recognized by RNA polymerase (RNAP) holoenzyme containing 
RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of 
all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an
internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA
operon), within each 16S rRNA gene was confirmed by gel shift assay and AFM
observation. Using this riRNA promoter within the rrnD operon as a
representative, transcription in vitro was detected with use of the purified RpoD
holoenzyme, confirming the presence of a constitutive promoter in this region.
LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The
location of riRNA promoter in vivo as identified using a set of reporter plasmids
agrees well with that identified in vitro. Based on transcription profile in
vitro and Northern blot analysis in vivo, the majority of transcript initiated
from this riRNA promoter was estimated to terminate near the beginning of 23S
rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under
starved conditions, transcription of the rRNA operon is markedly repressed to
reduce the intracellular level of ribosomes, but the levels of both riRNA and its
processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the
continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We
then propose that the tRNA genes organized within the spacers of rRNA-tRNA
composite operons are expressed independent of rRNA synthesis under specific
conditions where further synthesis of ribosomes is not needed.

DOI: 10.1371/journal.pone.0163057 
PMCID: PMC5179076
PMID: 28005933  [Indexed for MEDLINE]

Conflict of interest statement: The authors have declared that no competing
interests exist.


17. Mol Cells. 2016 Nov 30;39(11):807-813. Epub 2016 Nov 18.

Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its
Use in Various Detection Formats.

Dua P(1), Ren S(2), Lee SW(2), Kim JK(1), Shin HS(1), Jeong OC(3), Kim S(2), Lee 
DK(1).

Author information: 
(1)Global Research Laboratory (GRL) for RNAi Medicine, Department of Chemistry,
Sungkyunkwan University (SKKU), Suwon 16419, Korea.
(2)Department of Bioengineering, Dongguk University, Seoul 04620, Korea.
(3)Department of Biomedical Engineering and School of Mechanical Engineering,
Inje University, Gimhae 50834, Korea.

Escherichia coli are important indicator organisms, used routinely for the
monitoring of water and food safety. For quick, sensitive and real-time detection
of E. coli we developed a 2'F modified RNA aptamer Ec3, by Cell-SELEX. The 31
nucleotide truncated Ec3 demonstrated improved binding and low nano-molar
affinity to E. coli. The aptamer developed by us out-performs the commercial
antibody and aptamer used for E. coli detection. Ec3(31) aptamer based E. coli
detection was done using three different detection formats and the assay
sensitivities were determined. Conventional Ec3(31)-biotin-streptavidin magnetic 
separation could detect E. coli with a limit of detection of 1.3 × 106 CFU/ml.
Although, optical analytic technique, biolayer interferometry, did not improve
the sensitivity of detection for whole cells, a very significant improvement in
the detection was seen with the E. coli cell lysate (5 × 104 CFU/ml). Finally we 
developed Electrochemical Impedance Spectroscopy (EIS) gap capacitance biosensor 
that has detection limits of 2 × 104 CFU/mL of E. coli cells, without any
labeling and signal amplification techniques. We believe that our developed
method can step towards more complex and real sample application.

DOI: 10.14348/molcells.2016.0167 
PMCID: PMC5125936
PMID: 27871171  [Indexed for MEDLINE]


18. Microbiology. 2016 Sep;162(9):1698-1707. doi: 10.1099/mic.0.000337. Epub 2016 Jul
19.

Transcription factor DecR (YbaO) controls detoxification of L-cysteine in
Escherichia coli.

Shimada T(1), Tanaka K(2), Ishihama A(3).

Author information: 
(1)1​Laboratory for Chemistry and Life Science, Institute of Innovative Research,
Tokyo Institute of Technology, Nagatsuta, 4259-R1-29, Yokohama 226-8503, Japan
2​Research Center for Micro-Nano Technology, Hosei University, Koganei, Tokyo
184-8584, Japan.
(2)1​Laboratory for Chemistry and Life Science, Institute of Innovative Research,
Tokyo Institute of Technology, Nagatsuta, 4259-R1-29, Yokohama 226-8503, Japan.
(3)2​Research Center for Micro-Nano Technology, Hosei University, Koganei, Tokyo 
184-8584, Japan.

YbaO is an uncharacterized AsnC-family transcription factor of Escherichia coli. 
In both Salmonella enterica and Pantoea ananatis, YbaO homologues were identified
to regulate the adjacent gene encoding cysteine desulfhydrase for detoxification 
of cysteine. Using the genomic SELEX (systematic evolution of ligands by
exponential enrichment) screening system, we identified the yhaOM operon, located
far from the ybaO gene on the E. coli genome, as a single regulatory target of
YbaO. In both gel shift assay in vitro and reporter and Northern blot assays in
vivo, YbaO was found to regulate the yhaOM promoter. The growth of mutants
lacking either ybaO or its targets yhaOM was delayed in the presence of cysteine,
indicating involvement of these genes in cysteine detoxification. In the major
pathway of cysteine degradation, hydrogen sulfide is produced in wild-type E.
coli, but its production was not observed in each of the ybaO, yhaO and yhaM
mutants. The yhaOM promoter was activated in the presence of cysteine, implying
the role of cysteine in activation of YbaO. Taken together, we propose that YbaO 
is the cysteine-sensing transcriptional activator of the yhaOM operon, which is
involved in the detoxification of cysteine. We then propose the naming of ybaO as
decR (regulator of detoxification of cysteine).

DOI: 10.1099/mic.0.000337 
PMID: 27435271  [Indexed for MEDLINE]


19. Microbiology. 2016 Jul;162(7):1253-64. doi: 10.1099/mic.0.000292. Epub 2016 Apr
25.

Transcription factor CecR (YbiH) regulates a set of genes affecting the
sensitivity of Escherichia coli against cefoperazone and chloramphenicol.

Yamanaka Y(1), Shimada T(2), Yamamoto K(3), Ishihama A(1).

Author information: 
(1)1​ Research Center for Micro-Nano Technology, Nano Technology, Koganei, Tokyo 
184-8584, Japan.
(2)2​ Chemical Resources Laboratory, Tokyo Institute of Technology, Nagatsuda,
Yokohama, Japan.
(3)3​ Department of Frontier Bioscience, Hosei University, Koganei, Tokyo
184-8584, Japan.

Genomic SELEX (systematic evolution of ligands by exponential enrichment)
screening was performed for identification of the binding site of YbiH, an as yet
uncharacterized TetR-family transcription factor, on the Escherichia coli genome.
YbiH was found to be a unique single-target regulator that binds in vitro within 
the intergenic spacer located between the divergently transcribed ybiH-ybhGFSR
and rhlE operons. YbhG is an inner membrane protein and YbhFSR forms a
membrane-associated ATP-binding cassette (ABC) transporter while RhlE is a
ribosome-associated RNA helicase. Gel shift assay and DNase footprinting analyses
indicated one clear binding site of YbiH, including a complete palindromic
sequence of AATTAGTT-AACTAATT. An in vivo reporter assay indicated repression of 
the ybiH operon and activation of the rhlE operon by YbiH. After phenotype
microarray screening, YbiH was indicated to confer resistance to chloramphenicol 
and cefazoline (a first-generation cephalosporin). A systematic survey of the
participation of each of the predicted YbiH-regulated genes in the antibiotic
sensitivity indicated involvement of the YbhFSR ABC-type transporter in the
sensitivity to cefoperazone (a third-generation cephalosporin) and of the
membrane protein YbhG in the control of sensitivity to chloramphenicol. Taken
together with the growth test in the presence of these two antibiotics and in
vitro transcription assay, it was concluded that the hitherto uncharacterized
YbiH regulates transcription of both the bidirectional transcription units, the
ybiH-ybhGFSR operon and the rhlE gene, which altogether are involved in the
control of sensitivity to cefoperazone and chloramphenicol. We thus propose to
rename YbiH as CecR (regulator of cefoperazone and chloramphenicol sensitivity).

DOI: 10.1099/mic.0.000292 
PMID: 27112147  [Indexed for MEDLINE]


20. PLoS One. 2016 Apr 22;11(4):e0153637. doi: 10.1371/journal.pone.0153637.
eCollection 2016.

Isolation of an Aptamer that Binds Specifically to E. coli.

Marton S(1), Cleto F(1), Krieger MA(1)(2), Cardoso J(1).

Author information: 
(1)Instituto de Biologia Molecular do Paraná, Department of Research and
Development, 3375 Professor Algacyr Munhoz Mader Street, Curitiba, Brazil.
(2)Instituto Carlos Chagas, Laboratório de Genomica Functional, 3375 Professor
Algacyr Munhoz Mader Street, Curitiba, Brazil.

Escherichia coli is a bacterial species found ubiquitously in the intestinal
flora of animals, although pathogenic variants cause major public health
problems. Aptamers are short oligonucleotides that bind to targets with high
affinity and specificity, and have great potential for use in diagnostics and
therapy. We used cell-based Systematic Evolution of Ligands by EXponential
enrichment (cell-SELEX) to isolate four single stranded DNA (ssDNA) aptamers that
bind strongly to E. coli cells (ATCC generic strain 25922), with Kd values in the
nanomolar range. Fluorescently labeled aptamers label the surface of E. coli
cells, as viewed by fluorescent microscopy. Specificity tests with twelve
different bacterial species showed that one of the aptamers-called P12-31-is
highly specific for E. coli. Importantly, this aptamer binds to Meningitis/sepsis
associated E. coli (MNEC) clinical isolates, and is the first aptamer described
with potential for use in the diagnosis of MNEC-borne pathologies.

DOI: 10.1371/journal.pone.0153637 
PMCID: PMC4841571
PMID: 27104834  [Indexed for MEDLINE]


21. Nucleic Acids Res. 2016 Mar 18;44(5):2058-74. doi: 10.1093/nar/gkw051. Epub 2016 
Feb 3.

Transcription profile of Escherichia coli: genomic SELEX search for regulatory
targets of transcription factors.

Ishihama A(1), Shimada T(2), Yamazaki Y(3).

Author information: 
(1)Micro-Nano Technology Research Center, Hosei University, Koganei, Tokyo,
184-8584, Japan aishiham@hosei.ac.jp.
(2)Chemical Resources Laboratory, Tokyo Institute of Technology, Nagatsuda,
Yokohama 226-8503, Japan.
(3)National Institute of Genetics, Mishima, Shizuoka 411-8540, Japan
yyamazak@nig.ac.jp.

Bacterial genomes are transcribed by DNA-dependent RNA polymerase (RNAP), which
achieves gene selectivity through interaction with sigma factors that recognize
promoters, and transcription factors (TFs) that control the activity and
specificity of RNAP holoenzyme. To understand the molecular mechanisms of
transcriptional regulation, the identification of regulatory targets is needed
for all these factors. We then performed genomic SELEX screenings of targets
under the control of each sigma factor and each TF. Here we describe the assembly
of 156 SELEX patterns of a total of 116 TFs performed in the presence and absence
of effector ligands. The results reveal several novel concepts: (i) each TF
regulates more targets than hitherto recognized; (ii) each promoter is regulated 
by more TFs than hitherto recognized; and (iii) the binding sites of some TFs are
located within operons and even inside open reading frames. The binding sites of 
a set of global regulators, including cAMP receptor protein, LeuO and Lrp,
overlap with those of the silencer H-NS, suggesting that certain global
regulators play an anti-silencing role. To facilitate sharing of these
accumulated SELEX datasets with the research community, we compiled a database,
'Transcription Profile of Escherichia coli' (www.shigen.nig.ac.jp/ecoli/tec/).

© The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic
Acids Research.

DOI: 10.1093/nar/gkw051 
PMCID: PMC4797297
PMID: 26843427  [Indexed for MEDLINE]


22. J Mol Evol. 2015 Dec;81(5-6):172-8. doi: 10.1007/s00239-015-9718-4. Epub 2015 Nov
14.

Selection of Intracellularly Functional RNA Mimics of Green Fluorescent Protein
Using Fluorescence-Activated Cell Sorting.

Zou J(1), Huang X(1), Wu L(1), Chen G(1), Dong J(1), Cui X(1), Tang Z(2).

Author information: 
(1)Natural Products Research Center, Chengdu Institute of Biology, Chinese
Academy of Sciences, Chengdu, 610041, People's Republic of China.
(2)Natural Products Research Center, Chengdu Institute of Biology, Chinese
Academy of Sciences, Chengdu, 610041, People's Republic of China.
tangzhuo@cib.ac.cn.

Fluorescence-activated cell sorting (FACS) was exploited to isolate Escherichia
coli cells that were highly fluorescent due to the expression of RNA aptamers
that induce fluorescence of 3,5-difluoro-4-hydroxybenzylidene imidazolinone. Two 
different aptamers, named ZT-26 and ZT-324, were identified by this method and
compared to the fluorescence-signaling properties of Spinach, a previously
reported RNA aptamer. Aptamer ZT-26 exhibits significantly enhanced fluorescence 
over Spinach only in vitro. However, aptamer ZT-324 is 36% brighter than Spinach 
when expressed in E. coli. The FACS-based selection strategy presented here is
attractive for deriving fluorescent RNA aptamers that function in cells as it
directly selects for cells with a high level of fluorescence due to the
expression of the RNA aptamer.

DOI: 10.1007/s00239-015-9718-4 
PMID: 26573804  [Indexed for MEDLINE]


23. Appl Biochem Biotechnol. 2016 Feb;178(4):849-64. doi: 10.1007/s12010-015-1913-7. 
Epub 2015 Nov 5.

Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis.

Mozioglu E(1)(2), Gokmen O(3), Tamerler C(4)(5), Kocagoz ZT(6)(7), Akgoz M(8).

Author information: 
(1)Molecular Biology-Biotechnology & Genetics Research Center, Istanbul Technical
University, Istanbul, Turkey. erkanmozioglu@yahoo.com.
(2)Bioanalysis Laboratory, TÜBİTAK UME (National Metrology Institute), Kocaeli,
Turkey. erkanmozioglu@yahoo.com.
(3)Chemistry Department, Gebze Institute of Technology, Kocaeli, Turkey.
ozgurgokmen75@hotmail.com.
(4)Molecular Biology-Biotechnology & Genetics Research Center, Istanbul Technical
University, Istanbul, Turkey. candan.tamerler@gmail.com.
(5)Mechanical Engineering and Bioengineering Research Center, University of
Kansas, Lawrence, KS, USA. candan.tamerler@gmail.com.
(6)Department of Microbiology and Clinical Microbiology, Acıbadem University,
Istanbul, Turkey. tanilkocagoz@gmail.com.
(7)Trends in Innovative Biotechnology Organization, Istanbul, Turkey.
tanilkocagoz@gmail.com.
(8)Bioanalysis Laboratory, TÜBİTAK UME (National Metrology Institute), Kocaeli,
Turkey. muslum.akgoz@tubitak.gov.tr.

Tuberculosis (TB) remains to be a major global health problem, with about 9
million new cases and 1.4 million deaths in 2011. For the control of tuberculosis
as well as other infectious diseases, WHO recommended "ASSURED" (Affordable,
Sensitive, Specific, User-friendly, Rapid and robust, Equipment-free, and
Deliverable to the end user) diagnostic tools that can easily be maintained and
used in developing countries. Aptamers are promising tools for developing
point-of-care diagnostic assays for TB. In this study, ssDNA aptamers that
recognize Mycobacterium tuberculosis H37Ra were selected by systematic evolution 
of ligands by exponential enrichment (SELEX). For this purpose, two different
selection protocols, ultrafiltration and centrifugation, were applied. A total of
21 TB specific aptamers were selected. These aptamers exhibited "G-rich" regions 
on the 3' terminus of the aptamers, including a motif of "TGGGG," "GTGG," or
"CTGG." Binding capability of selected aptamers were investigated by quantitative
PCR and Mtb36 DNA aptamer was found the most specific aptamer to M. tuberculosis 
H37Ra. The dissociation constant (K d) of Mtb36 aptamer was calculated as
5.09 ± 1.43 nM in 95% confidence interval. Relative binding ratio of Mtb36
aptamer to M. tuberculosis H37Ra over Mycobacterium bovis and Escherichia coli
was also determined about 4 times and 70 times more, respectively. Mtb36 aptamer 
is highly selective for M. tuberculosis, and it can be used in an aptamer-based
biosensor for the detection of M. tuberculosis.

DOI: 10.1007/s12010-015-1913-7 
PMID: 26541162  [Indexed for MEDLINE]


24. J Chromatogr A. 2015 Oct 30;1418:130-139. doi: 10.1016/j.chroma.2015.09.055. Epub
2015 Sep 25.

Imidazole-free purification of His3-tagged recombinant proteins using ssDNA
aptamer-based affinity chromatography.

Bartnicki F(1), Kowalska E(1), Pels K(1), Strzalka W(2).

Author information: 
(1)Department of Plant Biotechnology, Faculty of Biochemistry, Biophysics and
Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Krakow, Poland.
(2)Department of Plant Biotechnology, Faculty of Biochemistry, Biophysics and
Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Krakow, Poland.
Electronic address: wojciech.strzalka@uj.edu.pl.

Immobilized metal ion affinity chromatography (IMAC) is widely used for the
purification of many different His6-tagged recombinant proteins. On the one hand,
it is a powerful technique but on the other hand it has its disadvantages. In
this report, we present the development of a unique ssDNA aptamer for the
purification of His3-tagged recombinant proteins. Our study shows that stability 
of the His3-tag/H3T aptamer complex can be controlled by the sodium ion
concentration. Based on this feature, we demonstrate that H3T aptamer resin was
successfully employed for the purification of three out of four tested
His3-tagged recombinant proteins from an E. coli total protein extract using
imidazole-free buffers. Finally, we show that the purity of His3-tagged proteins 
is superior when purified with the help of the H3T aptamer in comparison with
Ni-NTA resin.

Copyright © 2015 Elsevier B.V. All rights reserved.

DOI: 10.1016/j.chroma.2015.09.055 
PMID: 26427325  [Indexed for MEDLINE]


25. Genes Cells. 2015 Nov;20(11):915-31. doi: 10.1111/gtc.12282. Epub 2015 Sep 2.

Expanded roles of two-component response regulator OmpR in Escherichia coli:
genomic SELEX search for novel regulation targets.

Shimada T(1)(2), Takada H(1), Yamamoto K(1)(3), Ishihama A(1)(3).

Author information: 
(1)Micro-Nano Technology Research Center, Hosei University, Koganai, Tokyo,
184-8584, Japan.
(2)Chemical Resources Laboratory, Tokyo Institute of Technology, Nagatsuda,
Yokohama, 226-8503, Japan.
(3)Department of Frontier Bioscience, Hosei University, Koganai, Tokyo, 184-8584,
Japan.

The two-component system (TCS) is a sophisticated bacterial signal transduction
system for regulation of genome transcription in response to environmental
conditions. The EnvZ-OmpR system is one of the well-characterized TCS of
Escherichia coli, responding to changes in environmental osmolality. Regulation
has largely focused on the differential expression of two porins, OmpF and OmpC, 
which transport small molecules across the outer membrane. Recently, it has
become apparent that OmpR serves a more global regulatory role and regulates
additional targets. To identify the entire set of regulatory targets of OmpR, we 
performed the genomic SELEX screening of OmpR-binding sites along the E. coli
genome. As a result, more than 30 novel genes have been identified to be under
the direct control of OmpR. One abundant group includes the genes encoding a
variety of membrane-associated transporters that mediate uptake or efflux of
small molecules, while another group encodes a set of transcription regulators,
raising a concept that OmpR is poised to control a diverse set of responses by
altering downstream transcriptional regulators.

© 2015 The Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd.

DOI: 10.1111/gtc.12282 
PMID: 26332955  [Indexed for MEDLINE]


26. Nucleic Acids Res. 2015 Dec 2;43(21):e144. doi: 10.1093/nar/gkv718. Epub 2015 Jul
14.

Dual-colour imaging of RNAs using quencher- and fluorophore-binding aptamers.

Arora A(1), Sunbul M(1), Jäschke A(2).

Author information: 
(1)Institute of Pharmacy and Molecular Biotechnology, Heidelberg University, Im
Neuenheimer Feld 364, Heidelberg 69120, Germany.
(2)Institute of Pharmacy and Molecular Biotechnology, Heidelberg University, Im
Neuenheimer Feld 364, Heidelberg 69120, Germany jaeschke@uni-hd.de.

In order to gain deeper insight into the functions and dynamics of RNA in cells, 
the development of methods for imaging multiple RNAs simultaneously is of
paramount importance. Here, we describe a modular approach to image RNA in living
cells using an RNA aptamer that binds to dinitroaniline, an efficient general
contact quencher. Dinitroaniline quenches the fluorescence of different
fluorophores when directly conjugated to them via ethylene glycol linkers by
forming a non-fluorescent intramolecular complex. Since the binding of the RNA
aptamer to the quencher destroys the fluorophore-quencher complex, fluorescence
increases dramatically upon binding. Using this principle, a series of
fluorophores were turned into fluorescent turn-on probes by conjugating them to
dinitroaniline. These probes ranged from fluorescein-dinitroaniline (green) to
TexasRed-dinitroaniline (red) spanning across the visible spectrum. The
dinitroaniline-binding aptamer (DNB) was generated by in vitro selection, and was
found to bind all probes, leading to fluorescence increase in vitro and in living
cells. When expressed in E. coli, the DNB aptamer could be labelled and
visualized with different-coloured fluorophores and therefore it can be used as a
genetically encoded tag to image target RNAs. Furthermore, combining
contact-quenched fluorogenic probes with orthogonal DNB (the quencher-binding RNA
aptamer) and SRB-2 aptamers (a fluorophore-binding RNA aptamer) allowed
dual-colour imaging of two different fluorescence-enhancing RNA tags in living
cells, opening new avenues for studying RNA co-localization and trafficking.

© The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic
Acids Research.

DOI: 10.1093/nar/gkv718 
PMCID: PMC4666381
PMID: 26175046  [Indexed for MEDLINE]


27. Microb Genom. 2015 Jul 15;1(1):e000001. doi: 10.1099/mgen.0.000001. eCollection
2015 Jul.

Expanded roles of leucine-responsive regulatory protein in transcription
regulation of the Escherichia coli genome: Genomic SELEX screening of the
regulation targets.

Shimada T(1), Saito N(2), Maeda M(3), Tanaka K(4), Ishihama A(5).

Author information: 
(1)Chemical Resources Laboratory, Tokyo Institute of Technology, Nagatsuta,
Yokohama, Japan; Department of Frontier Bioscience, Hosei University, Koganei,
Tokyo, Japan; Research Center for Micro-Nano Technology, Hosei University,
Koganei, Tokyo, Japan.
(2)Department of Chemistry and Material Engineering, Tsuruoka National College of
Technology, Yamagata, Japan; Institute for Advanced Biosciences, Keio University,
Yamagata, Japan.
(3)School of Agriculture, Meiji University, Kawasaki, Kanagawa, Japan.
(4)Chemical Resources Laboratory, Tokyo Institute of Technology, Nagatsuta,
Yokohama, Japan.
(5)Department of Frontier Bioscience, Hosei University, Koganei, Tokyo, Japan;
Research Center for Micro-Nano Technology, Hosei University, Koganei, Tokyo,
Japan.

Leucine-responsive regulatory protein (Lrp) is a transcriptional regulator for
the genes involved in transport, biosynthesis and catabolism of amino acids in
Escherichia coli. In order to identify the whole set of genes under the direct
control of Lrp, we performed Genomic SELEX screening and identified a total of
314 Lrp-binding sites on the E. coli genome. As a result, the regulation target
of Lrp was predicted to expand from the hitherto identified genes for amino acid 
metabolism to a set of novel target genes for utilization of amino acids for
protein synthesis, including tRNAs, aminoacyl-tRNA synthases and rRNAs. Northern 
blot analysis indicated alteration of mRNA levels for at least some novel
targets, including the aminoacyl-tRNA synthetase genes. Phenotype MicroArray of
the lrp mutant indicated significant alteration in utilization of amino acids and
peptides, whilst metabolome analysis showed variations in the concentration of
amino acids in the lrp mutant. From these two datasets we realized a reverse
correlation between amino acid levels and cell growth rate: fast-growing cells
contain low-level amino acids, whilst a high level of amino acids exists in
slow-growing cells. Taken together, we propose that Lrp is a global regulator of 
transcription of a large number of the genes involved in not only amino acid
transport and metabolism, but also amino acid utilization.

DOI: 10.1099/mgen.0.000001 
PMCID: PMC5320599
PMID: 28348809 


28. J Biotechnol. 2015 Sep 10;209:41-9. doi: 10.1016/j.jbiotec.2015.06.389. Epub 2015
Jun 12.

Generation and characterization of nucleic acid aptamers targeting the capsid P
domain of a human norovirus GII.4 strain.

Moore MD(1), Escudero-Abarca BI(2), Suh SH(2), Jaykus LA(2).

Author information: 
(1)Department of Food, Bioprocessing and Nutrition Sciences, North Carolina State
University, 315 Schaub Hall, 400 Dan Allen Drive, Raleigh, NC 27695, USA.
Electronic address: mdmoore5@ncsu.edu.
(2)Department of Food, Bioprocessing and Nutrition Sciences, North Carolina State
University, 315 Schaub Hall, 400 Dan Allen Drive, Raleigh, NC 27695, USA.

Human noroviruses (NoV) are the leading cause of acute viral gastroenteritis
worldwide. Significant antigenic diversity of NoV strains has limited the
availability of broadly reactive ligands for design of detection assays. The
purpose of this work was to produce and characterize single stranded (ss)DNA
aptamers with binding specificity to human NoV using an easily produced NoV
target-the P domain protein. Aptamer selection was done using SELEX (Systematic
Evolution of Ligands by EXponential enrichment) directed against an Escherichia
coli-expressed and purified epidemic NoV GII.4 strain P domain. Two of six unique
aptamers (designated M1 and M6-2) were chosen for characterization. Inclusivity
testing using an enzyme-linked aptamer sorbent assay (ELASA) against a panel of
14 virus-like particles (VLPs) showed these aptamers had broad reactivity and
exhibited strong binding to GI.7, GII.2, two GII.4 strains, and GII.7 VLPs.
Aptamer M6-2 exhibited at least low to moderate binding to all VLPs tested.
Aptamers significantly (p<0.05) bound virus in partially purified GII.4 New
Orleans outbreak stool specimens as demonstrated by ELASA and aptamer magnetic
capture (AMC) followed by RT-qPCR. This is the first demonstration of human NoV P
domain protein as a functional target for the selection of nucleic acid aptamers 
that specifically bind and broadly recognize diverse human NoV strains.

Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

DOI: 10.1016/j.jbiotec.2015.06.389 
PMID: 26080079  [Indexed for MEDLINE]


29. Int J Biol Macromol. 2015;77:293-302. doi: 10.1016/j.ijbiomac.2015.03.043. Epub
2015 Apr 1.

Development of receptor-based inhibitory RNA aptamers for anthrax toxin
neutralization.

Lee SC(1), Gedi V(1), Ha NR(1), Cho JH(1), Park HC(2), Yoon MY(3).

Author information: 
(1)Department of Chemistry and Research Institute of Natural Sciences, Hanyang
University, Seoul 133-791, Republic of Korea.
(2)Veterinary Drugs & Biologics Division, Animal and Plant Quarantine Agency
(QIA), Anyang 430-757, Republic of Korea.
(3)Department of Chemistry and Research Institute of Natural Sciences, Hanyang
University, Seoul 133-791, Republic of Korea. Electronic address:
myyoon@hanyang.ac.kr.

Anthrax toxin excreted by Bacillus anthracis is the key causative agent of
infectious anthrax disease. In the present study, we targeted the binding of PA
to the ATR/TEM8 Von Willebrand factor type A (VWA) domain, which we cloned into
Escherichia coli and purified to homogeneity under denaturing conditions. To
develop an anthrax toxin inhibitor, we selected and identified short single
strand RNA aptamers (approximately 30mer) consisting of different sequences of
nucleic acids with a high binding affinity in the 100 nanomolar range against the
recombinant ATR/TEM8 VWA domain using systematic evolution of ligands by
exponential enrichment (SELEX). Five candidate aptamers were further
characterized by several techniques including secondary structural analysis. The 
inhibitor efficiency (IC50) of one of the aptamers toward anthrax toxin was
approximately 5μM in macrophage RAW 264.7 cells, as determined from cytotoxicity 
analysis by MTT assay. We believe that the candidate aptamers should be useful
for blocking the binding of PA to its receptor in order to neutralize anthrax
toxin.

Copyright © 2015 Elsevier B.V. All rights reserved.

DOI: 10.1016/j.ijbiomac.2015.03.043 
PMID: 25841381  [Indexed for MEDLINE]


30. FEMS Microbiol Lett. 2015 Jan;362(1):1-8. doi: 10.1093/femsle/fnu013. Epub 2014
Dec 4.

Role of transcription factor NimR (YeaM) in sensitivity control of Escherichia
coli to 2-nitroimidazole.

Ogasawara H(1), Ohe S(2), Ishihama A(3).

Author information: 
(1)Research Center for Human and Environmental Sciences, Shinshu University,
Ueda, Nagano 386-8567, Japan.
(2)Department of Frontier Bioscience, Hosei University, Koganei, Tokyo 184-8584, 
Japan.
(3)Department of Frontier Bioscience, Hosei University, Koganei, Tokyo 184-8584, 
Japan Research Center for Micro-Nano Technology, Hosei University, Koganei, Tokyo
184-8584, Japan aishiham@hosei.ac.jp.

The binding site(s) on the Escherichia coli genome was determined for an
uncharacterized AraC/XylS superfamily transcription factor YeaM by using the in
vitro genomic SELEX screening system. The only one clear binding target of YeaM
was found to locate in the spacer between the divergently transcribed yeaM and
yeaN genes. After the phenotype microarray analysis, the major facilitator
superfamily transporter YeaN was found to confer E. coli the resistance to
2-nitroimidazole, the antibacterial and antifungal antibiotic, suggesting that
YeaN plays a role in 2-nitromidazole efflux. Purified YeaM bound to three sites
within this yeaM-yeaN spacer region. Several lines of in vitro and in vivo
evidence indicate that YeaM regulates transcription of both the yeaM gene itself 
and the yeaNO operon. Taken together we propose to rename yeaN to nimT
(nitroimidazole transporter) and yeaM to nimR (regulator of nimT).

© FEMS 2014. All rights reserved. For permissions, please e-mail:
journals.permissions@oup.com.

DOI: 10.1093/femsle/fnu013 
PMID: 25790494  [Indexed for MEDLINE]


31. Biosens Bioelectron. 2015 Jun 15;68:272-80. doi: 10.1016/j.bios.2015.01.009. Epub
2015 Jan 3.

Analytical bioconjugates, aptamers, enable specific quantitative detection of
Listeria monocytogenes.

Lee SH(1), Ahn JY(1), Lee KA(1), Um HJ(1), Sekhon SS(1), Sun Park T(2), Min J(3),
Kim YH(4).

Author information: 
(1)Department of Microbiology, Chungbuk National University, 1 Chungdae-Ro,
Seowon-Gu, Cheongju 362-763, South Korea.
(2)Division of Endocrinology & Metabolism, Department of Internal Medicine,
Chonbuk National University Medical School, 634-18 Geumam-Dong, Duckjin-Gu,
Jeonju 561-712, South Korea.
(3)Graduate School of Semiconductor and Chemical Engineering, Chonbuk National
University, 664-14 Deokjin-dong, 1Ga Deokjin-Gu, Jeonju 561-756, South Korea.
Electronic address: jihomin@jbnu.ac.kr.
(4)Department of Microbiology, Chungbuk National University, 1 Chungdae-Ro,
Seowon-Gu, Cheongju 362-763, South Korea. Electronic address: kyh@chungbuk.ac.kr.

As a major human pathogen in the Listeria genus, Listeria monocytogenes causes
the bacterial disease listeriosis, which is a serious infection caused by eating 
food contaminated with the bacteria. We have developed an aptamer-based sandwich 
assay (ABSA) platform that demonstrates a promising potential for use in pathogen
detection using aptamers as analytical bioconjugates. The whole-bacteria SELEX
(WB-SELEX) strategy was adopted to generate aptamers with high affinity and
specificity against live L. monocytogenes. Of the 35 aptamer candidates tested,
LMCA2 and LMCA26 reacted to L. monocytogenes with high binding, and were
consequently chosen as sensing probes. The ABSA platform can significantly
enhance the sensitivity by employing a very specific aptamer pair for the
sandwich complex. The ABSA platform exhibited a linear response over a wide
concentration range of L. monocytogenes from 20 to 2×10(6) CFU per mL and was
closely correlated with the following relationship: y=9533.3x+1542.3 (R(2)=0.99).
Our proposed ABSA platform also provided excellent specificity for the tests to
distinguish L. monocytogenes from other Listeria species and other bacterial
genera (3 Listeria spp., 4 Salmonella spp., 2 Vibrio spp., 3 Escherichia coli and
3 Shigella spp.). Improvements in the sensitivity and specificity have not only
facilitated the reliable detection of L. monocytogenes at extremely low
concentrations, but also allowed for the development of a 96-well plate-based
routine assay platform for multivalent diagnostics.

Copyright © 2015 Elsevier B.V. All rights reserved.

DOI: 10.1016/j.bios.2015.01.009 
PMID: 25590973  [Indexed for MEDLINE]


32. Microbiology. 2015 Apr;161(Pt 4):729-38. doi: 10.1099/mic.0.000026. Epub 2015 Jan
7.

Cooperative regulation of the common target genes between H₂O₂-sensing YedVW and 
Cu²⁺-sensing CusSR in Escherichia coli.

Urano H(1), Umezawa Y(2), Yamamoto K(3), Ishihama A(3), Ogasawara H(4).

Author information: 
(1)Research Center for Human and Environmental Sciences, Shinshu University,
Ueda, Nagano 386-8567, Japan.
(2)Department of Frontier Bioscience, Hosei University, Koganei, Tokyo 184-8584, 
Japan.
(3)Department of Frontier Bioscience, Hosei University, Koganei, Tokyo 184-8584, 
Japan Research Center for Micro-Nano Technology, Hosei University, Koganei, Tokyo
184-8584, Japan.
(4)Research Center for Human and Environmental Sciences, Shinshu University,
Ueda, Nagano 386-8567, Japan hogasawara@shinshu-u.ac.jp.

YedVW is one of the uncharacterized two-component systems (TCSs) of Escherichia
coli. In order to identify the regulation targets of YedVW, we performed genomic 
SELEX (systematic evolution of ligands by exponential enrichment) screening using
phosphorylated YedW and an E. coli DNA library, and identified YedW-binding sites
within three intergenic spacers, yedW-hiuH, cyoA-ampG and cusR-cusC, along the E.
coli genome. Using a reporter assay system, we found that transcription of hiuH, 
encoding 5-hydroxyisourate hydrolase, was induced at high concentrations of
either Cu(2+) or H₂O₂. Cu(2+)-dependent expression of hiuH was observed in the
yedWV knockout mutant, but was reduced markedly in the cusRS-null mutant.
However, H₂O₂-induced hiuH expression was observed in the cusRS-null mutant, but 
not in the yedWV-null mutant. Gel mobility shift and DNase I footprinting
analyses showed binding of both YedW and CusR to essentially the same sequence
within the hiuH promoter region. Taken together, we concluded that YedVW and
CusSR formed a unique cooperative TCS pair by recognizing and regulating the same
targets, but under different environmental conditions - YedVW played a role in
H₂O₂ response regulation, whilst CusSR played a role in Cu(2+) response
regulation.

DOI: 10.1099/mic.0.000026 
PMID: 25568260  [Indexed for MEDLINE]


33. Microbiology. 2015 Jan;161(Pt 1):99-111. doi: 10.1099/mic.0.083550-0. Epub 2014
Nov 18.

Regulatory role of transcription factor SutR (YdcN) in sulfur utilization in
Escherichia coli.

Yamamoto K(1)(2), Nakano M(2), Ishihama A(1)(2).

Author information: 
(1)1Department of Frontier Bioscience, Hosei University, Koganei, Tokyo 185-8584,
Japan.
(2)2Research Institute of Micro-Nano Technology, Hosei University, Koganei, Tokyo
185-8584, Japan.

Sulfur makes up 1 % of the dry mass of bacteria, and it is an abundant element
(0.1 %) on earth. Sulfur in the environment is, however, mostly in oxidized forms
and inaccessible to living organisms. At present, the entire assimilation pathway
of external sulfur to sulfur-containing biomolecules and its regulation in
Escherichia coli remain poorly understood, except for the metabolic pathway of
cysteine synthesis, the first-step metabolite of sulfur assembly. During the
search for regulation targets of uncharacterized transcription factors by Genomic
SELEX screening, we found that the hitherto uncharacterized YdcN regulates a set 
of genes involved in the utilization of sulfur, including the generation of
sulfate and its reduction, the synthesis of cysteine, the synthesis of enzymes
containing Fe-S as cofactors, and the modification of tRNA with use of
sulfur-containing substrates. Taking these findings together, we propose renaming
YdcN as SutR (regulator of sulfur utilization).

© 2015 The Authors.

DOI: 10.1099/mic.0.083550-0 
PMID: 25406449  [Indexed for MEDLINE]


34. J Am Chem Soc. 2014 Nov 19;136(46):16299-308. doi: 10.1021/ja508478x. Epub 2014
Nov 5.

Broccoli: rapid selection of an RNA mimic of green fluorescent protein by
fluorescence-based selection and directed evolution.

Filonov GS(1), Moon JD, Svensen N, Jaffrey SR.

Author information: 
(1)Department of Pharmacology, Weill Cornell Medical College , New York, New York
10065, United States.

Genetically encoded fluorescent ribonucleic acids (RNAs) have diverse
applications, including imaging RNA trafficking and as a component of RNA-based
sensors that exhibit fluorescence upon binding small molecules in live cells.
These RNAs include the Spinach and Spinach2 aptamers, which bind and activate the
fluorescence of fluorophores similar to that found in green fluorescent protein. 
Although additional highly fluorescent RNA-fluorophore complexes would extend the
utility of this technology, the identification of novel RNA-fluorophore complexes
is difficult. Current approaches select aptamers on the basis of their ability to
bind fluorophores, even though fluorophore binding alone is not sufficient to
activate fluorescence. Additionally, aptamers require extensive mutagenesis to
efficiently fold and exhibit fluorescence in living cells. Here we describe a
platform for rapid generation of highly fluorescent RNA-fluorophore complexes
that are optimized for function in cells. This procedure involves selection of
aptamers on the basis of their binding to fluorophores, coupled with
fluorescence-activated cell sorting (FACS) of millions of aptamers expressed in
Escherichia coli. Promising aptamers are then further optimized using a
FACS-based directed evolution approach. Using this approach, we identified
several novel aptamers, including a 49-nt aptamer, Broccoli. Broccoli binds and
activates the fluorescence of
(Z)-4-(3,5-difluoro-4-hydroxybenzylidene)-1,2-dimethyl-1H-imidazol-5(4H)-one.
Broccoli shows robust folding and green fluorescence in cells, and increased
fluorescence relative to Spinach2. This reflects, in part, improved folding in
the presence of low cytosolic magnesium concentrations. Thus, this novel
fluorescence-based selection approach simplifies the generation of aptamers that 
are optimized for expression and performance in living cells.

DOI: 10.1021/ja508478x 
PMCID: PMC4244833
PMID: 25337688  [Indexed for MEDLINE]


35. Beijing Da Xue Xue Bao Yi Xue Ban. 2014 Oct 18;46(5):698-702.

[Screening and structure analysis of the aptamer target to Escherichia coli tolC 
protein].

[Article in Chinese]

Chen LL(1), Li J(1), Zhang XQ(1), Song L(1), Qian C(1), Ge JW(1).

Author information: 
(1)Medical school of Hunan University of Chinese Medicine, Changsha 410208,
China.

OBJECTIVE: To screen and characterize the aptamer of Escherichia coli outer
member protein tolC.
METHODS: By using the recombinant E.coli outer member protein tolC for the
screening target, oligonucleotides which were capable of specifically binding to 
the protein were screened from a random oligonucleotide library through the
stematic evolution of ligand by exponential enrichment (SELEX) technique. The
binding capacity of ssDNA to the targeted protein from each round was detected by
the FITC fluorescence labeling technique.The ssDNA from the last cycle was cloned
and sequenced,and the second structure was further analyzed by the DNAMan
program.
RESULTS: After 12 cycles of selection, 40 clones were selected randomly and
sequenced. Although a unique conserved sequence was not obtained among the 23
obtained aptamers by the primary structure analysis,three pairs of aptamers and
two pairs of aptamers were found to be identical.Analysis of the secondary
structure revealed that the stem-loop and bulge loop were the main
motifs,indicating that they might play a key role in the binding of aptamers to
the target protein. According to the characteristic of the second structure,23
aptamers were divided into four families,and aptamer 20 bore the greatest
affinity.
CONCLUSION: Aptamers against E.coli outer member protein tolC were successfully
identified by the SELEX method. The results laid a foundation for the
investigation of the interference to the drug resistance of E. coli and the
underlying mechanisms.


PMID: 25331389  [Indexed for MEDLINE]


36. Appl Biochem Biotechnol. 2014 Dec;174(7):2548-56. doi: 10.1007/s12010-014-1206-6.
Epub 2014 Sep 4.

Selection of peptidoglycan-specific aptamers for bacterial cells identification.

Ferreira IM(1), de Souza Lacerda CM, de Faria LS, Corrêa CR, de Andrade AS.

Author information: 
(1)Centro de Desenvolvimento da Tecnologia Nuclear/Comissão Nacional de Energia
Nuclear (CDTN/CNEN), Rua Professor Mário Werneck S/N°, Cidade
Universitária-Campus da UFMG, CEP:31120-970, Belo Horizonte, MG, Brasil,
imendesf@yahoo.com.br.

Peptidoglycan is a highly complex and essential macromolecule of bacterial outer 
cell wall; it is a heteropolymer made up of linear glycan strands cross-linked by
peptides. Peptidoglycan has a particular composition which makes it a possible
target for specific bacterial recognition. Aptamers are single-stranded DNA or
RNA oligonucleotides that bind to target molecules with high affinity and
specificity. Aptamers can be labeled with different radioisotopes and possess
several properties that make them suitable for molecular imaging. The purpose of 
this study was to obtain aptamers for use as radiopharmaceutical in bacterial
infection diagnosis. Two aptamers (Antibac1 and Antibac2) against peptidoglycan
were selected through the Systematic Evolution of Ligands by Exponential
Enrichment (SELEX) methodology. The dissociation constant (Kd) for Antibac1 was
0.415 + 0.047 μM and for Antibac2 was 1.261 + 0.280 μM. These aptamers labeled
with (32)P showed high affinity for Staphylococcus aureus cells. The binding to
S. aureus and Escherichia coli in vitro were significantly higher than for
Candida albicans and human fibroblasts, demonstrating their specificity for
bacterial cells. These results point Antibac1 and Antibac2 as promising tools for
bacterial infections identification.

DOI: 10.1007/s12010-014-1206-6 
PMID: 25185503  [Indexed for MEDLINE]


37. Appl Biochem Biotechnol. 2014 Sep;174(2):793-802. doi: 10.1007/s12010-014-1103-z.
Epub 2014 Aug 6.

Development of ssDNA aptamers for the sensitive detection of Salmonella
typhimurium and Salmonella enteritidis.

Park HC(1), Baig IA, Lee SC, Moon JY, Yoon MY.

Author information: 
(1)Department of Chemistry, College of Natural Science, Hanyang University,
Seoul, 133-791, Republic of Korea.

Salmonella enterica subsp. enterica ser. enteritidis and Salmonella enterica
subsp. enterica ser. typhimurium are the most common and severe food-borne
pathogens responsible for causing salmonellosis in humans and animals. The
development of an early and ultra-sensitive detection system is the first
critical step in controlling this disease. To accomplish this, we used the cell
systematic evolution of ligands by exponential enrichment (Cell-SELEX) technique 
to identify single-stranded DNA (ssDNA) aptamers to be used as detection probes
that can specifically bind to S. enteritidis and S. typhimurium. A total of 12
target-specific ssDNA aptamers were obtained through ten rounds of Cell-SELEX
under stringent selection conditions, and negative selection further enhanced the
selectivity among these aptamers. Aptamer specificity was investigated using the 
gram-negative bacteria E. coli and P. aeruginosa and was found to be much higher 
towards S. enteritidis and S. typhimurium. Importantly, three candidate aptamers 
demonstrated higher binding affinities and the dissociation constants (Kd) were
found to be in the range of nanomolar to submicromolar levels. Furthermore,
individual aptamers were conjugated onto polyvalent directed aptamer polymer,
which led to 100-fold increase in binding affinity compared to the individual
aptamers alone. Taken together, this study reports the identification of higher
affinity and specificity ssDNA aptamers (30mer), which may be useful as capture
and detection probes in biosensor-based detection systems for salmonellosis.

DOI: 10.1007/s12010-014-1103-z 
PMID: 25096391  [Indexed for MEDLINE]


38. J Chromatogr A. 2014 Sep 5;1358:269-76. doi: 10.1016/j.chroma.2014.06.079. Epub
2014 Jul 1.

Interaction evaluation of bacteria and protoplasts with single-stranded
deoxyribonucleic acid library based on capillary electrophoresis.

Meng C(1), Zhao X(2), Qu F(3), Mei F(4), Gu L(4).

Author information: 
(1)School of Life Science, Beijing Institute of Technology, 5 South Zhongguancun 
Street, Beijing 100081, China; State Key Laboratory of Reproductive Biology,
Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China.
(2)Beijing Centre for Physical and Chemical Analysis, Beijing 100089, China.
(3)School of Life Science, Beijing Institute of Technology, 5 South Zhongguancun 
Street, Beijing 100081, China. Electronic address: qufengqu@bit.edu.cn.
(4)School of Life Science, Beijing Institute of Technology, 5 South Zhongguancun 
Street, Beijing 100081, China.

For whole-cell aptamers selection, cells surface situation has great impact on
single-stranded (ssDNA) binding and aptamers selection. In this work, both
Lactobacillus acidophilus and Escherichia coli as well as their protoplasts were 
as cells targets, their interaction with ssDNA library were evaluated based on
capillary zone electrophoresis (CZE) and affinity capillary electrophoresis (ACE)
with UV and LIF detection. Our results demonstrated that protoplasts without
cells wall had apparently stronger interaction with ssDNA library than bacteria, 
the protoplasts-ssDNA complex could be observed clearly with CZE-LIF.
Furthermore, E. coli pretreated by four organic solvents (methanol, ethanol,
formaldehyde and glutaraldehyde) showed binding difference with ssDNA library,
which could be identified with ACE-UV. Binding constants indicated the
interaction of E. coli with ssDNA library were in the order of E. coli
protoplasts>methanol (ethanol) treated E. coli>formaldehyde (glutaraldehyde)
treated E. coli≈E. coli. Above results suggest that cells surface situation
determines their binding affinity with ssDNA, which should be considered in
whole-cell aptamers selection and aptamers further application. Capillary
electrophoresis is a preferable technique for interaction evaluation of composite
targets binding with ssDNA library.

Copyright © 2014 Elsevier B.V. All rights reserved.

DOI: 10.1016/j.chroma.2014.06.079 
PMID: 25035238  [Indexed for MEDLINE]


39. J Microbiol Methods. 2014 Sep;104:94-100. doi: 10.1016/j.mimet.2014.06.016. Epub 
2014 Jul 4.

Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by
quantitative PCR controlled Cell-SELEX.

Savory N(1), Nzakizwanayo J(2), Abe K(3), Yoshida W(4), Ferri S(5), Dedi C(6),
Jones BV(7), Ikebukuro K(8).

Author information: 
(1)Department of Biotechnology and Life Science, Tokyo University of Agriculture 
and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588, Japan. Electronic
address: 50012831103@st.tuat.ac.jp.
(2)School of Pharmacy and Biomolecular Sciences, University of Brighton, Huxley
Building, Lewes Road, Brighton, East Sussex, BN2 4GJ, United Kingdom. Electronic 
address: J.Nzakizwanayo@brighton.ac.uk.
(3)Department of Biotechnology and Life Science, Tokyo University of Agriculture 
and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588, Japan. Electronic
address: abekou@cc.tuat.ac.jp.
(4)School of Bioscience and Biotechnology, Tokyo University of Technology, 1404-1
Katakuramachi, Hachioji, Tokyo 192-0982, Japan. Electronic address:
yoshidawtr@stf.teu.ac.jp.
(5)Department of Biotechnology and Life Science, Tokyo University of Agriculture 
and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588, Japan. Electronic
address: stefano@cc.tuat.ac.jp.
(6)School of Pharmacy and Biomolecular Sciences, University of Brighton, Huxley
Building, Lewes Road, Brighton, East Sussex, BN2 4GJ, United Kingdom. Electronic 
address: C.G.Dedi@brighton.ac.uk.
(7)School of Pharmacy and Biomolecular Sciences, University of Brighton, Huxley
Building, Lewes Road, Brighton, East Sussex, BN2 4GJ, United Kingdom; Queen
Victoria Hospital NHS Foundation Trust, Holtye Road, East Grinstead, West Sussex,
RD19 3DZ, United Kingdom. Electronic address: B.V.Jones@brighton.ac.uk.
(8)Department of Biotechnology and Life Science, Tokyo University of Agriculture 
and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588, Japan. Electronic
address: ikebu@cc.tuat.ac.jp.

In order to better control nosocomial infections, and facilitate the most prudent
and effective use of antibiotics, improved strategies for the rapid detection and
identification of problematic bacterial pathogens are required. DNA aptamers have
much potential in the development of diagnostic assays and biosensors to address 
this important healthcare need, but further development of aptamers targeting
common pathogens, and the strategies used to obtain specific aptamers are
required. Here we demonstrate the application of a quantitative PCR (qPCR)
controlled Cell-SELEX process, coupled with downstream
secondary-conformation-based aptamer profiling. We used this approach to identify
and select DNA aptamers targeted against uropathogenic Escherichia coli, for
which specific aptamers are currently lacking, despite the prevalence of these
infections. The use of qPCR to monitor the Cell-SELEX process permitted a minimal
number of SELEX cycles to be employed, as well as the cycle-by-cycle optimisation
of standard PCR amplification of recovered aptamer pools at each round.
Identification of useful aptamer candidates was also facilitated by profiling of 
secondary conformations and selection based on putative aptamer secondary
structure. One aptamer selected this way (designated EcA5-27), displaying a
guanine-quadruplex sequence motif, was shown to have high affinity and
specificity for target cells, and the potential to discriminate between distinct 
strains of E. coli, highlighting the possibility for development of aptamers
selectively recognising pathogenic strains. Overall, the identified aptamers hold
much potential for the development of rapid diagnostic assays for nosocomial
urinary tract infections caused by E. coli.

Copyright © 2014. Published by Elsevier B.V.

DOI: 10.1016/j.mimet.2014.06.016 
PMID: 25008464  [Indexed for MEDLINE]


40. J Nucleic Acids. 2014;2014:214929. doi: 10.1155/2014/214929. Epub 2014 Apr 15.

Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers
against Shiga Toxins.

Challa S(1), Tzipori S(2), Sheoran A(2).

Author information: 
(1)Department of Infectious Disease and Global Health, Tufts Cummings School of
Veterinary Medicine, Tufts University, 200 Westboro Road, Building 20, North
Grafton, MA 01536, USA ; AstraZeneca, 35 Gatehouse Drive, Waltham, MA 02451, USA.
(2)Department of Infectious Disease and Global Health, Tufts Cummings School of
Veterinary Medicine, Tufts University, 200 Westboro Road, Building 20, North
Grafton, MA 01536, USA.

Infection with Shiga toxin- (Stx-) producing E. coli causes life threatening
hemolytic uremic syndrome (HUS), a leading cause of acute renal failure in
children. Of the two antigenically distinct toxins, Stx1 and Stx2, Stx2 is more
firmly linked with the development of HUS. In the present study, selective
evolution of ligands by exponential enrichment (SELEX) was used in an attempt to 
identify RNA aptamers against Stx1 and Stx2. After 5 rounds of selection,
significant enrichment of aptamer pool was obtained against Stx2, but not against
Stx1, using a RNA aptamer library containing 56 random nucleotides (N56).
Characterization of individual aptamer sequences revealed that six unique RNA
aptamers (mA/pC, mB/pA, mC, mD, pB, and pD) recognized Stx2 in a filter binding
assay. None of these aptamers bound Stx1. Aptamers mA/pC, mB/pA, mC, and mD, but 
not pB and pD, partially blocked binding of Alexa 488-labeled Stx2 with HeLa
cells in a flow cytometry assay. However, none of the aptamers neutralized
Stx2-mediated cytotoxicity and death of HeLa cells.

DOI: 10.1155/2014/214929 
PMCID: PMC4009280
PMID: 24839553 


41. J Bacteriol. 2014 Aug;196(15):2718-27. doi: 10.1128/JB.01579-14. Epub 2014 May
16.

Intracellular concentrations of 65 species of transcription factors with known
regulatory functions in Escherichia coli.

Ishihama A(1), Kori A(2), Koshio E(3), Yamada K(2), Maeda H(3), Shimada T(2),
Makinoshima H(4), Iwata A(4), Fujita N(3).

Author information: 
(1)Department of Frontier Bioscience and Micro-Nano Technology Research Center,
Hosei University, Koganei, Tokyo, Japan Nippon Institute for Biological Science, 
Ome, Tokyo, Japan Department of Molecular Genetics, National Institute of
Genetics, Mishima, Shizuoka, Japan aishiham@hosei.ac.jp.
(2)Department of Frontier Bioscience and Micro-Nano Technology Research Center,
Hosei University, Koganei, Tokyo, Japan Nippon Institute for Biological Science, 
Ome, Tokyo, Japan.
(3)Department of Molecular Genetics, National Institute of Genetics, Mishima,
Shizuoka, Japan.
(4)Nippon Institute for Biological Science, Ome, Tokyo, Japan.

The expression pattern of the Escherichia coli genome is controlled in part by
regulating the utilization of a limited number of RNA polymerases among a total
of its approximately 4,600 genes. The distribution pattern of RNA polymerase
changes from modulation of two types of protein-protein interactions: the
interaction of core RNA polymerase with seven species of the sigma subunit for
differential promoter recognition and the interaction of RNA polymerase
holoenzyme with about 300 different species of transcription factors (TFs) with
regulatory functions. We have been involved in the systematic search for the
target promoters recognized by each sigma factor and each TF using the newly
developed Genomic SELEX system. In parallel, we developed the promoter-specific
(PS)-TF screening system for identification of the whole set of TFs involved in
regulation of each promoter. Understanding the regulation of genome transcription
also requires knowing the intracellular concentrations of the sigma subunits and 
TFs under various growth conditions. This report describes the intracellular
levels of 65 species of TF with known function in E. coli K-12 W3110 at various
phases of cell growth and at various temperatures. The list of intracellular
concentrations of the sigma factors and TFs provides a community resource for
understanding the transcription regulation of E. coli under various stressful
conditions in nature.

Copyright © 2014, American Society for Microbiology. All Rights Reserved.

DOI: 10.1128/JB.01579-14 
PMCID: PMC4135669
PMID: 24837290  [Indexed for MEDLINE]


42. FEMS Microbiol Lett. 2014 Jun;355(2):93-9. doi: 10.1111/1574-6968.12466. Epub
2014 May 27.

Involvement of cAMP-CRP in transcription activation and repression of the pck
gene encoding PEP carboxykinase, the key enzyme of gluconeogenesis.

Nakano M(1), Ogasawara H, Shimada T, Yamamoto K, Ishihama A.

Author information: 
(1)Department of Frontier Bioscience and Research Center for Micro-Nano
Technology, Hosei University, Koganei, Tokyo, Japan.

cAMP receptor protein (CRP) is the best characterized global regulator of
Escherichia coli. After genomic SELEX screening, a total of minimum 378 promoters
have been identified as its regulation targets on the E. coli genome. Among a
number of promoters carrying two CRP-binding sites, several promoters carry two
CRP-binding sites, one upstream but another downstream of transcription
initiation sites. The regulatory role of downstream CRP site remains unsolved.
Using the pck gene encoding phosphoenolpyruvate carboxykinase as a model
promoter, we analyzed the role of CRP-associated downstream of the transcription 
initiation site. Gel shift assay and AFM observation indicate that CRP binds to
both the promoter-distal site (CRP box-1) at -90.5 and the site (CRP box-2) at
+13.5 downstream of transcription initiation site. The binding affinity is higher
for CRP box-1. Roles of two CRP sites were examined using in vitro transcription 
assay and in vivo reporter assay. In both cases, transcription repression was
observed in the presence of high concentrations of CRP. Taken together, we
propose that cAMP-CRP associated at downstream CRP box-2 plays as a repressor for
pck transcription only in the presence of high levels of cAMP-CRP.

© 2014 Federation of European Microbiological Societies. Published by John Wiley 
& Sons Ltd. All rights reserved.

DOI: 10.1111/1574-6968.12466 
PMID: 24814025  [Indexed for MEDLINE]


43. J Fluoresc. 2014 Jul;24(4):1159-68. doi: 10.1007/s10895-014-1396-x. Epub 2014 Apr
25.

Rapid fluorescent detection of Escherichia coli K88 based on DNA aptamer library 
as direct and specific reporter combined with immuno-magnetic separation.

Peng Z(1), Ling M, Ning Y, Deng L.

Author information: 
(1)The Co-construction Laboratory of Microbial Molecular Biology of Province and 
Ministry of Science and Technology, College of Life Science, Hunan Normal
University, Changsha, 410081, Hunan, China.

Nucleic acid aptamers have long demonstrated the capacity to bind cells with high
affinity so that they have been utilized to diagnose various important pathogens.
In this study, a DNA aptamer library was on initial efforts developed to act as a
specific reporter for rapid detection of enter toxigenic Escherichia coli (ETEC) 
K88 combined with immuno-magnetic separation (IMS). During a Whole-cell
Systematic Evolution of Ligands by Exponential Enrichment (CELL-SELEX) procedure,
the last selection pool against ETEC K88, which is named "DNA aptamer library"
here, was selected and subsequently identified by flow cytometric analysis and
confocal imaging. A K88 monoclonal antibody (mAb) with high affinity (K(aff):
1.616 ± 0.033 × 10(8) M(-1)) against K88 fimbrial protein was prepared,
biotinylated and conjugated to streptavidin-coated magnetic beads (MBs). After
the bacteria were effectively captured and enriched from the complex sample by
immuno-magnetic beads (IMBs), 5'-FITC modified aptamer library was directly bound
to target cells as a specific reporter for its detection. The detection system
showed clearly high specificity and sensitivity with the detection limit of
1.1 × 10(3) CFU/ml in pure culture and 2.2 × 10(3) CFU/g in artificially
contaminated fecal sample. The results also indicated that fluorophore-lablled
DNA aptamer library as specific reporter could generate more reliable signals
than individual aptamer with best affinity against target cells and implied it
would have great applied potential in directly reporting bacteria from complex
samples combined with IMS technology.

DOI: 10.1007/s10895-014-1396-x 
PMID: 24763818  [Indexed for MEDLINE]


44. Genes Cells. 2014 May;19(5):405-18. doi: 10.1111/gtc.12139. Epub 2014 Mar 19.

Roles of cell division control factor SdiA: recognition of quorum sensing signals
and modulation of transcription regulation targets.

Shimada T(1), Shimada K, Matsui M, Kitai Y, Igarashi J, Suga H, Ishihama A.

Author information: 
(1)Department of Frontier Bioscience, Hosei University, Koganei, Tokyo, 184-8584,
Japan; Research Center for Micro-Nano Technology, Hosei University, Koganei,
Tokyo, 184-8584, Japan; Chemical Resources Laboratory, Tokyo Institute of
Technology, Nagatsuda, Yokohama, 226-8503, Japan.

In Gram-negative bacteria, N-acylhomoserine lactone (HSL) is used as a signal in 
cell-cell communication and quorum sensing (QS). The model prokaryote Escherichia
coli lacks the system of HSL synthesis, but is capable of monitoring HSL signals 
in environment. Transcription factor SdiA for cell division control is believed
to play a role as a HSL sensor. Using a collection of 477 species of chemically
synthesized HSL analogues, we identified three synthetic signal molecules (SSMs) 
that bind in vitro to purified SdiA. After SELEX-chip screening of SdiA-binding
DNA sequences, a striking difference was found between these SSMs in the pattern 
of regulation target genes on the E. coli genome. Based on Northern blot analysis
in vivo, a set of target genes were found to be repressed by SdiA in the absence 
of effectors and derepressed by the addition of SSMs. Another set of genes were, 
however, expressed in the absence of effector ligands but repressed by the
addition of SSMs. Taken together, we propose that the spectrum of taget gene
selection by SdiA is modulated in multiple modes depending on the interacting
HSL-like signal molecules.

© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of
Japan and Wiley Publishing Asia Pty Ltd.

DOI: 10.1111/gtc.12139 
PMID: 24645791  [Indexed for MEDLINE]


45. PLoS One. 2014 Mar 6;9(3):e90447. doi: 10.1371/journal.pone.0090447. eCollection 
2014.

The whole set of constitutive promoters recognized by RNA polymerase RpoD
holoenzyme of Escherichia coli.

Shimada T(1), Yamazaki Y(2), Tanaka K(3), Ishihama A(4).

Author information: 
(1)Department of Frontier Biosience, Hosei University, Koganai, Tokyo, Japan;
Micro-Nano Technology Research Center, Hosei University, Koganai, Tokyo, Japan;
Chemical Resources Laboratory, Tokyo Institute of Technology, Nagatsuda,
Yokohama, Japan.
(2)Genetics Strains Research Institute, National Institute of Genetics, Mishima, 
Shizuoka, Japan.
(3)Chemical Resources Laboratory, Tokyo Institute of Technology, Nagatsuda,
Yokohama, Japan.
(4)Department of Frontier Biosience, Hosei University, Koganai, Tokyo, Japan;
Micro-Nano Technology Research Center, Hosei University, Koganai, Tokyo, Japan.

Erratum in
    PLoS One. 2014;9(6):e100908.

The promoter selectivity of Escherichia coli RNA polymerase is determined by the 
sigma subunit with promoter recognition activity. The model prokaryote
Escherichia coli contains seven species of the sigma subunit, each recognizing a 
specific set of promoters. The major sigma subunit, sigma-70 encoded by rpoD,
plays a major role in transcription of growth-related genes. Concomitant with the
increase in detection of promoters functioning in vivo under various stressful
conditions, the variation is expanding in the consensus sequence of RpoD
promoters. In order to identify the canonical sequence of "constitutive
promoters" that are recognized by the RNA polymerase holoenzyme containing RpoD
sigma in the absence of supporting transcription factors, an in vitro mixed
transcription assay was carried out using a whole set of variant promoters, each 
harboring one base replacement, within the model promoter with the conserved -35 
and -10 sequences of RpoD promoters. The consensus sequences, TTGACA(-35) and
TATAAT(-10), were identified to be ideal for the maximum level of open complex
formation and the highest rate of promoter opening, respectively. For
identification of the full range of constitutive promoters on the E. coli genome,
a total of 2,701 RpoD holoenzyme-binding sites were identified by Genomic SELEX
screening, and using the reconfirmed consensus promoter sequence, a total of
maximum 669 constitutive promoters were identified, implying that the majority of
hitherto identified promoters represents the TF-dependent "inducible promoters". 
One unique feature of the constitutive promoters is the high level of promoter
sequence conservation, about 85% carrying five-out-of-six agreements with -35 or 
-10 consensus sequence. The list of constitutive promoters provides the community
resource toward estimation of the inducible promoters that operate under various 
stressful conditions in nature.

DOI: 10.1371/journal.pone.0090447 
PMCID: PMC3946193
PMID: 24603758  [Indexed for MEDLINE]


46. Nat Protoc. 2014 Jan;9(1):146-55. doi: 10.1038/nprot.2014.001. Epub 2013 Dec 19.

Using Spinach-based sensors for fluorescence imaging of intracellular metabolites
and proteins in living bacteria.

Strack RL(1), Song W(1), Jaffrey SR(1).

Author information: 
(1)Department of Pharmacology, Weill Medical College, Cornell University, New
York, New York, USA.

Genetically encoded fluorescent sensors can be valuable tools for studying the
abundance and flux of molecules in living cells. We recently developed a novel
class of sensors composed of RNAs that can be used to detect diverse small
molecules and untagged proteins. These sensors are based on Spinach, an RNA mimic
of GFP, and they have successfully been used to image several metabolites and
proteins in living bacteria. Here we discuss the generation and optimization of
these Spinach-based sensors, which, unlike most currently available genetically
encoded reporters, can be readily generated to any target of interest. We also
provide a detailed protocol for imaging ADP dynamics in living Escherichia coli
after a change from glucose-containing medium to other carbon sources. The entire
procedure typically takes ∼4 d including bacteria transformation and image
analysis. The majority of this protocol is applicable to sensing other
metabolites and proteins in living bacteria.

DOI: 10.1038/nprot.2014.001 
PMCID: PMC4028027
PMID: 24356773  [Indexed for MEDLINE]


47. Biosens Bioelectron. 2014 Apr 15;54:195-8. doi: 10.1016/j.bios.2013.11.003. Epub 
2013 Nov 12.

Aptamer cocktails: enhancement of sensing signals compared to single use of
aptamers for detection of bacteria.

Kim YS(1), Chung J(1), Song MY(2), Jurng J(1), Kim BC(3).

Author information: 
(1)Center for Environment, Health and Welfare Research, Korea Institute of
Science and Technology, Seoul 136-701, Republic of Korea.
(2)Center for Environment, Health and Welfare Research, Korea Institute of
Science and Technology, Seoul 136-701, Republic of Korea; Graduate School of
Energy and Environmental System Engineering, University of Seoul, Seoul 130-743, 
Republic of Korea.
(3)Center for Environment, Health and Welfare Research, Korea Institute of
Science and Technology, Seoul 136-701, Republic of Korea. Electronic address:
bchankim@kist.re.kr.

Microbial cells have many binding moieties on their surface for binding to their 
specific bioreceptors. The whole-cell SELEX process enables the isolation of
various aptamers that can bind to different components on the cell surface such
as proteins, polysaccharides, or flagella with high affinity and specificity.
Here, we examine the binding capacity of an aptamer mixture (aptamer cocktail)
composed of various combinations of 3 different DNA aptamers isolated from
Escherichia coli and compare it with one of the single aptamers using
fluorescence-tagged aptamers. The aptamer mixtures showed higher fluorescence
signal than did any single aptamer used, which suggests that use of aptamer
mixtures can enhance the sensitivity of detection of microbial cells. To further 
evaluate this effect, the signal enhancement and improvement of sensitivity
provided by combinatorial use of aptamers were examined in an electrochemical
detection system. With regard to current decreases, the aptamer cocktail
immobilized on gold electrodes performed better than a single aptamer immobilized
on gold electrodes did. Consequently, the detection limit achieved using the
aptamers individually was approximately 18 times that when the 3 aptamers were
used in combination. These results support the use of aptamer cocktails for
detection of complex targets such as E. coli with enhanced sensitivity.

© 2013 Published by Elsevier B.V.

DOI: 10.1016/j.bios.2013.11.003 
PMID: 24280049  [Indexed for MEDLINE]


48. J Microbiol Methods. 2013 Nov;95(2):162-6. doi: 10.1016/j.mimet.2013.08.005. Epub
2013 Aug 24.

Identification of Salmonella Typhimurium-specific DNA aptamers developed using
whole-cell SELEX and FACS analysis.

Moon J(1), Kim G, Lee S, Park S.

Author information: 
(1)Department of Agricultural Engineering, National Academy of Agricultural
Sciences, Suwon 441-707, South Korea.

Conventional methods for detection of infective organisms, such as Salmonella,
are complicated and require multiple steps, and the need for rapid detection has 
increased. Biosensors show great potential for rapid detection of pathogens. In
turn, aptamers have great potential for biosensor assay development, given their 
small size, ease of synthesis and labeling, lack of immunogenicity, a lower cost 
of production than antibodies, and high target specificity. In this study, ssDNA 
aptamers specific to Salmonella Typhimurium were obtained by a whole
bacterium-based systematic evolution of ligands by exponential enrichment (SELEX)
procedure and applied to probing S. Typhimurium. After 10 rounds of selection
with S. Typhimurium as the target and Salmonella Enteritidis, Escherichia coli
and Staphylococcus aureus as counter targets, the highly enriched oligonucleic
acid pool was sorted using flow cytometry. In total, 12 aptamer candidates from
different families were sequenced and grouped. Fluorescent analysis demonstrated 
that aptamer C4 had particularly high binding affinity and selectivity; this
aptamer was then further characterized.

© 2013 Elsevier B.V. All rights reserved.

DOI: 10.1016/j.mimet.2013.08.005 
PMID: 23978634  [Indexed for MEDLINE]


49. J Bacteriol. 2013 Oct;195(19):4496-505. doi: 10.1128/JB.00304-13. Epub 2013 Aug
2.

Identification of the set of genes, including nonannotated morA, under the direct
control of ModE in Escherichia coli.

Kurata T(1), Katayama A, Hiramatsu M, Kiguchi Y, Takeuchi M, Watanabe T,
Ogasawara H, Ishihama A, Yamamoto K.

Author information: 
(1)Department of Frontier Bioscience.

ModE is the molybdate-sensing transcription regulator that controls the
expression of genes related to molybdate homeostasis in Escherichia coli. ModE is
activated by binding molybdate and acts as both an activator and a repressor. By 
genomic systematic evolution of ligands by exponential enrichment (SELEX)
screening and promoter reporter assays, we have identified a total of nine
operons, including the hitherto identified modA, moaA, dmsA, and napF operons, of
which six were activated by ModE and three were repressed. In addition, two
promoters were newly identified and direct transcription of novel genes, referred
to as morA and morB, located on antisense strands of yghW and torY, respectively.
The morA gene encodes a short peptide, MorA, with an unusual initiation codon.
Surprisingly, overexpression of the morA 5' untranslated region exhibited an
inhibitory influence on colony formation of E. coli K-12.

DOI: 10.1128/JB.00304-13 
PMCID: PMC3807462
PMID: 23913318  [Indexed for MEDLINE]


50. Methods. 2013 Sep 15;63(2):144-59. doi: 10.1016/j.ymeth.2013.04.023. Epub 2013
May 23.

Identifying and characterizing Hfq-RNA interactions.

Faner MA(1), Feig AL.

Author information: 
(1)Department of Chemistry, Wayne State University, 5101 Cass Ave., Detroit, MI, 
United States.

To regulate stress responses and virulence, bacteria use small regulatory RNAs
(sRNAs). These RNAs can up or down regulate target mRNAs through base pairing by 
influencing ribosomal access and RNA decay. A large class of these sRNAs, called 
trans-encoded sRNAs, requires the RNA binding protein Hfq to facilitate base
pairing between the regulatory RNA and its target mRNA. The resulting network of 
regulation is best characterized in Escherichia coli and Salmonella typhimurium, 
but the importance of Hfq dependent sRNA regulation is recognized in a diverse
population of bacteria. In this review we present the approaches and methods used
to discover Hfq binding RNAs, characterize their interactions and elucidate their
functions.

Copyright © 2013 Elsevier Inc. All rights reserved.

DOI: 10.1016/j.ymeth.2013.04.023 
PMCID: PMC3787079
PMID: 23707622  [Indexed for MEDLINE]


51. J Microbiol Biotechnol. 2013 Jun 28;23(6):878-84.

In vitro selection of RNA aptamer specific to Salmonella typhimurium.

Han SR(1), Lee SW.

Author information: 
(1)Department of Molecular Biology, Institute of Nanosensor and Biotechnology,
Dankook University, Yongin 448-701, Korea.

Salmonella is a major foodborne pathogen that causes a variety of human diseases.
Development of ligands directly and specifically binding to the Salmonella will
be crucial for the rapid detection of, and thus for efficient protection from,
the virulent bacteria. In this study, we identified a RNA aptamer-based ligand
that can specifically recognize Salmonella Typhimurium through SELEX technology. 
To this end, we isolated and characterized an RNase-resistant RNA aptamer that
bound to the OmpC protein of Salmonella Typhimurium with high specificity and
affinity (Kd ~ 20 nM). Of note, the selected aptamer was found to specifically
bind to Salmonella Typhimurium, but neither to Gram-positive bacteria
(Staphylococcus aureus) nor to other Gram-negative bacteria (Escherichia coli
O157:H7). This was evinced by aptamer-immobilized ELISA and aptamer-linked
precipitation experiments. This Salmonella species-specific aptamer could be
useful as a diagnostic ligand against pathogen-caused foodborne sickness.


PMID: 23676911  [Indexed for MEDLINE]


52. FEMS Microbiol Lett. 2013 Jul;344(2):159-65. doi: 10.1111/1574-6968.12172. Epub
2013 Jun 3.

Involvement of the ribose operon repressor RbsR in regulation of purine
nucleotide synthesis in Escherichia coli.

Shimada T(1), Kori A, Ishihama A.

Author information: 
(1)Department of Frontier Bioscience, Hosei University, Koganei, Tokyo, Japan.

Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes
for the transport and initial-step metabolism of d-ribose form a single rbsDACBK 
operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD 
and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In
the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type
transcription factor RbsR, which is encoded by a gene located downstream of this 
ribose operon. At present, the rbs operon is believed to be the only target of
regulation by RbsR. After Genomic SELEX screening, however, we have identified
that RbsR binds not only to the rbs promoter but also to the promoters of a set
of genes involved in purine nucleotide metabolism. Northern blotting analysis
indicated that RbsR represses the purHD operon for de novo synthesis of purine
nucleotide but activates the add and udk genes involved in the salvage pathway of
purine nucleotide synthesis. Taken together, we propose that RbsR is a global
regulator for switch control between the de novo synthesis of purine nucleotides 
and its salvage pathway.

© 2013 Federation of European Microbiological Societies. Published by John Wiley 
& Sons Ltd. All rights reserved.

DOI: 10.1111/1574-6968.12172 
PMID: 23651393  [Indexed for MEDLINE]


53. Biotechnol Bioeng. 2013 Oct;110(10):2573-80. doi: 10.1002/bit.24922. Epub 2013
Apr 22.

In silico maturation of binding-specificity of DNA aptamers against Proteus
mirabilis.

Savory N(1), Lednor D, Tsukakoshi K, Abe K, Yoshida W, Ferri S, Jones BV,
Ikebukuro K.

Author information: 
(1)Department of Biotechnology and Life Science, Tokyo University of Agriculture 
and Technology, 2-24-16 Naka-cho, Koganei, Tokyo, 184-8588, Japan.

Proteus mirabilis is a prominent cause of catheter-associated urinary tract
infections (CAUTIs) among patients undergoing long-term bladder catheterization. 
There are currently no effective means of preventing P. mirabilis infections, and
strategies for prophylaxis and rapid early diagnosis are urgently required.
Aptamers offer significant potential for development of countermeasures against
P. mirabilis CAUTI and are an ideal class of molecules for the development of
diagnostics and therapeutics. Here we demonstrate the application of Cell-SELEX
to identify DNA aptamers that show high affinity for P. mirabilis. While the
aptamers identified displayed high affinity for P. mirabilis cells in dot
blotting assays, they also bound to other uropathogenic bacteria. To improve
aptamer specificity for P. mirabilis, an in silico maturation (ISM) approach was 
employed. Two cycles of ISM allowed the identification of an aptamer showing 36% 
higher specificity, evaluated as a ratio of binding signal for P. mirabilis to
that for Escherichia coli (also a cause of CAUTI and the most common urinary
tract pathogen). Aptamers that specifically recognize P. mirabilis would have
diagnostic and therapeutic values and constitute useful tools for studying
membrane-associated proteins in this organism.

Copyright © 2013 Wiley Periodicals, Inc.

DOI: 10.1002/bit.24922 
PMID: 23568752  [Indexed for MEDLINE]


54. Appl Microbiol Biotechnol. 2013 Apr;97(8):3677-86. doi:
10.1007/s00253-013-4766-4. Epub 2013 Mar 14.

Selection of DNA aptamers for capture and detection of Salmonella Typhimurium
using a whole-cell SELEX approach in conjunction with cell sorting.

Dwivedi HP(1), Smiley RD, Jaykus LA.

Author information: 
(1)Population Health and Pathobiology, College of Veterinary Medicine, North
Carolina State University, Raleigh, NC, USA. hari-prakash.dwivedi@biomerieux.com

Alternative ligands such as nucleic acid aptamers can be used for pathogen
capture and detection and offer advantages over antibodies, including reduced
cost, ease of production and modification, and improved stability. DNA aptamers
demonstrating binding specificity to Salmonella enterica serovar Typhimurium were
identified by whole-cell-systematic evolution of ligands by exponential
enrichment (SELEX) beginning with a combinatorial library of biotin-labeled
single stranded DNA molecules. Aptamer specificity was achieved using whole-cell 
counter-SELEX against select non-Salmonella genera. Aptamers binding to
Salmonella were sorted, cloned, sequenced, and characterized for binding
efficiency. Out of 18 candidate aptamers screened, aptamer S8-7 showed relatively
high binding affinity with an apparent dissociation constant (K d value) of
1.73 ± 0.54 μM and was selected for further characterization. Binding exclusivity
analysis of S8-7 showed low apparent cross-reactivity with other foodborne
bacteria including Escherichia coli O157: H7 and Citrobacter braakii and moderate
cross-reactivity with Bacillus cereus. Aptamer S8-7 was successfully used as a
ligand for magnetic capture of serially diluted Salmonella Typhimurium cells,
followed by downstream detection using qPCR. The lower limit of detection of the 
aptamer magnetic capture-qPCR assay was 10(2)-10(3) CFU equivalents of Salmonella
Typhimurium in a 290-μl sample volume. Mean capture efficiency ranged from 3.6 to
12.6 %. Unique aspects of the study included (a) the use of SELEX targeting whole
cells; (b) the application of flow cytometry for aptamer pool selection, thereby 
favoring purification of ligands with both high binding affinity and targeting
abundant cell surface moieties; and (c) the use of pre-labeled primers that
circumvented the need for post-selection ligand labeling. Taken together, this
study provides proof-of-concept that biotinylated aptamers selected by whole-cell
SELEX can be used in a qPCR-based capture-detection platform for Salmonella
Typhimurium.

DOI: 10.1007/s00253-013-4766-4 
PMID: 23494620  [Indexed for MEDLINE]


55. Anal Biochem. 2013 May 1;436(1):22-8. doi: 10.1016/j.ab.2013.01.014. Epub 2013
Jan 26.

Isolation and characterization of DNA aptamers against Escherichia coli using a
bacterial cell-systematic evolution of ligands by exponential enrichment
approach.

Kim YS(1), Song MY, Jurng J, Kim BC.

Author information: 
(1)Center for Environment, Health and Welfare Research, Korea Institute of
Science and Technology, Seoul 136-701, Republic of Korea.

Aptamers are powerful capturing probes against various targets such as proteins, 
small organic compounds, metal ions, and even cells. In this study, we isolated
and characterized single-stranded DNA (ssDNA) aptamers against Escherichia coli. 
A total of 28 ssDNAs were isolated after 10 rounds of selection using a bacterial
cell-SELEX (systematic evolution of ligands by exponential enrichment) process.
Other bacterial species (Klebsiella pneumoniae, Citrobacter freundii,
Enterobacter aerogenes, and Staphylococcus epidermidis) were used for counter
selection to enhance the selectivity of ssDNA aptamers against E. coli. Finally, 
four ssDNA aptamers showed high affinity and selectivity to E. coli, The
dissociation constants (K(d)) of these four ssDNA aptamers to E. coli were
estimated to range from 12.4 to 25.2 nM. These aptamers did not bind to other
bacterial species, including four counter cells, but they showed affinity to
different E. coli strains. The binding of these four aptamers to E. coli was
observed directly by fluorescence microscopy.

Copyright © 2013 Elsevier Inc. All rights reserved.

DOI: 10.1016/j.ab.2013.01.014 
PMID: 23357235  [Indexed for MEDLINE]


56. Genes Cells. 2013 Feb;18(2):123-34. doi: 10.1111/gtc.12026. Epub 2013 Jan 10.

Novel regulator PgrR for switch control of peptidoglycan recycling in Escherichia
coli.

Shimada T(1), Yamazaki K, Ishihama A.

Author information: 
(1)Department of Frontier Bioscience, Hosei University, Koganei, Tokyo, Japan.

Peptidoglycan (PG), also designated as murein, forms a skeletal mesh within the
periplasm of bacterial membrane. PG is a metabolically stable cell architecture
in Escherichia coli, but under as yet ill-defined conditions, a portion of PG is 
degraded, of which both amino sugar and peptide moieties are either recycled or
used as self-generated nutrients for cell growth. At present, the control of PG
degradation remains uncharacterized. Using the Genomic SELEX screening system, we
identified an uncharacterized transcription factor YcjZ is a repressor of the
expression of the initial step enzymes for PG peptide degradation. Under nutrient
starvation, the genes encoding the enzymes for PG peptide degradation are
derepressed so as to generate amino acids but are tightly repressed at high
osmotic conditions so as to maintain the rigid membrane for withstanding the
turgor. Taken together, we propose to rename YcjZ as PgrR (regulator of peptide
glycan recycling).

© 2013 The Authors Genes to Cells © 2013 by the Molecular Biology Society of
Japan and Wiley Publishing Asia Pty Ltd.

DOI: 10.1111/gtc.12026 
PMID: 23301696  [Indexed for MEDLINE]


57. Microbiologyopen. 2012 Dec;1(4):381-94. doi: 10.1002/mbo3.42. Epub 2012 Oct 8.

A novel regulator RcdA of the csgD gene encoding the master regulator of biofilm 
formation in Escherichia coli.

Shimada T(1), Katayama Y, Kawakita S, Ogasawara H, Nakano M, Yamamoto K, Ishihama
A.

Author information: 
(1)Department of Frontier Bioscience and Research Center for Micro-Nano
Technology, Hosei University, Koganei, Tokyo, 184-8584, Japan.

The FixJ/LuxR family transcription factor CsgD is a master regulator of biofilm
formation in Escherichia coli. Previously, we identified more than 10
transcription factors that participate in regulation of the csgD promoter. After 
genomic SELEX screening of regulation targets, an uncharacterized TetR-type
transcription factor YbjK was found to be involved in regulation of the csgD
promoter. In addition, a number of stress-response genes were found to be under
the direct control of YbjK. Taken together, we propose to rename it to RcdA
(regulator of csgD). One unique feature of RcdA is its mode of DNA binding. Gel
shift, DNase-I footprinting, and atomic force microscopic (AFM) analyses
indicated that RcdA is a DNA-binding protein with a high level of cooperativity, 
with which it covers the entire surface of probe DNA through protein-protein
interaction and moreover it induces the formation of aggregates of DNA-RcdA
complexes.

© 2012 The Authors. Published by Blackwell Publishing Ltd.

DOI: 10.1002/mbo3.42 
PMCID: PMC3535384
PMID: 23233451  [Indexed for MEDLINE]


58. Proc Jpn Acad Ser B Phys Biol Sci. 2012;88(9):485-508.

Prokaryotic genome regulation: a revolutionary paradigm.

Ishihama A(1).

Author information: 
(1)Department of Frontier Bioscience and Micro-Nano Technology Research Center,
Hosei University, Koganei, Tokyo 184-8584, Japan. aishiham@hosei.ac.jp

After determination of the whole genome sequence, the research frontier of
bacterial molecular genetics has shifted to reveal the genome regulation under
stressful conditions in nature. The gene selectivity of RNA polymerase is
modulated after interaction with two groups of regulatory proteins, 7 sigma
factors and 300 transcription factors. For identification of regulation targets
of transcription factors in Escherichia coli, we have developed Genomic SELEX
system and subjected to screening the binding sites of these factors on the
genome. The number of regulation targets by a single transcription factor was
more than those hitherto recognized, ranging up to hundreds of promoters. The
number of transcription factors involved in regulation of a single promoter also 
increased to as many as 30 regulators. The multi-target transcription factors and
the multi-factor promoters were assembled into complex networks of transcription 
regulation. The most complex network was identified in the regulation cascades of
transcription of two master regulators for planktonic growth and biofilm
formation.


PMCID: PMC3511978
PMID: 23138451  [Indexed for MEDLINE]


59. Anal Chem. 2012 Nov 6;84(21):8966-9. doi: 10.1021/ac302902s. Epub 2012 Oct 22.

Aptamer-based viability impedimetric sensor for bacteria.

Labib M, Zamay AS, Kolovskaya OS, Reshetneva IT, Zamay GS, Kibbee RJ, Sattar SA, 
Zamay TN, Berezovski MV.

The development of an aptamer-based viability impedimetric sensor for bacteria
(AptaVISens-B) is presented. Highly specific DNA aptamers to live Salmonella
typhimurium were selected via the cell-systematic evolution of ligands by
exponential enrichment (SELEX) technique. Twelve rounds of selection were
performed; each comprises a positive selection step against viable S. typhimurium
and a negative selection step against heat killed S. typhimurium and a mixture of
related pathogens, including Salmonella enteritidis, Escherichia coli,
Staphylococcus aureus, Pseudomonas aeruginosa, and Citrobacter freundii to ensure
the species specificity of the selected aptamers. The DNA sequence showing the
highest binding affinity to the bacteria was further integrated into an
impedimetric sensor via self-assembly onto a gold nanoparticle-modified
screen-printed carbon electrode (GNP-SPCE). Remarkably, this aptasensor is highly
selective and can successfully detect S. typhimurium down to 600 CFU mL(-1)
(equivalent to 18 live cells in 30 μL of assay volume) and distinguish it from
other Salmonella species, including S. enteritidis and S. choleraesuis. This
report is envisaged to open a new venue for the aptamer-based viability sensing
of a variety of microorganisms, particularly viable but nonculturable (VBNC)
bacteria, using a rapid, economic, and label-free electrochemical platform.

DOI: 10.1021/ac302902s 
PMID: 23075417  [Indexed for MEDLINE]


60. Chemistry. 2012 Oct 15;18(42):13320-30. doi: 10.1002/chem.201201662. Epub 2012
Sep 20.

Synthesis of deoxynucleoside triphosphates that include proline, urea, or
sulfonamide groups and their polymerase incorporation into DNA.

Hollenstein M(1).

Author information: 
(1)Department of Chemistry & Biochemistry, University of Bern, Freiestrasse 3,
3012 Bern, Switzerland. hollenstein@dcb.unibe.ch

To expand the chemical array available for DNA sequences in the context of in
vitro selection, I present herein the synthesis of five nucleoside triphosphate
analogues containing side chains capable of organocatalysis. The synthesis
involved the coupling of L-proline-containing residues (dU(tP)TP and dU(cP)TP), a
dipeptide (dU(FP)TP), a urea derivative (dU(Bpu)TP), and a sulfamide residue
(dU(Bs)TP) to a suitably protected common intermediate, followed by
triphosphorylation. These modified dNTPs were shown to be excellent substrates
for the Vent (exo(-)) and Pwo DNA polymerases, as well as the Klenow fragment of 
E. coli DNA polymerase I, although they were only acceptable substrates for the
9°N(m) polymerase. All of the modified dNTPs, with the exception of dU(Bpu)TP,
were readily incorporated into DNA by the polymerase chain reaction (PCR).
Modified oligonucleotides efficiently served as templates for PCR for the
regeneration of unmodified DNA. Thermal denaturation experiments showed that
these modifications are tolerated in the major groove. Overall, these heavily
modified dNTPs are excellent candidates for SELEX.

Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DOI: 10.1002/chem.201201662 
PMID: 22996052  [Indexed for MEDLINE]


61. Anal Chem. 2012 Oct 2;84(19):8114-7. doi: 10.1021/ac302217u. Epub 2012 Sep 14.

Aptamer-based impedimetric sensor for bacterial typing.

Labib M(1), Zamay AS, Kolovskaya OS, Reshetneva IT, Zamay GS, Kibbee RJ, Sattar
SA, Zamay TN, Berezovski MV.

Author information: 
(1)Department of Chemistry, University of Ottawa, 10 Marie Curie, Ottawa, Ontario
K1N 6N5, Canada.

The development of an aptamer-based impedimetric sensor for typing of bacteria
(AIST-B) is presented. Highly specific DNA aptamers to Salmonella enteritidis
were selected via Cell-SELEX technique. Twelve rounds of selection were
performed; each comprises a positive selection step against S. enteritidis and a 
negative selection step against a mixture of related pathogens, including
Salmonella typhimurium, Escherichia coli, Staphylococcus aureus, Pseudomonas
aeruginosa, and Citrobacter freundii, to ensure the species-specificity of the
selected aptamers. After sequencing of the pool showing the highest binding
affinity to S. enteritidis, a DNA sequence of high affinity to the bacteria was
integrated into an impedimetric sensor via self-assembly onto a gold
nanoparticles-modified screen-printed carbon electrode (GNPs-SPCE). Remarkably,
this aptasensor is highly selective and can successfully detect S. enteritidis
down to 600 CFU mL(-1) (equivalent to 18 CFU in 30 μL assay volume) in 10 min and
distinguish it from other Salmonella species, including S. typhimurium and S.
choleraesuis. This report is envisaged to open a new venue for the aptamer-based 
typing of a variety of microorganisms using a rapid, economic, and label-free
electrochemical platform.

DOI: 10.1021/ac302217u 
PMID: 22971146  [Indexed for MEDLINE]


62. J Nanosci Nanotechnol. 2012 Jul;12(7):5138-42.

Rapid detection of food pathogens using RNA aptamers-immobilized slide.

Maeng JS(1), Kim N, Kim CT, Han SR, Lee YJ, Lee SW, Lee MH, Cho YJ.

Author information: 
(1)Bio-Nanotechnology Research Center Korea Food Research Institute, Songnam
463-746, Korea.

The purpose of this study was to develop a simple and rapid detection system for 
foodborne bacteria, which consisted of an optical microscope and its slide chip
with artificial antibodies, or RNA aptamers. From an RNA pool, three each RNA
aptamers were built by the method of SELEX (systematic evolution of ligands by
exponential enrichment) for components of cell wall, LPS (lipopolysaccharide)
from E. coli O157:H7, teichoic acid from Staphylococcus aureus and a cell
membrane protein of OmpC from Salmonella typhimurium, respectively. These
aptamers were hybridized with thiol-conjugated 16 dT-linker molecules in order to
be immobilized on silver surface which was, in advance, fabricated on glass
slide, using a spin-coating method. To confirm that each aptamers retained its
specific binding activities to their antigenic live bacteria, microscopic view of
bound cells immobilized on silver film were observed. Furthermore, we observed
the fluorescence-emitting bacteria-aptamer complex immobilized on silver film
after adding RNA aptamers hybridized with fluorophore, FAM-conjugated 16
dT-linker molecules. As a result, the RNA aptamers-immobilized slide system
developed in this study was a useful new tool to rapidly monitor individual food 
pathogens.


PMID: 22966534  [Indexed for MEDLINE]


63. J Vis Exp. 2012 May 28;(63). pii: 3961. doi: 10.3791/3961.

Detection of bacteria using fluorogenic DNAzymes.

Aguirre SD(1), Ali MM, Kanda P, Li Y.

Author information: 
(1)Department of Biochemistry and Biomedical Sciences, McMaster University,
Canada.

Outbreaks linked to food-borne and hospital-acquired pathogens account for
millions of deaths and hospitalizations as well as colossal economic losses each 
and every year. Prevention of such outbreaks and minimization of the impact of an
ongoing epidemic place an ever-increasing demand for analytical methods that can 
accurately identify culprit pathogens at the earliest stage. Although there is a 
large array of effective methods for pathogen detection, none of them can satisfy
all the following five premier requirements embodied for an ideal detection
method: high specificity (detecting only the bacterium of interest), high
sensitivity (capable of detecting as low as a single live bacterial cell), short 
time-to-results (minutes to hours), great operational simplicity (no need for
lengthy sampling procedures and the use of specialized equipment), and cost
effectiveness. For example, classical microbiological methods are highly specific
but require a long time (days to weeks) to acquire a definitive result.(1) PCR-
and antibody-based techniques offer shorter waiting times (hours to days), but
they require the use of expensive reagents and/or sophisticated equipment.(2-4)
Consequently, there is still a great demand for scientific research towards
developing innovative bacterial detection methods that offer improved
characteristics in one or more of the aforementioned requirements. Our laboratory
is interested in examining the potential of DNAzymes as a novel class of
molecular probes for biosensing applications including bacterial detection.(5)
DNAzymes (also known as deoxyribozymes or DNA enzymes) are man-made
single-stranded DNA molecules with the capability of catalyzing chemical
reactions.(6-8) These molecules can be isolated from a vast random-sequence DNA
pool (which contains as many as 10(16) individual sequences) by a process known
as "in vitro selection" or "SELEX" (systematic evolution of ligands by
exponential enrichment).(9-16) These special DNA molecules have been widely
examined in recent years as molecular tools for biosensing applications.(6-8) Our
laboratory has established in vitro selection procedures for isolating
RNA-cleaving fluorescent DNAzymes (RFDs; Fig. 1) and investigated the use of RFDs
as analytical tools.(17-29) RFDs catalyze the cleavage of a DNA-RNA chimeric
substrate at a single ribonucleotide junction (R) that is flanked by a
fluorophore (F) and a quencher (Q). The close proximity of F and Q renders the
uncleaved substrate minimal fluorescence. However, the cleavage event leads to
the separation of F and Q, which is accompanied by significant increase of
fluorescence intensity. More recently, we developed a method of isolating RFDs
for bacterial detection.(5) These special RFDs were isolated to "light up" in the
presence of the crude extracellular mixture (CEM) left behind by a specific type 
of bacteria in their environment or in the media they are cultured (Fig. 1). The 
use of crude mixture circumvents the tedious process of purifying and identifying
a suitable target from the microbe of interest for biosensor development (which
could take months or years to complete). The use of extracellular targets means
the assaying procedure is simple because there is no need for steps to obtain
intracellular targets. Using the above approach, we derived an RFD that cleaves
its substrate (FS1; Fig. 2A) only in the presence of the CEM produced by E. coli 
(CEM-EC).(5) This E. coli-sensing RFD, named RFD-EC1 (Fig. 2A), was found to be
strictly responsive to CEM-EC but nonresponsive to CEMs from a host of other
bacteria (Fig. 3). Here we present the key experimental procedures for setting up
E. coli detection assays using RFD-EC1 and representative results.

DOI: 10.3791/3961 
PMCID: PMC3466938
PMID: 22688431  [Indexed for MEDLINE]


64. Microbiology. 2012 Jun;158(Pt 6):1482-92. doi: 10.1099/mic.0.057745-0. Epub 2012 
Mar 22.

Novel regulation targets of the metal-response BasS-BasR two-component system of 
Escherichia coli.

Ogasawara H(1), Shinohara S, Yamamoto K, Ishihama A.

Author information: 
(1)Department of Frontier Bioscience, Hosei University, Koganei, Tokyo, Japan.

The BasS-BasR two-component system is known as an iron- and zinc-sensing
transcription regulator in Escherichia coli, but so far only a few genes have
been identified to be under the direct control of phosphorylated BasR. Using
Genomic SELEX (systematic evolution of ligands by exponential enrichment)
screening, we have identified a total of at least 38 binding sites of
phosphorylated BasR on the E. coli genome, and based on the BasR-binding sites,
have predicted more than 20 novel targets of regulation. By DNase I footprint
analysis for high-affinity BasR-binding sites, a direct repeat of a TTAAnnTT
sequence was identified as the BasR box. Transcription regulation in vivo of the 
target genes was confirmed after Northern blot analysis of target gene mRNAs from
both wild-type E. coli and an otherwise isogenic basR deletion mutant. The BasR
regulon can be classified into three groups of genes: group 1 includes the genes 
for the formation and modification of membrane structure; group 2 includes genes 
for modulation of membrane functions; and group 3 includes genes for
stress-response cell functions, including csgD, the master regulator of biofilm
formation.

DOI: 10.1099/mic.0.057745-0 
PMID: 22442305  [Indexed for MEDLINE]


65. Biochem Biophys Res Commun. 2012 Jan 6;417(1):414-20. doi:
10.1016/j.bbrc.2011.11.130. Epub 2011 Dec 7.

In vitro selection of Escherichia coli O157:H7-specific RNA aptamer.

Lee YJ(1), Han SR, Maeng JS, Cho YJ, Lee SW.

Author information: 
(1)Department of Molecular Biology, Institute of Nanosensor and Biotechnology,
Dankook University, Yongin, Republic of Korea.

Escherichia coli (E. coli) O157:H7 is a major foodborne pathogen that causes
life-threatening symptoms in humans worldwide. To rapidly and properly identify
the pathogen and avoid its toxic effects, ligands which can directly and
specifically bind to the virulent E. coli O157:H7 serotype should be identified. 
In this study, a RNA aptamer-based ligand which can specifically distinguish the 
pathogen E. coli O157:H7 from others was developed by a subtractive cell-SELEX
method. To this end, an RNA library was first incubated with the E. coli K12
strain, and the RNAs binding to the strain were discarded. The precluded RNAs
were then used for the selection of O157:H7-specific aptamers. After 6 rounds of 
the subtractive cell-SELEX process, the selected aptamer was found to
specifically bind to the O157:H7 serotype, but not to the K12 strain. This was
evidenced by aptamer-immobilized ELISA, real-time PCR analysis, or an
aptamer-linked precipitation experiment. Importantly, the isolated RNA aptamer
that distinguishes between the virulent serotype and the nonpathogenic strain
specifically bound to an O157:H7-specific lipopolysaccharide which includes the O
antigen. This novel O157:H7-specific aptamer could be of potential application as
a diagnostic ligand against the pathogen-related food borne illness.

Copyright © 2011 Elsevier Inc. All rights reserved.

DOI: 10.1016/j.bbrc.2011.11.130 
PMID: 22166202  [Indexed for MEDLINE]


66. Mol Cells. 2011 Dec;32(6):527-33. doi: 10.1007/s10059-011-0156-x. Epub 2011 Nov
3.

DNA aptamers against the receptor binding region of hemagglutinin prevent avian
influenza viral infection.

Choi SK(1), Lee C, Lee KS, Choe SY, Mo IP, Seong RH, Hong S, Jeon SH.

Author information: 
(1)Department of Life Science, Hallym University, Chuncheon 200-702, Korea.

The entrance of influenza virus into host cells is facilitated by the attachment 
of the globular region of viral hemagglutinin to the sialic acid receptors on
host cell surfaces. In this study, we have cloned the cDNA fragment encoding the 
entire globular region (residues 101-257) of hemagglutinin of the H9N2 type avian
influenza virus (A/ck/Korea/ms96/96). The protein segment (denoted as the H9
peptide), which was expressed and purified in E. coli, was used for the
immunization of BALB/c mice to obtain the anti-H9 antiserum. To identify specific
DNA aptamers with high affinity to H9 peptide, we conducted the SELEX method; 19 
aptamers were newly isolated. A random mixture of these aptamers showed an
increased level of binding affinity to the H9 peptide. The sequence alignment
analysis of these aptamers revealed that 6 aptamers have highly conserved
consensus sequences. Among these, aptamer C7 showed the highest similarity to the
consensus sequences. Therefore, based on the C7 aptamer, we synthesized a new
modified aptamer designated as C7-35M. This new aptamer showed strong binding
capability to the viral particles. Furthermore, it could prevent MDCK cells from 
viral infection by strong binding to the viral particles. These results suggest
that our aptamers can recognize the hemagglutinin protein of avian influenza
virus and inhibit the binding of the virus to target receptors required for the
penetration of host cells.

DOI: 10.1007/s10059-011-0156-x 
PMCID: PMC3887679
PMID: 22058017  [Indexed for MEDLINE]


67. Nucleic Acids Res. 2012 Feb;40(4):1856-67. doi: 10.1093/nar/gkr892. Epub 2011 Nov
3.

Crystal structure of Hfq from Bacillus subtilis in complex with SELEX-derived RNA
aptamer: insight into RNA-binding properties of bacterial Hfq.

Someya T(1), Baba S, Fujimoto M, Kawai G, Kumasaka T, Nakamura K.

Author information: 
(1)Graduate School of Life and Environmental Sciences, University of Tsukuba,
1-1-1 Tennodai, Tsukuba-shi, Ibaraki 305-8572, Japan. tsomeya@biol.tsukuba.ac.jp

Bacterial Hfq is a protein that plays an important role in the regulation of
genes in cooperation with sRNAs. Escherichia coli Hfq (EcHfq) has two or more
sites that bind RNA(s) including U-rich and/or the poly(A) tail of mRNA. However,
functional and structural information about Bacillus subtilis Hfq (BsHfq)
including the RNA sequences that specifically bind to it remain unknown. Here, we
describe RNA aptamers including fragment (AG)(3)A that are recognized by BsHfq
and crystal structures of the BsHfq-(AG)(3)A complex at 2.2 Å resolution.
Mutational and structural studies revealed that the RNA fragment binds to the
distal site, one of the two binding sites on Hfq, and identified amino acid
residues that are critical for sequence-specific interactions between BsHfq and
(AG)(3)A. In particular, R32 appears to interact with G bases in (AG)(3)A.
Poly(A) also binds to the distal site of EcHfq, but the overall RNA structure and
protein-RNA interaction patterns engaged in the R32 residues of BsHfq-(AG)(3)A
differ from those of EcHfq-poly(A). These findings provide novel insight into how
the Hfq homologue recognizes RNA.

DOI: 10.1093/nar/gkr892 
PMCID: PMC3287200
PMID: 22053080  [Indexed for MEDLINE]


68. J Biol Chem. 2011 Dec 30;286(52):44726-38. doi: 10.1074/jbc.M111.290684. Epub
2011 Oct 28.

Determination of target sequence bound by PapX, repressor of bacterial motility, 
in flhD promoter using systematic evolution of ligands by exponential enrichment 
(SELEX) and high throughput sequencing.

Reiss DJ(1), Mobley HL.

Author information: 
(1)Department of Microbiology and Immunology, University of Michigan Medical
School, Ann Arbor, Michigan 48104, USA.

Most uncomplicated urinary tract infections (UTIs) are caused by uropathogenic
Escherichia coli (UPEC). Both motility and adherence are integral to UTI
pathogenesis, yet they represent opposing forces. Therefore, it is logical to
reciprocally regulate these functions. In UPEC strain CFT073, PapX, a
non-structural protein encoded by one of the two pap operons encoding P fimbria
adherence factor, represses flagella-mediated motility and is a putative member
of the winged helix transcription factor family. The mechanism of this
repression, however, is not understood. papX is found preferentially in more
virulent UPEC isolates, being significantly more prevalent in pyelonephritis
strains (53% of isolates) than in asymptomatic bacteriuria (32%) or
fecal/commensal (12.5%) strains. To examine PapX structure-function, we generated
papX linker insertion and site-directed mutants, which identified two key
residues for PapX function (Lys(54) and Arg(127)) within domains predicted by
modeling with I-TASSER software to be important for dimerization and DNA binding,
respectively. To determine the PapX binding site in the CFT073 genome, systematic
evolution of ligands by exponential enrichment (SELEX) in conjunction with high
throughput sequencing was utilized for the first time to determine a novel
binding site for a bacterial transcription factor. This method identified a 29-bp
binding site within the flhDC promoter (TTACGGTGAGTTATTTTAACTGTGCGCAA), centered 
410 bp upstream of the flhD translational start site. Gel shift experiments
demonstrated that PapX binds directly to this site to repress transcription of
flagellar genes.

DOI: 10.1074/jbc.M111.290684 
PMCID: PMC3247938
PMID: 22039053  [Indexed for MEDLINE]


69. Mol Microbiol. 2011 Oct;82(2):378-97. doi: 10.1111/j.1365-2958.2011.07818.x. Epub
2011 Sep 14.

Novel roles of LeuO in transcription regulation of E. coli genome: antagonistic
interplay with the universal silencer H-NS.

Shimada T(1), Bridier A, Briandet R, Ishihama A.

Author information: 
(1)Hosei University, Department of Frontier Bioscience, Koganei, Tokyo 184-8540, 
Japan INRA UMR1319 MICALIS, 78352 Jouy-en-Josas, France AgroParisTech UMR
MICALIS, 91300 Massy, France.

LeuO, the regulator of leucine biosynthesis operon of Escherichia coli, is
involved in the regulation of as yet unspecified genes affecting the stress
response and pathogenesis expression. To get insights into the regulatory role(s)
of LeuO, Genomic SELEX screening has been performed to identify the whole set of 
its regulation targets. A total of 140 LeuO-binding sites were identified on the 
E. coli genome, of which as many as 133 (95%) were found to contain the binding
sites of H-NS, the universal silencer of stress-response genes, supporting the
concept that LeuO plays an antagonistic role with anti-silencing activity.
Western blot analysis indicated that H-NS predominates in growing phase; however,
after prolonged culture for 1 week, H-NS decreased instead LeuO increased,
supporting the anti-silencing role of LeuO. In concert with this model, a set of 
stress-response genes including cryptic chaperone/usher-type fimbriae operons are
under the control of antagonistic interplay between LeuO and H-NS. Confocal laser
scanning microscopic observation in flow-chambers showed that the mutants lacking
leuO and some fimbriae genes are defective in biofilm formation or form altered
biofilm architecture. Taken together we propose that LeuO is a major player in
antagonistic interplay against the universal silencer H-NS.

© 2011 Blackwell Publishing Ltd.

DOI: 10.1111/j.1365-2958.2011.07818.x 
PMID: 21883529  [Indexed for MEDLINE]


70. J Mol Biol. 2011 Oct 14;413(1):51-65. doi: 10.1016/j.jmb.2011.07.063. Epub 2011
Aug 3.

Degenerate RNA packaging signals in the genome of Satellite Tobacco Necrosis
Virus: implications for the assembly of a T=1 capsid.

Bunka DH(1), Lane SW, Lane CL, Dykeman EC, Ford RJ, Barker AM, Twarock R,
Phillips SE, Stockley PG.

Author information: 
(1)Astbury Centre for Structural Molecular Biology, University of Leeds, Leeds
LS2 9JT, UK.

Using a recombinant, T=1 Satellite Tobacco Necrosis Virus (STNV)-like particle
expressed in Escherichia coli, we have established conditions for in vitro
disassembly and reassembly of the viral capsid. In vivo assembly is dependent on 
the presence of the coat protein (CP) N-terminal region, and in vitro assembly
requires RNA. Using immobilised CP monomers under reassembly conditions with
"free" CP subunits, we have prepared a range of partially assembled CP species
for RNA aptamer selection. SELEX directed against the RNA-binding face of the
STNV CP resulted in the isolation of several clones, one of which (B3) matches
the STNV-1 genome in 16 out of 25 nucleotide positions, including across a
statistically significant 10/10 stretch. This 10-base region folds into a
stem-loop displaying the motif ACAA and has been shown to bind to STNV CP.
Analysis of the other aptamer sequences reveals that the majority can be folded
into stem-loops displaying versions of this motif. Using a sequence and secondary
structure search motif to analyse the genomic sequence of STNV-1, we identified
30 stem-loops displaying the sequence motif AxxA. The implication is that there
are many stem-loops in the genome carrying essential recognition features for
binding STNV CP. Secondary structure predictions of the genomic RNA using Mfold
showed that only 8 out of 30 of these stem-loops would be formed in the
lowest-energy structure. These results are consistent with an assembly mechanism 
based on kinetically driven folding of the RNA.

Copyright © 2011 Elsevier Ltd. All rights reserved.

DOI: 10.1016/j.jmb.2011.07.063 
PMID: 21839093  [Indexed for MEDLINE]


71. PLoS One. 2011;6(6):e20081. doi: 10.1371/journal.pone.0020081. Epub 2011 Jun 1.

Novel roles of cAMP receptor protein (CRP) in regulation of transport and
metabolism of carbon sources.

Shimada T(1), Fujita N, Yamamoto K, Ishihama A.

Author information: 
(1)Department of Frontier Bioscience, Hosei University, Koganei, Tokyo, Japan.

CRP (cAMP receptor protein), the global regulator of genes for carbon source
utilization in the absence of glucose, is the best-studied prokaryotic
transcription factor. A total of 195 target promoters on the Escherichia coli
genome have been proposed to be under the control of cAMP-bound CRP. Using the
newly developed Genomic SELEX screening system of transcription factor-binding
sequences, however, we have identified a total of at least 254 CRP-binding sites.
Based on their location on the E. coli genome, we predict a total of at least 183
novel regulation target operons, altogether with the 195 hitherto known targets, 
reaching to the minimum of 378 promoters as the regulation targets of cAMP-CRP.
All the promoters selected from the newly identified targets and examined by
using the lacZ reporter assay were found to be under the control of CRP,
indicating that the Genomic SELEX screening allowed to identify the CRP targets
with high accuracy. Based on the functions of novel target genes, we conclude
that CRP plays a key regulatory role in the whole processes from the selective
transport of carbon sources, the glycolysis-gluconeogenesis switching to the
metabolisms downstream of glycolysis, including tricarboxylic acid (TCA) cycle,
pyruvate dehydrogenase (PDH) pathway and aerobic respiration. One unique
regulation mode is that a single and the same CRP molecule bound within
intergenic regions often regulates both of divergently transcribed operons.

DOI: 10.1371/journal.pone.0020081 
PMCID: PMC3105977
PMID: 21673794  [Indexed for MEDLINE]


72. Can J Microbiol. 2011 Jun;57(6):453-9. doi: 10.1139/w11-030. Epub 2011 May 31.

Aptamer selection for the detection of Escherichia coli K88.

Li H(1), Ding X, Peng Z, Deng L, Wang D, Chen H, He Q.

Author information: 
(1)The Co-construction Laboratory of Microbial Molecular Biology of Province
Department and Ministry of Science and Technology, College of Life Sciences,
Hunan Normal University, Changsha, People's Republic of China.

In this study, the first group of single-stranded DNA aptamers that are highly
specific to enterotoxigenic Escherichia coli (ETEC) K88 was obtained from an
enriched oligonucleotide pool by the SELEX (Systematic Evolution of Ligands by
Exponential Enrichment) procedure, during which the K88 fimbriae protein was used
as the target and bovine serum albumin as counter targets. These aptamers were
applied successfully in the detection of ETEC K88. They were then grouped under
different families based on the similarity of their secondary structure and the
homology of their primary sequence. Four sequences from different families were
deliberately chosen for further characterization by fluorescence analysis. Having
the advantage of high sensitivity, fluorescence photometry was selected as
single-stranded DNA quantification method during the SELEX process. Aptamers with
the highest specificity and affinity were analyzed to evaluate binding ability
with E. coli. Since ETEC K88 is the only type of bacterium that expressed
abundant K88 fimbriae, the selected aptamers against the K88 fimbriae protein
were able to specifically identify ETEC K88 among other bacteria. This method of 
detecting ETEC K88 by aptamers can also be applied to bacteria other than ETEC
K88.

DOI: 10.1139/w11-030 
PMID: 21627466  [Indexed for MEDLINE]


73. Methods Enzymol. 2011;497:207-20. doi: 10.1016/B978-0-12-385075-1.00009-3.

From SELEX to cell dual selections for synthetic riboswitches.

Sinha J(1), Topp S, Gallivan JP.

Author information: 
(1)Department of Chemistry and Center for Fundamental and Applied Molecular
Evolution, Emory University, Atlanta, Georgia, USA.

Synthetic riboswitches have emerged as useful tools for controlling gene
expression to reprogram cellular behavior. However, advancing beyond
proof-of-principle experiments requires the ability to quickly generate new
synthetic riboswitches from RNA libraries. In this chapter, we provide a
step-by-step overview of the process of obtaining synthetic riboswitches for use 
in Escherichia coli, starting from a randomized RNA library.

Copyright © 2011 Elsevier Inc. All rights reserved.

DOI: 10.1016/B978-0-12-385075-1.00009-3 
PMID: 21601088  [Indexed for MEDLINE]


74. J Bacteriol. 2011 Feb;193(3):649-59. doi: 10.1128/JB.01214-10. Epub 2010 Nov 29.

Novel members of the Cra regulon involved in carbon metabolism in Escherichia
coli.

Shimada T(1), Yamamoto K, Ishihama A.

Author information: 
(1)Hosei University, Department of Frontier Bioscience, Koganei, Tokyo 184-8584, 
Japan.

Cra (catabolite repressor activator) is a global regulator of the genes for
carbon metabolism in Escherichia coli. To gain insights into the regulatory roles
of Cra, attempts were made to identify the whole set of regulation targets using 
an improved genomic SELEX (systematic evolution of ligands by exponential
enrichment) system. Surprisingly, a total of 164 binding sites were identified
for Cra, 144 (88%) of which were newly identified. The majority of known targets 
were included in the SELEX chip pattern. The promoters examined by the lacZ
reporter assay in vivo were all regulated by Cra. These two lines of evidence
indicate that a total of as many as 178 promoters are under the control of Cra.
The majority of Cra targets are the genes coding for the enzymes involved in
central carbon metabolism, covering all the genes for the enzymes involved in
glycolysis and metabolism downstream of glycolysis, including the tricarboxylic
acid (TCA) cycle and aerobic respiration. Taken together, we propose that Cra
plays a key role in balancing the levels of the enzymes for carbon metabolism.

DOI: 10.1128/JB.01214-10 
PMCID: PMC3021228
PMID: 21115656  [Indexed for MEDLINE]


75. ACS Chem Biol. 2010 Nov 19;5(11):1065-74. doi: 10.1021/cb1001894.

Combining SELEX screening and rational design to develop light-up fluorophore-RNA
aptamer pairs for RNA tagging.

Lee J(1), Lee KH, Jeon J, Dragulescu-Andrasi A, Xiao F, Rao J.

Author information: 
(1)Department of Chemistry, Stanford University School of Medicine, 1210 Welch
Road, Stanford, California 94305-5484, USA.

We report here a new small molecule fluorogen and RNA aptamer pair for RNA
labeling. The small-molecule fluorogen is designed on the basis of fluorescently 
quenched sulforhodamine dye. The SELEX (Systematic Evolution of Ligands by
EXponential enrichment) procedure and fluorescence screening in E. coli have been
applied to discover the aptamer that can specifically activate the fluorogen with
micromolar binding affinity. The systematic mutation and truncation study on the 
aptamer structure determined the minimum binding domain of the aptamer. A series 
of rationally modified fluorogen analogues have been made to probe the
interacting groups of fluorogen with the aptamer. These results led to the design
of a much improved fluorogen ASR 7 that displayed a 33-fold increase in the
binding affinity for the selected aptamer in comparison to the original ASR 1 and
an 88-fold increase in the fluorescence emission after the aptamer binding. This 
study demonstrates the value of combining in vitro SELEX and E. coli fluorescence
screening with rational modifications in discovering and optimizing new
fluorogen-RNA aptamer labeling pairs.

DOI: 10.1021/cb1001894 
PMCID: PMC3044212
PMID: 20809562  [Indexed for MEDLINE]


76. ACS Chem Biol. 2010 Sep 17;5(9):851-61. doi: 10.1021/cb100070j.

Engineering a direct and inducible protein-RNA interaction to regulate RNA
biology.

Belmont BJ(1), Niles JC.

Author information: 
(1)Department of Biological Engineering, Massachusetts Institute of Technology,
Cambridge, 02139, USA.

The importance and pervasiveness of naturally occurring regulation of RNA
function in biology is increasingly being recognized. A common mechanism uses
inducible protein-RNA interactions to shape diverse aspects of cellular RNA fate.
Recapitulating this regulatory mode in cells using a novel set of protein-RNA
interactions is appealing given the potential to subsequently modulate RNA
biology in a manner decoupled from endogenous cellular physiology. Achieving this
outcome, however, has previously proven challenging. Here, we describe a
ligand-responsive protein-RNA interaction module, which can be used to target a
specific RNA for subsequent regulation. Using the Systematic Evolution of Ligands
by Exponential Enrichment (SELEX) method, RNA aptamers binding to the bacterial
Tet Repressor protein (TetR) with low- to subnanomolar affinities were obtained. 
This interaction is reversibly controlled by tetracycline in a manner analogous
to the interaction of TetR with its cognate DNA operator. Aptamer minimization
and mutational analyses support a functional role for two conserved sequence
motifs in TetR binding. As an initial illustration of using this system to
achieve protein-based regulation of RNA function in living cells, insertion of a 
TetR aptamer into the 5'-UTR of a reporter mRNA confers post-transcriptionally
regulated, ligand-inducible protein synthesis in E. coli. Altogether, these
results define and validate an inducible protein-RNA interaction module that
incorporates desirable aspects of a ubiquitous mechanism for regulating RNA
function in Nature and can be used as a foundational interaction for functionally
and reversibly controlling the multiple fates of RNA in cells.

DOI: 10.1021/cb100070j 
PMID: 20545348  [Indexed for MEDLINE]


77. FEMS Microbiol Rev. 2010 Sep;34(5):628-45. doi: 10.1111/j.1574-6976.2010.00227.x.
Epub 2010 Apr 14.

Prokaryotic genome regulation: multifactor promoters, multitarget regulators and 
hierarchic networks.

Ishihama A(1).

Author information: 
(1)Department of Frontier Bioscience, Hosei University, Koganei, Tokyo 184-8584, 
Japan. aishiham@hosei.ac.jp

Comment in
    FEMS Microbiol Rev. 2010 Sep;34(5):611-27.

The vast majority of experimental data have been accumulated on the transcription
regulation of individual genes within a single model prokaryote, Escherichia
coli, which form the well-established on-off switch model of transcription by
DNA-binding regulatory proteins. After the development of modern high-throughput 
experimental systems such as microarray analysis of whole genome transcription
and the Genomic SELEX search for the whole set of regulation targets by
transcription factors, a number of E. coli promoters are now recognized to be
under the control of multiple transcription factors, as in the case of
eukaryotes. The number of regulation targets of a single transcription factor has
also been found to be more than hitherto recognized, ranging up to hundreds of
promoters, genes or operons for several global regulators. The multifactor
promoters and the multitarget transcription factors can be assembled into complex
networks of transcription regulation, forming hierarchical networks.

DOI: 10.1111/j.1574-6976.2010.00227.x 
PMID: 20491932  [Indexed for MEDLINE]


78. Nucleic Acids Res. 2010 Jun;38(11):3794-808. doi: 10.1093/nar/gkq032. Epub 2010
Mar 26.

Genomic SELEX for Hfq-binding RNAs identifies genomic aptamers predominantly in
antisense transcripts.

Lorenz C(1), Gesell T, Zimmermann B, Schoeberl U, Bilusic I, Rajkowitsch L,
Waldsich C, von Haeseler A, Schroeder R.

Author information: 
(1)Department of Biochemistry, Medical University of Vienna and University of
Veterinary Medicine, Vienna, Austria.

An unexpectedly high number of regulatory RNAs have been recently discovered that
fine-tune the function of genes at all levels of expression. We employed Genomic 
SELEX, a method to identify protein-binding RNAs encoded in the genome, to search
for further regulatory RNAs in Escherichia coli. We used the global regulator
protein Hfq as bait, because it can interact with a large number of RNAs,
promoting their interaction. The enriched SELEX pool was subjected to deep
sequencing, and 8865 sequences were mapped to the E. coli genome. These short
sequences represent genomic Hfq-aptamers and are part of potential regulatory
elements within RNA molecules. The motif 5'-AAYAAYAA-3' was enriched in the
selected RNAs and confers low-nanomolar affinity to Hfq. The motif was confirmed 
to bind Hfq by DMS footprinting. The Hfq aptamers are 4-fold more frequent on the
antisense strand of protein coding genes than on the sense strand. They were
enriched opposite to translation start sites or opposite to intervening sequences
between ORFs in operons. These results expand the repertoire of Hfq targets and
also suggest that Hfq might regulate the expression of a large number of genes
via interaction with cis-antisense RNAs.

DOI: 10.1093/nar/gkq032 
PMCID: PMC2887942
PMID: 20348540  [Indexed for MEDLINE]


79. PLoS One. 2010 Feb 11;5(2):e9169. doi: 10.1371/journal.pone.0009169.

Monitoring genomic sequences during SELEX using high-throughput sequencing:
neutral SELEX.

Zimmermann B(1), Gesell T, Chen D, Lorenz C, Schroeder R.

Author information: 
(1)Max F Perutz Laboratories, Department of Biochemistry, University of Vienna,
Vienna, Austria.

BACKGROUND: SELEX is a well established in vitro selection tool to analyze the
structure of ligand-binding nucleic acid sequences called aptamers. Genomic SELEX
transforms SELEX into a tool to discover novel, genomically encoded RNA or DNA
sequences binding a ligand of interest, called genomic aptamers. Concerns have
been raised regarding requirements imposed on RNA sequences undergoing SELEX
selection.
METHODOLOGY/PRINCIPAL FINDINGS: To evaluate SELEX and assess the extent of these 
effects, we designed and performed a Neutral SELEX experiment omitting the
selection step, such that the sequences are under the sole selective pressure of 
SELEX's amplification steps. Using high-throughput sequencing, we obtained
thousands of full-length sequences from the initial genomic library and the pools
after each of the 10 rounds of Neutral SELEX. We compared these to sequences
obtained from a Genomic SELEX experiment deriving from the same initial library, 
but screening for RNAs binding with high affinity to the E. coli regulator
protein Hfq. With each round of Neutral SELEX, sequences became less stable and
changed in nucleotide content, but no sequences were enriched. In contrast, we
detected substantial enrichment in the Hfq-selected set with enriched sequences
having structural stability similar to the neutral sequences but with
significantly different nucleotide selection.
CONCLUSIONS/SIGNIFICANCE: Our data indicate that positive selection in SELEX acts
independently of the neutral selective requirements imposed on the sequences. We 
conclude that Genomic SELEX, when combined with high-throughput sequencing of
positively and neutrally selected pools, as well as the gnomic library, is a
powerful method to identify genomic aptamers.

DOI: 10.1371/journal.pone.0009169 
PMCID: PMC2820082
PMID: 20161784  [Indexed for MEDLINE]


80. Nucleic Acids Res. 2010 Jun;38(11):3605-18. doi: 10.1093/nar/gkq077. Epub 2010
Feb 15.

A novel nucleoid protein of Escherichia coli induced under anaerobiotic growth
conditions.

Teramoto J(1), Yoshimura SH, Takeyasu K, Ishihama A.

Author information: 
(1)Department of Frontier Bioscience, Hosei University, Koganei, Tokyo 184-8584, 
Japan.

A systematic search was performed for DNA-binding sequences of YgiP, an
uncharacterized transcription factor of Escherichia coli, by using the Genomic
SELEX. A total of 688 YgiP-binding loci were identified after genome-wide
profiling of SELEX fragments with a high-density microarray (SELEX-chip). Gel
shift and DNase-I footprinting assays indicated that YgiP binds to multiple sites
along DNA probes with a consensus GTTNATT sequence. Atomic force microscope
observation indicated that at low concentrations, YgiP associates at various
sites on DNA probes, but at high concentrations, YgiP covers the entire DNA
surface supposedly through protein-protein contact. The intracellular
concentration of YgiP is very low in growing E. coli cells under aerobic
conditions, but increases more than 100-fold to the level as high as the major
nucleoid proteins under anaerobic conditions. An E. coli mutant lacking ygiP
showed retarded growth under anaerobic conditions. High abundance and large
number of binding sites together indicate that YgiP is a nucleoid-associated
protein with both architectural and regulatory roles as the nucleoid proteins Fis
and IHF. We then propose that YgiP is a novel nucleoid protein of E. coli under
anaerobiosis and propose to rename it Dan (DNA-binding protein under anaerobic
conditions).

DOI: 10.1093/nar/gkq077 
PMCID: PMC2887951
PMID: 20156994  [Indexed for MEDLINE]


81. J Bacteriol. 2009 Oct;191(19):6136-44. doi: 10.1128/JB.00663-09. Epub 2009 Jul
24.

Participation of regulator AscG of the beta-glucoside utilization operon in
regulation of the propionate catabolism operon.

Ishida Y(1), Kori A, Ishihama A.

Author information: 
(1)Department of Frontier Bioscience, Hosei University, Tokyo, Japan.

The asc operon of Escherichia coli is one of the cryptic genetic systems for
beta-D-galactoside utilization as a carbon source. The ascFB genes for
beta-D-galactoside transport and catabolism are repressed by the AscG regulator. 
After genomic SELEX screening, AscG was found to recognize and bind the consensus
palindromic sequence TGAAACC-GGTTTCA. AscG binding was detected at two sites
upstream of the ascFB promoter and at three sites upstream of the prpBC operon
for propionate catabolism. In an ascG-disrupted mutant, transcription of ascFB
was enhanced, in agreement with the repressor model of AscG. This repression was 
indicated to be due to interference of binding of cyclic AMP-CRP to the CRP box, 
which overlaps with the AscG-binding site 1, as well as binding of RNA polymerase
to the promoter. Under conditions of steady-state E. coli growth in a rich
medium, the intracellular level of AscG stayed constant at a level supposedly
leading to tight repression of the ascFB operon. The level of prpR, encoding the 
activator of prpBCDE, was also increased in the absence of AscG, indicating the
involvement of AscG in repression of prpR. Taken together, these data suggest a
metabolic link through interplay between the asc and prp operons.

DOI: 10.1128/JB.00663-09 
PMCID: PMC2747900
PMID: 19633077  [Indexed for MEDLINE]


82. Biochemistry. 2009 Jul 7;48(26):6278-84. doi: 10.1021/bi802373d.

In vitro selection of RNA aptamers derived from a genomic human library against
the TAR RNA element of HIV-1.

Watrin M(1), Von Pelchrzim F, Dausse E, Schroeder R, Toulmé JJ.

Author information: 
(1)Inserm U869, European Institute of Chemistry and Biology, Pessac, France.

The transactivating responsive (TAR) element is a RNA hairpin located in the 5'
untranslated region of HIV-1 mRNA. It is essential for full-length transcription 
of the retroviral genome and therefore for HIV-1 replication. Hairpin aptamers
that generate highly stable and specific complexes with TAR were previously
identified, thus decreasing the level of TAR-dependent expression in cultured
cells [Kolb, G., et al. (2006) RNA Biol. 3, 150-156]. We performed genomic SELEX 
against TAR using a human RNA library to identify human transcripts that might
interact with the retroviral genome through loop-loop interactions and
potentially contribute to the regulation of TAR-mediated processes. We identified
a genomic aptamer termed a1 that folds as a hairpin with an apical loop
complementary to five nucleotides of the TAR hexanucleotide loop. Surface plasmon
resonance experiments performed on a truncated or mutated version of the a1
aptamer, in the presence of the Rop protein of Escherichia coli, indicate the
formation of a highly stable a1-TAR kissing complex. The 5' ACCCAG loop of a1
constitutes a new motif of interaction with the TAR loop.

DOI: 10.1021/bi802373d 
PMID: 19496624  [Indexed for MEDLINE]


83. Nucleic Acids Res. 2009 Jul;37(13):4407-19. doi: 10.1093/nar/gkp378. Epub 2009
May 25.

The DNA-recognition mode shared by archaeal feast/famine-regulatory proteins
revealed by the DNA-binding specificities of TvFL3, FL10, FL11 and Ss-LrpB.

Yokoyama K(1), Nogami H, Kabasawa M, Ebihara S, Shimowasa A, Hashimoto K,
Kawashima T, Ishijima SA, Suzuki M.

Author information: 
(1)National Institute of Advanced Industrial Science and Technology, Tsukuba
Center 6-10, Tsukuba 305-8566, Japan.

The DNA-binding mode of archaeal feast/famine-regulatory proteins (FFRPs), i.e.
paralogs of the Esherichia coli leucine-responsive regulatory protein (Lrp), was 
studied. Using the method of systematic evolution of ligands by exponential
enrichment (SELEX), optimal DNA duplexes for interacting with TvFL3, FL10, FL11
and Ss-LrpB were identified as TACGA[AAT/ATT]TCGTA, GTTCGA[AAT/ATT]TCGAAC,
CCGAAA[AAT/ATT]TTTCGG and TTGCAA[AAT/ATT]TTGCAA, respectively, all fitting into
the form abcdeWWWedcba. Here W is A or T, and e.g. a and a are bases
complementary to each other. Apparent equilibrium binding constants of the FFRPs 
and various DNA duplexes were determined, thereby confirming the DNA-binding
specificities of the FFRPs. It is likely that these FFRPs recognize DNA in
essentially the same way, since their DNA-binding specificities were all
explained by the same pattern of relationship between amino-acid positions and
base positions to form chemical interactions. As predicted from this
relationship, when Gly36 of TvFL3 was replaced by Thr, the b base in the optimal 
DNA duplex changed from A to T, and, when Thr36 of FL10 was replaced by Ser, the 
b base changed from T to G/A. DNA-binding characteristics of other archaeal
FFRPs, Ptr1, Ptr2, Ss-Lrp and LysM, are also consistent with the relationship.

DOI: 10.1093/nar/gkp378 
PMCID: PMC2715240
PMID: 19468044  [Indexed for MEDLINE]


84. J Bacteriol. 2009 Jul;191(14):4562-71. doi: 10.1128/JB.00108-09. Epub 2009 May 8.

Involvement of the leucine response transcription factor LeuO in regulation of
the genes for sulfa drug efflux.

Shimada T(1), Yamamoto K, Ishihama A.

Author information: 
(1)Department of Frontier Bioscience, Hosei University, Tokyo, Japan.

LeuO, a LysR family transcription factor, exists in a wide variety of bacteria of
the family Enterobacteriaceae and is involved in the regulation of as yet
unidentified genes affecting the stress response and pathogenesis expression.
Using genomic screening by systematic evolution of ligands by exponential
enrichment (SELEX) in vitro, a total of 106 DNA sequences were isolated from 12
different regions of the Escherichia coli genome. All of the SELEX fragments
formed complexes in vitro with purified LeuO. After Northern blot analysis of the
putative target genes located downstream of the respective LeuO-binding sequence,
a total of nine genes were found to be activated by LeuO, while three genes were 
repressed by LeuO. The LeuO target gene collection included several multidrug
resistance genes. A phenotype microarray assay was conducted to identify the
gene(s) responsible for drug resistance and the drug species that are under the
control of the LeuO target gene(s). The results described herein indicate that
the yjcRQP operon, one of the LeuO targets, is involved in sensitivity control
against sulfa drugs. We propose to rename the yjcRQP genes the sdsRQP genes
(sulfa drug sensitivity determinant).

DOI: 10.1128/JB.00108-09 
PMCID: PMC2704711
PMID: 19429622  [Indexed for MEDLINE]


85. BMC Biotechnol. 2008 Dec 23;8:94. doi: 10.1186/1472-6750-8-94.

Better estimation of protein-DNA interaction parameters improve prediction of
functional sites.

Nagaraj VH(1), O'Flanagan RA, Sengupta AM.

Author information: 
(1)BioMaPS Institute, Rutgers University, Piscataway, NJ 08854-8020, USA.
viji@waksman.rutgers.edu

BACKGROUND: Characterizing transcription factor binding motifs is a common
bioinformatics task. For transcription factors with variable binding sites, we
need to get many suboptimal binding sites in our training dataset to get accurate
estimates of free energy penalties for deviating from the consensus DNA sequence.
One procedure to do that involves a modified SELEX (Systematic Evolution of
Ligands by Exponential Enrichment) method designed to produce many such
sequences.
RESULTS: We analyzed low stringency SELEX data for E. coli Catabolic Activator
Protein (CAP), and we show here that appropriate quantitative analysis improves
our ability to predict in vitro affinity. To obtain large number of sequences
required for this analysis we used a SELEX SAGE protocol developed by Roulet et
al. The sequences obtained from here were subjected to bioinformatic analysis.
The resulting bioinformatic model characterizes the sequence specificity of the
protein more accurately than those sequence specificities predicted from previous
analysis just by using a few known binding sites available in the literature. The
consequences of this increase in accuracy for prediction of in vivo binding sites
(and especially functional ones) in the E. coli genome are also discussed. We
measured the dissociation constants of several putative CAP binding sites by EMSA
(Electrophoretic Mobility Shift Assay) and compared the affinities to the
bioinformatics scores provided by methods like the weight matrix method and
QPMEME (Quadratic Programming Method of Energy Matrix Estimation) trained on
known binding sites as well as on the new sites from SELEX SAGE data. We also
checked predicted genome sites for conservation in the related species S.
typhimurium. We found that bioinformatics scores based on SELEX SAGE data does
better in terms of prediction of physical binding energies as well as in
detecting functional sites.
CONCLUSION: We think that training binding site detection algorithms on datasets 
from binding assays lead to better prediction. The improvements in accuracy came 
from the unbiased nature of the SELEX dataset rather than from the number of
sites available. We believe that with progress in short-read sequencing
technology, one could use SELEX methods to characterize binding affinities of
many low specificity transcription factors.

DOI: 10.1186/1472-6750-8-94 
PMCID: PMC2654563
PMID: 19105805  [Indexed for MEDLINE]


86. Mol Cell Probes. 2009 Feb;23(1):20-8. doi: 10.1016/j.mcp.2008.10.006. Epub 2008
Nov 18.

Selection, characterization, and application of DNA aptamers for the capture and 
detection of Salmonella enterica serovars.

Joshi R(1), Janagama H, Dwivedi HP, Senthil Kumar TM, Jaykus LA, Schefers J,
Sreevatsan S.

Author information: 
(1)Veterinary Population Medicine Department, College of Veterinary Medicine,
University of Minnesota, St. Paul, MN 55108, United States.

Sensitive and specific pre-analytical sample processing methods are needed to
enhance our ability to detect and quantify food borne pathogens from complex food
and environmental samples. In this study, DNA aptamers were selected and
evaluated for the capture and detection of Salmonella enterica serovar.
Typhimurium. A total of 66 candidate sequences were enriched against S.
Typhimurium outer membrane proteins (OMPs) with counter-selection against
Escherichia coli OMPs and lipopolysaccharides (LPS). Specificity of the selected 
aptamers was evaluated by gel-shift analysis against S. Typhimurium OMP. Five
Salmonella-specific aptamer candidates were selected for further
characterization. A dilution-to-extinction capture protocol using pure cultures
of S. Typhimurium further narrowed the field to two candidates (aptamers 33 and
45) which showed low-end detection limits of 10-40CFU. DNase protection assays
applied to these aptamers confirmed sequence-specific binding to S. Typhimurium
OMP preparations, while South-Western blot analysis combined with mass
spectrometry identified putative membrane proteins as targets for aptamer
binding. Aptamer 33 was bound to magnetic beads and used for the capture of S.
Typhimurium seeded into whole carcass chicken rinse samples, followed by
detection using quantitative real-time RT-PCR. In a pull-down assay format,
detection limits were 10(1)-10(2)CFU S. Typhimurium/9mL rinsate, while in a
recirculation format, detection limits were 10(2)-10(3)CFU/25mL rinsate.
Reproducible detection at <10(1)S. typhimurium CFU/g was also achieved in
spike-and-recovery experiments using bovine feces. The pull-down analysis using
aptamer 33 was validated on 3 naturally infected chicken litter samples
confirming their applicability in the field. This study demonstrates the
applicability of Salmonella specific aptamers for pre-analytical sample
processing as applied to food and environmental sample matrices.

DOI: 10.1016/j.mcp.2008.10.006 
PMID: 19049862  [Indexed for MEDLINE]


87. Biol Chem. 2009 Feb;390(2):137-44. doi: 10.1515/BC.2009.022.

Aptamers selected against the unglycosylated EGFRvIII ectodomain and delivered
intracellularly reduce membrane-bound EGFRvIII and induce apoptosis.

Liu Y(1), Kuan CT, Mi J, Zhang X, Clary BM, Bigner DD, Sullenger BA.

Author information: 
(1)Department of Surgery, Duke University Medical Center, Durham, NC 27710, USA.

Epidermal growth factor receptor variant III (EGFRvIII) is a glycoprotein
uniquely expressed in glioblastoma, but not in normal brain tissues. To develop
targeted therapies for brain tumors, we selected RNA aptamers against the
histidine-tagged EGFRvIII ectodomain, using an Escherichia coli system for
protein expression and purification. Representative aptamer E21 has a
dissociation constant (Kd) of 33x10(-9) m, and exhibits high affinity and
specificity for EGFRvIII in ELISA and surface plasmon resonance assays. However, 
selected aptamers cannot bind the same protein expressed from eukaryotic cells
because glycosylation, a post-translational modification present only in
eukaryotic systems, significantly alters the structure of the target protein. By 
transfecting EGFRvIII aptamers into cells, we find that membrane-bound,
glycosylated EGFRvIII is reduced and the percentage of cells undergoing apoptosis
is increased. We postulate that transfected aptamers can interact with newly
synthesized EGFRvIII, disrupt proper glycosylation, and reduce the amount of
mature EGFRvIII reaching the cell surface. Our work establishes the feasibility
of disrupting protein post-translational modifications in situ with aptamers.
This finding is useful for elucidating the function of proteins of interest with 
various modifications, as well as dissecting signal transduction pathways.

DOI: 10.1515/BC.2009.022 
PMCID: PMC3816755
PMID: 19040357  [Indexed for MEDLINE]


88. Folia Microbiol (Praha). 2008;53(4):295-302. doi: 10.1007/s12223-008-0046-6. Epub
2008 Aug 31.

In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs
complexes.

Bruno JG(1), Carrillo MP, Phillips T.

Author information: 
(1)Operational Technologies Corporation, San Antonio, TX 78229, USA.
john.bruno@otcorp.com

DNA aptamers were developed against lipopolysaccharide (LPS) from E. coli O111:B4
and shown to bind both LPS and E. coli by a colorimetric enzyme-based microplate 
assay. The polyclonal aptamers were coupled to human C1qrs protein either
directly using a bifunctional linker or indirectly using biotinylated aptamers
and a streptavidin-C1qrs complex. Both systems significantly reduced colony
counts when applied to E. coli O111:B4 and K12 strains across a series of 10x
dilutions of the bacteria in the presence of human serum; it was diluted 1: 10(3)
in order to avoid significant bacterial lysis by the competing alternate pathway 
of complement activation. A number of candidate DNA aptamer sequences were cloned
and sequenced from the anti-LPS aptamer library for future screening of
antibacterial or "antibiotic" potential and to aid in eventual development of an 
alternative therapy for antibiotic-resistant bacterial infections.

DOI: 10.1007/s12223-008-0046-6 
PMID: 18759112  [Indexed for MEDLINE]


89. BMB Rep. 2008 Jul 31;41(7):511-5.

Examination of specific binding activity of aptamer RNAs to the HIV-NC by using a
cell-based in vivo assay for protein-RNA interaction.

Jeong YY(1), Kim SH, Jang SI, You JC.

Author information: 
(1)National Research Laboratory for Molecular Virology, Department of Pathology, 
College of Medicine, The Catholic University of Korea, 505 Banpo-dong, Seocho-gu,
Seoul 137-701, Korea.

The nucleocapsid (NC) protein of the Human Immunodeficiency Virus-1 plays a key
role in viral genomic packaging by specifically recognizing the Psi(Psi) RNA
sequence within the HIV-1 genome RNA. Recently, a novel cell-based assay was
developed to probe the specific interactions in vivo between the NC and Psi-RNA
using E.coli cells (J. Virol. 81: 6151-55, 2007). In order to examine the
extendibility of this cell-based assay to RNAs other than Psi-RNA, this study
tested the RNA aptamers isolated in vitro using the SELEX method, but whose
specific binding ability to NC in a living cellular environment has not been
established. The results demonstrate for the first time that each of those
aptamer RNAs can bind specifically to NC in a NC zinc finger motif dependent
manner within the cell. This confirms that the cell-based assay developed for
NC-Psi interaction can be further extended and applied to NC-binding RNAs other
than Psi-RNA.


PMID: 18682034  [Indexed for MEDLINE]


90. J Bacteriol. 2008 Sep;190(17):5890-7. doi: 10.1128/JB.00459-08. Epub 2008 Jun 20.

The uncharacterized transcription factor YdhM is the regulator of the nemA gene, 
encoding N-ethylmaleimide reductase.

Umezawa Y(1), Shimada T, Kori A, Yamada K, Ishihama A.

Author information: 
(1)Department of Frontier Bioscience, Hosei University, Koganei, Tokyo 184-8584, 
Japan.

N-ethylmaleimide (NEM) has been used as a specific reagent of Cys modification in
proteins and thus is toxic for cell growth. On the Escherichia coli genome, the
nemA gene coding for NEM reductase is located downstream of the gene encoding an 
as-yet-uncharacterized transcription factor, YdhM. Disruption of the ydhM gene
results in reduction of nemA expression even in the induced state, indicating
that the two genes form a single operon. After in vitro genomic SELEX screening, 
one of the target recognition sequences for YdhM was identified within the
promoter region for this ydhM-nemA operon. Both YdhM binding in vitro to the ydhM
promoter region and transcription repression in vivo of the ydhM-nemA operon by
YdhM were markedly reduced by the addition of NEM. Taken together, we propose
that YdhM is the repressor for the nemA gene, thus hereafter designated NemR. The
repressor function of NemR was inactivated by the addition of not only NEM but
also other Cys modification reagents, implying that Cys modification of NemR
renders it inactive. This is an addition to the mode of controlling activity of
transcription factors by alkylation with chemical agents.

DOI: 10.1128/JB.00459-08 
PMCID: PMC2519536
PMID: 18567656  [Indexed for MEDLINE]


91. RNA Biol. 2008 Jan-Mar;5(1):30-40. Epub 2008 Feb 4.

Isolation of small RNA-binding proteins from E. coli: evidence for frequent
interaction of RNAs with RNA polymerase.

Windbichler N(1), von Pelchrzim F, Mayer O, Csaszar E, Schroeder R.

Author information: 
(1)Max F. Perutz Laboratories, University of Vienna, Vienna, Austria.

Bacterial small RNAs (sRNAs) are non-coding RNAs that regulate gene expression
enabling cells to adapt to various growth conditions. Assuming that most RNAs
require proteins to exert their activities, we purified and identified
sRNA-binding factors via affinity chromatography and mass spectrometry. We
consistently obtained RNA polymerase betasubunit, host factor Hfq and ribosomal
protein S1 as sRNA-binding proteins in addition to several other factors. Most
importantly, we observed that RNA polymerase not only binds several sRNAs but
also reacts with them, both cleaving and extending the RNAs at their 3' ends. The
fact that the RNA polymerase reacts with sRNAs maps their interaction site to the
active centre cleft of the enzyme and shows that it takes RNAs as template to
perform RNA-dependent RNA polymerase activity. We further performed genomic SELEX
to isolate RNA polymerase-binding RNAs and obtained a large number of E. coli
sequences binding with high affinity to this enzyme. In vivo binding of some of
the RNAs to the RNA polymerase was confirmed via co-immunoprecipitation in cell
extracts prepared from different growth conditions. Our observations show that
RNA polymerase is able to bind and react with many different RNAs and we suggest 
that RNAs are involved in transcriptional regulation more frequently than
anticipated.


PMID: 18388495  [Indexed for MEDLINE]


92. Mol Microbiol. 2007 Nov;66(3):744-57. Epub 2007 Oct 5.

RutR is the uracil/thymine-sensing master regulator of a set of genes for
synthesis and degradation of pyrimidines.

Shimada T(1), Hirao K, Kori A, Yamamoto K, Ishihama A.

Author information: 
(1)Department of Frontier Bioscience and Micro-Nano Technology Research Centre,
Hosei University, Koganei, Tokyo 184-8584, Japan.

Using the genomic SELEX, a total of six Escherichia coli DNA fragments have been 
identified, which formed complexes with transcription factor RutR. The RutR
regulon was found to include a large number of genes encoding components for not 
only degradation of pyrimidines but also transport of glutamate, synthesis of
glutamine, synthesis of pyrimidine nucleotides and arginine, and degradation of
purines. DNase I footprinting indicated that RutR recognizes a palindromic
sequence of TTGACCAnnTGGTCAA. The RutR box in P1 promoter of carAB encoding
carbamoyl phosphate synthetase, a key enzyme of pyrimidine synthesis, overlaps
with the PepA (CarP) repressor binding site, implying competition between RutR
and PepA. Adding either uracil or thymine abolished RutR binding in vitro to the 
carAB P1 promoter. Accordingly, in the rutR-deletion mutant or in the presence of
uracil, the activation in vivo of carAB P1 promoter was markedly reduced.
Northern blot analysis of the RutR target genes indicated that RutR represses the
Gad system genes involved in glutamate-dependent acid resistance and allantoin
degradation. Altogether we propose that RutR is the pyrimidine sensor and the
master regulator for a large set of the genes involved in the synthesis and
degradation of pyrimidines.

DOI: 10.1111/j.1365-2958.2007.05954.x 
PMID: 17919280  [Indexed for MEDLINE]


93. Bioorg Med Chem. 2007 Dec 15;15(24):7688-95. Epub 2007 Aug 31.

Elucidation of the RNA target of linezolid by using a linezolid-neomycin B
heteroconjugate and genomic SELEX.

Kim HJ(1), Kwon M, Yu J.

Author information: 
(1)Department of Chemistry and Education, Seoul National University, Seoul
151-742, Republic of Korea.

A covalently modified heteroconjugate between linezolid and neomycin B leads to
an enhanced and more specific binding affinity to hairpin RNA targets in
comparison to neomycin B itself. This heteroconjugate was used as a lure to
select linezolid-specific hairpin RNA from an Escherichia coli genome RNA. The
selected RNA obtained after eight cycles not only has typical stem-loop
structures but also includes known sequences of the linezolid binding site. The
results of RNA footprinting show that the binding site of the heteroconjugate
encompasses both stem and loop regions, suggesting that the possible binding site
for linezolid is in the terminal loop. In addition, findings from application of 
a surface plasmon resonance assay clearly demonstrate that linezolid binds to
selected hairpin RNA in a highly specific manner with a low millimolar affinity. 
The results suggest that heteroconjugates might represent a generally useful
approach in studies aimed at uncovering loop-specific RNA binding ligands that
would be otherwise difficult to identify owing to their weak affinities.

DOI: 10.1016/j.bmc.2007.08.053 
PMID: 17869523  [Indexed for MEDLINE]


94. J Bacteriol. 2007 Aug;189(16):6080-4. Epub 2007 Jun 8.

folA, a new member of the TyrR regulon in Escherichia coli K-12.

Yang J(1), Ogawa Y, Camakaris H, Shimada T, Ishihama A, Pittard AJ.

Author information: 
(1)Department of Microbiology and Immunology, The University of Melbourne,
Victoria 3010, Australia.

The folA gene was identified as a new member of the TyrR regulon by genomic
SELEX. Binding of TyrR to two sites in folA activated its transcription.
Mutations in the N-terminal or central domain of TyrR, the alpha subunit of RNA
polymerase, or integration host factor all abolished activation of the folA
promoter.

DOI: 10.1128/JB.00482-07 
PMCID: PMC1952039
PMID: 17557822  [Indexed for MEDLINE]


95. J Bacteriol. 2007 Aug;189(15):5472-81. Epub 2007 May 25.

CsrA inhibits translation initiation of Escherichia coli hfq by binding to a
single site overlapping the Shine-Dalgarno sequence.

Baker CS(1), Eöry LA, Yakhnin H, Mercante J, Romeo T, Babitzke P.

Author information: 
(1)Department of Biochemistry and Molecular Biology, The Pennsylvania State
University, University Park, PA 16802, USA.

Csr (carbon storage regulation) of Escherichia coli is a global regulatory system
that consists of CsrA, a homodimeric RNA binding protein, two noncoding small
RNAs (sRNAs; CsrB and CsrC) that function as CsrA antagonists by sequestering
this protein, and CsrD, a specificity factor that targets CsrB and CsrC for
degradation by RNase E. CsrA inhibits translation initiation of glgC, cstA, and
pgaA by binding to their leader transcripts and preventing ribosome binding.
Translation inhibition is thought to contribute to the observed mRNA
destabilization. Each of the previously known target transcripts contains
multiple CsrA binding sites. A position-specific weight matrix search program was
developed using known CsrA binding sites in mRNA. This search tool identified a
potential CsrA binding site that overlaps the Shine-Dalgarno sequence of hfq, a
gene that encodes an RNA chaperone that mediates sRNA-mRNA interactions. This
putative CsrA binding site matched the SELEX-derived binding site consensus
sequence in 8 out of 12 positions. Results from gel mobility shift and footprint 
assays demonstrated that CsrA binds specifically to this site in the hfq leader
transcript. Toeprint and cell-free translation results indicated that bound CsrA 
inhibits Hfq synthesis by competitively blocking ribosome binding. Disruption of 
csrA caused elevated expression of an hfq'-'lacZ translational fusion, while
overexpression of csrA inhibited expression of this fusion. We also found that
hfq mRNA is stabilized upon entry into stationary-phase growth by a
CsrA-independent mechanism. The interaction of CsrA with hfq mRNA is the first
example of a CsrA-regulated gene that contains only one CsrA binding site.

DOI: 10.1128/JB.00529-07 
PMCID: PMC1951803
PMID: 17526692  [Indexed for MEDLINE]


96. J Bacteriol. 2007 Aug;189(15):5534-41. Epub 2007 May 18.

PdhR (pyruvate dehydrogenase complex regulator) controls the respiratory electron
transport system in Escherichia coli.

Ogasawara H(1), Ishida Y, Yamada K, Yamamoto K, Ishihama A.

Author information: 
(1)Department of Frontier Bioscience, Hosei University, Kajino-cho 3-7-2,
Koganei, Tokyo 184-8584, Japan.

The pyruvate dehydrogenase (PDH) multienzyme complex plays a key role in the
metabolic interconnection between glycolysis and the citric acid cycle.
Transcription of the Escherichia coli genes for all three components of the PDH
complex in the pdhR-aceEF-lpdA operon is repressed by the pyruvate-sensing PdhR, 
a GntR family transcription regulator, and derepressed by pyruvate. After a
systematic search for the regulation targets of PdhR using genomic systematic
evolution of ligands by exponential enrichment (SELEX), we have identified two
novel targets, ndh, encoding NADH dehydrogenase II, and cyoABCDE, encoding the
cytochrome bo-type oxidase, both together forming the pathway of respiratory
electron transport downstream from the PDH cycle. PDH generates NADH, while Ndh
and CyoABCDE together transport electrons from NADH to oxygen. Using gel shift
and DNase I footprinting assays, the PdhR-binding site (PdhR box) was defined,
which includes a palindromic consensus sequence, ATTGGTNNNACCAAT. The binding in 
vitro of PdhR to the PdhR box decreased in the presence of pyruvate. Promoter
assays in vivo using a two-fluorescent-protein vector also indicated that the
newly identified operons are repressed by PdhR and derepressed by the addition of
pyruvate. Taken together, we propose that PdhR is a master regulator for
controlling the formation of not only the PDH complex but also the respiratory
electron transport system.

DOI: 10.1128/JB.00229-07 
PMCID: PMC1951801
PMID: 17513468  [Indexed for MEDLINE]


97. J Bacteriol. 2007 Jul;189(13):4791-9. Epub 2007 Apr 27.

Genomic SELEX search for target promoters under the control of the PhoQP-RstBA
signal relay cascade.

Ogasawara H(1), Hasegawa A, Kanda E, Miki T, Yamamoto K, Ishihama A.

Author information: 
(1)Hosei University, Department of Frontier Bioscience, Kajino-cho 3-7-2,
Koganei, Tokyo 184-8584, Japan.

RstBA, a two-component regulatory system of Escherichia coli with an unidentified
regulatory function, is under the control of a Mg(2+)-sensing PhoQP two-component
system. In order to identify the network of transcription regulation downstream
of RstBA, we isolated a set of RstA-binding sequences from the E. coli genome by 
using the genomic SELEX system. A gel mobility shift assay indicated the binding 
of RstA to two SELEX DNA fragments, one including the promoter region of asr
(acid shock RNA) and another including the promoter for csgD (a regulator of the 
curli operon). Using a DNase I footprinting assay, we determined the RstA-binding
sites (RstA boxes) with the consensus sequence TACATNTNGTTACA. Transcription of
the asr gene was induced 10- to 60-fold either in low-pH (pH 4.5) LB medium or in
low-phosphate minimal medium as detected by promoter assay. The acid-induced in
vivo transcription of asr was reduced after the deletion of rstA. In vivo
transcription of the asr promoter was observed only in the presence of RstA. In
agreement with the PhoQP-RstBA network, the addition of Mg(2+) led to a severe
reduction of the asr promoter activity, and the disruption of phoP also reduced
the asr promoter activity, albeit to a lesser extent. These observations
altogether indicate that RstA is an activator of asr transcription. In contrast, 
transcription of csgD was repressed by overexpression of RstA, indicating that
RstA is a repressor for csgD. With these data taken together, we conclude that
the expression of both asr and csgD is under the direct control of the
PhoQP-RstBA signal relay cascade.

DOI: 10.1128/JB.00319-07 
PMCID: PMC1913430
PMID: 17468243  [Indexed for MEDLINE]


98. Biochem Biophys Res Commun. 2007 Feb 23;353(4):1028-33. Epub 2006 Dec 28.

Characterization of the ColE2-like replicon of plasmid pTT8 from Thermus
thermophilus.

Aoki K(1), Itoh T.

Author information: 
(1)Department of Biology, Faculty of Science, Shinshu University, Matsumoto,
Nagano 390-8621, Japan.

We identified the 1.6-kb region of Thermus thermophilus plasmid pTT8 capable of
autonomous replication, which shows a significant sequence similarity to the
replicon regions of the ColE2-related plasmids. We showed the requirement of DNA 
polymerase I for pTT8 replication. The putative rep gene coding for the
replication initiator protein, Rep, similar to those of the ColE2-related
plasmids was cloned into an expression vector. The 6xHis-Rep protein expressed in
Escherichia coli was successfully purified by stepwise denaturing with urea and
refolding in the presence of glycerol on Ni-resin. We identified the nucleotide
sequence recognized by the pTT8 Rep protein by the SELEX experiment using the
purified protein, and proposed the existence of the third origin of pTT8
replication different from those predicted previously.

DOI: 10.1016/j.bbrc.2006.12.150 
PMID: 17207772  [Indexed for MEDLINE]


99. Nucleic Acids Res. 2007;35(2):506-16. Epub 2006 Dec 14.

Cold shock domain proteins and glycine-rich RNA-binding proteins from Arabidopsis
thaliana can promote the cold adaptation process in Escherichia coli.

Kim JS(1), Park SJ, Kwak KJ, Kim YO, Kim JY, Song J, Jang B, Jung CH, Kang H.

Author information: 
(1)Department of Plant Biotechnology, Agricultural Plant Stress Research Center
and Biotechnology Research Institute, College of Agriculture and Life Sciences,
Chonnam National University, Gwangju, 500-757, Republic of Korea.

Despite the fact that cold shock domain proteins (CSDPs) and glycine-rich
RNA-binding proteins (GRPs) have been implicated to play a role during the cold
adaptation process, their importance and function in eukaryotes, including
plants, are largely unknown. To understand the functional role of plant CSDPs and
GRPs in the cold response, two CSDPs (CSDP1 and CSDP2) and three GRPs (GRP2, GRP4
and GRP7) from Arabidopsis thaliana were investigated. Heterologous expression of
CSDP1 or GRP7 complemented the cold sensitivity of BX04 mutant Escherichia coli
that lack four cold shock proteins (CSPs) and is highly sensitive to cold stress,
and resulted in better survival rate than control cells during incubation at low 
temperature. In contrast, CSDP2 and GRP4 had very little ability. Selective
evolution of ligand by exponential enrichment (SELEX) revealed that GRP7 does not
recognize specific RNAs but binds preferentially to G-rich RNA sequences. CSDP1
and GRP7 had DNA melting activity, and enhanced RNase activity. In contrast,
CSDP2 and GRP4 had no DNA melting activity and did not enhance RNAase activity.
Together, these results indicate that CSDPs and GRPs help E.coli grow and survive
better during cold shock, and strongly imply that CSDP1 and GRP7 exhibit RNA
chaperone activity during the cold adaptation process.

DOI: 10.1093/nar/gkl1076 
PMCID: PMC1802614
PMID: 17169986  [Indexed for MEDLINE]


100. Nucleic Acids Symp Ser (Oxf). 2005;(49):269-70.

In vitro selection of RNA aptamers for the Escherichia coli release factor 1.

Ogawa A(1), Nishi T, Sando S, Aoyama Y.

Author information: 
(1)Department of Synthetic Chemistry and Biological Chemistry, Graduate School of
Engineering, Kyoto University, Katsura, Nishikyo-ku, Kyoto 615-8510, Japan.

We carried out an in vitro selection of RNA aptamers that bind to Escherichia
coli release factor 1 (E. coli RF1). The selected aptamer (class II) showed an
apparent dissociation constant of nM range. The binding of the class II aptamer
with E. coli RF1 is highly specific (orthogonal), allowing selective inhibition
of RF1 activity in the E. coli translation system.

DOI: 10.1093/nass/49.1.269 
PMID: 17150737  [Indexed for MEDLINE]


101. Biomol Eng. 2006 Jun;23(2-3):59-76. Epub 2006 Mar 9.

The affinity concept in bioseparation: evolving paradigms and expanding range of 
applications.

Mondal K(1), Gupta MN.

Author information: 
(1)Department of Chemistry, Indian Institute of Technology Delhi, Hauz Khas, New 
Delhi 110016, India.

The meaning of the word affinity in the context of protein separation has
undergone evolutionary changes over the years. The exploitation of molecular
recognition phenomenon is no longer limited to affinity chromatography modes.
Affinity based separations today include precipitation, membrane based
purification and two-phase/three-phase extractions. Apart from the affinity
ligands, which have biological relationship (in vivo) with the target protein, a 
variety of other ligands are now used in the affinity based separations. These
include dyes, chelated metal ions, peptides obtained by phage display technology,
combinatorial synthesis, ribosome display methods and by systematic evolution of 
ligands by exponential enrichment (SELEX). Molecular modeling techniques have
also facilitated the designing of biomimetic ligands. Fusion proteins obtained by
recombinatorial methods have emerged as a powerful approach in bioseparation.
Overexpression in E. coli often result in inactive and insoluble inclusion
bodies. A number of interesting approaches are used for simultaneous refolding
and purification in such cases. Proteomics also needs affinity chromatography to 
reduce the complexity of the system before analysis by electrophoresis and mass
spectrometry are made. At industrial level, validation, biosafety and process
hygiene are also important aspects. This overview looks at these evolving
paradigms and various strategies which utilize affinity phenomenon for protein
separations.

DOI: 10.1016/j.bioeng.2006.01.004 
PMID: 16527537  [Indexed for MEDLINE]


102. RNA. 2005 Oct;11(10):1579-87. Epub 2005 Aug 30.

RNA sequence and secondary structure participate in high-affinity CsrA-RNA
interaction.

Dubey AK(1), Baker CS, Romeo T, Babitzke P.

Author information: 
(1)Department of Biochemistry and Molecular Biology, The Pennsylvania State
University, University Park, PA 16802, USA.

The global Csr regulatory system controls bacterial gene expression
post-transcriptionally. CsrA of Escherichia coli is an RNA binding protein that
plays a central role in repressing several stationary phase processes and
activating certain exponential phase functions. CsrA regulates translation
initiation of several genes by binding to the mRNA leaders and blocking ribosome 
binding. CsrB and CsrC are noncoding regulatory RNAs that are capable of
sequestering CsrA and antagonizing its activity. Each of the known target
transcripts contains multiple CsrA binding sites, although considerable sequence 
variation exists among these RNA targets, with GGA being the most highly
conserved element. High-affinity RNA ligands containing single CsrA binding sites
were identified from a combinatorial library using systematic evolution of
ligands by exponential enrichment (SELEX). The SELEX-derived consensus was
determined as RUACARGGAUGU, with the ACA and GGA motifs being 100% conserved and 
the GU sequence being present in all but one ligand. The majority (51/55) of the 
RNAs contained GGA in the loop of a hairpin within the most stable predicted
structure, an arrangement similar to several natural CsrA binding sites.
Strikingly, the identity of several nucleotides that were predicted to form base 
pairs in each stem were 100% conserved, suggesting that primary sequence
information was embedded within the base-paired region. The affinity of CsrA for 
several selected ligands was measured using quantitative gel mobility shift
assays. A mutational analysis of one selected ligand confirmed that the conserved
ACA, GGA, and GU residues were critical for CsrA binding and that RNA secondary
structure participates in CsrA-RNA recognition.

DOI: 10.1261/rna.2990205 
PMCID: PMC1370842
PMID: 16131593  [Indexed for MEDLINE]


103. Genes Cells. 2005 Sep;10(9):907-18.

Systematic search for the Cra-binding promoters using genomic SELEX system.

Shimada T(1), Fujita N, Maeda M, Ishihama A.

Author information: 
(1)Nippon Institute for Biological Science, Division of Molecular Biology, Ome,
Tokyo 198-0024, Japan.

Cra (or FruR), a global transcription factor with both repression and activation 
activities, controls a large number of the genes for glycolysis and
gluconeogenesis. To get insights into the entire network of transcription
regulation of the E. coli genome by Cra, we isolated a set of Cra-binding
sequences using an improved method of genomic SELEX. From the DNA sequences of 97
independently isolated DNA fragments by SELEX, the Cra-binding sequences were
identified in a total of ten regions on the E. coli genome, including promoters
of six known genes and four hitherto-unidentified genes. All six known promoters 
are repressed by Cra, but none of the activation-type promoters were cloned after
two cyles of SELEX, because the Cra-binding affinity to the repression-type
promoters is higher than the activation-type promoters, as determined by the
quantitative gel shift assay. Of a total of four newly identified Cra-binding
sequences, two are associated with promoter regions of the gapA (glyceraldehyde
3-phosphate dehydrogenase) and eno (enolase) genes, both involved in sugar
metabolism. The regulation of newly identified genes by Cra was confirmed by the 
in vivo promoter strength assay using a newly developed TFP (two-fluorescent
protein) vector for promoter assay or by in vitro transcription assay in the
presence of Cra protein.

DOI: 10.1111/j.1365-2443.2005.00888.x 
PMID: 16115199  [Indexed for MEDLINE]


104. Biochem J. 2004 Jul 15;381(Pt 2):373-8.

The water- and salt-stress-regulated Asr1 (abscisic acid stress ripening) gene
encodes a zinc-dependent DNA-binding protein.

Kalifa Y(1), Gilad A, Konrad Z, Zaccai M, Scolnik PA, Bar-Zvi D.

Author information: 
(1)Department of Life Sciences and The Doris and Bertie Black Center for
Bioenergetics in Life Sciences, Ben-Gurion University of the Negev, Beer-Sheva
84105, Israel.

Tomato (Lycopersicon esculantum) ASR1 (abscisic acid stress ripening protein), a 
small plant-specific protein whose cellular mode of action defies deduction based
on its sequence or homology analyses, is one of numerous plant gene products with
unknown biological roles that become over-expressed under water- and salt-stress 
conditions. Steady-state cellular levels of tomato ASR1 mRNA and protein are
transiently increased following exposure of plants to poly(ethylene glycol), NaCl
or abscisic acid. Western blot and indirect immunofluorescence analysis with
anti-ASR1 antibodies demonstrated that ASR1 is present both in the cytoplasmic
and nuclear subcellular compartments; approx. one-third of the total ASR1 protein
could be detected in the nucleus. Nuclear ASR1 is a chromatin-bound protein, and 
can be extracted with 1 M NaCl, but not with 0.5% Triton X-100. ASR1,
overexpressed in Escherichia coli and purified to homogeneity, possesses
zinc-dependent DNA-binding activity. Competitive-binding experiments and SELEX
(systematic evolution of ligands by exponential enrichment) analysis suggest that
ASR1 binds at a preferred DNA sequence.

DOI: 10.1042/BJ20031800 
PMCID: PMC1133842
PMID: 15101820  [Indexed for MEDLINE]


105. Nucleic Acids Res. 2003 Oct 1;31(19):5776-88.

Selective inhibitory DNA aptamers of the human RNase H1.

Pileur F(1), Andreola ML, Dausse E, Michel J, Moreau S, Yamada H, Gaidamakov SA, 
Crouch RJ, Toulmé JJ, Cazenave C.

Author information: 
(1)INSERM U386, IFR Pathologies Infectieuses, Université Victor Segalen Bordeaux 
2, 146, rue Léo Saignat, 33076 Bordeaux cedex, France.

Human RNase H1 binds double-stranded RNA via its N-terminal domain and RNA-DNA
hybrid via its C-terminal RNase H domain, the latter being closely related to
Escherichia coli RNase HI. Using SELEX, we have generated a set of DNA sequences 
that can bind efficiently (K(d) values ranging from 10 to 80 nM) to the human
RNase H1. None of them could fold into a simple perfect double-stranded DNA
hairpin confirming that double-stranded DNA does not constitute a trivial ligand 
for the enzyme. Only two of the 37 DNA aptamers selected were inhibitors of human
RNase H1 activity. The two inhibitory oligomers, V-2 and VI-2, were quite
different in structure with V-2 folding into a large, imperfect but stable
hairpin loop. The VI-2 structure consists of a central region unimolecular
quadruplex formed by stacking of two guanine quartets flanked by the 5' and 3'
tails that form a stem of six base pairs. Base pairing between the 5' and 3'
tails appears crucial for conferring the inhibitory properties to the aptamer.
Finally, the inhibitory aptamers were capable of completely abolishing the action
of an antisense oligonucleotide in a rabbit reticulocyte lysate supplemented with
human RNase H1, with IC50 ranging from 50 to 100 nM.


PMCID: PMC206449
PMID: 14500841  [Indexed for MEDLINE]


106. Nucleic Acids Res. 2002 Dec 15;30(24):5360-8.

Interaction of C5 protein with RNA aptamers selected by SELEX.

Lee JH(1), Kim H, Ko J, Lee Y.

Author information: 
(1)Department of Chemistry, Center for Molecular Design and Synthesis, Korea
Advanced Institute of Science and Technology, Daejeon 305-701, South Korea.

RNA aptamers binding to C5 protein, the protein component of Escherichia coli
RNase P, were selected and characterized as an initial step in elucidating the
mechanism of action of C5 protein as an RNA-binding protein. Sequence analyses of
the RNA aptamers suggest that C5 protein binds various RNA molecules with
dissociation constants comparable to that of M1 RNA, the RNA component of RNase
P. The dominant sequence, W2, was chosen for further study. Interactions between 
W2 and C5 protein were independent of Mg2+, in contrast to the Mg2+ dependency of
M1 RNA-C5 protein interactions. The affinity of W2 for C5 protein increased with 
increasing concentration of monovalent NH4+, suggesting interactions via
hydrophobic attraction. W2 forms a fairly stable complex with C5 protein,
although the stability of this complex is lower than that of the complex of M1
RNA with C5 protein. The core RNA motif essential for interaction with C5 protein
was identified as a stem-loop structure, comprising a 5 bp stem and a 20 nt loop.
Our results strongly imply that C5 protein is an interacting partner protein of
some cellular RNA species apart from M1 RNA.


PMCID: PMC140078
PMID: 12490703  [Indexed for MEDLINE]


107. J Biol Chem. 2002 Dec 13;277(50):48558-64. Epub 2002 Sep 24.

RNA binding properties of the AU-rich element-binding recombinant
Nup475/TIS11/tristetraprolin protein.

Worthington MT(1), Pelo JW, Sachedina MA, Applegate JL, Arseneau KO, Pizarro TT.

Author information: 
(1)Digestive Health Center of Excellence, University of Virginia Health Sciences 
Center, Charlottesville 22908, USA. mtw3p@virginia.edu

Regulation of messenger RNA stability by AU-rich elements is an important means
of regulating genes induced by growth factors and cytokines. Nup475 (also known
as tristetraprolin, or TIS11) is the prototype for a family of zinc-binding
Cys(3)His motif proteins required for proper regulation of tumor necrosis factor 
mRNA stability in macrophages. We developed an Escherichia coli expression system
to produce soluble Nup475 protein in quantity to study its RNA binding
properties. Nup475 protein bound a tumor necrosis factor AU-rich element over a
broad range of pH and salt concentrations by RNA gel shift. This binding was
inhibited by excess zinc metal, providing a potential mechanism for previous
reports of zinc stabilization of AU-rich element (ARE) containing messenger RNAs.
Immobilized Nup475 protein was used to select its optimal binding site by RNA
SELEX and revealed a strong preference for the extended sequence UUAUUUAUU,
rather than a simple AUUUA motif. These findings were confirmed by site-directed 
mutagenesis of the tumor necrosis factor ARE and RNA gel shifts on c-fos,
interferon-gamma, and interferon-beta ARE fragments. A weaker binding activity
toward adenine-rich sites, such as a poly(A) tail RNA fragment, can partially
disrupt the Nup475-tumor necrosis factor AU-rich element complex.

DOI: 10.1074/jbc.M206505200 
PMID: 12324455  [Indexed for MEDLINE]


108. J Bacteriol. 2002 Sep;184(17):4846-56.

Identification of a DtxR-regulated operon that is essential for
siderophore-dependent iron uptake in Corynebacterium diphtheriae.

Qian Y(1), Lee JH, Holmes RK.

Author information: 
(1)Department of Microbiology, University of Colorado Health Sciences Center,
4200 East Ninth Avenue, Denver, CO 80262, USA.

The diphtheria toxin repressor (DtxR) uses Fe(2+) as a corepressor and inhibits
transcription from iron-regulated promoters (IRPs) in Corynebacterium
diphtheriae. A new IRP, designated IRP6, was cloned from C. diphtheriae by a
SELEX-like procedure. DtxR bound to IRP6 in vitro only in the presence of
appropriate divalent metal ions, and repression of IRP6 by DtxR in an Escherichia
coli system was iron dependent. The open reading frames (ORFs) downstream from
IRP6 and previously described promoter IRP1 were found to encode proteins
homologous to components of ATP-binding cassette (ABC) transport systems involved
in high-affinity iron uptake in other bacteria. IRP1 and IRP6 were repressed
under high-iron conditions in wild-type C. diphtheriae C7(beta), but they were
expressed constitutively in C7(beta) mutant strains HC1, HC3, HC4, and HC5, which
were shown previously to be defective in corynebactin-dependent iron uptake. A
clone of the wild-type irp6 operon (pCM6ABC) complemented the constitutive
corynebactin production phenotype of HC1, HC4, and HC5 but not of HC3, whereas a 
clone of the wild-type irp1 operon failed to complement any of these strains.
Complementation by subclones of pCM6ABC demonstrated that mutant alleles of
irp6A, irp6C, and irp6B were responsible for the phenotypes of HC1, HC4, and HC5,
respectively. The irp6A allele in HC1 and the irp6B allele in HC5 encoded single 
amino acid substitutions in their predicted protein products, and the irp6C
allele in HC4 caused premature chain termination of its predicted protein
product. Strain HC3 was found to have a chain-terminating mutation in dtxR in
addition to a missense mutation in its irp6B allele. These findings demonstrated 
that the irp6 operon in C. diphtheriae encodes a putative ABC transporter, that
specific mutant alleles of irp6A, irp6B, and irp6C are associated with defects in
corynebactin-dependent iron uptake, and that complementation of these mutant
alleles restores repression of corynebactin production under high-iron growth
conditions, most likely as a consequence of restoring siderophore-dependent iron 
uptake mediated by the irp6 operon.


PMCID: PMC135300
PMID: 12169610  [Indexed for MEDLINE]


109. FEBS Lett. 2002 Mar 6;514(1):90-5.

RNA aptamers directed against release factor 1 from Thermus thermophilus.

Szkaradkiewicz K(1), Nanninga M, Nesper-Brock M, Gerrits M, Erdmann VA, Sprinzl
M.

Author information: 
(1)Laboratorium für Biochemie, Universität Bayreuth, Universitätsstrasse 30,
D-95440, Bayreuth, Germany.

An in vitro selection/amplification (SELEX) was used to generate RNA aptamers
that specifically bind Thermus thermophilus release factor 1 (RF1). From 31
isolated clones, two groups of aptamers with invariable sequences 5'-ACCU-3' and 
5'-GAAAGC-3' were isolated. Chemical and enzymatic probing of the structure
indicate that in both groups the invariable sequences are located in
single-stranded regions of hairpin structures. Complex formations between RF1 and
aptamers of both groups were identified by electrophoretic shift assay and
chemical footprinting. Deletion of the invariable sequences did not effect the
secondary structure of the aptamers but abolished their binding to RF1. RNA
motifs matching the invariable sequences of the aptamers are present as consensus
sequences in the peptidyl transferase center of 23S rRNAs. T. thermophilus RF1
recognizes UAG stop codons in an Escherichia coli in vitro translation system.
Aptamers from both groups inhibited this RF1 activity.


PMID: 11904188  [Indexed for MEDLINE]


110. Bioorg Khim. 2001 Jul-Aug;27(4):282-90.

[Extensive complementarity of the Shine-Dalgarno region and 3'-terminal sequence 
of 16S ribosomal RNA is inefficient for translation in vivo].

[Article in Russian]

Komarova AV(1), Chufistova LS, Supina EV, Boni IV.

Author information: 
(1)Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of
Sciences, ul. Miklukho-Maklaya 16/10, GSP Moscow, 117997 Russia.

Translation initiation in Escherichia coli involves as a rule complementary
interactions between a Shine-Dalgarno (SD) sequence upstream of the initiation
codon and a highly conserved 3'-end sequence of 16S rRNA (anti-SD). The
translation efficiency is believed to be directly affected by the affinity of the
ribosome to the mRNA initiation region. Earlier, high-affinity RNA ligands to E. 
coli ribosomes were selected by the SELEX approach, with the ligands containing
an extended SD-sequence well represented. In this work, we examined the ability
of artificial ribosome binding sites (RBSs) containing such an extended (10-nt)
SD-sequence (superSD) to drive translation in vivo, as well as its ability to
form the translation initiation complex in vitro. Toe print experiments showed
the formation of a ternary initiation complex on mRNA comprising superSD.
Moreover, they proved the formation of an extended SD-duplex in the binary
30S-mRNA complex. Nevertheless, the superSD appeared to be inefficient in
translation in vivo. We believe that the initiation complex involving a
superSD-element is too stable to be functional; it may impede the transition from
initiation to elongation, thus disrupting the transcription-translation coupling 
and inhibiting the formation of polysomes.


PMID: 11558262  [Indexed for MEDLINE]


111. Nucleic Acids Res. 2000 Nov 1;28(21):E93.

Interactions of Escherichia coli RNA with bacteriophage MS2 coat protein: genomic
SELEX.

Shtatland T(1), Gill SC, Javornik BE, Johansson HE, Singer BS, Uhlenbeck OC,
Zichi DA, Gold L.

Author information: 
(1)Department of Molecular, University of Colorado, Boulder, CO 80309-0347, USA.

Genomic SELEX is a method for studying the network of nucleic acid-protein
interactions within any organism. Here we report the discovery of several
interesting and potentially biologically important interactions using genomic
SELEX. We have found that bacteriophage MS2 coat protein binds several
Escherichia coli mRNA fragments more tightly than it binds the natural,
well-studied, phage mRNA site. MS2 coat protein binds mRNA fragments from rffG
(involved in formation of lipopolysaccharide in the bacterial outer membrane),
ebgR (lactose utilization repressor), as well as from several other genes.
Genomic SELEX may yield experimentally induced artifacts, such as molecules in
which the fixed sequences participate in binding. We describe several methods
(annealing of oligonucleotides complementary to fixed sequences or switching
fixed sequences) to eliminate some, or almost all, of these artifacts. Such
methods may be useful tools for both randomized sequence SELEX and genomic SELEX.


PMCID: PMC113162
PMID: 11058143  [Indexed for MEDLINE]


112. J Biol Chem. 1999 Oct 29;274(44):31236-44.

Highly specific recognition of primer RNA structures for 2'-OH priming reaction
by bacterial reverse transcriptases.

Inouye S(1), Hsu MY, Xu A, Inouye M.

Author information: 
(1)Department of Biochemistry, Robert Wood Johnson Medical School, Piscataway,
New Jersey 08854, USA.

A minor population of Escherichia coli contains retro-elements called retrons,
which encode reverse transcriptases (RT) to synthesize peculiar satellite DNAs
called multicopy single-stranded DNA (msDNA). These RTs recognize specific RNA
structures in their individual primer-template RNAs to initiate cDNA synthesis
from the 2'-OH group of a specific internal G residue (branching G residue). The 
resulting products (msDNA) consist of RNA and single-stranded DNA, sharing hardly
any sequence homology. Here, we investigated how RT-Ec86 recognizes the specific 
RNA structure in its primer-template RNA. On the basis of structural comparison
with HIV-1 RT, domain exchanges were carried out between two E. coli RTs, RT-Ec86
and RT-Ec73. RT-Ec86 (320 residues) and RT-Ec73 (316 residues) share only 71
identical residues (22%). From the analysis of 10 such constructs, the C-terminal
91-residue sequence of RT-Ec86 was found to be essential for the recognition of
the unique stem-loop structure and the branching G residue in the primer-template
RNA for retron-Ec86. Using the SELEX (systematic evolution of ligands by
exponential enrichment) method with RT-Ec86 and primer RNAs containing random
sequences, the identical stem-loop structure (including the 3-U loop) to that
found in the retron-Ec86 primer-template RNA was enriched. In addition, the
highly conserved 4-base sequence (UAGC), including the branching G residue, was
also enriched. These results indicate that the highly diverse C-terminal region
recognizes specific stem-loop structures and the branching G residue located
upstream of the stem-loop structure. The present results with seemingly primitive
RNA-dependent DNA polymerases provide insight into the mechanisms for specific
protein RNA recognition.


PMID: 10531319  [Indexed for MEDLINE]


113. RNA. 1999 Sep;5(9):1180-90.

In vitro selection of RNA aptamers that bind special elongation factor SelB, a
protein with multiple RNA-binding sites, reveals one major interaction domain at 
the carboxyl terminus.

Klug SJ(1), Hüttenhofer A, Famulok M.

Author information: 
(1)Institut für Biochemie der Universität München, Germany.

Erratum in
    RNA. 2014 Jun;20(6):956.

The SelB protein of Escherichia coli is a special elongation factor required for 
the cotranslational incorporation of the uncommon amino acid selenocysteine into 
proteins such as formiate dehydrogenases. To do this, SelB binds simultaneously
to selenocysteyl-tRNA(Sec) and to an RNA hairpin structure in the mRNA of
formiate dehydrogenases located directly 3' of the selenocysteine opal (UGA)
codon. The protein is also thought to contain binding sites allowing its
interaction with ribosomal proteins and/or rRNA. SelB thus includes specific
binding sites for a variety of different RNA molecules. We used an in vitro
selection approach with a pool completely randomized at 40 nt to isolate new
high-affinity SelB-binding RNA motifs. Our main objective was to investigate
which of the various RNA-binding domains in SelB would turn out to be prime
targets for aptamer interaction. The resulting sequences were compared with those
from a previous SELEX experiment using a degenerate pool of the wild-type
formiate dehydrogenase H (fdhF) hairpin sequence (Klug SJ et al., 1997, Proc.
Natl. Acad. Sci. USA 94:6676-6681). In four selection cycles an enriched pool of 
tight SelB-binding aptamers was obtained; sequencing revealed that all aptamers
were different in their primary sequence and most bore no recognizable consensus 
to known RNA motifs. Domain mapping for SelB-binding aptamers showed that despite
the different RNA-binding sites in the protein, the vast majority of aptamers
bound to the ultimate C-terminus of SelB, the domain responsible for mRNA hairpin
binding.


PMCID: PMC1369841
PMID: 10496219  [Indexed for MEDLINE]


114. Mol Microbiol. 1999 Sep;33(5):1004-14.

Sequence-selective interactions with RNA by CspB, CspC and CspE, members of the
CspA family of Escherichia coli.

Phadtare S(1), Inouye M.

Author information: 
(1)Department of Biochemistry, Robert Wood Johnson Medical School, 675 Hoes Lane,
Piscataway, NJ 08854, USA.

The CspA family of Escherichia coli comprises nine homologous proteins, CspA to
CspI. CspA, the major cold shock protein, binds RNA with low sequence specificity
and low binding affinity. This is considered to be important for its proposed
function as an RNA chaperone to prevent the formation of secondary structures in 
RNA molecules, thus facilitating translation at low temperature. The cellular
functions of other Csp proteins are yet to be fully elucidated, and their
sequence specific binding capabilities have not been identified. As a step
towards identification of the target genes of Csp proteins, we investigated the
RNA binding specificities of CspB, CspC and CspE by an in vitro selection
approach (SELEX). In the present study, we show that these proteins are able to
bind preferentially to specific RNA/single-stranded DNA sequences. The consensus 
sequences for CspB, CspC and CspE are U/T stretches, AGGGAGGGA and AU/AT-rich
regions, especially AAAUUU, respectively. CspE and CspB have Kd values in the
range 0.23-0.9 x 10(-6) M, while CspC has 10-fold lower binding affinity.
Consistent with our recent findings of transcriptional regulation of cspA by
CspE, we have identified a motif identical to the CspE consensus. This motif is
the putative CspE-mediated transcription pause recognition site in a
5'-untranslated region of the cspA mRNA.


PMID: 10476034  [Indexed for MEDLINE]


115. J Mol Biol. 1998 Nov 27;284(2):241-54.

A comprehensive library of DNA-binding site matrices for 55 proteins applied to
the complete Escherichia coli K-12 genome.

Robison K(1), McGuire AM, Church GM.

Author information: 
(1)Department of Genetics, Harvard Medical School, Boston, MA 02115, USA.

A major mode of gene regulation occurs via the binding of specific proteins to
specific DNA sequences. The availability of complete bacterial genome sequences
offers an unprecedented opportunity to describe networks of such interactions by 
correlating existing experimental data with computational predictions. Of the 240
candidate Escherichia coli DNA-binding proteins, about 55 have DNA-binding sites 
identified by DNA footprinting. We used these sites to construct recognition
matrices, which we used to search for additional binding sites in the E. coli
genomic sequence. Many of these matrices show a strong preference for non-coding 
DNA. Discrepancies are identified between matrices derived from natural sites and
those derived from SELEX (Systematic Evolution of Ligands by Exponential
enrichment) experiments. We have constructed a database of these proteins and
binding sites, called DPInteract (available at
http://arep.med.harvard.edu/dpinteract).

Copyright 1998 Academic Press.

DOI: 10.1006/jmbi.1998.2160 
PMID: 9813115  [Indexed for MEDLINE]


116. Proc Natl Acad Sci U S A. 1998 Aug 18;95(17):9761-6.

Identification of an UP element consensus sequence for bacterial promoters.

Estrem ST(1), Gaal T, Ross W, Gourse RL.

Author information: 
(1)Department of Bacteriology, University of Wisconsin, 1550 Linden Drive,
Madison, WI 53706, USA.

The UP element, a component of bacterial promoters located upstream of the -35
hexamer, increases transcription by interacting with the RNA polymerase
alpha-subunit. By using a modification of the SELEX procedure for identification 
of protein-binding sites, we selected in vitro and subsequently screened in vivo 
for sequences that greatly increased promoter activity when situated upstream of 
the Escherichia coli rrnB P1 core promoter. A set of 31 of these upstream
sequences increased transcription from 136- to 326-fold in vivo, considerably
more than the natural rrnB P1 UP element, and was used to derive a consensus
sequence: -59 nnAAA(A/T)(A/T)T(A/T)TTTTnnAAAAnnn -38. The most active selected
sequence contained the derived consensus, displayed all of the properties of an
UP element, and the interaction of this sequence with the alpha C-terminal domain
was similar to that of previously characterized UP elements. The identification
of the UP element consensus should facilitate a detailed understanding of the
alpha-DNA interaction. Based on the evolutionary conservation of the residues in 
alpha responsible for interaction with UP elements, we suggest that the UP
element consensus sequence should be applicable throughout eubacteria, should
generally facilitate promoter prediction, and may be of use for biotechnological 
applications.


PMCID: PMC21410
PMID: 9707549  [Indexed for MEDLINE]


117. Bioinformatics. 1998;14(3):271-8.

Systematic genomic screening and analysis of mRNA in untranslated regions and
mRNA precursors: combining experimental and computational approaches.

Dandekar T(1), Beyer K, Bork P, Kenealy MR, Pantopoulos K, Hentze M, Sonntag-Buck
V, Flouriot G, Gannon F, Schreiber S.

Author information: 
(1)European Molecular Biology Laboratory, Postfach 102209, D-69012 Heidelberg,
Germany. dandekar@embl-heidelberg.de

MOTIVATION: The untranslated regions (UTRs) of mRNA upstream (5'UTR) and
downstream (3'UTR) of the open reading frame, as well as the mRNA precursor,
carry important regulatory sequences. To reveal unidentified regulatory signals, 
we combine information from experiments with computational approaches. Depending 
on available knowledge, three different strategies are employed.
RESULTS: Searching with a consensus template, new RNAs with regulatory RNA
elements can be identified in genomic screens. By this approach, we identify new 
candidate regulatory motifs resembling iron-responsive elements in the 5'UTRs of 
HemA, FepB and FrdB mRNA from Escherichia coli. If an RNA element is not yet
defined, it may be analyzed by combining results from SELEX (selective enrichment
of ligands by exponential amplification) and a search of databases from RNA or
genomic sequences. A cleavage stimulating factor (CstF) binding element 3 of the 
polyadenylation site in the mRNA precursor serves as a test example.
Alternatively, the regulatory RNA element may be found by studying different RNA 
foldings and their correlation with simple experimental tests. We delineate a
novel instability element in the 3'UTR of the estrogen receptor mRNA in this way.
AVAILABILITY: Strategy, methods and programs are available on request from
T.Dandekar.
CONTACT: dandekar@embl-heidelberg.de


PMID: 9614270  [Indexed for MEDLINE]


118. RNA. 1997 Mar;3(3):255-68.

The RNA binding site of S8 ribosomal protein of Escherichia coli: Selex and
hydroxyl radical probing studies.

Moine H(1), Cachia C, Westhof E, Ehresmann B, Ehresmann C.

Author information: 
(1)UPR 9002 du CNRS, Institut de Biologie Moléculaire et Cellulaire, Strasbourg, 
France. moine@ibmc.u-strasbg.fr.

The RNA binding site of ribosomal protein S8 of Escherichia coli is confined to a
small region within the stem of a hairpin in 16S rRNA (nt 588-605/633-651), and
thus represents a model system for understanding RNA/protein interaction rules.
The S8 binding site on 16S rRNA was suspected to contain noncanonical features
difficult to prove with classical genetical or biochemical means. We performed in
vitro iterative selection of RNA aptamers that bind S8. For the different
aptamers, the interactions with the protein were probed with hydroxyl radicals.
Aptamers that were recognized according to the same structural rules as wild-type
RNA, but with variations not found in nature, were identified. These aptamers
revealed features in the S8 binding site that had been concealed during previous 
characterizations by the high base conservation throughout evolution. Our data
demonstrate that the core structure of the S8 binding site is composed of three
interdependent bases (nt 597/641/643), with an essential intervening adenine
nucleotide (position 642). The other elements important for the binding site are 
a base pair (598/640) above the three interdependent bases and a bulged base at
position 595, the identity of which is not important. Possible implications on
the geometry of the S8 binding site are discussed with the help of a
three-dimensional model.


PMCID: PMC1369478
PMID: 9056763  [Indexed for MEDLINE]


119. Nucleic Acids Res. 1997 Feb 15;25(4):781-6.

Libraries for genomic SELEX.

Singer BS(1), Shtatland T, Brown D, Gold L.

Author information: 
(1)Department of Molecular Biology, University of Colorado, Boulder 80309-0347,
USA.

Erratum in
    Nucleic Acids Res 1997 Nov 1;25(21):4430.

An increasing number of proteins are being identified that regulate gene
expression by binding specific nucleic acidsin vivo. A method termed genomic
SELEX facilitates the rapid identification of networks of protein-nucleic acid
interactions by identifying within the genomic sequences of an organism the
highest affinity sites for any protein of the organism. As with its progenitor,
SELEX of random-sequence nucleic acids, genomic SELEX involves iterative binding,
partitioning, and amplification of nucleic acids. The two methods differ in that 
the variable region of the nucleic acid library for genomic SELEX is derived from
the genome of an organism. We have used a quick and simple method to construct
Escherichia coli, Saccharomyces cerevisiae, and human genomic DNA PCR libraries
that can be transcribed with T7 RNA polymerase. We present evidence that the
libraries contain overlapping inserts starting at most of the positions within
the genome, making these libraries suitable for genomic SELEX.


PMCID: PMC146522
PMID: 9016629  [Indexed for MEDLINE]


120. Proc Natl Acad Sci U S A. 1996 Apr 30;93(9):4409-14.

Gene repression by the ferric uptake regulator in Pseudomonas aeruginosa: cycle
selection of iron-regulated genes.

Ochsner UA(1), Vasil ML.

Author information: 
(1)Department of Microbiology, University of Colorado Health Science Center,
Denver 80262, USA.

The expression of at least 24 distinct genes of Pseudomonas aeruginosa PAO1 is
under direct control of the "ferric uptake regulator" (Fur). Novel targets of the
Fur protein were isolated in a powerful SELEX (systematic evolution of ligands by
exponential enrichment)-like cycle selection consisting of in vitro DNA-Fur
interaction, binding to anti-Fur antibody, purification on protein G, and PCR
amplification. DNA fragments obtained after at least three exponential enrichment
cycles were cloned and subjected to DNA mobility-shift assays and DNase I
footprint analyses to verify the specific interaction with the Fur protein in
vitro. Iron-dependent expression of the corresponding genes in vivo was monitored
by RNase protection analysis. In total, 20 different DNA fragments were
identified which represent actual Pseudomonas iron-regulated genes (PIGs). While 
four PIGs are identical to already known genes (pfeR, pvdS, tonB, and fumC,
respectively), 16 PIGs represent previously unknown genes. Homology studies of
the putative proteins encoded by the PIGs allowed us to speculate about their
possible function. Two PIG products were highly similar to siderophore receptors 
from various species, and three PIG products were significantly homologous to
alternative sigma factors. Furthermore, homologs of the Escherichia coli
ORF1-tolQ, nuoA, stringent starvation protein Ssp, and of a two-component
regulatory system similar to the Pseudomonas syringae LemA sensor kinase were
identified. The putative gene products of seven additional PIGs did not show
significant homologies to any known proteins. The PIGs were mapped on the
P.aeruginosa chromosome. Their possible role in iron metabolism and virulence of 
P. aeruginosa is discussed.


PMCID: PMC39551
PMID: 8633080  [Indexed for MEDLINE]


121. Biochemistry. 1996 Feb 20;35(7):2349-56.

In vitro selection of RNA specifically cleaved by bacteriophage T4 RegB
endonuclease.

Jayasena VK(1), Brown D, Shtatland T, Gold L.

Author information: 
(1)Department of Molecular, Cellular and Developmental Biology, University of
Colorado, Boulder 80309-0347, USA.

T4 RegB endonuclease specifically cleaves at -GGAG- sites in several early T4
messages, rendering them nonfunctional. Not all -GGAG- sites are processed
equally by RegB; those found at the Shine-Dalgarno sequences and in
intercistronic regions are processed with higher efficiency than the -GGAG- sites
located in coding regions. The low activity of RegB observed in vitro is enhanced
by 1-2 orders of magnitude by the Escherichia coli ribosomal protein S1. We have 
used SELEX (systematic evolution of ligands by exponential enrichment) on a
combinatorial RNA library to obtain molecules that are specifically cleaved by T4
RegB endonuclease in the presence of S1. The sequences obtained contain the
required -GGAG- tetranucleotide and were unusually enriched in adenosine and
cytosine nucleotides. No consensus structure or sequence motif other than -GGAG- 
was conserved among the selected molecules. The majority of the RNAs are entirely
dependent on S1 for RegB-catalyzed cleavage; however, a few RNAs are found to be 
S1 independent but are cleaved by RegB with much lower rates.

DOI: 10.1021/bi951879b 
PMID: 8652576  [Indexed for MEDLINE]


122. J Mol Biol. 1996 Jan 12;255(1):55-66.

In vitro evolution of the DNA binding sites of Escherichia coli methionine
repressor, MetJ.

He YY(1), Stockley PG, Gold L.

Author information: 
(1)Department of Molecular Cellular and Developmental Biology, University of
Colorado at Boulder 80309, USA.

The SELEX procedure was used to study the recognition between the E. coli
methionine repressor (MetJ) and its DNA binding sites. DNA ligands with high
affinity for either the holo-repressor or apo-repressor were isolated from a pool
of molecules randomized over 20 base-pairs. Among 90 DNA ligands selected by
holo-repressor binding, roughly 90% contain variations of two tandem, perfect
eight base-pair Met-boxes, which are the consensus deduced from natural met
operators. Base-pairs that are important, for specific interactions with the
protein are highly conserved. The data also reveal the importance of the
non-contacted operator base-pairs in facilitating the conformational changes in
the operator which must occur for repressor binding. There are also effects due
to the sequences of the base-pairs immediately flanking the operator site. DNA
ligands selected by apo-repressor share a very similar, but not identical,
consensus with that selected by holo-repressor, suggesting that the corepressor
does not greatly alter the specificity of repressor binding.

DOI: 10.1006/jmbi.1996.0006 
PMID: 8568875  [Indexed for MEDLINE]


123. J Bacteriol. 1995 Sep;177(17):4872-80.

A consensus sequence for binding of Lrp to DNA.

Cui Y(1), Wang Q, Stormo GD, Calvo JM.

Author information: 
(1)Section of Biochemistry, Molecular and Cell Biology, Cornell University,
Ithaca, New York 14853, USA.

Lrp (leucine-responsive regulatory protein) is a major regulatory protein
involved in the expression of numerous operons in Escherichia coli. For ilvIH,
one of the operons positively regulated by Lrp, Lrp binds to multiple sites
upstream of the transcriptional start site and activates transcription. An
alignment of 12 Lrp binding sites within ilvIH DNA from two different organisms
revealed a tentative consensus sequence AGAAT TTTATTCT (Q. Wang, M. Sacco, E.
Ricca, C.T. Lago, M. DeFelice, and J.M. Calvo, Mol. Microbiol. 7:883-891, 1993). 
To further characterize the binding specificity of Lrp, we used a variation of
the Selex procedure of C. Tuerk and L. Gold (Science 249:505-510, 1990) to
identify sequences that bound Lrp out of a pool of 10(12) different DNA
molecules. We identified 63 related DNA sequences that bound Lrp and estimated
their relative binding affinities for Lrp. A consensus sequence derived from
analysis of these sequences, YAGHAWATTWT DCTR, where Y = C or T, H = not G, W = A
or T, D = not C, and R = A or G, contains clear dyad symmetry and is very similar
to the one defined earlier. To test the idea that Lrp in the presence of leucine 
might bind to a different subset of DNA sequences, we carried out a second
selection experiment with leucine present during the binding reactions. DNA
sequences selected in the presence or absence of leucine were similar, and
leucine did not stimulate binding to any of the sequences that were selected in
the presence of leucine. Therefore, it is unlikely that leucine changes the
specificity of Lrp binding.


PMCID: PMC177260
PMID: 7665463  [Indexed for MEDLINE]


124. FASEB J. 1993 Jan;7(1):201-7.

Selective enrichment of RNA species for tight binding to Escherichia coli rho
factor.

Schneider D(1), Gold L, Platt T.

Author information: 
(1)Department of Molecular, Cellular, and Developmental Biology, University of
Colorado, Boulder 80309.

We have applied the SELEX procedure (systematic evolution of ligands by
exponential enrichment) to obtain RNA molecules that bind tightly to the
Escherichia coli transcription termination factor rho. The starting pool was a
population of RNA molecules 77 nucleotides (nt) long, in which was embedded a
cassette of 30 nt of randomized sequence. The apparent dissociation constant of
this RNA pool for hexameric rho factor was about 1 microM. After eight rounds of 
selection by filter binding, with RNA in either 10-fold or 40 to 100-fold excess 
at each step, the dissociation constant of the selected RNA had dropped by more
than 500-fold to about 1 nM. Analysis of 29 clonal isolates from the population
revealed that five had KDs substantially weaker than 10 nM (presumably background
carryover), 40% were C-rich (as might have been predicted from rho's known
substrate binding), and 40% had a strikingly preserved potential hairpin, in most
cases of 6 base pairs with a 3 nt CAA loop and preceded by a CCCCA consensus. The
rho-dependent trp t' terminator region includes a related potential hairpin
structure; however, it is energetically unfavorable. The implications of the
sequence findings for elucidating both static and dynamic aspects of rho factor
recognition and response to its RNA target site are discussed.


PMID: 7678562  [Indexed for MEDLINE]