29438366	 BACKGROUND: Colorectal cancer is a common cause of death in developed countries.  Progression from adenoma to invasive carcinoma requires accumulation of mutations starting with the Adenomatous Polyposis Coli (Apc) gene. NF-κB signalling is a key element in cancer, mainly related to the activity of IKKβ. IKKα kinase also participates in this process by mechanisms that are primarily unknown. METHODS: We generated a compound mouse model with mutation in Apc and lacking intestinal epithelial IKKα, produced intestinal organoids and tumour spheroids with different genetic backgrounds, and performed immunohistochemistry and RNA-seq analysis. RESULTS: Deficiency of IKKα prevents adenoma formation, with adenomas lacking IKKα showing reduced proliferation. In contrast, IKKα status did not affect normal intestinal function. The same divergent phenotype was found in the organoid-spheroid model. We also found that epithelial IKKα controls stemness, proliferation and apoptosis-related expression. CONCLUSIONS: IKKα is a potential therapeutic target for Apc mutant colorectal cancer patients. 
29305978	 Insect gut immunity plays a key role in defense against microorganism infection.  The knowledge of insect gut immunity has been obtained mostly from Drosophila melanogaster. Little is known about gut immunity in the diamondback moth, Plutella xylostella (L.), a pest destroying cruciferous crops worldwide. In this  study, expressions of the immune-related genes in the midgut of P. xylostella orally infected with Staphylococcus aureus, Escherichia coli and Pichia pastoris  were profiled by RNA-seq and qRT-PCR approaches. The results revealed that the Toll, IMD, JNK and JAK-STAT pathways and possibly the prophenoloxidase activation system in P. xylostella could be activated by oral infections, and moricins, gloverins and lysozyme2 might act as important effectors against microorganisms.  Subsequent knock-down of IMD showed that this gene was involved in regulating the expression of down-stream genes in the IMD pathway. Our work indicates that the Toll, IMD, JNK and JAK-STAT pathways may synergistically modulate immune responses in the P. xylostella midgut, implying a complex and diverse immune system in the midgut of insects. 
29448635	 In this paper, whole-bacteria SELEX (WB-SELEX) strategy was adopted to isolate specific aptamers against Vibrio parahaemolyticus. Round selection for V. parahaemolyticus was conducted 11 rounds, including two negative selection rounds. It was determined through real-time PCR amplification and post-SELEX experiment. The selected aptmers had high binding property and specificity to V.  parahaemolyticus. Of 28 aptamers tested, VPCA-apta#1 had the highest binding affinity compared to other aptamer candidates obtained. To detect V. parahaemolyticus, aptamer based SPR biosensor platform was constructed and pathogenic bacteria sensing was conducted in two steps. The first step was to construct 5'-biotinylated VPCA-apta#1 binding probe. The second step was to incubate V. parahaemolyticus and test microbes in functionalized SA sensor chip in parallel. Our platform showed significant activity for detecting and discriminating V. parahaemolyticus from other enteric species such as Escherichia coli, Listeria monocytogenes, Sigella sonnei, and Vibrio fischeri. This is the first report on the use of whole-SELEX to isolate DNA aptamers specific for V. parahaemolyticus. We demonstrated the feasibility of using aptamer platform for the detection of V. parahaemolyticus in various food supplies. It might be used in multiple points of care for diagnosing Vibriosis. 
29134255	 Escherichia coli and Staphylococcus epidermidis are predominant causes of neonatal sepsis, particularly affecting preterm infants. Susceptibility to infection has been attributed to "immature" innate monocyte defences, but no studies have assessed global transcriptional responses of neonatal monocytes to these pathogens. Here, we aimed to identify and characterise the neonatal monocyte transcriptional responses to E. coli and S. epidermidis and the role of  common modifiers such as gestational age (GA) and exposure to chorioamnionitis (a common complication of preterm birth) to better understand early life innate immune responses. RNA-sequencing was performed on purified cord blood monocytes from very preterm (< 32 weeks GA) and term infants (37-40 weeks GA) following standardised challenge with live S. epidermidis or E. coli. The major transcriptional changes induced by either pathogen were highly conserved between  infant groups and stimuli, highlighting a common extant neonatal monocyte response to infection, largely mediated by TLR/NF-κB/TREM-1 signalling. In addition, we observed an activated interferon-centred immune response specific to stimulation with E. coli in both preterm and term infants. These data provide novel insights into the functionality of neonatal monocytes at birth and highlight potential pathways that could be targeted to reduce the harmful effects of bacterial-induced inflammation in sepsis. E. coli and S. epidermidis elicit common transcriptional changes in cord monocytes. The common transcriptional response is mediated by TLR/NF-κB/TREM-1 signalling. IFN genes are differentially regulated by E. coli and S. epidermidis in monocytes. These responses are largely unaffected by GA or exposure to chorioamnionitis.KEY MESSAGES: E. coli and S. epidermidis elicit common transcriptional changes in cord monocytes. The common transcriptional response is mediated by TLR/NF-κB/TREM-1 signalling. IFN-genes are differentially regulated by E. coli and S. epidermidis in monocytes. These responses are largely unaffected by GA or exposure to chorioamnionitis. 
29242148	 The rapid detection of foodborne pathogens is critical to ensure food safety. The objective of this study is to select aptamers specifically bound to Escherichia coli O157:H7 using the whole-bacterium SELEX (Systematic Evolution of Ligands by  Exponential Enrichment) and apply the selected aptamer to a QCM (quartz crystal microbalance) sensor for rapid and sensitive detection of target bacteria. A total of 19 rounds of selection against live E. coli O157:H7 and 6 rounds of counter selection against a mixture of Staphylococcus aureus, Listeria monocytogenes, and Salmonella Typhimurium, were performed. The aptamer pool from  the last round was cloned and sequenced. One sequence S1 that appeared 16 times was characterized and a dissociation constant (Kd) of 10.30nM was obtained. Subsequently, a QCM aptasensor was developed for the rapid detection of E. coli O157:H7. The limit of detection (LOD) and the detection time of the aptasensor was determined to be 1.46×103 CFU/ml and 50min, respectively. This study demonstrated that the ssDNA aptamer selected by the whole-bacterium SELEX possessed higher sensitivity than previous work and the potential use of the constructed QCM aptasensor in rapid screening of foodborne pathogens. 
28782241	 Supernumerary teeth are teeth that are present in addition to normal teeth. Although several hypotheses and some molecular signalling pathways explain the formation of supernumerary teeth, but their exact disease pathogenesis is unknown. To study the molecular mechanisms of supernumerary tooth-related syndrome (Gardner syndrome), a deeper understanding of the aetiology of supernumerary teeth and the associated syndrome is needed, with the goal of inhibiting disease inheritance via prenatal diagnosis. We recruited a Chinese family with Gardner syndrome. Haematoxylin and eosin staining of supernumerary teeth and colonic polyp lesion biopsies revealed that these patients exhibited significant pathological characteristics. APC gene mutations were detected by PCR and direct sequencing. We revealed the pathological pathway involved in human supernumerary tooth development and the mouse tooth germ development expression profile by RNA sequencing (RNA-seq). Sequencing analysis revealed that an APC gene mutation in exon 15, namely 4292-4293-Del GA, caused Gardner syndrome in this family. This mutation not only initiated the various manifestations typical  of Gardner syndrome but also resulted in odontoma and supernumerary teeth in this case. Furthermore, RNA-seq analysis of human supernumerary teeth suggests that the APC gene is the key gene involved in the development of supernumerary teeth in humans. The mouse tooth germ development expression profile shows that the APC gene plays an important role in tooth germ development. We identified a new mutation in the APC gene that results in supernumerary teeth in association with  Gardner syndrome. This information may shed light on the molecular pathogenesis of supernumerary teeth. Gene-based diagnosis and gene therapy for supernumerary teeth may become available in the future, and our study provides a high-resolution reference for treating other syndromes associated with supernumerary teeth. 
28728009	 We report a novel fabrication method of functionalised Bridged Rebar Graphene (BRG) onto newly designed nanostructured aptasensor for label free impedimetric sensing of pathogenic bacteria E. coli O78:K80:H11. The chemical facilitated unscrolling of MWCNT and subsequent bridging with terephthalaldehyde (TPA) to form 3D-hierarchical BRG nanoconstruct exhibited synergistic effect by combining  enhanced electrical properties and facile chemical functionality for stable bio-interface. The bacteria-DNA interactions were captured on BRG nanostructured  electrode by using specific anti-E.coli DNA aptamer (Kd~ 14nM), screened by new in-situ developed SELEX method using phenylboronic acid on microtitre plate. The  developed nanostructured aptasensor demonstrated a low detection limit and sensitivity of ~ 101cfu/mL towards E. coli O78:K80:H11 with a dynamic response range from 101 to 106cfu/mL in water, juice and milk samples. 
29039494	 The hepatitis C virus (HCV) infection is associated with various extrahepatic manifestations, which are correlated with poor outcomes, and thus increase the morbidity and mortality of chronic hepatitis C (CHC). Therefore, understanding the internal linkages between systemic manifestations and HCV infection is helpful for treatment of CHC. Yet, the mechanism by which the virus evokes the systemic diseases remains to be elucidated. In the present study, using gene set  enrichment analysis (GSEA) and signaling pathway impact analysis (SPIA), a comprehensive analysis of microarray data of mRNAs was conducted in HCV-infected  and -uninfected Huh7.5 cells, and signaling pathways (which are significantly activated or inhibited) and certain molecules (which are commonly important in those signaling pathways) were selected. Forty signaling pathways were selected using GSEA, and eight signaling pathways were selected with SPIA. These pathways  are associated with cancer, metabolism, environmental information processing and  organismal systems, which provide important information for further clarifying the intrinsic associations between syndromes of HCV infection, of which seven pathways were not previously reported, including basal transcription factors, pathogenic Escherichia coli infection, shigellosis, gastric acid secretion, dorso-ventral axis formation, amoebiasis and cholinergic synapse. Ten genes, SOS1, RAF1, IFNA2, IFNG, MTHFR, IGF1, CALM3, UBE2B, TP53 and BMP7 whose expression may be the key internal driving molecules, were selected using the online tool Anni 2.1. Furthermore, the present study demonstrated the internal linkages between systemic manifestations and HCV infection, and presented the potential molecules that are key to those linkages. 
29025390	 BACKGROUND: DNA microarrays offer motivation and hope for the simultaneous study  of variations in multiple genes. Gene expression is a temporal process that allows variations in expression levels with a characterized gene function over a  period of time. Temporal gene expression curves can be treated as functional data since they are considered as independent realizations of a stochastic process. This process requires appropriate models to identify patterns of gene functions.  The partitioning of the functional data can find homogeneous subgroups of entities for the massive genes within the inherent biological networks. Therefor  it can be a useful technique for the analysis of time-course gene expression data. We propose a new self-consistent partitioning method of functional coefficients for individual expression profiles based on the orthonormal basis system. RESULTS: A principal points based functional partitioning method is proposed for  time-course gene expression data. The method explores the relationship between genes using Legendre coefficients as principal points to extract the features of  gene functions. Our proposed method provides high connectivity in connectedness after clustering for simulated data and finds a significant subsets of genes with the increased connectivity. Our approach has comparative advantages that fewer coefficients are used from the functional data and self-consistency of principal  points for partitioning. As real data applications, we are able to find partitioned genes through the gene expressions found in budding yeast data and Escherichia coli data. CONCLUSIONS: The proposed method benefitted from the use of principal points, dimension reduction, and choice of orthogonal basis system as well as provides appropriately connected genes in the resulting subsets. We illustrate our method  by applying with each set of cell-cycle-regulated time-course yeast genes and E.  coli genes. The proposed method is able to identify highly connected genes and to explore the complex dynamics of biological systems in functional genomics. 
29026081	 Numerous RNAs are enriched within cellular protrusions, but the underlying mechanisms are largely unknown. We had shown that the APC (adenomatous polyposis  coli) protein controls localization of some RNAs at protrusions. Here, using protrusion-isolation schemes and RNA-Seq, we find that RNAs localized in protrusions of migrating fibroblasts can be distinguished in two groups, which are differentially enriched in distinct types of protrusions, and are additionally differentially dependent on APC. APC-dependent RNAs become enriched  in high-contractility protrusions and, accordingly, their localization is promoted by increasing stiffness of the extracellular matrix. Dissecting the underlying mechanism, we show that actomyosin contractility activates a RhoA-mDia1 signaling pathway that leads to formation of a detyrosinated-microtubule network, which in turn is required for localization of  APC-dependent RNAs. Importantly, a competition-based approach to specifically mislocalize APC-dependent RNAs suggests that localization of the APC-dependent RNA subgroup is functionally important for cell migration.Adenomatous polyposis coli (APC) regulates the localization of some mRNAs at cellular protrusions but the underlying mechanisms and functional roles are not known. Here the authors show that APC-dependent RNAs are enriched in contractile protrusions, via detyrosinated microtubules, and enhance cell migration. 
28543037	 The ability to design and construct combinatorial synthetic metabolic pathways has far exceeded our capacity for efficient screening and selection of the resulting microbial strains. The need for high-throughput rapid screening techniques is of upmost importance for the future of synthetic biology and metabolic engineering. Here we describe the development of an RNA riboswitch-based biosensor module with dual fluorescent reporters, and demonstrate a high-throughput flow cytometry-based screening method for identification of naringenin over producing Escherichia coli strains in co-culture. Our efforts helped identify a number of key operating parameters that affect biosensor performance, including the selection of promoter and linker elements within the sensor-actuator domain, and the effect of host strain, fermentation time, and growth medium on sensor dynamic range. The resulting biosensor demonstrates a high correlation between specific fluorescence of the biosensor strain and naringenin titer produced by the second member of the synthetic co-culture system. This technique represents a novel application for synthetic microbial co-cultures and can be expanded from naringenin to any metabolite if a suitable riboswitch is identified. The co-culture technique presented here can be applied to a variety of target metabolites in combination with the SELEX approach for aptamer design. Due to the compartmentalization of the two genetic constructs responsible for production and detection into separate cells and application as independent modules of a synthetic microbial co-culture  we have subsequently reduced the need for re-optimization of the producer module  when the biosensor is replaced or removed. Biotechnol. Bioeng. 2017;114: 2235-2244. © 2017 Wiley Periodicals, Inc. 
28381114	 We assessed the ability of a commercial DNA microarray to characterize bovine Shiga toxin-producing Escherichia coli (STEC) isolates and evaluated the results  using in silico hybridization of the microarray probes within whole genome sequencing scaffolds. From a total of 69,954 reactions (393 probes with 178 isolates), 68,706 (98.2%) gave identical results by DNA microarray and in silico  probe hybridization. Results were more congruent when detecting the genoserotype  (209 differing results from 19,758 in total; 1.1%) or antimicrobial resistance genes (AMRGs; 141 of 26,878; 0.5%) than when detecting virulence-associated genes (VAGs; 876 of 22,072; 4.0%). Owing to the limited coverage of O-antigens by the microarray, only 37.2% of the isolates could be genoserotyped. However, the microarray proved suitable to rapidly screen bovine STEC strains for the occurrence of high numbers of VAGs and AMRGs and is suitable for molecular surveillance workflows. 
28774270	 BACKGROUND: Enterohemorrhagic Escherichia coli (EHEC) are zoonotic agents associated with outbreaks worldwide. Growth of EHEC strains in ground beef could  be inhibited by background microbiota that is present initially at levels greater than that of the pathogen E. coli. However, how the microbiota outcompetes the pathogenic bacteria is unknown. Our objective was to identify metabolic pathways  of EHEC that were altered by natural microbiota in order to improve our understanding of the mechanisms controlling the growth and survival of EHECs in ground beef. RESULTS: Based on 16S metagenomics analysis, we identified the microbial community structure in our beef samples which was an essential preliminary for subtractively analyzing the gene expression of the EHEC strains. Then, we applied strand-specific RNA-seq to investigate the effects of this microbiota on the global gene expression of EHEC O2621765 and O157EDL933 strains by comparison with their behavior in beef meat without microbiota. In strain O2621765, the expression of genes connected with nitrate metabolism and nitrite detoxification, DNA repair, iron and nickel acquisition and carbohydrate metabolism, and numerous genes involved in amino acid metabolism were down-regulated. Further, the observed repression of ftsL and murF, involved respectively in building the cytokinetic ring apparatus and in synthesizing the cytoplasmic precursor of cell  wall peptidoglycan, might help to explain the microbiota's inhibitory effect on EHECs. For strain O157EDL933, the induced expression of the genes implicated in detoxification and the general stress response and the repressed expression of the peR gene, a gene negatively associated with the virulence phenotype, might be linked to the survival and virulence of O157:H7 in ground beef with microbiota. CONCLUSION: In the present study, we show how RNA-Seq coupled with a 16S metagenomics analysis can be used to identify the effects of a complex microbial  community on relevant functions of an individual microbe within it. These findings add to our understanding of the behavior of EHECs in ground beef. By measuring transcriptional responses of EHEC, we could identify putative targets which may be useful to develop new strategies to limit their shedding in ground meat thus reducing the risk of human illnesses. 
28766584	 Enteropathogenic Escherichia coli (EPEC) bacteria are a diverse group of pathogens that cause moderate to severe diarrhea in young children in developing  countries. EPEC isolates can be further subclassified as typical EPEC (tEPEC) isolates that contain the bundle-forming pilus (BFP) or as atypical EPEC (aEPEC)  isolates that do not contain BFP. Comparative genomics studies have recently highlighted the considerable genomic diversity among EPEC isolates. In the current study, we used RNA sequencing (RNA-Seq) to characterize the global transcriptomes of eight tEPEC isolates representing the identified genomic diversity, as well as one aEPEC isolate. The global transcriptomes were determined for the EPEC isolates under conditions of laboratory growth that are known to induce expression of virulence-associated genes. The findings demonstrate that unique genes of EPEC isolates from diverse phylogenomic lineages contribute to variation in their global transcriptomes. There were also phylogroup-specific differences in the global transcriptomes, including genes involved in iron acquisition, which had significant differential expression in the EPEC isolates belonging to phylogroup B2. Also, three EPEC isolates from the  same phylogenomic lineage (EPEC8) had greater levels of similarity in their genomic content and exhibited greater similarities in their global transcriptomes than EPEC from other lineages; however, even among closely related isolates there were isolate-specific differences among their transcriptomes. These findings highlight the transcriptional variability that correlates with the previously unappreciated genomic diversity of EPEC. IMPORTANCE Recent studies have demonstrated that there is considerable genomic diversity among EPEC isolates; however, it is unknown if this genomic diversity leads to differences in their global transcription. This study used RNA-Seq to compare the global transcriptomes of EPEC isolates from diverse phylogenomic lineages. We demonstrate that there are lineage- and isolate-specific differences in the transcriptomes of genomically diverse EPEC isolates during growth under in vitro  virulence-inducing conditions. This study addressed biological variation among isolates of a single pathovar in an effort to demonstrate that while each of these isolates is considered an EPEC isolate, there is significant transcriptional diversity among members of this pathovar. Future studies should consider whether this previously undescribed transcriptional variation may play a significant role in isolate-specific variability of EPEC clinical presentations. 
28505584	 Bacterial foodborne diseases remain major threats to food safety and public health, especially in developing countries. In this study a novel assay, combining gold nanoparticle (GNP)-based multiplex oligonucleotide ligation-PCR and universal oligonucleotide microarray technology, was developed for inexpensive, specific, sensitive, and multiplex detection of eight common foodborne pathogens, including Shigella spp., Campylobacter jejuni, Bacillus cereus, Escherichia coli O157:H7, Listeria monocytogenes, Salmonella enterica, Staphylococcus aureus, and Vibrio parahaemolyticus. The target fragments of the eight pathogens were enriched by multiplex PCR and subjected to multiplex ligase  detection reaction. Ligation products were enriched and labeled with GNPs by universal asymmetric PCR, using excess GNP-conjugated primers. The labeled single-stranded amplicons containing complementary tag sequences were captured by the corresponding tag sequences immobilized on microarrays, followed by silver staining for signal enhancement. Black images of microarray spots were visualized by naked eyes or scanned on a simple flatbed scanner, and quantified. The results indicated that this assay could unambiguously discriminate all eight pathogens in single and multiple infections, with detection sensitivity of 3.3-85CFU/mL for pure cultures. Microarray results of ninety-five artificially contaminated and retail food samples were consistent with traditional culture, biochemical and real-time PCR findings. Therefore, the novel assay has the potential to be used for routine detection due to rapidity, low cost, and high specificity and sensitivity. 
28671252	 Glycosphingolipid biosynthesis-globo series pathway genes (FUT1, FUT2, ST3GAL1, HEXA, HEXB, B3GALNT1, and NAGA) play an important regulatory role in the defense  against Escherichia coli F18 in piglets. In this study, we identified the transcription initiation site and promoter of this gene cluster by mined previous RNA-seq results using bioinformatics tools. The FUT1 transcription initiation region included five alternative splicing sites and two promoter regions, whereas each of the six other genes had one promoter. Dual luciferase reporter results revealed significantly higher transcriptional activity by FUT1 promoter 2, indicating that it played a more important role in transcription. The promoters of glycosphingolipid biosynthesis genes identified contained a CpG island within  the first 500 bp, except for the B3GALNT1 promoter which included fewer CpG sites. These results provide a deeper insight into methylation and the regulatory mechanisms of glycosphingolipid biosynthesis-globo series pathway genes in piglets. 
28252945	 A promoter is one of the most important and basic tools used to achieve diverse synthetic biology goals. Escherichia coli is one of the most commonly used model  organisms in synthetic biology to produce useful target products and establish complicated regulation networks. During the fine-tuning of metabolic or regulation networks, the limited number of well-characterized inducible promoters has made implementing complicated strategies difficult. In this study, 104 native promoter-5'-UTR complexes (PUTR) from E. coli were screened and characterized based on a series of RNA-seq data. The strength of the 104 PUTRs varied from 0.007% to 4630% of that of the PBAD promoter in the transcriptional level and from 0.1% to 137% in the translational level. To further upregulate gene expression, a series of combinatorial PUTRs and cascade PUTRs were constructed by integrating strong transcriptional promoters with strong translational 5'-UTRs. Finally, two combinatorial PUTRs (PssrA-UTRrpsT and PdnaKJ-UTRrpsT) and two cascade PUTRs (PUTRssrA-PUTRinfC-rplT and PUTRalsRBACE-PUTRinfC-rplT) were identified as having the highest activity, with expression outputs of 170%, 137%, 409%, and 203% of that of the PBAD promoter, respectively. These engineered PUTRs are stable for the expression of different genes, such as the red fluorescence protein gene and the β-galactosidase gene. These results show that the PUTRs characterized and constructed in this study may be useful as a plug-and-play synthetic biology toolbox to achieve complicated metabolic engineering goals in fine-tuning metabolic networks to produce target products. 
28622510	 Homeostasis of the gut microbiota critically influences host health and aging. Developing genetically engineered probiotics holds great promise as a new therapeutic paradigm to promote healthy aging. Here, through screening 3,983 Escherichia coli mutants, we discovered that 29 bacterial genes, when deleted, increase longevity in the host Caenorhabditis elegans. A dozen of these bacterial mutants also protect the host from age-related progression of tumor growth and amyloid-beta accumulation. Mechanistically, we discovered that five bacterial mutants promote longevity through increased secretion of the polysaccharide colanic acid (CA), which regulates mitochondrial dynamics and unfolded protein response (UPRmt) in the host. Purified CA polymers are sufficient to promote longevity via ATFS-1, the host UPRmt-responsive transcription factor. Furthermore, the mitochondrial changes and longevity effects induced by CA are conserved across different species. Together, our results identified molecular targets for developing pro-longevity microbes and a bacterial metabolite acting on host mitochondria to promote longevity. 
28513559	 In this paper, a Whole-Bacteria SELEX (WB-SELEX) strategy was adopted to isolate  specific aptamers against Shigella sonnei. Real-time PCR amplification and post-SELEX experiment revealed that the selected aptmers possessed a high binding affinity and specificity for S. sonnei. Of the 21 aptamers tested, the C(t) values of the SS-3 and SS-4 aptamers (Ct = 13.89 and Ct = 12.23, respectively) had the lowest value compared to other aptamer candidates. The SS-3 and SS-4 aptamers also displayed a binding affinity (KD) of 39.32 ± 5.02 nM and 15.89 ± 1.77 nM, respectively. An aptamer-based fluorescent biosensor assay was designed  to detect and discriminate S. sonnei cells using a sandwich complex pair of SS-3  and SS-4. The detection of S. sonnei by the aptamer based fluorescent biosensor platform consisted of three elements: (1) 5'amine-SS-4 modification in a 96-well  type microtiter plate surface (N-oxysuccinimide, NOS) as capture probes; (2) the  incubation with S. sonnei and test microbes in functionalized 96 assay wells in parallel; (3) the readout of fluorescent activity using a Cy5-labeled SS-3 aptamer as the detector. Our platform showed a significant ability to detect and  discriminate S. sonnei from other enteric species such as E. coli, Salmonella typhimurium and other Shigella species (S. flexneri, S. boydii). In this study, we demonstrated the feasibility of an aptamer sensor platform to detect S. sonnei in a variety of foods and pave the way for its use in diagnosing shigellosis through multiple, portable designs. 
28069431	 Drosophila have served as a model for research on innate immunity for decades. However, knowledge of the post-transcriptional regulation of immune gene expression by microRNAs (miRNAs) remains rudimentary. In the present study, using small RNA-seq and bioinformatics analysis, we identified 67 differentially expressed miRNAs in Drosophila infected with Escherichia coli compared to injured flies at three time-points. Furthermore, we found that 21 of these miRNAs were potentially involved in the regulation of Imd pathway-related genes. Strikingly,  based on UAS-miRNAs line screening and Dual-luciferase assay, we identified that  miR-9a and miR-981 could both negatively regulate Drosophila antibacterial defenses and decrease the level of the antibacterial peptide, Diptericin. Taken together, these data support the involvement of miRNAs in the regulation of the Drosophila Imd pathway. 
28406080	 Expression of the major biofilm components of E. coli, curli fimbriae and cellulose, requires the CsgD transcription factor. A complex regulatory network allows environmental control of csgD transcription and biofilm formation. However, most clinical serotype O157 : H7 strains contain prophage insertions in  the csgD regulator, mlrA, or mutations in other regulators that restrict csgD expression. These barriers can be circumvented by certain compensating mutations  that restore higher csgD expression. One mechanism is via csgD promoter mutations that switch sigma factor utilization. Biofilm-forming variants utilizing RpoD rather than RpoS have been identified in glycerol freezer stocks of the non-biofilm-forming food-borne outbreak strain, ATCC 43894. In this study we used whole genome sequencing and RNA-seq to study genotypic and transcriptomic differences between those strains. In addition to defining the consequences of the csgD promoter switch and identifying new csgD-controlled genes, we discovered a region of genome amplification in our laboratory stock of 43894 (designated 43894OW) that contributed to the regulation of csgD-dependent properties. 
28301469	 Terminating protein translation accurately and efficiently is critical for both protein fidelity and ribosome recycling for continued translation. The three bacterial release factors (RFs) play key roles: RF1 and 2 recognize stop codons and terminate translation; and RF3 promotes disassociation of bound release factors. Probing release factors mutations with reporter constructs containing programmed frameshifting sequences or premature stop codons had revealed a propensity for readthrough or frameshifting at these specific sites, but their effects on translation genome-wide have not been examined. We performed ribosome  profiling on a set of isogenic strains with well-characterized release factor mutations to determine how they alter translation globally. Consistent with their known defects, strains with increasingly severe release factor defects exhibit increasingly severe accumulation of ribosomes over stop codons, indicative of an  increased duration of the termination/release phase of translation. Release factor mutant strains also exhibit increased occupancy in the region following the stop codon at a significant number of genes. Our global analysis revealed that, as expected, translation termination is generally efficient and accurate, but that at a significant number of genes (≥ 50) the ribosome signature after the stop codon is suggestive of translation past the stop codon. Even native E. coli  K-12 exhibits the ribosome signature suggestive of protein extension, especially  at UGA codons, which rely exclusively on the reduced function RF2 variant of the  K-12 strain for termination. Deletion of RF3 increases the severity of the defect. We unambiguously demonstrate readthrough and frameshifting protein extensions and their further accumulation in mutant strains for a few select cases. In addition to enhancing recoding, ribosome accumulation over stop codons  disrupts attenuation control of biosynthetic operons, and may alter expression of some overlapping genes. Together, these functional alterations may either augment the protein repertoire or produce deleterious proteins. 
28266571	 A transcription unit (TU) consists of K ≥ 1consecutive genes on the same strand of a bacterial genome that are transcribed into a single mRNA molecule under certain conditions. Their identification is an essential step in elucidation of transcriptional regulatory networks. We have recently developed a machine-learning method to accurately identify TUs from RNA-seq data, based on two features of the assembled RNA reads: the continuity and stability of RNA-seq  coverage across a genomic region. While good performance was achieved by the method on Escherichia coli and Clostridium thermocellum, substantial work is needed to make the program generally applicable to all bacteria, knowing that the program requires organism specific information. A web server, named SeqTU, was developed to automatically identify TUs with given RNA-seq data of any bacterium  using a machine-learning approach. The server consists of a number of utility tools, in addition to TU identification, such as data preparation, data quality check and RNA-read mapping. SeqTU provides a user-friendly interface and automated prediction of TUs from given RNA-seq data. The predicted TUs are displayed intuitively using HTML format along with a graphic visualization of the prediction. 
27826737	 Disease problems cause major economic losses for the aquaculture industries. In catfish, enteric septicemia of catfish (ESC), caused by the bacterial pathogen Edwardsiella ictaluri, is the leading disease problem, causing tens of millions of dollars of annual economic losses. In this study, we conducted a genome-wide association study to determine quantitative trait loci (QTL) for resistance against ESC using an interspecific hybrid system. Five hundred fish were used in  the analysis and 192 phenotypic extremes were used for genotyping with the catfish 250K SNP arrays. A genomic region on linkage group (LG) 1 was found significantly associated with ESC disease resistance. In addition, two suggestively associated QTL for ESC resistance were identified on LG 12 and LG 16. The nlrc3 duplicates were identified within all the three QTL, suggesting  their importance in association with the QTL. Within the significant QTL on LG 1, 16 genes with known functions in immunity were identified. Of particular interest is the nck1 gene nearby the most significantly associated SNP. Nck1 was known to  function as an adaptor to facilitating the pathogenesis of enteropathogenic Escherichia coli (EPEC) in humans. E. ictaluri and EPEC pathogens belong to the same bacterial family and share many common characteristics. The fact that nck1 is mapped in the QTL and that it was significantly upregulated in channel catfish intestine after ESC challenge suggested its candidacy of being involved in resistance/susceptibility of ESC. 
28110781	 Resistance to antimicrobials, in particular that mediated by extended spectrum β-lactamases (ESBL) and AmpC β-lactamases are frequently reported in bacteria causing canine disease as well as in commensal bacteria, which could be a potential health risk for humans they come into contact with. This cross-sectional study aimed to estimate the prevalence and investigate the molecular characteristics of ESBL and plasmid encoded AmpC (pAmpC)-producing E. coli in the mainland UK vet-visiting canine population and, using responses from  detailed questionnaires identify factors associated with their carriage. Faecal samples were cultured for antimicrobial resistant (AMR), ESBL and pAmpC-producing E. coli. A subset of ESBL and pAmpC-producing isolates were subjected to multi-locus sequence typing and DNA microarray analyses. Multivariable logistic regression analysis was used to construct models to identify risk factors associated with multidrug resistant (MDR, resistance to three or more antimicrobial classes), fluoroquinolone resistant, ESBL and AmpC-producing E. coli. AMR E.coli were isolated from 44.8% (n=260) of samples, with 1.9% and 7.1%  of samples carrying ESBL and pAmpC-producing E. coli, respectively. MDR E. coli were identified in 18.3% of samples. Recent use of antimicrobials and being fed raw poultry were both identified as risk factors in the outcomes investigated. A  number of virulence and resistance genes were identified, including genes associated with extra-intestinal and enteropathogenic E. coli genotypes. Considering the close contact that people have with dogs, the high levels of AMR  E. coli in canine faeces may be a potential reservoir of AMR bacteria or resistance determinants. 
28094291	 Vitamin A and vitamin D are essential nutrients with a wide range of pleiotropic  effects in humans. Beyond their well-documented roles in cellular differentiation, embryogenesis, tissue maintenance and bone/calcium homeostasis,  both vitamins have attracted considerable attention due to their association with-immunological traits. Nevertheless, our knowledge of their immunomodulatory  potential during infection is restricted to single gene-centric studies, which do not reflect the complexity of immune processes. In the present study, we performed a comprehensive RNA-seq-based approach to define the whole immunomodulatory role of vitamins A and D during infection. Using human monocytes as host cells, we characterized the differential role of both vitamins upon infection with three different pathogens: Aspergillus fumigatus, Candida albicans and Escherichia coli. Both vitamins showed an unexpected ability to counteract the pathogen-induced transcriptional responses. Upon infection, we identified 346 and 176 immune-relevant genes that were regulated by atRA and vitD, respectively. This immunomodulatory activity was dependent on the inflammatory stimulus, allowing us to distinguish regulatory patterns which were specific for each stimulatory setting. Moreover, we explored possible direct and indirect mechanisms of vitamin-mediated regulation of the immune response. Our findings highlight the importance of vitamin-monitoring in critically ill patients. Moreover, our results underpin the potential of atRA and vitD as therapeutic options for anti-inflammatory treatment. 
27873258	 Author information:  (1)Quantitative Biology Center, RIKEN, 6-2-3 Furuedai, Suita, Osaka, 565-0874, Japan. (2)Quantitative Biology Center, RIKEN, 6-2-3 Furuedai, Suita, Osaka, 565-0874, Japan. chikara.furusawa@riken.jp. 
28003017	 BACKGROUND: Enterohaemorrhagic Escherichia coli (EHEC), like E. coli O157:H7 are  frequently detected in bovine faecal samples at slaughter. Cattle do not show clinical symptoms upon infection, but for humans the consequences after consuming contaminated beef can be severe. The immune response against EHEC in cattle cannot always clear the infection as persistent colonization and shedding in infected animals over a period of months often occurs. In previous infection trials, we observed a primary immune response after infection which was unable to protect cattle from re-infection. These results may reflect a suppression of certain immune pathways, making cattle more prone to persistent colonization after re-infection. To test this, RNA-Seq was used for transcriptome analysis of  recto-anal junction tissue and ileal Peyer's patches in nine Holstein-Friesian calves in response to a primary and secondary Escherichia coli O157:H7 infection  with the Shiga toxin (Stx) negative NCTC12900 strain. Non-infected calves served  as controls. RESULTS: In tissue of the recto-anal junction, only 15 genes were found to be significantly affected by a first infection compared to 1159 genes in the ileal Peyer's patches. Whereas, re-infection significantly changed the expression of 10 and 17 genes in the recto-anal junction tissue and the Peyer's patches, respectively. A significant downregulation of 69 immunostimulatory genes and a significant upregulation of seven immune suppressing genes was observed. CONCLUSIONS: Although the recto-anal junction is a major site of colonization, this area does not seem to be modulated upon infection to the same extent as ileal Peyer's patches as the changes in gene expression were remarkably higher in the ileal Peyer's patches than in the recto-anal junction during a primary but not a secondary infection. We can conclude that the main effect on the transcriptome was immunosuppression by E. coli O157:H7 (Stx-) due to an upregulation of immune suppressive effects (7/12 genes) or a downregulation of immunostimulatory effects (69/94 genes) in the ileal Peyer's patches. These data  might indicate that a primary infection promotes a re-infection with EHEC by suppressing the immune function. 
27871171	 Escherichia coli are important indicator organisms, used routinely for the monitoring of water and food safety. For quick, sensitive and real-time detection of E. coli we developed a 2'F modified RNA aptamer Ec3, by Cell-SELEX. The 31 nucleotide truncated Ec3 demonstrated improved binding and low nano-molar affinity to E. coli. The aptamer developed by us out-performs the commercial antibody and aptamer used for E. coli detection. Ec3(31) aptamer based E. coli detection was done using three different detection formats and the assay sensitivities were determined. Conventional Ec3(31)-biotin-streptavidin magnetic  separation could detect E. coli with a limit of detection of 1.3 × 106 CFU/ml. Although, optical analytic technique, biolayer interferometry, did not improve the sensitivity of detection for whole cells, a very significant improvement in the detection was seen with the E. coli cell lysate (5 × 104 CFU/ml). Finally we  developed Electrochemical Impedance Spectroscopy (EIS) gap capacitance biosensor  that has detection limits of 2 × 104 CFU/mL of E. coli cells, without any labeling and signal amplification techniques. We believe that our developed method can step towards more complex and real sample application. 
27569534	 Avian pathogenic Escherichia coli (APEC) cause typical extraintestinal infections in poultry, including acute fatal septicemia, subacute pericarditis, and airsacculitis. These bacteria most often infect chickens, turkeys, ducks, and other avian species, and therefore pose a significant economic burden on the poultry industry worldwide. Few studies have analyzed the genome-wide transcriptional profile of APEC during infection in vivo. In this study, we examined the genome-wide transcriptional response of APEC O2 strain E058 in an in vivo chicken infection model to better understand the factors necessary for APEC colonization, growth, and survival in vivo. An Affymetrix multigenome DNA microarray, which contains most of the genomic open reading frames of E. coli K-12 strain MG1655, uropathogenic E. coli strain CFT073, and E. coli O157:H7 strain EDL 933, was used to profile the gene expression in APEC E058. We identified the in vivo transcriptional response of APEC E058 bacteria collected directly from the blood of infected chickens. Significant differences in expression levels were detected between the in vivo expression profile and the in vitro expression profile in LB medium. The genes highly expressed during infection were involved in metabolism, iron acquisition or transport, virulence,  response to stress, and biological regulation. The reliability of the microarray  data was confirmed by performing quantitative real-time PCR on 12 representative  genes. Moreover, several significantly upregulated genes, including yjiY, sodA, phoB and spy, were selected to study their role in APEC pathogenesis. The data will help to better understand the mechanisms of APEC pathogenesis. 
27663028	 Surface layers, or S-layers, are two-dimensional protein arrays that form the outermost layer of many bacteria and archaea. They serve several functions including physical protection of the cell from environmental threats. The high abundance of S-layer proteins necessitates a highly efficient export mechanism to transport S-layer protein from the cytoplasm to the cell exterior. Caulobacter crescentus is unique in that it has two homologous, seemingly redundant outer membrane proteins, RsaFa and RsaFb, that, together with other components, form a  type I protein translocation pathway for S-layer export. These proteins have homology to E. coli TolC, the outer membrane channel of multidrug efflux pumps. Here we provide evidence that, unlike TolC, RsaFa and RsaFb are not involved in either the maintenance of membrane stability or the active export of antimicrobial compounds. Rather, RsaFa and RsaFb are required to prevent intracellular accumulation and aggregation of the S-layer protein RsaA; deletion  of RsaFa and RsaFb led to a general growth defect and lowered cellular fitness. Using Western blotting, transmission electron microscopy, and RNA-seq, we show that loss of both RsaFa and RsaFb led to accumulation of insoluble RsaA in the cytoplasm, which in turn caused upregulation of a number of genes involved in protein mis-folding and degradation pathways. These findings provide new insight  into the requirement for RsaFa and RsaFb in cellular fitness and tolerance to antimicrobial agents and further our understanding of the S-layer export mechanism on both the transcriptional and translational levels in C. crescentus IMPORTANCE: Decreased growth rate and reduced cell fitness are common side effects of protein production in overexpression systems. Inclusion bodies typically form inside the cell largely due to lack of sufficient export machinery to transport the overexpressed proteins to the extracellular environment. This phenomenon can conceivably also occur in natural systems. As one example of a system evolved to prevent intracellular protein accumulation, our study demonstrates that Caulobacter crescentus has two homologous outer membrane transporter proteins that are involved in S-layer export. This is an interesting  case study that demonstrates how bacteria can evolve redundancy to ensure adequate protein export functionality and maintain high cellular fitness. Moreover, we provide evidence that these two outer membrane proteins, although being the closest C. crescentus homologs to TolC in E. coli, do not process TolC  functionality in C. crescentus. 
27276114	 Fish are a representative population of lower vertebrates that serve as an essential link to early vertebrate evolution, and this has fueled academic interest in studying ancient vertebrate immune defense mechanisms in teleosts. Notothenia coriiceps, a typical Antarctic notothenioid teleost, has evolved to adapt to the cold and thermally stable Antarctic sea. In this study, we examined  adaptive signaling pathways and immune responses to bacterial and viral pathogenic exposure in N. coriiceps. Using RNA sequencing, we investigated transcriptional differences in the liver tissues of N. coriiceps challenged with  two pathogen-mimicking agonists, a bacterial ligand (heat-killed Escherichia coli, HKEB) and a viral ligand (polyinosinic:polycytidylic acid, Poly I:C). We found that 567 unique genes were up-regulated two-fold in the HKEB-exposed group, whereas 392 unique genes, including 124 immune-relevant genes, were up-regulated  two-fold in the Poly I:C-exposed group. A KEGG pathway analysis of the 124 immune-relevant genes revealed that they exhibited major features of antigen processing and presentation bacterial ligand exposure, but they were down-regulated after viral ligand exposure. A quantitative real time RT-PCR analysis revealed that TNFα and TNF2, major inducers of apoptosis, were highly up-regulated after exposure to the viral ligand but not the bacterial ligand. The results suggest that the bacterial and viral ligands up-regulate inducers of different immune mechanisms in N. coriiceps liver tissue. N. coriiceps has an immune response defense strategy that uses antigen presentation against bacterial infection, but it may use a different defense, such as TNF-mediated apoptosis, against viral infection. The specific immune responses of N. coriiceps may be adaptations to the Antarctic environment and pathogens. These results will help define the characteristics of Antarctic fish and increase our understanding of their immune response mechanisms. 
25749054	 Generally, the enumeration and isolation of food-borne pathogens is performed using culture-dependent methods. These methods are sensitive, inexpensive, and provide both qualitative and quantitative assessment of the microorganisms present in a sample, but these are time-consuming. For this reason, researchers are developing new techniques that allow detection of food pathogens in shorter period of time. This review identifies commercially available methods for rapid detection and quantification of Listeria monocytogenes, Salmonella spp., Staphylococcus aureus, and Shiga toxin-producing Escherichia coli in food samples. Three categories are discussed: immunologically based methods, nucleic acid-based assays, and biosensors. This review describes the basic mechanism and  capabilities of each method, discusses the difficulties of choosing the most convenient method, and provides an overview of the future challenges for the technology for rapid detection of microorganisms. 
26976906	 Due to an interplay between intestinal microbiota and immune system, disruption of intestinal microbiota composition during immune development may have consequences for immune responses later in life. The present study investigated the effects of antibiotic treatment in the first weeks of life on the specific antibody response later in life in chickens. Layer chicks received an antibiotic  cocktail consisting of vancomycin, neomycin, metronidazole, and amphotericin-B by oral gavage every 12 h, and ampicillin and colistin in drinking water for the first week of life. After the first week of life, chicks received ampicillin and  colistin in drinking water for two more weeks. Control birds received no antibiotic cocktail and plain drinking water. Fecal microbiota composition was determined during antibiotic treatment (d 8 and 22), two weeks after cessation of antibiotic treatment (d 36), and at the end of the experimental period at d 175 using a 16S ribosomal RNA gene targeted microarray, the Chicken Intestinal Tract  Chip (ChickChip). During antibiotic treatment fecal microbiota composition differed strongly between treatment groups. Fecal microbiota of antibiotic treated birds consisted mainly of Proteobacteria, and in particular E.coli, whereas fecal microbiota of control birds consisted mainly of Firmicutes, such as lactobacilli and clostridia. Two weeks after cessation of antibiotic treatment fecal microbiota composition of antibiotic treated birds had recovered and was similar to that of control birds. On d 105, 12 weeks after cessation of antibiotic treatment, chicks of both treatment groups received an intra-tracheal  lipopolysaccharide (LPS)/human serum albumin (HuSA) challenge. Antibody titers against LPS and HuSA were measured 10 days after administration of the challenge. While T cell independent antibody titers (LPS) were not affected by antibiotic treatment, antibiotic treated birds showed lower T cell dependent antibody titers (HuSA) compared with control birds. In conclusion, intestinal microbial dysbiosis early in life may still have effects on the specific antibody response months after cessation of antibiotic treatment and despite an apparent recovery in microbiota composition. 
27021322	 Multidrug-resistant (MDR) Enterobacteriaceae infections are increasing in U.S. children; however, there is a paucity of multicentered analyses of antibiotic resistance genes responsible for MDR phenotypes among pediatric Enterobacteriaceae isolates. In this study, 225 isolates phenotypically identified as extended-spectrum β-lactamase (ESBL) or carbapenemase producers, recovered from children ages 0 to 18 years hospitalized between January 2011 and  April 2015 at three Chicago area hospitals, were analyzed. We used DNA microarray platforms to detect ESBL, plasmid-mediated AmpC (pAmpC), and carbapenemase type β-lactamase (bla) genes. Repetitive-sequence-based PCR and multilocus sequence typing (MLST) were performed to assess isolate similarity. Plasmid replicon typing was conducted to classify plasmids. The median patient age was 4.2 years,  56% were female, and 44% presented in the outpatient setting. The majority (60.9%) of isolates were Escherichia coli and from urinary sources (69.8%). Of 225 isolates exhibiting ESBL- or carbapenemase-producing phenotypes, 90.7% contained a bla gene. The most common genotype was the blaCTX-M-1 group (49.8%);  1.8% were carbapenem-resistant Enterobacteriaceae (three blaKPC and one blaIMP).  Overall, pAmpC (blaACT/MIR and blaCMY) were present in 14.2%. The predominant E.  coli phylogenetic group was the virulent B2 group (67.6%) associated with ST43/ST131 (Pasteur/Achtman MLST scheme) containing the blaCTX-M-1 group (84%), and plasmid replicon types FIA, FII, and FIB. K. pneumoniae harboring blaKPC were non-ST258 with replicon types I1 and A/C. Enterobacter spp. carrying blaACT/MIR contained plasmid replicon FIIA. We found that β-lactam resistance in children is diverse and that certain resistance mechanisms differ from known circulating genotypes in adults in an endemic area. The potential impact of complex molecular types and the silent dissemination of MDR Enterobacteriaceae in a vulnerable population needs to be studied further. 
27216622	 BACKGROUND: The evolution of novel genes is thought to be a critical component of morphological innovation but few studies have explicitly examined the contribution of novel genes to the evolution of novel tissues. Nematosomes, the free-floating cellular masses that circulate through the body cavity of the sea anemone Nematostella vectensis, are the defining apomorphy of the genus Nematostella and are a useful model for understanding the evolution of novel tissues. Although many hypotheses have been proposed, the function of nematosomes is unknown. To gain insight into their putative function and to test hypotheses about the role of lineage-specific genes in the evolution of novel structures, we have re-examined the cellular and molecular biology of nematosomes. RESULTS: Using behavioral assays, we demonstrate that nematosomes are capable of  immobilizing live brine shrimp (Artemia salina) by discharging their abundant cnidocytes. Additionally, the ability of nematosomes to engulf fluorescently labeled bacteria (E. coli) reveals the presence of phagocytes in this tissue. Using RNA-Seq, we show that the gene expression profile of nematosomes is distinct from that of the tentacles and the mesenteries (their tissue of origin)  and, further, that nematosomes (a Nematostella-specific tissue) are enriched in Nematostella-specific genes. CONCLUSIONS: Despite the small number of cell types they contain, nematosomes are distinct among tissues, both functionally and molecularly. We provide the first evidence that nematosomes comprise part of the innate immune system in N. vectensis, and suggest that this tissue is potentially an important place to look for genes associated with pathogen stress. Finally, we demonstrate that Nematostella-specific genes comprise a significant proportion of the differentially expressed genes in all three of the tissues we examined and may play an important role in novel cell functions. 
27242742	 Extraintestinal pathogenic Escherichia coli (ExPEC) causes a variety of acute infections in its hosts, and multidrug-resistant strains present significant challenges to public health and animal husbandry. Therefore, it is necessary to explore new drug targets to control E. coli epidemics. Previous studies have reported that ppk mutants of Burkholderia pseudomallei and Mycobacterium tuberculosis are more susceptible than the wild types (WTs) to stress. Therefore, we investigated the stress response to antibiotics mediated by polyphosphate kinase (PPK) in ExPEC strain PCN033. We observed that planktonic cells of a ppk knockout strain (Δppk) were more susceptible to antibiotics than was WT. However, biofilm-grown Δppk cells showed similar susceptibility to that of the WT and were more tolerant than the planktonic cells. During the planktonic lifestyle, the expression of genes involved in antibiotic tolerance (including resistance-conferring genes, and antibiotic influx, and efflux genes) did not change in the Δppk mutant without antibiotic treatment. However, the resistance-conferring gene bla and efflux genes were upregulated more in the WT than in the Δppk mutant by treatment with tazobactam. After treatment with gentamycin, the efflux genes and influx genes were upregulated and downregulated, respectively, more in the WT than in the Δppk mutant. The expression of genes involved in biofilm regulation also changed after treatment with tazobactam or gentamycin, and which is consistent with the results of the biofilm formation. Together, these observations indicate that PPK is important for the antibiotic stress response during the planktonic growth of ExPEC and might be a potential drug target in bacteria. 
27159323	 Enteropathogenic Escherichia coli (EPEC) represents a major causative agent of infant diarrhea associated with significant morbidity and mortality in developing countries. Although studied extensively in vitro, the investigation of the host-pathogen interaction in vivo has been hampered by the lack of a suitable small animal model. Using RT-PCR and global transcriptome analysis, high throughput 16S rDNA sequencing as well as immunofluorescence and electron microscopy, we characterize the EPEC-host interaction following oral challenge of newborn mice. Spontaneous colonization of the small intestine and colon of neonate mice that lasted until weaning was observed. Intimate attachment to the epithelial plasma membrane and microcolony formation were visualized only in the  presence of a functional bundle forming pili (BFP) and type III secretion system  (T3SS). Similarly, a T3SS-dependent EPEC-induced innate immune response, mediated via MyD88, TLR5 and TLR9 led to the induction of a distinct set of genes in infected intestinal epithelial cells. Infection-induced alterations of the microbiota composition remained restricted to the postnatal period. Although EPEC colonized the adult intestine in the absence of a competing microbiota, no microcolonies were observed at the small intestinal epithelium. Here, we introduce the first suitable mouse infection model and describe an age-dependent, virulence factor-dependent attachment of EPEC to enterocytes in vivo. 
26361962	 BACKGROUND: KRAS gene mutations are found in 40-50% of colorectal cancer cases, but their functional contribution is not fully understood. To address this issue, we generated genetically engineered mice with colon tumors expressing an oncogenic Kras(G12D) allele in the context of the Adenomatous polyposis coli (Apc) deficiency to compare them to tumors harboring Apc deficiency alone. METHODS: CDX2P9.5-G22Cre (referred to as G22Cre) mice showing inducible Cre recombinase transgene expression in the proximal colon controlled under the CDX2  gene promoter were intercrossed with Apc (flox/flox) mice and LSL-Kras (G12D) mice carrying loxP-flanked Apc and Lox-Stop-Lox oncogenic Kras(G12D) alleles, respectively, to generate G22Cre; Apc(flox/flox); Kras(G12D) and G22Cre; Apc(flox/flox); KrasWT mice. Gene expression profiles of the tumors were analyzed using high-density oligonucleotide arrays. RESULTS: Morphologically, minimal difference in proximal colon tumor was observed between the two mouse models. Consistent with previous findings in vitro, Glut1 transcript and protein expression was up-regulated in the tumors of G22Cre;Apc (flox/flox) ; Kras(G12D) mice. Immunohistochemical staining analysis revealed that GLUT1 protein expression correlated with KRAS mutations in human colorectal  cancer. Microarray analysis identified 11 candidate genes upregulated more than fivefold and quantitative PCR analysis confirmed that Aqp8, Ttr, Qpct, and Slc26a3 genes were upregulated 3.7- to 30.2-fold in tumors with mutant Kras. CONCLUSIONS: These results demonstrated the validity of the G22Cre; Apc(flox/flox) ;Kras (G12D) mice as a new mouse model with oncogenic Kras activation. We believe that this model can facilitate efforts to define novel factors that contribute to the pathogenesis of human colorectal cancer with KRAS  mutations. 
26787651	 BACKGROUND: Enterotoxigenic Escherichia coli (ETEC) is a globally prevalent cause of diarrhea. Though usually self-limited, it can be severe and debilitating. Little is known about the host transcriptional response to infection. We report the first gene expression analysis of the human host response to experimental challenge with ETEC. METHODS: We challenged 30 healthy adults with an unattenuated ETEC strain, and collected serial blood samples shortly after inoculation and daily for 8 days. We performed gene expression analysis on whole peripheral blood RNA samples from subjects in whom severe symptoms developed (n = 6) and a subset of those who remained asymptomatic (n = 6) despite shedding. RESULTS: Compared with baseline, symptomatic subjects demonstrated significantly  different expression of 406 genes highlighting increased immune response and decreased protein synthesis. Compared with asymptomatic subjects, symptomatic subjects differentially expressed 254 genes primarily associated with immune response. This comparison also revealed 29 genes differentially expressed between groups at baseline, suggesting innate resilience to infection. Drug repositioning analysis identified several drug classes with potential utility in augmenting immune response or mitigating symptoms. CONCLUSIONS: There are statistically significant and biologically plausible differences in host gene expression induced by ETEC infection. Differential baseline expression of some genes may indicate resilience to infection. 
26970764	 We identified new defensin-like cDNA (called Psdefensin) by searching data set of high-throughput RNA sequencing (RNA-seq) expression profiling of immunized larva  of white-spotted flower chafers, Protaetia brevitarsis seulensis. The length of the analyzed new defensin-like sequences were 240 base pair (bp) and encoded the  deduced polypeptide of 79 amino acid residues with signal peptides (amino acids 1-20), pro-peptide region (amino acids 21-36), and mature peptide region (amino acids 37-79). The Psdefensin transcript levels were slightly up-regulated at 4 h  post-infection and were highly expressed at 8 h post-infection compared to control larvae injected with sterile water. In addition, the Psdefensin did have  antimicrobial activity against both Gram-negative bacteria, E. coli and Gram-positive bacteria, B. subtilis suggesting potentially pharmacologic agent. 
26980514	 RegulonDB is a database storing the biological information behind the transcriptional regulatory network (TRN) of the bacterium Escherichia coli. It is one of the key bioinformatics resources for Systems Biology investigations of bacterial gene regulation. Like most biological databases, the content drifts with time, both due to the accumulation of new information and due to refinements in the underlying biological concepts. Conclusions based on previous database versions may no longer hold. Here, we study the change of some topological properties of the TRN of E. coli, as provided by RegulonDB across 16 versions, as well as a simple index, digital control strength, quantifying the match between gene expression profiles and the transcriptional regulatory networks. While many  of network characteristics change dramatically across the different versions, the digital control strength remains rather robust and in tune with previous results  for this index. Our study shows that: (i) results derived from network topology should, when possible, be studied across a range of database versions, before detailed biological conclusions are derived, and (ii) resorting to simple indices, when interpreting high-throughput data from a network perspective, may help achieving a robustness of the findings against variation of the underlying biological information. Database URL: www.regulondb.ccg.unam.mx. 
26539667	 BACKGROUND: The fetal inflammatory response (FIR) in placental membranes to an intrauterine infection often precedes premature birth raising neonatal mortality  and morbidity. However, the precise molecular events behind FIR still remain largely unknown, and little has been investigated at gene expression level. METHODS: We collected publicly available microarray expression data profiling umbilical cord (UC) tissue derived from the cohort of extremely low gestational age newborns (ELGANs) and interrogate them for differentially expressed (DE) genes between FIR and non-FIR-affected ELGANs. RESULTS: We found a broad and complex FIR UC gene expression signature, changing  up to 19% (3,896/20,155) of all human genes at 1% false discovery rate. Significant changes of a minimum 50% magnitude (1,097/3,896) affect the upregulation of many inflammatory pathways and molecules, such as cytokines, toll-like receptors, and calgranulins. Remarkably, they also include the downregulation of neurodevelopmental pathways and genes, such as Fragile-X mental retardation 1 (FMR1), contactin 1 (CNTN1), and adenomatous polyposis coli (APC). CONCLUSION: The FIR expression signature in UC tissue contains molecular clues about signaling pathways that trigger FIR, and it is consistent with an acute inflammatory response by fetal innate and adaptive immune systems, which participate in the pathogenesis of neonatal brain damage. 
26981430	 The adenomatous polyposis coli (APC) tumour suppressor gene is mutated in about 80% of colorectal cancers (CRC) Brannon et al. (2014) [1]. APC is a large multifunctional protein that regulates many biological functions including Wnt signalling (through the regulation of beta-catenin stability) Reya and Clevers (2005) [2], cell migration Kroboth et al. (2007), Sansom et al. (2004) [3], [4],  mitosis Kaplan et al. (2001) [5], cell adhesion Faux et al. (2004), Carothers et  al. (2001) [6], [7] and differentiation Sansom et al. (2004) [4]. Although the role of APC in CRC is often described as the deregulation of Wnt signalling, its  other biological functions suggest that there are other factors at play that contribute to the onset of adenomas and the progression of CRC upon the truncation of APC. To identify genes and pathways that are dysregulated as a consequence of loss of function of APC, we compared the gene expression profiles  of the APC mutated human CRC cell line SW480 following reintroduction of wild-type APC (SW480 + APC) or empty control vector (SW480 + vector control) Faux et al. (2004) . Here we describe the RNA-seq data derived for three biological replicates of parental SW480, SW480 + vector control and SW480 + APC cells, and present the bioinformatics pipeline used to test for differential gene expression and pathway enrichment analysis. A total of 1735 genes showed significant differential expression when APC was restored and were enriched for genes associated with cell polarity, Wnt signalling and the epithelial to mesenchymal transition. There was additional enrichment for genes involved in cell-cell adhesion, cell-matrix junctions, angiogenesis, axon morphogenesis and cell movement. The raw and analysed RNA-seq data have been deposited in the Gene Expression Omnibus (GEO) database under accession number GSE76307. This dataset is useful for further investigations of the impact of APC mutation on the properties of colorectal cancer cells. 
26784237	 Extraintestinal Escherichia coli (E. coli) evolved by acquisition of pathogenicity islands, phage, plasmids, and DNA segments by horizontal gene transfer. Strains are heterogeneous but virulent uropathogenic isolates more often have specific fimbriae, toxins, and iron receptors than commensal strains.  One may ask whether it is the virulence factors alone that are required to establish infection. While these virulence factors clearly contribute strongly to pathogenesis, bacteria must survive by metabolizing nutrients available to them.  By constructing mutants in all major metabolic pathways and co-challenging mice transurethrally with each mutant and the wild type strain, we identified which major metabolic pathways are required to infect the urinary tract. We must also ask what else is E. coli doing in vivo? To answer this question, we examined the  transcriptome of E. coli CFT073 in the murine model of urinary tract infection (UTI) as well as for E. coli strains collected and analyzed directly from the urine of patients attending either a urology clinic or a university health clinic for symptoms of UTI. Using microarrays and RNA-seq, we measured in vivo gene expression for these uropathogenic E. coli strains, identifying genes upregulated during murine and human UTI. Our findings allow us to propose a new definition of bacterial virulence. 
26860568	 The accurate detection and identification of food-borne pathogenic microorganisms is critical for food safety nowadays. In the present work, a visual DNA microarray was established and applied to detect pathogens commonly found in food, including Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in food samples. Multiplex PCR (mPCR) was employed to simultaneously amplify specific gene fragments, fimY for Salmonella, ipaH for Shigella, iap for L. monocytogenes and ECs2841 for E. coli O157:H7, respectively. Biotinylated PCR amplicons annealed to the microarray probes were then reacted with a streptavidin-alkaline phosphatase conjugate and nitro blue tetrazolium/5-bromo-4-chloro-3'-indolylphosphate, p-toluidine salt (NBT/BCIP); the positive results were easily visualized as blue dots formatted on the microarray surface. The performance of a DNA microarray was tested against 14 representative collection strains and mock-contamination food samples. The combination of mPCR and a visual micro-plate chip specifically and sensitively detected Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in standard strains and food matrices with a sensitivity of ∼10(2)  CFU/mL of bacterial culture. Thus, the developed method is advantageous because of its high throughput, cost-effectiveness and ease of use. 
26926136	 Avian Pathogenic Escherichia coli is responsible for significant economic losses  in the poultry industry by causing a range of systemic or localized diseases collectively termed colibacillosis. The virulence mechanisms of these strains that are pathogenic in poultry and possibly pathogenic in humans have not yet been fully elucidated. This work was developed to study if over-expressed genes in a microarray assay could be potentially involved in the pathogenicity of an Avian Pathogenic Escherichia coli strain isolated from a swollen head syndrome case. For this study, five over-expressed genes were selected for the construction of null mutants [flgE (flagellar hook), tyrR (transcriptional regulator), potF (putrescine transporter), yehD (putative adhesin) and bfr (bacterioferritin)]. The constructed mutants were evaluated for their capacity for the adhesion and invasion of in vitro cultured cells, their motility capacity, and their pathogenic potential in one-day-old chickens compared with the wild-type strain (WT). The Δbfr strain showed a decreased adhesion capacity on avian fibroblasts compared with WT, in the presence and absence of alpha-D-mannopyranoside, and the ΔpotF strain showed decreased adhesion only in the absence of alpha-D-mannopyranoside. The ΔtyrR mutant had a reduced ability to invade Hep-2 cells. No mutant showed changes in invading CEC-32 cells. The mutants ΔflgE and ΔtyrR showed a decreased ability to survive in HD-11 cells. The motility of the mutant strains Δbfr, ΔyehD and ΔpotF was increased, while the ΔtyrR mutant showed reduction, and the ΔflgE became non-motile. No mutant strain  caused the same mortality of the WT in one-day-old chickens, showing attenuation  to different degrees. 
25910947	 The potential for using whole genome sequencing (WGS) data in microbiological risk assessment (MRA) has been discussed on several occasions since the beginning of this century. Still, the proposed heuristic approaches have never been applied in a practical framework. This is due to the non-trivial problem of mapping microbial information consisting of thousands of loci onto a probabilistic scale  for risks. The paradigm change for MRA involves translation of multidimensional microbial genotypic information to much reduced (integrated) phenotypic information and onwards to a single measure of human risk (i.e. probability of illness). In this paper a first approach in methodology development is described  for the application of WGS data in MRA; this is supported by a practical example. That is, combining genetic data (single nucleotide polymorphisms; SNPs) for Shiga toxin-producing Escherichia coli (STEC) O157 with phenotypic data (in vitro adherence to epithelial cells as a proxy for virulence) leads to hazard identification in a Genome Wide Association Study (GWAS). This application revealed practical implications when using SNP data for MRA. These can be summarized by considering the following main issues: optimum sample size for valid inference on population level, correction for population structure, quantification and calibration of results, reproducibility of the analysis, links with epidemiological data, anchoring and integration of results into a systems biology approach for the translation of molecular studies to human health risk. Future developments in genetic data analysis for MRA should aim at resolving the  mapping problem of processing genetic sequences to come to a quantitative description of risk. The development of a clustering scheme focusing on biologically relevant information of the microbe involved would be a useful approach in molecular data reduction for risk assessment. 
26572250	 BACKGROUND: The steroid hormone environment in healthy horses seems to have a significant impact on the efficiency of their uterine immune response. The objective of this study was to characterize the changes in gene expression in the equine endometrium in response to the introduction of bacterial pathogens and the influence of steroid hormone concentrations on this expression. METHODS: Endometrial biopsies were collected from five horses before and 3 h after the inoculation of Escherichia coli once in oestrus (follicle >35 mm in diameter) and once in dioestrus (5 days after ovulation) and analysed using high-throughput RNA sequencing techniques (RNA-Seq). RESULTS: Comparison between time points revealed that 2422 genes were expressed at significantly higher levels and 2191 genes at significantly lower levels 3 h post inoculation in oestrus in comparison to pre-inoculation levels. In dioestrus, the expression of 1476 genes was up-regulated and 383 genes were down-regulated post inoculation. Many immune related genes were found to be up-regulated after the introduction of E. coli. These include pathogen recognition receptors, particularly toll-like receptors TLR2 and 4 and NOD-like receptor NLRC5. In addition, several interleukins including IL1B, IL6, IL8 and IL1ra were significantly up-regulated. Genes for chemokines, including CCL 2, CXCL 6, 9, 10, 11 and 16 and those for antimicrobial peptides, including secretory phospholipase sPLA 2, lipocalin 2, lysozyme and equine β-defensin 1, as well as the gene for tissue inhibitor for metalloproteinases TIMP-1 were also up-regulated post inoculation. CONCLUSION: The results of this study emphasize the complexity of an effective uterine immune response during acute endometritis and the tight balance between pro- and anti-inflammatory factors required for efficient elimination of bacteria. It is one of the first high-throughput analyses of the uterine inflammatory response in any species and several new potential targets for treatment of inflammatory diseases of the equine uterus have been identified. 
26303802	 Drug resistance is a major problem in Mycobacterium tuberculosis control, and it  is critical to identify novel drug targets and new antimycobacterial compounds. We have previously identified an imidazo[1,2-a]pyridine-4-carbonitrile-based agent, MP-III-71, with strong activity against M. tuberculosis. In this study, we evaluated mechanisms of resistance to MP-III-71. We derived three independent M.  tuberculosis mutants resistant to MP-III-71 and conducted whole-genome sequencing of these mutants. Loss-of-function mutations in Rv2887 were common to all three MP-III-71-resistant mutants, and we confirmed the role of Rv2887 as a gene required for MP-III-71 susceptibility using complementation. The Rv2887 protein was previously unannotated, but domain and homology analyses suggested it to be a transcriptional regulator in the MarR (multiple antibiotic resistance repressor)  family, a group of proteins first identified in Escherichia coli to negatively regulate efflux pumps and other mechanisms of multidrug resistance. We found that two efflux pump inhibitors, verapamil and chlorpromazine, potentiate the action of MP-III-71 and that mutation of Rv2887 abrogates their activity. We also used transcriptome sequencing (RNA-seq) to identify genes which are differentially expressed in the presence and absence of a functional Rv2887 protein. We found that genes involved in benzoquinone and menaquinone biosynthesis were repressed by functional Rv2887. Thus, inactivating mutations of Rv2887, encoding a putative MarR-like transcriptional regulator, confer resistance to MP-III-71, an effective antimycobacterial compound that shows no cross-resistance to existing antituberculosis drugs. The mechanism of resistance of M. tuberculosis Rv2887 mutants may involve efflux pump upregulation and also drug methylation. 
26238215	 Melanosis coli (MC) refers to the condition characterized by abnormal brown or black pigmentation deposits on the colonic mucosa. However, the histopathological findings and genes associated with the pathogenesis of melanosis coli remain to be fully elucidated. The present study aimed to examine the histopathological features and differentially expressed genes of MC. This involved performing hematoxylin and eosin staining, specific staining and immunohistochemistry on tissues sections, which were isolated from patients diagnosed with MC. DNA expression microarray analysis, western blotting and immunofluorescence assays were performed to analyze the differentially expressed genes of melanosis coli. The results demonstrated that the pigment deposits in MC consisted of lipofuscin. A TUNEL assay revealed that a substantial number of apoptotic cells were present  within the macrophages and superficial lamina propria of the colonic epithelium.  Expression microarray analysis revealed that the significantly downregulated genes were CYP3A4, CYP3A7, UGT2B11 and UGT2B15 in melanosis coli. Western blotting and immunofluorescence assays indicated that the expression of CYP3A4 in the normal tissue was higher than in the MC tissue. The results of the present study provided a comprehensive description of the histopathological characteristics and pathogenesis of MC and for the first time, to the best of our knowledge, demonstrated that the cytochrome P450‑associated genes were significantly downregulated in melanosis coli. This novel information can be used to assist in further investigations of melanosis coli. 
25909338	 In this study, a novel approach for ultrasensitive detection and rapid high-throughput identification of a panel of common foodborne pathogens with the  naked eyes is presented. As a proof-of-concept application, a multiple pathogen analysis array is fabricated through immobilizing three specific polyT-capture probes which can respectively recognize rfbE gene (Escherichia coli O157:H7), invA gene (Salmonella enterica), inlA gene (Listeria monocytogenes) on the plastic substrates. PCR has been developed for amplification and labeling target  genes of rfbE, invA, inlA with biotin. The biotinated target DNA is then captured onto the surface of plastic strips through specific DNA hybridization. The succeeding staining of biotinated DNA duplexes with avidin-horseradish peroxidise (AV-HRP) and biotinated anti-HRP antibody greatly amplifies the detectable signal through the multiple cycle signal amplification strategy, and thus realizing ultrasensitive and specific detection of the above three pathogens in food samples with the naked eyes. Results showed approximately 5 copies target pathogenic DNA could be detected with the naked eyes. This simple but very efficient colorimetric assay also show excellent anti-interference capability and good stability, and can be readily applied to point-of-care diagnosis. 
26080079	 Human noroviruses (NoV) are the leading cause of acute viral gastroenteritis worldwide. Significant antigenic diversity of NoV strains has limited the availability of broadly reactive ligands for design of detection assays. The purpose of this work was to produce and characterize single stranded (ss)DNA aptamers with binding specificity to human NoV using an easily produced NoV target-the P domain protein. Aptamer selection was done using SELEX (Systematic Evolution of Ligands by EXponential enrichment) directed against an Escherichia coli-expressed and purified epidemic NoV GII.4 strain P domain. Two of six unique aptamers (designated M1 and M6-2) were chosen for characterization. Inclusivity testing using an enzyme-linked aptamer sorbent assay (ELASA) against a panel of 14 virus-like particles (VLPs) showed these aptamers had broad reactivity and exhibited strong binding to GI.7, GII.2, two GII.4 strains, and GII.7 VLPs. Aptamer M6-2 exhibited at least low to moderate binding to all VLPs tested. Aptamers significantly (p<0.05) bound virus in partially purified GII.4 New Orleans outbreak stool specimens as demonstrated by ELASA and aptamer magnetic capture (AMC) followed by RT-qPCR. This is the first demonstration of human NoV P domain protein as a functional target for the selection of nucleic acid aptamers  that specifically bind and broadly recognize diverse human NoV strains. 
26198111	 Highly portable, cost-effective, and rapid-response devices are required for the  subtyping of the most frequent food-borne bacteria; thereby the sample rejection  strategies and hygienization techniques along the food chain can be tailor-designed. Here, a novel biosensor is presented for the generic detection of Salmonella and Campylobacter and the discrimination between their most prevalent serovars (Salmonella Enteritidis, Salmonella Typhimurium) and species (Campylobacter jejuni, Campylobacter coli), respectively. The method is based on  DNA microarray developed on a standard digital versatile disc (DVD) as support for a hybridization assay and a DVD driver as scanner. This approach was found to be highly sensitive (detection limit down to 0.2 pg of genomic DNA), reproducible (relative standard deviation 4-19 %), and high working capacity (20 samples per disc). The inclusivity and exclusivity assays indicated that designed oligonucleotides (primers and probes) were able to discriminate targeted pathogens from other Salmonella serovars, Campylobacter species, or common food-borne pathogens potentially present in the indigenous microflora. One hundred isolates from meat samples, collected in a poultry factory, were analyzed by the DVD microarraying and fluorescent real-time PCR. An excellent correlation  was observed for both generic and specific detection (relative sensitivity 93-99 % and relative specificity 93-100 %). Therefore, the developed assay has been shown to be a reliable tool to be used in routine food safety analysis, especially in settings with limited infrastructure due to the excellent efficiency-cost ratio of compact disc technology. Graphical Abstract DNA microarray performed by DVD technology for pathogen genotyping. 
26099584	 Avian pathogenic Escherichia coli (APEC) strains cause one of the three most significant infectious diseases in the poultry industry and are also potential food-borne pathogens threating human health. In this study, we showed that ArcA (aerobic respiratory control), a global regulator important for E. coli's adaptation from anaerobic to aerobic conditions and control of that bacterium's enzymatic defenses against reactive oxygen species (ROS), is involved in the virulence of APEC. Deletion of arcA significantly attenuates the virulence of APEC in the duck model. Transcriptome sequencing (RNA-Seq) analyses comparing the APEC wild type and the arcA mutant indicate that ArcA regulates the expression of 129 genes, including genes involved in citrate transport and metabolism, flagellum synthesis, and chemotaxis. Further investigations revealed that citCEFXG contributed to APEC's microaerobic growth at the lag and log phases when cultured in duck serum and that ArcA played a dual role in the control of citrate metabolism and transportation. In addition, deletion of flagellar genes motA and  motB and chemotaxis gene cheA significantly attenuated the virulence of APEC, and ArcA was shown to directly regulate the expression of motA, motB, and cheA. The combined results indicate that ArcA controls metabolism, chemotaxis, and motility contributing to the pathogenicity of APEC. 
25919463	 Greater interaction between humans and wildlife populations poses significant risks of anthropogenic impact to natural ecosystems, especially in the marine environment. Understanding the spread of microorganisms at the marine interface is therefore important if we are to mitigate adverse effects on marine wildlife.  We investigated the establishment of Escherichia coli in the endangered Australian sea lion (Neophoca cinerea) by comparing fecal isolation from wild and captive sea lion populations. Fecal samples were collected from wild colonies March 2009-September 2010 and from captive individuals March 2011-May 2013. Using molecular screening, we assigned a phylotype to E. coli isolates and determined the presence of integrons, mobile genetic elements that capture gene cassettes conferring resistance to antimicrobial agents common in fecal coliforms. Group B2 was the most abundant phylotype in all E. coli isolates (n = 37), with groups A,  B1, and D also identified. Integrons were not observed in E. coli (n = 21) isolated from wild sea lions, but were identified in E. coli from captive animals (n = 16), from which class I integrases were detected in eight isolates. Sequencing of gene cassette arrays identified genes conferring resistance to streptomycin-spectinomycin (aadA1) and trimethoprim (dfrA17, dfrB4). Class II integrases were not detected in the E. coli isolates. The frequent detection in captive sea lions of E. coli with resistance genes commonly identified in human clinical cases suggests that conditions experienced in captivity may contribute to establishment. Identification of antibiotic resistance in the microbiota of Australian sea lions provides crucial information for disease management. Our data will inform conservation management strategies and provide a mechanism to monitor microorganism dissemination to sensitive pinniped populations. 
25590973	 As a major human pathogen in the Listeria genus, Listeria monocytogenes causes the bacterial disease listeriosis, which is a serious infection caused by eating  food contaminated with the bacteria. We have developed an aptamer-based sandwich  assay (ABSA) platform that demonstrates a promising potential for use in pathogen detection using aptamers as analytical bioconjugates. The whole-bacteria SELEX (WB-SELEX) strategy was adopted to generate aptamers with high affinity and specificity against live L. monocytogenes. Of the 35 aptamer candidates tested, LMCA2 and LMCA26 reacted to L. monocytogenes with high binding, and were consequently chosen as sensing probes. The ABSA platform can significantly enhance the sensitivity by employing a very specific aptamer pair for the sandwich complex. The ABSA platform exhibited a linear response over a wide concentration range of L. monocytogenes from 20 to 2×10(6) CFU per mL and was closely correlated with the following relationship: y=9533.3x+1542.3 (R(2)=0.99). Our proposed ABSA platform also provided excellent specificity for the tests to distinguish L. monocytogenes from other Listeria species and other bacterial genera (3 Listeria spp., 4 Salmonella spp., 2 Vibrio spp., 3 Escherichia coli and 3 Shigella spp.). Improvements in the sensitivity and specificity have not only facilitated the reliable detection of L. monocytogenes at extremely low concentrations, but also allowed for the development of a 96-well plate-based routine assay platform for multivalent diagnostics. 
26124752	 Enteropathogenic Escherichia coli (EPEC) are a leading cause of diarrheal illness among infants in developing countries. E. coli isolates classified as typical EPEC are identified by the presence of the locus of enterocyte effacement (LEE) and the bundle-forming pilus (BFP), and absence of the Shiga-toxin genes, while the atypical EPEC also encode LEE but do not encode BFP or Shiga-toxin. Comparative genomic analyses have demonstrated that EPEC isolates belong to diverse evolutionary lineages and possess lineage- and isolate-specific genomic content. To investigate whether this genomic diversity results in significant differences in global gene expression, we used an RNA sequencing (RNA-Seq) approach to characterize the global transcriptomes of the prototype typical EPEC  isolates E2348/69, B171, C581-05, and the prototype atypical EPEC isolate E110019. The global transcriptomes were characterized during laboratory growth in two different media and three different growth phases, as well as during adherence of the EPEC isolates to human cells using in vitro tissue culture assays. Comparison of the global transcriptomes during these conditions was used  to identify isolate- and growth phase-specific differences in EPEC gene expression. These analyses resulted in the identification of genes that encode proteins involved in survival and metabolism that were coordinately expressed with virulence factors. These findings demonstrate there are isolate- and growth  phase-specific differences in the global transcriptomes of EPEC prototype isolates, and highlight the utility of comparative transcriptomics for identifying additional factors that are directly or indirectly involved in EPEC pathogenesis. 
25993608	 Neonatal sepsis and meningitis (NSM) remains a leading cause worldwide of mortality and morbidity in newborn infants despite the availability of antibiotics over the last several decades. E. coli is the most common gram-negative pathogen causing NSM. Our previous studies show that α7 nicotinic receptor (α7 nAChR), an essential regulator of inflammation, plays a detrimental  role in the host defense against NSM. Despite notable successes, there still exists an unmet need for new effective therapeutic approaches to treat this disease. Using the in vitro/in vivo models of the blood-brain barrier (BBB) and RNA-seq, we undertook a drug repositioning study to identify unknown antimicrobial activities for known drugs. We have demonstrated for the first time that memantine (MEM), a FDA-approved drug for treatment of Alzheimer's disease, could very efficiently block E. coli-caused bacteremia and meningitis in a mouse  model of NSM in a manner dependent on α7 nAChR. MEM was able to synergistically enhance the antibacterial activity of ampicillin in HBMEC infected with E. coli K1 (E44) and in neonatal mice with E44-caused bacteremia and meningitis. Differential gene expression analysis of RNA-Seq data from mouse BMEC infected with E. coli K1 showed that several E44-increased inflammatory factors, including IL33, IL18rap, MMP10 and Irs1, were significantly reduced by MEM compared to the  infected cells without drug treatment. MEM could also significantly up-regulate anti-inflammatory factors, including Tnfaip3, CISH, Ptgds and Zfp36. Most interestingly, these factors may positively and negatively contribute to regulation of NF-κB, which is a hallmark feature of bacterial meningitis. Furthermore, we have demonstrated that circulating BMEC (cBMEC) are the potential novel biomarkers for NSM. MEM could significantly reduce E44-increased blood level of cBMEC in mice. Taken together, our data suggest that memantine can efficiently block host inflammatory responses to bacterial infection through modulation of both inflammatory and anti-inflammatory pathways. 
25714816	 Numerous tools allowing the rapid and universal identification of the clones/clonal complexes/phylogroups of Escherichia coli have been developed, as it is a commensal of the vertebrate gut, a major pathogen in veterinary and human medicine, and a bacterial indicator of faecal contamination. The ability to identify clones/clonal complexes/phylogroups is crucial, as a strain's ecological niche, lifestyle and propensity to cause disease vary with its phylogenetic origins. There are currently three multi-locus sequence typing (MLST) schemes for E. coli, as well as several PCR-based assays for determining a strain's phylogroup or clonal complex. In this work, we present data that will enable investigators to determine the correspondence between the PCR-based assays and the three MLST schemes, and provide the means for assigning a sequence type (ST)  to a phylogroup when no other data on the strain phylogroup membership are available. Such information will help the scientific community to accurately identify the E. coli clones reported in various publications. Although whole-genome sequencing will replace classical MLST and most alternative PCR-based methods, the ST nomenclature of the MLST scheme hosted at the University of Warwick will largely persist. 
25832359	 The genome of Clostridium acetobutylicum contains the gene encoding CsrA, a carbon storage regulator. We investigated the function of CsrA in C. acetobutylicum by insertionally inactivating the encoding gene, CA_C2209 using the ClosTron. Disruption of csrA obviously decreases the growth of the organism and reduces the yield of acetone, butanol and ethanol (ABEs). Like the csrA in Escherichia coli, RNA-seq and β-galactosidase analysis revealed that csrA in C. acetobutylicum was closely involved in regulating multiple pathways including flagella assembly, oligopeptide transporting, iron uptake, and central carbon metabolism. It has also been newly demonstrated that csrA in C. acetobutylicum is related to the regulation of pathways involved in the phosphotransferase transporting systems, synthesis of riboflavin, and stage III sporulation. This research represented the first investigation of global regulation by CsrA in the  strain belonging to Gram-positive bacteria through transcriptome analysis and provided the important theoretical evidence for improving solvent production by transcriptor engineering in C. acetobutylicum. 
25737579	 Enterococcus faecalis is the third cause of nosocomial infections. To obtain the  first snapshot of transcriptional organizations in this bacterium, we used a modified RNA-seq approach enabling to discriminate primary from processed 5' RNA  ends. We also validated our approach by confirming known features in Escherichia  coli. We mapped 559 transcription start sites (TSSs) and 352 processing sites (PSSs) in E. faecalis. A blind motif search retrieved canonical features of SigA- and SigN-dependent promoters preceding transcription start sites mapped. We discovered 85 novel putative regulatory RNAs, small- and antisense RNAs, and 72 transcriptional antisense organizations. Presented data constitute a significant  insight into bacterial RNA landscapes and a step toward the inference of regulatory processes at transcriptional and post-transcriptional levels in a comprehensive manner. 
25624354	 The emergence and spread of extended-spectrum beta-lactamases and carbapenemases  among common bacterial pathogens are threatening our ability to treat routine hospital- and community-acquired infections. With the pipeline for new antibiotics virtually empty, there is an urgent need to develop novel therapeutics. Bacteria require iron to establish infection, and specialized pathogen-associated iron acquisition systems like yersiniabactin, common among pathogenic species in the family Enterobacteriaceae, including multidrug-resistant Klebsiella pneumoniae and pathogenic Escherichia coli, represent potentially novel therapeutic targets. Although the yersiniabactin system was recently identified as a vaccine target for uropathogenic E. coli (UPEC)-mediated urinary tract infection (UTI), its contribution to UPEC pathogenesis is unknown. Using an E. coli mutant (strain 536ΔfyuA) unable to acquire yersiniabactin during infection, we established the yersiniabactin receptor as a UPEC virulence factor during cystitis and pyelonephritis, a fitness factor during bacteremia, and a surface-accessible target of the experimental FyuA vaccine. In addition, we determined through transcriptome sequencing (RNA-seq) analyses of RNA from E. coli causing cystitis in women that iron acquisition systems, including the yersiniabactin system, are highly expressed by bacteria during natural uncomplicated UTI. Given that yersiniabactin contributes  to the virulence of several pathogenic species in the family Enterobacteriaceae,  including UPEC, and is frequently associated with multidrug-resistant strains, it represents a promising novel target to combat antibiotic-resistant infections. 
25790188	 Our ability to engineer organisms with new biosynthetic pathways and genetic circuits is limited by the availability of protein characterization data and the  cost of synthetic DNA. With new tools for reading and writing DNA, there are opportunities for scalable assays that more efficiently and cost effectively mine for biochemical protein characteristics. To that end, we have developed the Multiplex Library Synthesis and Expression Correction (MuLSEC) method for rapid assembly, error correction, and expression characterization of many genes as a pooled library. This methodology enables gene synthesis from microarray-synthesized oligonucleotide pools with a one-pot technique, eliminating the need for robotic liquid handling. Post assembly, the gene library is subjected to an ampicillin based quality control selection, which serves as both an error correction step and a selection for proteins that are properly expressed and folded in E. coli. Next generation sequencing of post selection DNA enables quantitative analysis of gene expression characteristics. We demonstrate  the feasibility of this approach by building and testing over 90 genes for empirical evidence of soluble expression. This technique reduces the problem of part characterization to multiplex oligonucleotide synthesis and deep sequencing, two technologies under extensive development with projected cost reduction. 
25759496	 There have been many studies on the relationship between nonpathogenic bacteria and human epithelial cells; however, the bidirectional effects of the secretomes  (secreted substances in which there is no direct bacterium-cell contact) have yet to be fully investigated. In this study, we use a transwell model to explore the  transcriptomic effects of bacterial secretions from two different nonpathogenic Escherichia coli strains on the human colonic cell line HCT-8 using next-generation transcriptome sequencing (RNA-Seq). E. coli BL21 and W3110, while genetically very similar (99.1% homology), exhibit key phenotypic differences, including differences in their production of macromolecular structures (e.g., flagella and lipopolysaccharide) and in their secretion of metabolic byproducts (e.g., acetate) and signaling molecules (e.g., quorum-sensing autoinducer 2 [AI-2]). After analysis of differential epithelial responses to the respective secretomes, this study shows for the first time that a nonpathogenic bacterial secretome activates the NF-κB-mediated cytokine-cytokine receptor pathways while  also upregulating negative-feedback components, including the NOD-like signaling  pathway. Because of AI-2's relevance as a bacterium-bacterium signaling molecule  and the differences in its secretion rates between these strains, we investigated its role in HCT-8 cells. We found that the expression of the inflammatory cytokine interleukin 8 (IL-8) responded to AI-2 with a pattern of rapid upregulation before subsequent downregulation after 24 h. Collectively, these data demonstrate that secreted products from nonpathogenic bacteria stimulate the transcription of immune-related biological pathways, followed by the upregulation of negative-feedback elements that may serve to temper the inflammatory response.IMPORTANCE: The symbiotic relationship between the microbiome and the host is important in the maintenance of human health. There is a growing need to  further understand the nature of these relationships to aid in the development of homeostatic probiotics and also in the design of novel antimicrobial therapeutics. To our knowledge, this is the first global-transcriptome study of bacteria cocultured with human epithelial cells in a model to determine the transcriptional effects of epithelial cells in which epithelial and bacterial cells are allowed to "communicate" with each other only through diffusible small  molecules and proteins. By beginning to demarcate the direct and indirect effects of bacteria on the gastrointestinal (GI) tract, two-way interkingdom communication can potentially be mediated between host and microbe. 
25766582	 BACKGROUND: Gene prediction is a challenging but crucial part in most genome analysis pipelines. Various methods have evolved that predict genes ab initio on  reference sequences or evidence based with the help of additional information, such as RNA-Seq reads or EST libraries. However, none of these strategies is bias-free and one method alone does not necessarily provide a complete set of accurate predictions. RESULTS: We present IPred (Integrative gene Prediction), a method to integrate ab initio and evidence based gene identifications to complement the advantages of different prediction strategies. IPred builds on the output of gene finders and generates a new combined set of gene identifications, representing the integrated evidence of the single method predictions. CONCLUSION: We evaluate IPred in simulations and real data experiments on Escherichia Coli and human data. We show that IPred improves the prediction accuracy in comparison to single method predictions and to existing methods for prediction combination. 
25757888	 BACKGROUND: The RNA steady-state levels in the cell are a balance between synthesis and degradation rates. Although transcription is important, RNA processing and turnover are also key factors in the regulation of gene expression. In Escherichia coli there are three main exoribonucleases (RNase II,  RNase R and PNPase) involved in RNA degradation. Although there are many studies  about these exoribonucleases not much is known about their global effect in the transcriptome. RESULTS: In order to study the effects of the exoribonucleases on the transcriptome, we sequenced the total RNA (RNA-Seq) from wild-type cells and from mutants for each of the exoribonucleases (∆rnb, ∆rnr and ∆pnp). We compared each  of the mutant transcriptome with the wild-type to determine the global effects of the deletion of each exoribonucleases in exponential phase. We determined that the deletion of RNase II significantly affected 187 transcripts, while deletion of RNase R affects 202 transcripts and deletion of PNPase affected 226 transcripts. Surprisingly, many of the transcripts are actually down-regulated in the exoribonuclease mutants when compared to the wild-type control. The results obtained from the transcriptomic analysis pointed to the fact that these enzymes  were changing the expression of genes related with flagellum assembly, motility and biofilm formation. The three exoribonucleases affected some stable RNAs, but  PNPase was the main exoribonuclease affecting this class of RNAs. We confirmed by qPCR some fold-change values obtained from the RNA-Seq data, we also observed that all the exoribonuclease mutants were significantly less motile than the wild-type cells. Additionally, RNase II and RNase R mutants were shown to produce more biofilm than the wild-type control while the PNPase mutant did not form biofilms. CONCLUSIONS: In this work we demonstrate how deep sequencing can be used to discover new and relevant functions of the exoribonucleases. We were able to obtain valuable information about the transcripts affected by each of the exoribonucleases and compare the roles of the three enzymes. Our results show that the three exoribonucleases affect cell motility and biofilm formation that are two very important factors for cell survival, especially for pathogenic cells. 
25487442	 Avian Pathogenic Escherichia coli (APEC) strains are extra-intestinal E. coli that infect poultry and cause diseases. Nitrite is a central branch-point in bacterial nitrogen metabolism and is used as a cytotoxin by macrophages. Unlike nitric oxide (NO), nitrite cannot diffuse across bacterial membrane cells. The NirC protein acts as a specific channel to facilitate the transport of nitrite into Salmonella and E. coli cells for nitrogen metabolism and cytoplasmic detoxification. NirC is also required for the pathogenicity of Salmonella by downregulating the production of NO by the host macrophages. Based on an in vitro microarray that revealed the overexpression of the nirC gene in APEC strain SCI-07, we constructed a nirC-deficient SCI-07 strain (ΔnirC) and evaluated its virulence potential using in vivo and in vitro assays. The final cumulative mortalities caused by mutant and wild-type (WT) were similar; while the ΔnirC caused a gradual increase in the mortality rate during the seven days recorded, the WT caused mortality up to 24h post-infection (hpi). Counts of the ΔnirC cells in the spleen, lung and liver were higher than those of the WT after 48 hpi but similar at 24 hpi. Although similar number of ΔnirC and WT cells was observed in  macrophages at 3 hpi, there was higher number of ΔnirC cells at 16 hpi. The cell  adhesion ability of the ΔnirC strain was about half the WT level in the presence  and absence of alpha-D-mannopyranoside. These results indicate that the nirC gene influences the pathogenicity of SCI-07 strain. 
25385117	 The emergence of multidrug-resistant (MDR) Klebsiella pneumoniae has resulted in  a more frequent reliance on treatment using colistin. However, resistance to colistin (Col(r)) is increasingly reported from clinical settings. The genetic mechanisms that lead to Col(r) in K. pneumoniae are not fully characterized. Using a combination of genome sequencing and transcriptional profiling by RNA sequencing (RNA-Seq) analysis, distinct genetic mechanisms were found among nine  Col(r) clinical isolates. Col(r) was related to mutations in three different genes in K. pneumoniae strains, with distinct impacts on gene expression. Upregulation of the pmrH operon encoding 4-amino-4-deoxy-L-arabinose (Ara4N) modification of lipid A was found in all Col(r) strains. Alteration of the mgrB gene was observed in six strains. One strain had a mutation in phoQ. Common among these seven strains was elevated expression of phoPQ and unaltered expression of  pmrCAB, which is involved in phosphoethanolamine addition to lipopolysaccharide (LPS). In two strains, separate mutations were found in a previously uncharacterized histidine kinase gene that is part of a two-component regulatory  system (TCRS) now designated crrAB. In these strains, expression of pmrCAB, crrAB, and an adjacent glycosyltransferase gene, but not that of phoPQ, was elevated. Complementation with the wild-type allele restored colistin susceptibility in both strains. The crrAB genes are present in most K. pneumoniae genomes, but not in Escherichia coli. Additional upregulated genes in all strains include those involved in cation transport and maintenance of membrane integrity. Because the crrAB genes are present in only some strains, Col(r) mechanisms may be dependent on the genetic background. 
26625187	 A standardised method for determining Escherichia coli O157:H7 strain relatedness using whole genome sequencing or virulence gene profiling is not yet established. We sought to assess the capacity of either high-throughput polymerase chain reaction (PCR) of 49 virulence genes, core-genome single nt variants (SNVs) or k-mer clustering to discriminate between outbreak-associated and sporadic E. coli O157:H7 isolates. Three outbreaks and multiple sporadic isolates from the province of Alberta, Canada were included in the study. Two of the outbreaks occurred concurrently in 2014 and one occurred in 2012. Pulsed-field gel electrophoresis (PFGE) and multilocus variable-number tandem repeat analysis (MLVA) were employed as comparator typing methods. The virulence gene profiles of isolates from the 2012 and 2014 Alberta outbreak events and contemporary sporadic isolates were mostly identical; therefore the set of virulence genes chosen in this study were not discriminatory enough to distinguish between outbreak clusters. Concordant with PFGE and MLVA results, core genome SNV and k-mer phylogenies clustered isolates from the 2012 and 2014 outbreaks as distinct events. k-mer phylogenies demonstrated increased discriminatory power compared with core SNV phylogenies. Prior to the widespread implementation of whole genome sequencing for routine public health use, issues surrounding cost, technical expertise, software standardisation, and data sharing/comparisons must be addressed. 
25489107	 Uropathogenic Escherichia coli (UPEC) is the predominant etiological agent of uncomplicated urinary tract infection (UTI), manifested by inflammation of the urinary bladder, in humans and is a major global public health concern. Molecular pathogenesis of UPEC has been primarily examined using murine models of UTI. Translational research to develop novel therapeutics against this major pathogen, which is becoming increasingly antibiotic resistant, requires a thorough understanding of mechanisms involved in pathogenesis during human UTIs. Total RNA-sequencing (RNA-seq) and comparative transcriptional analysis of UTI samples  to the UPEC isolates cultured in human urine and laboratory medium were used to identify novel fitness genes that were specifically expressed during human infection. Evidence for UPEC genes involved in ion transport, including copper efflux, nickel and potassium import systems, as key fitness factors in uropathogenesis were generated using an experimental model of UTI. Translational  application of this study was investigated by targeting Cus, a bacterial copper efflux system. Copper supplementation in drinking water reduces E. coli colonization in the urinary bladder of mice. Additionally, our results suggest that anaerobic processes in UPEC are involved in promoting fitness during UTI in  humans. In summary, RNA-seq was used to establish the transcriptional signature in UPEC during naturally occurring, community acquired UTI in women and multiple  novel fitness genes used by UPEC during human infection were identified. The repertoire of UPEC genes involved in UTI presented here will facilitate further translational studies to develop innovative strategies against UTI caused by UPEC. 
25337688	 Author information:  (1)Department of Pharmacology, Weill Cornell Medical College , New York, New York 10065, United States. 
25390635	 Reverse engineering approaches to constructing gene regulatory networks (GRNs) based on genome-wide mRNA expression data have led to significant biological findings, such as the discovery of novel drug targets. However, the reliability of the reconstructed GRNs needs to be improved. Here, we propose an ensemble-based network aggregation approach to improving the accuracy of network  topologies constructed from mRNA expression data. To evaluate the performances of different approaches, we created dozens of simulated networks from combinations of gene-set sizes and sample sizes and also tested our methods on three Escherichia coli datasets. We demonstrate that the ensemble-based network aggregation approach can be used to effectively integrate GRNs constructed from different studies - producing more accurate networks. We also apply this approach to building a network from epithelial mesenchymal transition (EMT) signature microarray data and identify hub genes that might be potential drug targets. The  R code used to perform all of the analyses is available in an R package entitled  "ENA", accessible on CRAN (http://cran.r-project.org/web/packages/ENA/). 
25096391	 Salmonella enterica subsp. enterica ser. enteritidis and Salmonella enterica subsp. enterica ser. typhimurium are the most common and severe food-borne pathogens responsible for causing salmonellosis in humans and animals. The development of an early and ultra-sensitive detection system is the first critical step in controlling this disease. To accomplish this, we used the cell systematic evolution of ligands by exponential enrichment (Cell-SELEX) technique  to identify single-stranded DNA (ssDNA) aptamers to be used as detection probes that can specifically bind to S. enteritidis and S. typhimurium. A total of 12 target-specific ssDNA aptamers were obtained through ten rounds of Cell-SELEX under stringent selection conditions, and negative selection further enhanced the selectivity among these aptamers. Aptamer specificity was investigated using the  gram-negative bacteria E. coli and P. aeruginosa and was found to be much higher  towards S. enteritidis and S. typhimurium. Importantly, three candidate aptamers  demonstrated higher binding affinities and the dissociation constants (Kd) were found to be in the range of nanomolar to submicromolar levels. Furthermore, individual aptamers were conjugated onto polyvalent directed aptamer polymer, which led to 100-fold increase in binding affinity compared to the individual aptamers alone. Taken together, this study reports the identification of higher affinity and specificity ssDNA aptamers (30mer), which may be useful as capture and detection probes in biosensor-based detection systems for salmonellosis. 
25008464	 In order to better control nosocomial infections, and facilitate the most prudent and effective use of antibiotics, improved strategies for the rapid detection and identification of problematic bacterial pathogens are required. DNA aptamers have much potential in the development of diagnostic assays and biosensors to address  this important healthcare need, but further development of aptamers targeting common pathogens, and the strategies used to obtain specific aptamers are required. Here we demonstrate the application of a quantitative PCR (qPCR) controlled Cell-SELEX process, coupled with downstream secondary-conformation-based aptamer profiling. We used this approach to identify and select DNA aptamers targeted against uropathogenic Escherichia coli, for which specific aptamers are currently lacking, despite the prevalence of these infections. The use of qPCR to monitor the Cell-SELEX process permitted a minimal number of SELEX cycles to be employed, as well as the cycle-by-cycle optimisation of standard PCR amplification of recovered aptamer pools at each round. Identification of useful aptamer candidates was also facilitated by profiling of  secondary conformations and selection based on putative aptamer secondary structure. One aptamer selected this way (designated EcA5-27), displaying a guanine-quadruplex sequence motif, was shown to have high affinity and specificity for target cells, and the potential to discriminate between distinct  strains of E. coli, highlighting the possibility for development of aptamers selectively recognising pathogenic strains. Overall, the identified aptamers hold much potential for the development of rapid diagnostic assays for nosocomial urinary tract infections caused by E. coli. 
25096872	 mRNA profiling of pathogens during the course of human infections gives detailed  information on the expression levels of relevant genes that drive pathogenicity and adaptation and at the same time allows for the delineation of phylogenetic relatedness of pathogens that cause specific diseases. In this study, we used mRNA sequencing to acquire information on the expression of Escherichia coli pathogenicity genes during urinary tract infections (UTI) in humans and to assign the UTI-associated E. coli isolates to different phylogenetic groups. Whereas the in vivo gene expression profiles of the majority of genes were conserved among 21 E. coli strains in the urine of elderly patients suffering from an acute UTI, the specific gene expression profiles of the flexible genomes was diverse and reflected phylogenetic relationships. Furthermore, genes transcribed in vivo relative to laboratory media included well-described virulence factors, small regulatory RNAs, as well as genes not previously linked to bacterial virulence. Knowledge on relevant transcriptional responses that drive pathogenicity and adaptation of isolates to the human host might lead to the introduction of a virulence typing strategy into clinical microbiology, potentially facilitating management and prevention of the disease. Importance: Urinary tract infections (UTI) are very common; at least half of all women experience UTI, most of which are caused by pathogenic Escherichia coli strains. In this study, we applied massive parallel cDNA sequencing (RNA-seq) to provide unbiased, deep, and accurate insight into the nature and the dimension of the uropathogenic E. coli gene expression profile during an acute UTI within the human host. This work was  undertaken to identify key players in physiological adaptation processes and, hence, potential targets for new infection prevention and therapy interventions specifically aimed at sabotaging bacterial adaptation to the human host. 
24933631	 There has been much recent interest in systems biology for investigating the structure of gene regulatory systems. Such networks are often formed of specific  patterns, or network motifs, that are interesting from a biological point of view. Our aim in the present paper is to compare statistical methods specifically with regard to the question of how well they can detect such motifs. One popular  approach is by network analysis with Gaussian graphical models (GGMs), which are  statistical models associated with undirected graphs, where vertices of the graph represent genes and edges indicate regulatory interactions. Gene expression microarray data allow us to observe the amount of mRNA simultaneously for a large number of genes p under different experimental conditions n, where p is usually much larger than n prohibiting the use of standard methods. We therefore compare  the performance of a number of procedures that have been specifically designed to address this large p-small n issue: G-Lasso estimation, Neighbourhood selection,  Shrinkage estimation using empirical Bayes for model selection, and PC-algorithm. We found that all approaches performed poorly on the benchmark E. coli network. Hence we systematically studied their ability to detect specific network motifs,  pairs, hubs and cascades, in extensive simulations. We conclude that all methods  have difficulty detecting hubs, but the PC-algorithm is most promising. 
25068267	 Rapid molecular identification of carbapenemase genes in Gram-negative bacteria is crucial for infection control and prevention, surveillance and for epidemiological purposes. Furthermore, it may have a significant impact upon determining the appropriate initial treatment and greatly benefit for critically  ill patients. A novel oligonucleotide microarray-based assay was developed to simultaneously detect genes encoding clinically important carbapenemases as well  as selected extended (ESBL) and narrow spectrum (NSBL) beta-lactamases directly from clonal culture material within few hours. Additionally, a panel of species specific markers was included to identify Escherichia coli, Pseudomonas aeruginosa, Citrobacter freundii/braakii, Klebsiella pneumoniae and Acinetobacter baumannii. The assay was tested using a panel of 117 isolates collected from urinary, blood and stool samples. For these isolates, phenotypic identifications  and susceptibility tests were available. An independent detection of carbapenemase, ESBL and NSBL genes was carried out by various external reference  laboratories using PCR methods. In direct comparison, the microarray correctly identified 98.2% of the covered carbapenemase genes. This included blaVIM (13 out of 13), blaGIM (2/2), blaKPC (27/27), blaNDM (5/5), blaIMP-2/4/7/8/13/14/15/16/31 (10/10), blaOXA-23 (12/13), blaOXA-40-group (7/7), blaOXA-48-group (32/33), blaOXA-51 (1/1) and blaOXA-58 (1/1). Furthermore, the test correctly identified additional beta-lactamases [blaOXA-1 (16/16), blaOXA-2 (4/4), blaOXA-9 (33/33), OXA-10 (3/3), blaOXA-51 (25/25), blaOXA-58 (2/2), CTX-M1/M15 (17/17) and blaVIM (1/1)]. In direct comparison to phenotypical identification obtained by VITEK or  MALDI-TOF systems, 114 of 117 (97.4%) isolates, including Acinetobacter baumannii (28/28), Enterobacter spec. (5/5), Escherichia coli (4/4), Klebsiella pneumoniae  (62/63), Klebsiella oxytoca (0/2), Pseudomonas aeruginosa (12/12), Citrobacter freundii (1/1) and Citrobacter braakii (2/2), were correctly identified by a panel of species specific probes. This assay might be easily extended, adapted and transferred to point of care platforms enabling fast surveillance, rapid detection and appropriate early treatment of infections caused by multiresistant  Gram-negative bacteria. 
24799627	 Certain verocytotoxin-producing Escherichia coli (VTEC) O157 phage types (PTs), such as PT8 and PT2, are associated with severe human infections, while others, such as PT21, seem to be restricted to cattle. In an attempt to delve into the mechanisms underlying such a differential distribution of PTs, we performed microarray comparison of human PT8 and animal PT21 VTEC O157 isolates. The main differences observed were in the vtx2-converting phages, with the PT21 strains bearing a phage identical to that present in the reference strain EDL933, BP933W, and all the PT8 isolates displaying lack of hybridization in some regions of the  phage genome. We focused on the region spanning the gam and cII genes and developed a PCR tool to investigate the presence of PT8-like phages in a panel of VTEC O157 strains belonging to different PTs and determined that a vtx2 phage reacting with the primers deployed, which we named Φ8, was more frequent in VTEC  O157 strains from human disease than in bovine strains. No differences were observed in the production of the VT2 mRNA when Φ8-positive strains were compared with VTEC O157 possessing BP933W. Nevertheless, we show that the gam-cII region of phage Φ8 might carry genetic determinants downregulating the transcription of  the genes encoding the components of the type III secretion system borne on the locus of enterocyte effacement pathogenicity island. 
24595804	 Author information:  (1)Institute of Hygiene and Infectious Diseases of Animals, Justus-Liebig University Giessen, Giessen, Germany christa.ewers@vetmed.uni-giessen.de. (2)Vet Med Labor GmbH, Division of IDEXX Laboratories, Ludwigsburg, Germany. (3)Institute of Hygiene and Infectious Diseases of Animals, Justus-Liebig University Giessen, Giessen, Germany. (4)Institute of Microbiology and Epizootics, Free University Berlin, Berlin, Germany. (5)Robert Koch Institute, Wernigerode, Germany. 
24934981	 BACKGROUND: Genome-wide association studies have revealed that rare variants are  responsible for a large portion of the heritability of some complex human diseases. This highlights the increasing importance of detecting and screening for rare variants. Although the massively parallel sequencing technologies have greatly reduced the cost of DNA sequencing, the identification of rare variant carriers by large-scale re-sequencing remains prohibitively expensive because of  the huge challenge of constructing libraries for thousands of samples. Recently,  several studies have reported that techniques from group testing theory and compressed sensing could help identify rare variant carriers in large-scale samples with few pooled sequencing experiments and a dramatically reduced cost. RESULTS: Based on quantitative group testing, we propose an efficient overlapping pool sequencing strategy that allows the efficient recovery of variant carriers in numerous individuals with much lower costs than conventional methods. We used  random k-set pool designs to mix samples, and optimized the design parameters according to an indicative probability. Based on a mathematical model of sequencing depth distribution, an optimal threshold was selected to declare a pool positive or negative. Then, using the quantitative information contained in  the sequencing results, we designed a heuristic Bayesian probability decoding algorithm to identify variant carriers. Finally, we conducted in silico experiments to find variant carriers among 200 simulated Escherichia coli strains. With the simulated pools and publicly available Illumina sequencing data, our method correctly identified the variant carriers for 91.5-97.9% variants with the variant frequency ranging from 0.5 to 1.5%. CONCLUSIONS: Using the number of reads, variant carriers could be identified precisely even though samples were randomly selected and pooled. Our method performed better than the published DNA Sudoku design and compressed sequencing,  especially in reducing the required data throughput and cost. 
24440519	 Previously, large-scale proteomics was possible only for organisms whose genomes  were sequenced, meaning the most common model organisms. The use of next-generation sequencers is now changing the deal. With "proteogenomics", the use of experimental proteomics data to refine genome annotations, a higher integration of omics data is gaining ground. By extension, combining genomic and  proteomic data is becoming routine in many research projects. "Proteogenomic"-flavored approaches are currently expanding, enabling the molecular studies of non-model organisms at an unprecedented depth. Today draft genomes can be obtained using next-generation sequencers in a rather straightforward way and at a reasonable cost for any organism. Unfinished genome  sequences can be used to interpret tandem mass spectrometry proteomics data without the need for time-consuming genome annotation, and the use of RNA-seq to  establish nucleotide sequences that are directly translated into protein sequences appears promising. There are, however, certain drawbacks that deserve further attention for RNA-seq to become more efficient. Here, we discuss the opportunities of working with non-model organisms, the proteomic methods that have been used until now, and the dramatic improvements proffered by proteogenomics. These put the distinction between model and non-model organisms in great danger, at least in terms of proteomics!BIOLOGICAL SIGNIFICANCE: Model organisms have been crucial for in-depth analysis of cellular and molecular processes of life. Focusing the efforts of thousands of researchers on the Escherichia coli bacterium, Saccharomyces cerevisiae yeast, Arabidopsis thaliana  plant, Danio rerio fish and other models for which genetic manipulation was possible was certainly worthwhile in terms of fundamental and invaluable biological insights. Until recently, proteomics of non-model organisms was limited to tedious, homology-based techniques, but today draft genomes or RNA-seq data can be straightforwardly obtained using next-generation sequencers, allowing the establishment of a draft protein database for any organism. Thus, proteogenomics opens new perspectives for molecular studies of non-model organisms, although they are still difficult experimental organisms. This article is part of a Special Issue entitled: Proteomics of non-model organisms. 
25018749	 Analysis of microbial gene expression during host colonization provides valuable  information on the nature of interaction, beneficial or pathogenic, and the adaptive processes involved. Isolation of bacterial mRNA for in planta analysis can be challenging where host nucleic acid may dominate the preparation, or inhibitory compounds affect downstream analysis, e.g., quantitative reverse transcriptase PCR (qPCR), microarray, or RNA-seq. The goal of this work was to optimize the isolation of bacterial mRNA of food-borne pathogens from living plants. Reported methods for recovery of phytopathogen-infected plant material, using hot phenol extraction and high concentration of bacterial inoculation or large amounts of infected tissues, were found to be inappropriate for plant roots inoculated with Escherichia coli O157:H7. The bacterial RNA yields were too low and increased plant material resulted in a dominance of plant RNA in the sample.  To improve the yield of bacterial RNA and reduce the number of plants required, an optimized method was developed which combines bead beating with directed bacterial lysis using SDS and lysozyme. Inhibitory plant compounds, such as phenolics and polysaccharides, were counteracted with the addition of high-molecular-weight polyethylene glycol and hexadecyltrimethyl ammonium bromide. The new method increased the total yield of bacterial mRNA substantially and allowed assessment of gene expression by qPCR. This method can be applied to  other bacterial species associated with plant roots, and also in the wider context of food safety. 
24886751	 BACKGROUND: Diagnosis at an early stage of chronic pancreatitis (CP) is challenging. It has been reported that microRNAs (miRNAs) are increasingly found  and applied as targets for the diagnosis and treatment of various cancers. However, to the best of our knowledge, few published papers have described the role of miRNAs in the diagnosis of CP. METHOD: We downloaded gene expression profile data from the Gene Expression Omnibus and identified differentially expressed genes (DEGs) between CP and normal samples of Harlan mice and Jackson Laboratory mice. Common DEGs were filtered out, and the semantic similarities of gene classes were calculated using the GOSemSim software package. The gene class with the highest functional consistency was selected, and then the Lists2Networks web-based system was used to analyse regulatory relationships between miRNAs and gene classes. The functional enrichment of the gene classes was assessed based on Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes pathway annotation terms. RESULTS: A total of 405 common upregulated DEGs and 7 common downregulated DEGs were extracted from the two kinds of mice. Gene cluster D was selected from the common upregulated DEGs because it had the highest semantic similarity. miRNA 124a (miR-124a) was found to have a significant regulatory relationship with cluster D, and DEGs such as CHSY1 and ABCC4 were found to be regulated by miR-124a. The GO term of response to DNA damage stimulus and the pathway of Escherichia coli infection were significantly enriched in cluster D. CONCLUSION: DNA damage and E. coli infection might play important roles in CP pathogenesis. In addition, miR-124a might be a potential target for the diagnosis and treatment of CP. 
24884724	 BACKGROUND: Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. RESULTS: In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis,  Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. CONCLUSION: We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available. 
24886210	 BACKGROUND: Common approaches to pathway analysis treat pathways merely as lists  of genes disregarding their topological structures, that is, ignoring the genes'  interactions on which a pathway's cellular function depends. In contrast, PathWave has been developed for the analysis of high-throughput gene expression data that explicitly takes the topology of networks into account to identify both global dysregulation of and localized (switch-like) regulatory shifts within metabolic and signaling pathways. For this purpose, it applies adjusted wavelet transforms on optimized 2D grid representations of curated pathway maps. RESULTS: Here, we present the new version of PathWave with several substantial improvements including a new method for optimally mapping pathway networks unto compact 2D lattice grids, a more flexible and user-friendly interface, and pre-arranged 2D grid representations. These pathway representations are assembled for several species now comprising H. sapiens, M. musculus, D. melanogaster, D. rerio, C. elegans, and E. coli. We show that PathWave is more sensitive than common approaches and apply it to RNA-seq expression data, identifying crucial metabolic pathways in lung adenocarcinoma, as well as microarray expression data, identifying pathways involved in longevity of Drosophila. CONCLUSIONS: PathWave is a generic method for pathway analysis complementing established tools like GSEA, and the update comprises efficient new features. In  contrast to the tested commonly applied approaches which do not take network topology into account, PathWave enables identifying pathways that are either known be involved in or very likely associated with such diverse conditions as human lung cancer or aging of D. melanogaster. The PathWave R package is freely available at http://www.ichip.de/software/pathwave.html. 
24884349	 BACKGROUND: A means to predict the effects of gene over-expression, knockouts, and environmental stimuli in silico is useful for system biologists to develop and test hypotheses. Several studies had predicted the expression of all Escherichia coli genes from sequences and reported a correlation of 0.301 between predicted and actual expression. However, these do not allow biologists to study  the effects of gene perturbations on the native transcriptome. RESULTS: We developed a predictor to predict transcriptome-scale gene expression  from a small number (n = 59) of known gene expressions using gene co-expression network, which can be used to predict the effects of over-expressions and knockdowns on E. coli transcriptome. In terms of transcriptome prediction, our results show that the correlation between predicted and actual expression value is 0.467, which is similar to the microarray intra-array variation (p-value = 0.348), suggesting that intra-array variation accounts for a substantial portion of the transcriptome prediction error. In terms of predicting the effects of gene perturbation(s), our results suggest that the expression of 83% of the genes affected by perturbation can be predicted within 40% of error and the correlation between predicted and actual expression values among the affected genes to be 0.698. With the ability to predict the effects of gene perturbations, we demonstrated that our predictor has the potential to estimate the effects of varying gene expression level on the native transcriptome. CONCLUSION: We present a potential means to predict an entire transcriptome and a tool to estimate the effects of gene perturbations for E. coli, which will aid biologists in hypothesis development. This study forms the baseline for future work in using gene co-expression network for gene expression prediction. 
24574290	 Fast and accurate identification and typing of pathogens are essential for effective surveillance and outbreak detection. The current routine procedure is based on a variety of techniques, making the procedure laborious, time-consuming, and expensive. With whole-genome sequencing (WGS) becoming cheaper, it has huge potential in both diagnostics and routine surveillance. The aim of this study was to perform a real-time evaluation of WGS for routine typing and surveillance of verocytotoxin-producing Escherichia coli (VTEC). In Denmark, the Statens Serum Institut (SSI) routinely receives all suspected VTEC isolates. During a 7-week period in the fall of 2012, all incoming isolates were concurrently subjected to  WGS using IonTorrent PGM. Real-time bioinformatics analysis was performed using web-tools (www.genomicepidemiology.org) for species determination, multilocus sequence type (MLST) typing, and determination of phylogenetic relationship, and  a specific VirulenceFinder for detection of E. coli virulence genes was developed as part of this study. In total, 46 suspected VTEC isolates were characterized in parallel during the study. VirulenceFinder proved successful in detecting virulence genes included in routine typing, explicitly verocytotoxin 1 (vtx1), verocytotoxin 2 (vtx2), and intimin (eae), and also detected additional virulence genes. VirulenceFinder is also a robust method for assigning verocytotoxin (vtx)  subtypes. A real-time clustering of isolates in agreement with the epidemiology was established from WGS, enabling discrimination between sporadic and outbreak isolates. Overall, WGS typing produced results faster and at a lower cost than the current routine. Therefore, WGS typing is a superior alternative to conventional typing strategies. This approach may also be applied to typing and surveillance of other pathogens. 
24766808	 Quantitative views of cellular functions require precise measures of rates of biomolecule production, especially proteins-the direct effectors of biological processes. Here, we present a genome-wide approach, based on ribosome profiling,  for measuring absolute protein synthesis rates. The resultant E. coli data set transforms our understanding of the extent to which protein synthesis is precisely controlled to optimize function and efficiency. Members of multiprotein complexes are made in precise proportion to their stoichiometry, whereas components of functional modules are produced differentially according to their hierarchical role. Estimates of absolute protein abundance also reveal principles for optimizing design. These include how the level of different types of transcription factors is optimized for rapid response and how a metabolic pathway (methionine biosynthesis) balances production cost with activity requirements. Our studies reveal how general principles, important both for understanding natural systems and for synthesizing new ones, emerge from quantitative analyses  of protein synthesis. 
24709835	 Toxin-antitoxin (TA) systems are widespread in prokaryotes. Among these, the mazEF TA system encodes an endoribonucleolytic toxin, MazF, that inhibits growth  by sequence-specific cleavage of single-stranded RNA. Defining the physiological  targets of a MazF toxin first requires the identification of its cleavage specificity, yet the current toolkit is antiquated and limited. We describe a rapid genome-scale approach, MORE (mapping by overexpression of an RNase in Escherichia coli) RNA-seq, for defining the cleavage specificity of endoribonucleolytic toxins. Application of MORE RNA-seq to MazF-mt3 from Mycobacterium tuberculosis reveals two critical ribosomal targets-the essential,  evolutionarily conserved helix/loop 70 of 23S rRNA and the anti-Shine-Dalgarno (aSD) sequence of 16S rRNA. Our findings support an emerging model where both ribosomal and messenger RNAs are principal targets of MazF toxins and suggest that, as in E. coli, removal of the aSD sequence by a MazF toxin modifies ribosomes to selectively translate leaderless mRNAs in M. tuberculosis. 
24622336	 We introduce a novel algorithm for inference of causal gene interactions, termed  CaSPIAN (Causal Subspace Pursuit for Inference and Analysis of Networks), which is based on coupling compressive sensing and Granger causality techniques. The core of the approach is to discover sparse linear dependencies between shifted time series of gene expressions using a sequential list-version of the subspace pursuit reconstruction algorithm and to estimate the direction of gene interactions via Granger-type elimination. The method is conceptually simple and  computationally efficient, and it allows for dealing with noisy measurements. Its performance as a stand-alone platform without biological side-information was tested on simulated networks, on the synthetic IRMA network in Saccharomyces cerevisiae, and on data pertaining to the human HeLa cell network and the SOS network in E. coli. The results produced by CaSPIAN are compared to the results of several related algorithms, demonstrating significant improvements in inference accuracy of documented interactions. These findings highlight the importance of Granger causality techniques for reducing the number of false-positives, as well as the influence of noise and sampling period on the accuracy of the estimates. In addition, the performance of the method was tested  in conjunction with biological side information of the form of sparse "scaffold networks", to which new edges were added using available RNA-seq or microarray data. These biological priors aid in increasing the sensitivity and precision of  the algorithm in the small sample regime. 
24606609	 BACKGROUND: MicroRNAs (miRNAs) can post-transcriptionally regulate gene expression and have been shown to be critical regulators to the fine-tuning of epithelial immune responses. However, the role of miRNAs in bovine responses to E. coli and S. aureus, two mastitis causing pathogens, is not well understood. RESULTS: The global expression of miRNAs in bovine mammary epithelial cells (MAC-T cells) challenged with and without heat-inactivated Staphylococcus aureus  (S. aureus) or Escherichia coli (E. coli) bacteria at 0, 6, 12, 24, and 48 hr was profiled using RNA-Seq. A total of 231 known bovine miRNAs were identified with more than 10 counts per million in at least one of 13 libraries and 5 miRNAs including bta-miR-21-5p, miR-27b, miR-22-3p, miR-184 and let-7f represented more  than 50% of the abundance. One hundred and thirteen novel miRNAs were also identified and more than one third of them belong to the bta-miR-2284 family. Seventeen miRNAs were significantly (P < 0.05) differentially regulated by the presence of pathogens. E. coli initiated an earlier regulation of miRNAs (6 miRNAs differentially regulated within the first 6 hrs post challenge as compared to 1 miRNA for S. aureus) while S. aureus presented a delayed response. Five differentially expressed miRNAs (bta-miR-184, miR-24-3p, miR-148, miR-486 and let-7a-5p) were unique to E. coli while four (bta-miR-2339, miR-499, miR-23a and  miR-99b) were unique to S. aureus. In addition, our study revealed a temporal differential regulation of five miRNAs (bta-miR-193a-3p, miR-423-5p, miR-30b-5p,  miR-29c and miR-un116) in unchallenged cells. Target gene predictions of pathogen differentially expressed miRNAs indicate a significant enrichment in gene ontology functional categories in development/cellular processes, biological regulation as well as cell growth and death. Furthermore, target genes were significantly enriched in several KEGG pathways including immune system, signal transduction, cellular process, nervous system, development and human diseases. CONCLUSION: Using next-generation sequencing, our study identified a pathogen directed differential regulation of miRNAs in MAC-T cells with roles in immunity  and development. Our study provides a further confirmation of the involvement of  mammary epithelia cells in contributing to the immune response to infecting pathogens and suggests the potential of miRNAs to serve as biomarkers for diagnosis and development of control measures. 
24556669	 Campylobacter has developed resistance to several antimicrobial agents over the years, including macrolides, quinolones and fluoroquinolones, becoming a significant public health hazard. A total of 145 strains derived from raw milk, chicken faeces, chicken carcasses, cattle faeces and human faeces collected from  various Italian regions, were screened for antimicrobial susceptibility, molecular characterization (SmaI pulsed-field gel electrophoresis) and detection  of virulence genes (sequencing and DNA microarray analysis). The prevalence of C. jejuni and C. coli was 62.75% and 37.24% respectively. Antimicrobial susceptibility revealed a high level of resistance for ciprofloxacin (62.76%), tetracycline (55.86%) and nalidixic acid (55.17%). Genotyping of Campylobacter isolates using PFGE revealed a total of 86 unique SmaI patterns. Virulence gene profiles were determined using a new microbial diagnostic microarray composed of  70-mer oligonucleotide probes targeting genes implicated in Campylobacter pathogenicity. Correspondence between PFGE and microarray clusters was observed.  Comparisons of PFGE and virulence profiles reflected the high genetic diversity of the strains examined, leading us to speculate different degrees of pathogenicity inside Campylobacter populations. 
24551073	 Disease outbreaks due to the consumption of legume seedlings contaminated with human enteric bacterial pathogens like Escherichia coli O157:H7 and Salmonella enterica are reported every year. Besides contaminations occurring during food processing, pathogens present on the surface or interior of plant tissues are also responsible for such outbreaks. In the present study, surface and internal colonization of Medicago truncatula, a close relative of alfalfa, by Salmonella enterica and Escherichia coli O157:H7 were observed even with inoculum levels as  low as two bacteria per plant. Furthermore, expression analyses revealed that approximately 30% of Medicago truncatula genes were commonly regulated in response to both of these enteric pathogens. This study highlights that very low  inoculum doses trigger responses from the host plant and that both of these human enteric pathogens may in part use similar mechanisms to colonize legume seedlings. 
24298918	 In this study, an improvement in the oligonucleotide-based DNA microarray for the genoserotyping of Escherichia coli is presented. Primer and probes for additional 70 O antigen groups were developed. The microarray was transferred to a new platform, the ArrayStrip format, which allows high through-put tests in 96-well formats and fully automated microarray analysis. Thus, starting from a single colony, it is possible to determine within a few hours and a single experiment, 94 of the over 180 known O antigen groups as well as 47 of the 53 different H antigens. The microarray was initially validated with a set of defined reference  strains that had previously been serotyped by conventional agglutination in various reference centers. For further validation of the microarray, 180 clinical E. coli isolates of human origin (from urine samples, blood cultures, bronchial secretions, and wound swabs) and 53 E. coli isolates from cattle, pigs, and poultry were used. A high degree of concordance between the results of classical  antibody-based serotyping and DNA-based genoserotyping was demonstrated during validation of the new 70 O antigen groups as well as for the field strains of human and animal origin. Therefore, this oligonucleotide array is a diagnostic tool that is user-friendly and more efficient than classical serotyping by agglutination. Furthermore, the tests can be performed in almost every routine lab and are easily expanded and standardized. 
23754709	 A DNA macroarray was developed to provide the ability to detect multiple foodborne pathogens in fresh chicken meat. Probes targeted to the 16S rRNA and genus- and species-specific genes, including fimY, ipaH, prfA, and uspA, were selected for the specific detection of Salmonella spp., Shigella spp., Listeria monocytogenes, and Escherichia coli, respectively. The combination of target gene amplification by PCR and a DNA macroarray in our system was able to distinguish all target bacteria from pure cultures with a detection sensitivity of 10⁵ c.f.u. ml⁻¹. The DNA macroarray was also applied to 10 fresh chicken meat samples. The assay validation demonstrated that by combining the enrichment steps for the target bacteria and the DNA macroarray, all 4 target bacteria could be detected simultaneously from the fresh chicken samples. The sensitivity of L. monocytogenes and Shigella boydii detection in the fresh chicken samples was at least 10 and 3 c.f.u. of the initial contamination in 25 g samples, respectively. The advantages of our developed protocol are high accuracy and time reduction when compared to conventional culture. The macroarray developed in our investigation was cost effective compared to modern oligonucleotide microarray techniques because there was no expensive equipment required for the detection of multiple foodborne pathogens. 
24267595	 BACKGROUND: Serratia sp. ATCC 39006 (S39006) is a Gram-negative enterobacterium that is virulent in plant and animal models. It produces a red-pigmented trypyrrole secondary metabolite, prodigiosin (Pig), and a carbapenem antibiotic (Car), as well as the exoenzymes, pectate lyase and cellulase. Secondary metabolite production in this strain is controlled by a complex regulatory network involving quorum sensing (QS). Hfq and RsmA (two RNA binding proteins and major post-transcriptional regulators of gene expression) play opposing roles in  the regulation of several key phenotypes within S39006. Prodigiosin and carbapenem production was abolished, and virulence attenuated, in an S39006 ∆hfq  mutant, while the converse was observed in an S39006 rsmA transposon insertion mutant. RESULTS: In order to define the complete regulon of Hfq and RsmA, deep sequencing of cDNA libraries (RNA-seq) was used to analyse the whole transcriptome of S39006 ∆hfq and rsmA::Tn mutants. Moreover, we investigated global changes in the proteome using an LC-MS/MS approach. Analysis of differential gene expression showed that Hfq and RsmA directly or indirectly regulate (at the level of RNA) 4% and 19% of the genome, respectively, with some correlation between RNA and protein expression. Pathways affected include those involved in antibiotic regulation, virulence, flagella synthesis, and surfactant production. Although Hfq and RsmA are reported to activate flagellum production in E. coli and an adherent-invasive E. coli hfq mutant was shown to have no flagella by electron microscopy, we found that flagellar production was increased in the S39006 rsmA and hfq mutants. Additionally, deletion of rsmA resulted in greater genomic flux  with increased activity of two mobile genetic elements. This was confirmed by qPCR and analysis of rsmA culture supernatant revealed the presence of prophage DNA and phage particles. Finally, expression of a hypothetical protein containing DUF364 increased prodigiosin production and was controlled by a putative 5' cis-acting regulatory RNA element. CONCLUSION: Using a combination of transcriptomics and proteomics this study provides a systems-level understanding of Hfq and RsmA regulation and identifies  similarities and differences in the regulons of two major regulators. Additionally our study indicates that RsmA regulates both core and variable genome regions and contributes to genome stability. 
23978634	 Conventional methods for detection of infective organisms, such as Salmonella, are complicated and require multiple steps, and the need for rapid detection has  increased. Biosensors show great potential for rapid detection of pathogens. In turn, aptamers have great potential for biosensor assay development, given their  small size, ease of synthesis and labeling, lack of immunogenicity, a lower cost  of production than antibodies, and high target specificity. In this study, ssDNA  aptamers specific to Salmonella Typhimurium were obtained by a whole bacterium-based systematic evolution of ligands by exponential enrichment (SELEX) procedure and applied to probing S. Typhimurium. After 10 rounds of selection with S. Typhimurium as the target and Salmonella Enteritidis, Escherichia coli and Staphylococcus aureus as counter targets, the highly enriched oligonucleic acid pool was sorted using flow cytometry. In total, 12 aptamer candidates from different families were sequenced and grouped. Fluorescent analysis demonstrated  that aptamer C4 had particularly high binding affinity and selectivity; this aptamer was then further characterized. 
23620454	 According to estimates issued by the Center for Disease Control and Prevention, one out of six Americans will get sick during this year due to consumption of contaminated products and there will be 50,000 related hospitalizations. To control and treat the responsible foodborne diseases, rapid and accurate detection of pathogens is extremely important. A portable device capable of performing nucleic acid amplification will enable the effective detection of infectious agents in multiple settings, leading to better enforcement of food safety regulations. This work demonstrates the multiplexed detection of food pathogens through loop-mediated isothermal amplification on a silicon chip. Silane passivation is used to prevent the adsorption of the polymerase on silicon oxide, which can severely inhibit nucleic acid amplification. We demonstrate the  multiplexed screening of virulence genes of Listeria monocytogenes, Escherichia coli, and Salmonella by dehydrating the corresponding primers in oxidized silicon wells. Droplets of 30 nL with reagents for nucleic acid amplification and lysate  of suspected pathogens are arrayed on micro-machined wells with an automated microinjection system. We show that dehydrated primers re-suspend when other reagents are microinjected, and the resulting mix can be used to specifically amplify the targeted gene. Results of characterization experiments demonstrate sensitivity down to a few templates per reaction, specificity that enables multiplexed screening, and robustness that allows amplification without DNA extraction. 
23568752	 Proteus mirabilis is a prominent cause of catheter-associated urinary tract infections (CAUTIs) among patients undergoing long-term bladder catheterization.  There are currently no effective means of preventing P. mirabilis infections, and strategies for prophylaxis and rapid early diagnosis are urgently required. Aptamers offer significant potential for development of countermeasures against P. mirabilis CAUTI and are an ideal class of molecules for the development of diagnostics and therapeutics. Here we demonstrate the application of Cell-SELEX to identify DNA aptamers that show high affinity for P. mirabilis. While the aptamers identified displayed high affinity for P. mirabilis cells in dot blotting assays, they also bound to other uropathogenic bacteria. To improve aptamer specificity for P. mirabilis, an in silico maturation (ISM) approach was  employed. Two cycles of ISM allowed the identification of an aptamer showing 36%  higher specificity, evaluated as a ratio of binding signal for P. mirabilis to that for Escherichia coli (also a cause of CAUTI and the most common urinary tract pathogen). Aptamers that specifically recognize P. mirabilis would have diagnostic and therapeutic values and constitute useful tools for studying membrane-associated proteins in this organism. 
23945601	 Cyanobacteria (blue-green algae) play profound roles in ecology and biogeochemistry. One model cyanobacterial species is the unicellular cyanobacterium Synechocystis sp. PCC 6803. This species is highly amenable to genetic modification. Its genome has been sequenced and many systems biology and  molecular biology tools are available to study this bacterium. Recently, researchers have put significant efforts into understanding and engineering this  bacterium to produce chemicals and biofuels from sunlight and CO2. To demonstrate our perspective on the application of this cyanobacterium as a photosynthesis-based chassis, we summarize the recent research on Synechocystis 6803 by focusing on five topics: rate-limiting factors for cell cultivation; molecular tools for genetic modifications; high-throughput system biology for genome wide analysis; metabolic modeling for physiological prediction and rational metabolic engineering; and applications in producing diverse chemicals.  We also discuss the particular challenges for systems analysis and engineering applications of this microorganism, including precise characterization of versatile cell metabolism, improvement of product rates and titers, bioprocess scale-up, and product recovery. Although much progress has been achieved in the development of Synechocystis 6803 as a phototrophic cell factory, the biotechnology for "Compounds from Synechocystis" is still significantly lagging behind those for heterotrophic microbes (e.g., Escherichia coli). 
23936031	 Molecular methods that enable the detection of antimicrobial resistance determinants are critical surveillance tools that are necessary to aid in curbing the spread of antibiotic resistance. In this study, we describe the use of the Antimicrobial Resistance Determinant Microarray (ARDM) that targets 239 unique genes that confer resistance to 12 classes of antimicrobial compounds, quaternary amines and streptothricin for the determination of multidrug resistance (MDR) gene profiles. Fourteen reference MDR strains, which either were genome, sequenced or possessed well characterized drug resistance profiles were used to optimize detection algorithms and threshold criteria to ensure the microarray's effectiveness for unbiased characterization of antimicrobial resistance determinants in MDR strains. The subsequent testing of Acinetobacter baumannii, Escherichia coli and Klebsiella pneumoniae hospital isolates revealed the presence of several antibiotic resistance genes [e.g. belonging to TEM, SHV, OXA  and CTX-M classes (and OXA and CTX-M subfamilies) of β-lactamases] and their assemblages which were confirmed by PCR and DNA sequence analysis. When combined  with results from the reference strains, ~25% of the ARDM content was confirmed as effective for representing allelic content from both Gram-positive and -negative species. Taken together, the ARDM identified MDR assemblages containing six to 18 unique resistance genes in each strain tested, demonstrating its utility as a powerful tool for molecular epidemiological investigations of antimicrobial resistance in clinically relevant bacterial pathogens. 
23758523	 Several bacteria, viruses, and parasites cause diarrhea as coinfecting pathogens. We designed a DNA microarray comprising 60-bp probes spotted 194 times for the multiplex detection of 33 enteropathogenic bacteria and seven enteropathogenic viruses, and the archaeon Methanobrevibacter smithii was used as an internal positive control. Nine pathogen-free stool specimens were used as negative controls. One of these control specimens was further spiked with Salmonella enterica as a positive control. The microarray was then tested with 40 pathological stool specimens, comprising S. enterica (n = 30), Campylobacter jejuni (n = 4), pathogenic Escherichia coli (n = 2), and adenovirus (n = 4). M. smithii was detected in 47/49 (95.9%) specimens, no pathogen was detected in negative controls and S. enterica was identified in the S. enterica-spiked positive control. The overall specificity was 100% and the overall sensitivity was 97.5% because one S. enterica sample was missed by the microarray. The multiplexed detection of C. jejuni spiked into an adenovirus-positive stool sample gave positive results, with fluorescence values of 14.3 and 9.1, respectively. These data indicate that using the protocol developed in this article, the DNA array allows for the multiplexed detection of some enteropathogens in stool samples. 
23840569	 The establishment and succession of bacterial communities in infants may have a profound impact in their health, but information about the composition of meconium microbiota and its evolution in hospitalized preterm infants is scarce.  In this context, the objective of this work was to characterize the microbiota of meconium and fecal samples obtained during the first 3 weeks of life from 14 donors using culture and molecular techniques, including DGGE and the Human Intestinal Tract Chip (HITChip) analysis of 16S rRNA amplicons. Culture techniques offer a quantification of cultivable bacteria and allow further study  of the isolate, while molecular techniques provide deeper information on bacterial diversity. Culture and HITChip results were very similar but the former showed lower sensitivity. Inter-individual differences were detected in the microbiota profiles although the meconium microbiota was peculiar and distinct from that of fecal samples. Bacilli and other Firmicutes were the main bacteria groups detected in meconium while Proteobacteria dominated in the fecal samples.  Culture technique showed that Staphylococcus predominated in meconium and that Enterococcus, together with Gram-negative bacteria such as Escherichia coli, Escherichia fergusonii, Klebsiella pneumoniae and Serratia marcescens, was more abundant in fecal samples. In addition, HITChip results showed the prevalence of  bacteria related to Lactobacillus plantarum and Streptococcus mitis in meconium samples whereas those related to Enterococcus, Escherichia coli, Klebsiella pneumoniae and Yersinia predominated in the 3(rd) week feces. This study highlights that spontaneously-released meconium of preterm neonates contains a specific microbiota that differs from that of feces obtained after the first week of life. Our findings indicate that the presence of Serratia was strongly associated with a higher degree of immaturity and other hospital-related parameters, including antibiotherapy and mechanical ventilation. 
23570874	 Adenomatous polyposis coli (APC) and K-ras are the two most frequently mutated genes found in human colorectal cancers. In human colorectal cancers, Wnt signaling activation after the loss of APC is hypothesized to be the key event for adenoma initiation, whereas additional mutations such as Ras activation are required for the progression from adenoma to carcinoma. However, accumulating data have led to conflicting views regarding the precise role of Ras in APC loss-induced tumorigenesis. Here, using Drosophila midgut as a model system, we show that in the absence of Ras, APC mutant epithelial cells cannot initiate hyperplasia, suggesting that Ras plays an essential role in tumor initiation. Conversely, activating Ras by expressing oncogenic Ras or Raf in APC-deficient cells led to a blockage of cell differentiation and to preinvasive tumor outgrowth, characteristics that are shared by advanced colorectal carcinoma in humans. Mechanistically, we find that Ras is not required for Wnt signaling activation after APC loss, although Ras hyperactivation is able to potentiate Wnt signaling by increasing the cytoplasmic and nuclear accumulation of Armadillo/β-catenin via mechanisms independent of JNK/Rac1 or PI3K-Akt signaling, partly owing to the downregulation of DE-cadherin. Together with the data from gene expression analyses, our results indicate that both parallel and cooperative mechanisms of Wnt and Ras signaling are responsible for the initiation and progression of intestinal tumorigenesis after APC loss. 
23524674	 Salmonella is a major cause of food-borne disease in many countries. Serotype determination of Salmonella is important for disease assessment, infection control, and epidemiological surveillance. In this study, a microarray system that targets the O antigen-specific genes was developed for simultaneously detecting and identifying all 46 Salmonella O serogroups. Of these, 40 serogroups can be confidently identified, and the remaining 6, in three pairs (serogroups O67 and B, E1 and E4, and A and D1), need to be further distinguished from each other using PCR methods or conventional serotyping methods. The microarray was shown to be highly specific when evaluated against 293 Salmonella strains, 186 Shigella strains, representative Escherichia coli strains, and 10 strains of other bacterial species. The assay correctly identified 288 (98%) of the Salmonella strains. The detection sensitivity was determined to be 50 ng genomic  DNA per sample. By testing simulated samples in a tomato background, 2 to 8 CFU per gram inoculated could be detected after enrichment. This newly developed microarray assay is the first molecular protocol that can be used for the comprehensive detection and identification of all 46 Salmonella O serogroups. Compared to the traditional serogrouping method, the microarray provides a reliable, high-throughput, and sensitive approach that can be used for rapid identification of multiple Salmonella O serogroups simultaneously. 
23377948	 The detection and abundance of Escherichia coli in water is used to monitor and mandate the quality of drinking and recreational water. Distinguishing commensal  waterborne E. coli isolates from those that cause diarrhea or extraintestinal disease in humans is important for quantifying human health risk. A DNA microarray was used to evaluate the distribution of virulence genes in 148 E. coli environmental isolates from a watershed in eastern Ontario, Canada, and in eight clinical isolates. Their pathogenic potential was evaluated with Caenorhabditis elegans, and the concordance between the bioassay result and the pathotype deduced by genotyping was explored. Isolates identified as potentially  pathogenic on the basis of their complement of virulence genes were significantly more likely to be pathogenic to C. elegans than those determined to be potentially nonpathogenic. A number of isolates that were identified as nonpathogenic on the basis of genotyping were pathogenic in the infection assay,  suggesting that genotyping did not capture all potentially pathogenic types. The  detection of the adhesin-encoding genes sfaD, focA, and focG, which encode adhesins; of iroN2, which encodes a siderophore receptor; of pic, which encodes an autotransporter protein; and of b1432, which encodes a putative transposase, was significantly associated with pathogenicity in the infection assay. Overall,  E. coli isolates predicted to be pathogenic on the basis of genotyping were indeed so in the C. elegans infection assay. Furthermore, the detection of C. elegans-infective environmental isolates predicted to be nonpathogenic on the basis of genotyping suggests that there are hitherto-unrecognized virulence factors or combinations thereof that are important in the establishment of infection. 
23494620	 Alternative ligands such as nucleic acid aptamers can be used for pathogen capture and detection and offer advantages over antibodies, including reduced cost, ease of production and modification, and improved stability. DNA aptamers demonstrating binding specificity to Salmonella enterica serovar Typhimurium were identified by whole-cell-systematic evolution of ligands by exponential enrichment (SELEX) beginning with a combinatorial library of biotin-labeled single stranded DNA molecules. Aptamer specificity was achieved using whole-cell  counter-SELEX against select non-Salmonella genera. Aptamers binding to Salmonella were sorted, cloned, sequenced, and characterized for binding efficiency. Out of 18 candidate aptamers screened, aptamer S8-7 showed relatively high binding affinity with an apparent dissociation constant (K d value) of 1.73 ± 0.54 μM and was selected for further characterization. Binding exclusivity analysis of S8-7 showed low apparent cross-reactivity with other foodborne bacteria including Escherichia coli O157: H7 and Citrobacter braakii and moderate cross-reactivity with Bacillus cereus. Aptamer S8-7 was successfully used as a ligand for magnetic capture of serially diluted Salmonella Typhimurium cells, followed by downstream detection using qPCR. The lower limit of detection of the  aptamer magnetic capture-qPCR assay was 10(2)-10(3) CFU equivalents of Salmonella Typhimurium in a 290-μl sample volume. Mean capture efficiency ranged from 3.6 to 12.6 %. Unique aspects of the study included (a) the use of SELEX targeting whole cells; (b) the application of flow cytometry for aptamer pool selection, thereby  favoring purification of ligands with both high binding affinity and targeting abundant cell surface moieties; and (c) the use of pre-labeled primers that circumvented the need for post-selection ligand labeling. Taken together, this study provides proof-of-concept that biotinylated aptamers selected by whole-cell SELEX can be used in a qPCR-based capture-detection platform for Salmonella Typhimurium. 
23867670	 OBJECTIVE: To design a resistance gene detection chip that could, in parallel, detect common clinical drug resistance genes of Gram-negative bacteria. MATERIALS AND METHODS: Seventy clinically significant Gram-negative bacilli (Klebsiella pneumoniae, Escherichia coli, Enterobacter cloacae, Pseudomonas aeruginosa, Acinetobacter baumannii) were collected. According to the known resistance gene sequences, we designed and synthesized primers and probes, which  were used to prepare resistance gene detection chips, and finally we hybridized and scanned the gene detection chips. RESULTS: The results between the gene chip and polymerase chain reaction (PCR) were compared. The rate was consistently 100% in the eight kinds of resistance genes tested (TEM, SHV, CTX-M, DHA, CIT, VIM, KPC, OXA-23). One strain of Pseudomonas aeruginosa had the IMP, but it was not found by gene chip. CONCLUSION: The design of Gram-negative bacteria-resistant gene detection chip had better application value. 
23078902	 Diarrhoea in neonatal and early-weaned piglets due to enterotoxigenic Escherichia coli-F4 (ETEC-F4) is an important problem in the pig farming industry. There is substantial evidence for a genetic basis for susceptibility to ETEC-F4 since not  all pigs suffer from diarrhoea after an ETEC-F4 infection. A region on SSC13 has  been found to be in close linkage to the susceptibility of piglets for ETEC-F4ab,ac. Potential candidate genes on SSC13 have been examined and although  some polymorphisms were found to be in linkage disequilibrium with the phenotype, the causative mutation has not yet been found. In this study we are looking at the expression of porcine genes in relation to ETEC-F4ab,ac. With the aid of the  Affymetrix GeneChip Porcine Genome Array we were able to find differentially expressed genes between ETEC-F4ab,ac receptor positive (Fab,acR(+)) piglets without diarrhoea and F4ab,acR(+) piglets with diarrhoea or F4ab,acR(-) animals.  Since the susceptibility to ETEC-F4ab,ac was described as a Mendelian trait, it is not so surprisingly that only two differentially expressed genes, transferrin  receptor (TFRC) and trefoil factor 1 (TFF1), came out of the analysis. Although both genes could pass for functional candidate genes only TFRC also mapped to the region on SSC13 associated with susceptibility for ETEC-F4, which makes TFRC a positional functional candidate gene. Validation by qRT-PCR confirmed the differential expression of TFRC and TFF1. In piglets without diarrhoea, the expression of both genes was higher in F4ab,acR(+) than in F4ab,acR(-) piglets. Similarly, TFRC and TFF1 expression in F4ab,acR(+) piglets without diarrhoea was  also higher than in F4ab,acR(+) piglets with diarrhoea. Consequently, although both genes might not play a role as receptor for F4 fimbriae, they could be of great importance during an ETEC-F4 outbreak. An upregulation of TFRC can be a consequence of the piglets ability to raise an effective immune response. An elevation of TFF1, a protein involved in mucin formation, may also affect the piglet's capability to cope with ETEC bacteria, rather than being a receptor for  its fimbriae. 
23142137	 BACKGROUND & AIMS: The Wnt signaling pathway is required for maintenance of the intestinal epithelia; blocking this pathway reduces the proliferative capacity of the intestinal stem cells. However, aberrant Wnt signaling leads to intestinal cancer. We investigated the roles of the Wnt pathway in homeostasis of the intestinal epithelium and during malignant transformation in human cells and mice. METHODS: We performed chromatin immunoprecipitation (ChIP) with DNA microarray analysis (ChIP-on-chip) to identify genes regulated by Wnt signaling in human colorectal cancer cells Colo320, DLD1, LS174T, and SW480. Formation of intestinal tumor was induced in C57BL/6J mice using azoxymethane and dextran sulfate. Intestinal tissues from these mice, as well as Apc(+/Min) and Apc(CKO/CKO)/Lgr5-EGFP-IRES-CreERT2 mice, were analyzed by immunohistochemistry and in situ hybridization. RESULTS: We identified promoter regions of 960 genes that interacted with the Wnt pathway nuclear effector T-cell factor 4 in 4 different human colorectal cancer-derived cell lines; 18 of these promoters were present in all chromatin precipitates. Wnt signaling up-regulated a member of the tumor necrosis factor receptor superfamily called TROY. Levels of TROY messenger RNA were increased in  human cells with deficiencies in the adenomatous polyposis coli (APC) gene and in cells stimulated with the Wnt3a ligand. Expression of Troy was significantly up-regulated in neoplastic tissues from mice during intestinal tumorigenesis. Lineage tracing experiments revealed that Troy is produced specifically by fast-cycling intestinal stem cells. TROY associated with a unique marker of these cells, leucine-rich repeat-containing G-protein coupled receptor (LGR) 5. In organoids established from the intestinal crypts, Troy suppressed signaling mediated by R-spondin, a Wnt agonist. CONCLUSIONS: TROY is up-regulated in human colorectal cancer cell lines and in intestinal tumors in mice. It functions as a negative modulator of the Wnt pathway in LGR5-positive stem cells. 
22354794	 Campylobacter have emerged as the most common bacterial food-borne illness in the developed world. The ability to reduce Campylobacter infections in humans is linked to the full comprehension of the principal key aspects of its infection cycle. A microbial diagnostic microarray detecting Campylobacter housekeeping, structural, and virulence associated genes was designed and validated using genomic DNA from reference and field strains of Campylobacter jejuni and coli isolated from human, chicken, and raw milk. This microarray was confirmed to be a powerful diagnostic tool for monitoring emerging Campylobacter pathotypes as well as for epidemiological, environmental, and phylogenetic studies including the evaluation of genome plasticity. 
23327937	 RegulonDB provides curated information on the transcriptional regulatory network  of Escherichia coli and contains both experimental data and computationally predicted objects. To account for the heterogeneity of these data, we introduced  in version 6.0, a two-tier rating system for the strength of evidence, classifying evidence as either 'weak' or 'strong' (Gama-Castro,S., Jimenez-Jacinto,V., Peralta-Gil,M. et al. RegulonDB (Version 6.0): gene regulation model of Escherichia Coli K-12 beyond transcription, active (experimental) annotated promoters and textpresso navigation. Nucleic Acids Res., 2008;36:D120-D124.). We now add to our classification scheme the classification of high-throughput evidence, including chromatin immunoprecipitation (ChIP) and RNA-seq technologies. To integrate these data into RegulonDB, we present two strategies for the evaluation of confidence, statistical validation and independent cross-validation. Statistical validation involves verification of ChIP data for transcription factor-binding sites, using tools for motif discovery and quality assessment of the discovered matrices. Independent cross-validation combines independent evidence with the intention to mutually exclude false positives. Both statistical validation and cross-validation allow to upgrade subsets of data that are supported by weak evidence to a higher confidence level. Likewise, cross-validation of strong confidence data extends our two-tier rating  system to a three-tier system by introducing a third confidence score 'confirmed'. Database URL: http://regulondb.ccg.unam.mx/ 
23324411	 BACKGROUND: The most important disease of dairy cattle is mastitis, caused by the infection of the mammary gland by various micro-organisms. Although the transcriptional response of bovine mammary gland cells to in vitro infection has  been studied, the interplay and consequences of these responses in the in vivo environment of the mammary gland are less clear. Previously mammary gland quarters were considered to be unaffected by events occurring in neighbouring quarters. More recently infection of individual quarters with mastitis causing pathogens, especially Escherichia coli, has been shown to influence the physiology of neighbouring uninfected quarters. Therefore, the transcriptional responses of uninfected mammary gland quarters adjacent to quarters infected with two major mastitis causing pathogens, E. coli and Staphylococcus aureus, were compared. RESULTS: The bacteriologically sterile, within-animal control quarters exhibited  a transcriptional response to the infection of neighbouring quarters. The greatest response was associated with E. coli infection, while a weaker, yet significant, response occurred during S. aureus infection. The transcriptional responses of these uninfected quarters included the enhanced expression of many genes previously associated with mammary gland infections. Comparison of the transcriptional response of uninfected quarters to S. aureus and E. coli infection identified 187 differentially expressed genes, which were particularly  associated with cellular responses, e.g. response to stress. The most affected network identified by Ingenuity Pathway analysis has the immunosuppressor transforming growth factor beta 1 (TGFB1) at its hub and largely consists of genes more highly expressed in control quarters from S. aureus infected cows. CONCLUSIONS: Uninfected mammary gland quarters reacted to the infection of neighbouring quarters and the responses were dependent on pathogen type. Therefore, bovine udder quarters exhibit interdependence and should not be considered as separate functional entities. This suggests that mastitis pathogens not only interact directly with host mammary cells, but also influence discrete sites some distance away, which will affect their response to the subsequent spread of the infection. Understanding the underlying mechanisms may provide further clues for ways to control mammary gland infections. These results also have implications for the design of experimental studies investigating immune regulatory mechanisms in the bovine mammary gland. 
23090962	 AggR is a transcriptional regulator of enteroaggregative Escherichia coli (EAEC)  and has been proposed as the defining factor for typical EAEC strains. Expression of multiple putative virulence factors, including the aggregative adherence fimbriae (AAF), dispersin, the dispersin translocator Aat, and the Aai type VI secretion system, have been found to be regulated by AggR. Here, we confirm the existence of at least 44 AggR-regulated genes using DNA microarray and real-time  quantitative reverse transcription-PCR (qRT-PCR); these genes include chromosomal and plasmid-borne loci and 19 previously unsuspected genes. Two previously uncharacterized virulence plasmid-encoded open reading frames (ORFs) (designated  ORF3 and ORF4) exhibit significant identity with isoprenoid biosynthesis genes of Bacteria and Archaea. The predicted ORF4 product is closely related to isopentenyl isomerase (IDI) enzymes, whereas the predicted product of the adjacent ORF3 exhibits an aspartate-rich region that is common among trans-isoprenyl phosphate synthases. We show that mutations in these ORFs confer  changes in bacterial surface properties. AggR coordinately controls expression of a large number of EAEC genes. 
22803819	 Identification of bacterial modulons from series of gene expression measurements  on microarrays is a principal problem, especially relevant for inadequately studied but practically important species. Usage of a priori information on regulatory interactions helps to evaluate parameters for regulatory subnetwork inference. We suggest a procedure for modulon construction where a seed regulon is iteratively updated with genes having expression patterns similar to those for regulon member genes. A set of genes essential for a regulon is used to control modulon updating. Essential genes for a regulon were selected as a subset of regulon genes highly related by different measures to each other. Using Escherichia coli as a model, we studied how modulon identification depends on the data, including the microarray experiments set, the adopted relevance measure and the regulon itself. We have found that results of modulon identification are highly dependent on all parameters studied and thus the resulting modulon varies  substantially depending on the identification procedure. Yet, modulons that were  identified correctly displayed higher stability during iterations, which allows developing a procedure for reliable modulon identification in the case of less studied species where the known regulatory interactions are sparse. 
23417807	 Recent advances in homologous recombination in Escherichia coli have enabled improved genome engineering by multiplex recombineering. In this chapter, we present trackable multiplex recombineering (TRMR), a method for gene-trait mapping which creates simulated knockdown and overexpression mutants for virtually all genes in the E. coli genome. The method combines oligonucleotide synthesis with multiplex recombineering to create two libraries comprising of over 8,000 E. coli strains in total that can be selected for traits of interest via high-throughput screening or selection. DNA barcodes included in the recombineering cassette allow for rapid characterization of a naïve or selected population via DNA microarray analysis. Important considerations for oligonucleotide design, DNA library construction, recombineering, strain characterization, and selection are discussed. 
23409004	 Pseudomonas aeruginosa (Pae) is a clinically important opportunistic pathogen. Herein, we demonstrate that the PA1006 protein is critical for all nitrate reductase activities, growth as a biofilm in a continuous flow system, as well as virulence in mouse burn and rat lung model systems. Microarray analysis revealed  that ΔPA1006 cells displayed extensive alterations in gene expression including nitrate-responsive, quorum sensing (including PQS production), and iron-regulated genes, as well as molybdenum cofactor and Fe-S cluster biosynthesis factors, members of the TCA cycle, and Type VI Secretion System components. Phenotype Microarray™ profiles of ΔPA1006 aerobic cultures using Biolog plates also revealed a reduced ability to utilize a number of TCA cycle intermediates as well as a failure to utilize xanthine as a sole source of nitrogen. As a whole, these  data indicate that the loss of PA1006 confers extensive changes in Pae metabolism. Based upon homology of PA1006 to the E. coli YhhP protein and data from the accompanying study, loss of PA1006 persulfuration and/or molybdenum homeostasis are likely the cause of extensive metabolic alterations that impact biofilm development and virulence in the ΔPA1006 mutant. 
23326304	 Staphylococcus aureus causes a spectrum of human infection. Diagnostic delays and uncertainty lead to treatment delays and inappropriate antibiotic use. A growing  literature suggests the host's inflammatory response to the pathogen represents a potential tool to improve upon current diagnostics. The hypothesis of this study  is that the host responds differently to S. aureus than to E. coli infection in a quantifiable way, providing a new diagnostic avenue. This study uses Bayesian sparse factor modeling and penalized binary regression to define peripheral blood gene-expression classifiers of murine and human S. aureus infection. The murine-derived classifier distinguished S. aureus infection from healthy controls and Escherichia coli-infected mice across a range of conditions (mouse and bacterial strain, time post infection) and was validated in outbred mice (AUC>0.97). A S. aureus classifier derived from a cohort of 94 human subjects distinguished S. aureus blood stream infection (BSI) from healthy subjects (AUC 0.99) and E. coli BSI (AUC 0.84). Murine and human responses to S. aureus infection share common biological pathways, allowing the murine model to classify S. aureus BSI in humans (AUC 0.84). Both murine and human S. aureus classifiers were validated in an independent human cohort (AUC 0.95 and 0.92, respectively).  The approach described here lends insight into the conserved and disparate pathways utilized by mice and humans in response to these infections. Furthermore, this study advances our understanding of S. aureus infection; the host response to it; and identifies new diagnostic and therapeutic avenues. 
23242319	 Our previous genetic, pharmacological and analogue protection studies identified  the glycosphingolipid, Gb(3) (globotriaosylceramide, Pk blood group antigen) as a natural resistance factor for HIV infection. Gb(3) is a B cell marker (CD77), but a fraction of activated peripheral blood mononuclear cells (PBMCs) can also express Gb(3). Activated PBMCs predominantly comprise CD4+ T-cells, the primary HIV infection target. Gb(3) is the sole receptor for Escherichia coli verotoxins  (VTs, Shiga toxins). VT1 contains a ribosome inactivating A subunit (VT1A) non-covalently associated with five smaller receptor-binding B subunits. The effect of VT on PHA/IL2-activated PBMC HIV susceptibility was determined. Following VT1 (or VT2) PBMC treatment during IL2/PHA activation, the small Gb(3)+/CD4+ T-cell subset was eliminated but, surprisingly, remaining CD4+ T-cell HIV-1(IIIB) (and HIV-1(Ba-L)) susceptibility was significantly reduced. The Gb(3)-Jurkat T-cell line was similarly protected by brief VT exposure prior to HIV-1(IIIB) infection. The efficacy of the VT1A subunit alone confirmed receptor  independent protection. VT1 showed no binding or obvious Jurkat cell/PBMC effect. Protective VT1 concentrations reduced PBMC (but not Jurkat cell) proliferation by 50%. This may relate to the mechanism of action since HIV replication requires primary T-cell proliferation. Microarray analysis of VT1A-treated PBMCs indicated up regulation of 30 genes. Three of the top four were histone genes, suggesting HIV protection via reduced gene activation. VT blocked HDAC inhibitor enhancement of HIV infection, consistent with a histone-mediated mechanism. We speculate that VT1A may provide a benign approach to reduction of (X4 or R5) HIV cell susceptibility. 
23397846	 Avian pathogenic Escherichia coli (APEC) causes morbidity in chickens and exhibits zoonotic potential. Understanding host transcriptional responses to infection aids the understanding of protective mechanisms and serves to inform future colibacillosis control strategies. Transcriptomes of spleen and peripheral blood leukocytes (PBLs) of the same individual birds in response to APEC infection were compared to identify common response patterns and connecting pathways. More than 100 genes in three contrasts examining pathology and infection status were significantly differentially expressed in both tissues and  similarly regulated. Tissue-specific differences in catalytic activity, however,  appear between birds with mild and severe pathology responses. Early expression differences, between birds with severe pathology and uninfected controls, in the  mitogen-activated protein kinase pathway in PBLs precede spleen responses in the  p53 and cytokine-cytokine receptor pathways. Tissue bianalysis is useful in identifying genes and pathways important to the response to APEC, whose role might otherwise be underestimated in importance. 
23022427	 To improve the quality and safety of food products, there is a need in the food industry for a reliable method for simultaneously monitoring multiple bacterial strains. Microarray technology is a high-throughput screening approach that can provide an alternative for bacteria detection. A total of 164 bacteria-specific probes were designed from 16S rRNA gene sequences to target 12 bacteria species,  including lactic acid bacteria and selected food pathogens. After fabrication onto aminosilane-coated slides, hybridization conditions of the array were optimized for high specificity and signal intensities. The array was applied to detect 12 bacteria individually and was specific to all (Lactobacillus plantarum  group, L. fermentum, L. brevis, L. delbrueckii, L. casei, L. sakei, Escherichia coli, Staphylococcus aureus, Micrococcus luteus and Listeria monocytogenes) except L. animalis. Multiplex detection using mixed bacteria populations was evaluated and accurate detection was obtained. The feasibility of using the array to detect the target bacteria in food was evaluated with Thai fermented sausages  (Nham). Meat samples were collected on days 2, 3 and 7 after natural fermentation, L. plantarum-inoculated fermentation and L. brevis-inoculated fermentation before applying to the array. The naturally-fermented Nham contained L. sakei, L. delbrueckii, L. plantarum and L. fermentum. The L. plantarum-inoculated Nham showed a similar lactic acid bacteria population but the positive signal level for L. plantarum was higher than with natural fermentation. The L. brevis-inoculated Nham contained L. brevis, L. plantarum, L. delbrueckii and L. fermentum. The array was used to monitor bacteria population dynamics during the fermentation process. The naturally-fermented and L. brevis-inoculated samples showed lower positive signal levels of L. plantarum on  day 2, but signals gradually increased on days 3 and 7 of the fermentation. In contrast, the L. plantarum-started fermentation showed a higher positive signal level on day 2 than the natural and L. brevis-inoculated samples, and the positive signal level remained high on days 3 and 7. The bacteria identification  array was proven to be useful as an alternative method to detect and monitor target bacteria populations during food fermentation. 
23012364	 Microarray analysis of Bradyrhizobium japonicum grown under copper limitation uncovered five genes named pcuABCDE, which are co-transcribed and co-regulated as an operon. The predicted gene products are periplasmic proteins (PcuA, PcuC, and  PcuD), a TonB-dependent outer membrane receptor (PcuB), and a cytoplasmic membrane-integral protein (PcuE). Homologs of PcuC and PcuE had been discovered in other bacteria, namely PCu(A)C and YcnJ, where they play a role in cytochrome  oxidase biogenesis and copper transport, respectively. Deletion of the pcuABCDE operon led to a pleiotropic phenotype, including defects in the aa(3)-type cytochrome oxidase, symbiotic nitrogen fixation, and anoxic nitrate respiration.  Complementation analyses revealed that, under our assay conditions, the tested functions depended only on the pcuC gene and not on pcuA, pcuB, pcuD, or pcuE. The B. japonicum genome harbors a second pcuC-like gene (blr7088), which, however, did not functionally replace the mutated pcuC. The PcuC protein was overexpressed in Escherichia coli, purified to homogeneity, and shown to bind Cu(I) with high affinity in a 1:1 stoichiometry. The replacement of His(79), Met(90), His(113), and Met(115) by alanine perturbed copper binding. This corroborates the previously purported role of this protein as a periplasmic copper chaperone for the formation of the Cu(A) center on the aa(3)-type cytochrome oxidase. In addition, we provide evidence that PcuC and the copper chaperone ScoI are important for the symbiotically essential, Cu(A)-free cbb(3)-type cytochrome oxidase specifically in endosymbiotic bacteroids of soybean root nodules, which could explain the symbiosis-defective phenotype of the pcuC and scoI mutants. 
22988238	 Testis differentiation in zebrafish involves juvenile ovary to testis transformation initiated by an apoptotic wave. The molecular regulation of this transformation process is not fully understood. NF-κB is activated at an early stage of development and has been shown to interact with steroidogenic factor-1 in mammals, leading to the suppression of anti-Müllerian hormone (Amh) gene expression. Because steroidogenic factor-1 and Amh are important for proper testis development, NF-κB-mediated induction of anti-apoptotic genes could, therefore, also play a role in zebrafish gonad differentiation. The aim of this study was to examine the potential role of NF-κB in zebrafish gonad differentiation. Exposure of juvenile zebrafish to heat-killed Escherichia coli activated the NF-κB pathways and resulted in an increased ratio of females from 30 to 85%. Microarray and quantitative real-time-PCR analysis of gonads showed elevated expression of NF-κB-regulated genes. To confirm the involvement of NF-κB-induced anti-apoptotic effects, zebrafish were treated with sodium deoxycholate, a known inducer of NF-κB or NF-κB activation inhibitor (NAI). Sodium deoxycholate treatment mimicked the effect of heat-killed bacteria and resulted in an increased proportion of females from 25 to 45%, whereas the inhibition of NF-κB using NAI resulted in a decrease in females from 45 to 20%. This study provides proof for an essential role of NF-κB in gonadal differentiation of zebrafish and represents an important step toward the complete understanding of the complicated process of sex differentiation in this species and possibly other cyprinid teleosts as well. 
22830299	 AIMS: The objective of this study was to examine transcriptional changes in Escherichia coli when the bacterium was growing in the lettuce rhizoshpere. METHODS AND RESULTS: A combination of microarray analyses, colonization assays and confocal microscopy was used to gain a more complete understanding of bacterial genes involved in the colonization and growth of E. coli K12 in the lettuce root rhizosphere using a novel hydroponic assay system. After 3 days of interaction with lettuce roots, E. coli genes involved in protein synthesis, stress responses and attachment were up-regulated. Mutants in curli production (crl, csgA) and flagella synthesis (fliN) had a reduced capacity to attach to roots as determined by bacterial counts and by confocal laser scanning microscopy. CONCLUSIONS: This study indicates that E. coli K12 has the capability to colonize lettuce roots by using attachment genes and can readily adapt to the rhizosphere  of lettuce plants. SIGNIFICANCE AND IMPACT OF THE STUDY: Results of this study show curli production and biofilm modulation genes are important for rhizosphere colonization and may provide useful targets to disrupt this process. Further studies using pathogenic  strains will provide additional information about lettuce-E. coli interactions. 
22971146	 The development of an aptamer-based impedimetric sensor for typing of bacteria (AIST-B) is presented. Highly specific DNA aptamers to Salmonella enteritidis were selected via Cell-SELEX technique. Twelve rounds of selection were performed; each comprises a positive selection step against S. enteritidis and a  negative selection step against a mixture of related pathogens, including Salmonella typhimurium, Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, and Citrobacter freundii, to ensure the species-specificity of the selected aptamers. After sequencing of the pool showing the highest binding affinity to S. enteritidis, a DNA sequence of high affinity to the bacteria was integrated into an impedimetric sensor via self-assembly onto a gold nanoparticles-modified screen-printed carbon electrode (GNPs-SPCE). Remarkably, this aptasensor is highly selective and can successfully detect S. enteritidis down to 600 CFU mL(-1) (equivalent to 18 CFU in 30 μL assay volume) in 10 min and distinguish it from other Salmonella species, including S. typhimurium and S. choleraesuis. This report is envisaged to open a new venue for the aptamer-based  typing of a variety of microorganisms using a rapid, economic, and label-free electrochemical platform. 
22497274	 In this study, Agilent two-colour microarray-based gene expression profiling was  used to detect differential gene expression in duodenal tissues collected from eight full-sib pairs of Sutai pigs differing in adhesion phenotype (sensitivity and resistance to Escherichia coli F18). Using a two-fold change minimum threshold, we found 18 genes that were differentially expressed (10 up-regulated  and eight down-regulated) between the sensitive and resistant animal groups. Our  gene ontology analysis revealed that these differentially expressed genes are involved in a variety of biological processes, including immune responses, extracellular modification (e.g. glycosylation), cell adhesion and signal transduction, all of which are related to the anabolic metabolism of glycolipids, as well as to inflammation- and immune-related pathways. Based on the genes identified in the screen and the pathway analysis results, real-time PCR was used to test the involvement of ST3GAL1 and A genes (of glycolipid-related pathways),  SLA-1 and SLA-3 genes (of inflammation- and immune-related pathways), as well as  the differential genes FUT1, TAP1 and SLA-DQA. Subsequently, real-time PCR was performed to validate seven differentially expressed genes screened out by the microarray approach, and sufficient consistency was observed between the two methods. The results support the conclusion that these genes are related to the E. coli F18 receptor and susceptibility to E. coli F18. 
23009705	 BACKGROUND: The events leading to sepsis start with an invasive infection of a primary organ of the body followed by an overwhelming systemic response. Intra-abdominal infections are the second most common cause of sepsis. Peritoneal fluid is the primary site of infection in these cases. A microarray-based approach was used to study the temporal changes in cells from the peritoneal cavity of septic mice and to identify potential biomarkers and therapeutic targets for this subset of sepsis patients. RESULTS: We conducted microarray analysis of the peritoneal cells of mice infected with a non-pathogenic strain of Escherichia coli. Differentially expressed genes were identified at two early (1 h, 2 h) and one late time point (18 h). A multiplexed bead array analysis was used to confirm protein expression  for several cytokines which showed differential expression at different time points based on the microarray data. Gene Ontology based hypothesis testing identified a positive bias of differentially expressed genes associated with cellular development and cell death at 2 h and 18 h respectively. Most differentially expressed genes common to all 3 time points had an immune response related function, consistent with the observation that a few bacteria are still present at 18 h. CONCLUSIONS: Transcriptional regulators like PLAGL2, EBF1, TCF7, KLF10 and SBNO2, previously not described in sepsis, are differentially expressed at early and late time points. Expression pattern for key biomarkers in this study is similar  to that reported in human sepsis, indicating the suitability of this model for future studies of sepsis, and the observed differences in gene expression suggest species differences or differences in the response of blood leukocytes and peritoneal leukocytes. 
22510704	 Escherichia coli infection is one of the most common causes of bovine mastitis in well managed dairies. Although E. coli infections are usually transient, E. coli  can also cause persistent intramammary infections. We sought to determine whether E. coli isolates recovered from either transient or persistent intramammary infections differed both genetically and in their ability to invade mammary epithelial cells. E. coli isolates from transient (EC(trans), n=16) and persistent (EC(pers), n=12) mastitis cases were compared for differences in overall genotype, virulence genes, serotype, phylogroup (A, B1, B2, D), and invasion of bovine mammary epithelial cells, MAC-T by microarray analysis, suppressive subtractive hybridization, PCR and gentamicin protection assays. EC(trans) and EC(pers) were diverse in overall genotype and serotype, and were predominantly of phylogroups A and B1. Both EC(trans) and EC(pers) contained genes encoding type II, IV and VI secretion systems, long polar fimbriae (lpfA) and iron acquisition, and lacked genes associated with virulence in diarrheagenic E. coli. EC(trans) had fewer virulence genes than EC(pers) (p<0.05), but no individual virulence genes were unique to either group. In phylogroup A, EC(pers) were more invasive than EC(trans) (p<0.05), but no difference was observed between them in phylogroup B1. Enhanced epithelial cell invasion was associated with lpfA (p<0.05). Our findings indicate that a genetically diverse group of E.  coli is associated with transient and persistent mastitis. We did not identify a  set of bacterial genes to account for phenotypic differences. However, we found that mastitis phenotype, phylogroup and presence of lpfA were associated with the ability to invade cultured bovine mammary epithelial cells. 
22863622	 Crosstalk between the Notch and wingless-type MMTV integration site (WNT) signaling pathways has been investigated for many developmental processes. However, this negative correlation between Notch and WNT/β-catenin signaling activity has been studied primarily in normal developmental and physiological processes in which negative feedback loops for both signaling pathways are intact. We found that Notch1 signaling retained the capability of suppressing the expression of WNT target genes in colorectal cancers even when β-catenin destruction by the adenomatous polyposis coli (APC) complex was disabled. Activation of Notch1 converted high-grade adenoma into low-grade adenoma in an Apcmin mouse colon cancer model and suppressed the expression of WNT target genes in human colorectal cancer cells through epigenetic modification recruiting histone methyltransferase SET domain bifurcated 1 (SETDB1). Extensive microarray  analysis of human colorectal cancers also showed a negative correlation between the Notch1 target gene, Notch-regulated ankyrin repeat protein 1 (NRARP), and WNT target genes. Notch is known to be a strong promoter of tumor initiation, but here we uncovered an unexpected suppressive role of Notch1 on WNT/β-catenin target genes involved in colorectal cancer. 
21913182	 Wilms Tumor (WT) is the most common renal childhood tumor. Recently, we reported  a cDNA microarray expression pattern that varied between WTs with different risk  histology. Since the Societé Internationale d'Oncologie Pédiatrique (SIOP) in Europe initiates treatment without a histological confirmation, it is important to identify blood-born markers that indicate WT development. In a multicenter study, we established an autoantibody signature by using an array with 1,827 recombinant E. coli clones. This array was screened with sera of patients with WT recruited by SIOP or the Children's Oncology Group (COG). We report an extended number of antigens that are reactive with autoantibodies present in sera from patients with WT. We established an autoantibody signature that separates untreated patients with WT recruited in SIOP from non-WT controls with a specificity of 0.83 and a sensitivity of 0.82 at standard deviations of 0.02 and  0.04, respectively. Likewise, patients recruited in the COG in the United States  were separated from the controls with an accuracy of 0.83 at a standard deviation of 0.02. Proteins that were most significant include zinc finger proteins (e.g.,  ZFP 346), ribosomal proteins and the protein fascin that has been associated with various types of cancer including renal cell carcinoma. Our study provides first  evidence for autoantibody signatures for WTs and suggests that these may be most  informative before chemotherapy. We present the first multicenter study of autoantibody signatures in patients with WT. We established an autoantibody signature that separates patients with WT from controls. 
21752412	 The aim of this study was to determine the presence of virulence genes in isolates of CTX-M Escherichia coli from diseased chickens, from healthy chickens  and from urinary tract infections in people. Three CTX-M E. coli strains from three different instances of disease in poultry (two of which were E. coli related) were tested for bla(CTX-M) sequence type and replicon type. Additionally, they were tested for the presence of 56 virulence genes (encoding fimbriae, adhesins, toxins, microcins and iron acquisition genes) using a micro-array. Results were compared to the virulence genes present in isolates from 26 healthy chickens and from 10 people with urinary tract infections. All genes found in isolates from diseased birds, including the astA (heat stable toxin) and tsh (temperature sensitive haemagglutinin) genes which have previously been associated with colibacillosis in chickens, were also present in isolates from healthy birds. However, 6/10 of the virulence genes found were exclusive to  isolates from humans. Genes exclusive to chicken isolates included ireA (sidephore receptor), lpfA (long polar fimbriae), mchF (microcin transporter protein) and tsh whilst genes exclusive to human isolates included ctdB (cytolethal distending toxin), nfaE (non-fimbrial adhesion), senB (plasmid encoded enterotoxin) and toxB (toxin B). The results support previous findings that CTX-M E. coli strains in chickens are generally different from those causing disease in humans, but genes such as astA and tsh in isolates from diseased birds with colisepticaemia were also present in isolates from healthy birds. 
22849760	 BACKGROUND: Lipopolysaccharide (LPS) is recognized as the most potent microbial mediator presaging the threat of invasion of Gram-negative bacteria that implicated in the pathogenesis of sepsis and septic shock. This study was designed to examine the microRNA (miRNA) expression in whole blood from mice injected with intraperitoneal LPS. METHODS: C57BL/6 mice received intraperitoneal injections of varying concentrations (range, 10-1000 μg) of LPS from different bacteria, including Escherichia coli, Klebsiella pneumonia, Pseudomonas aeruginosa, Salmonella enterica, and Serratia marcescens and were killed 2, 6, 24, and 72 h after LPS injection. Whole blood samples were obtained and tissues, including lung, brain,  liver, and spleen, were harvested for miRNA expression analysis using an miRNA array (Phalanx miRNA OneArray® 1.0). Upregulated expression of miRNA targets in the whole blood of C57BL/6 and Tlr4(-/-) mice injected with LPS was quantified using real-time RT-PCR and compared with that in the whole blood of C57BL/6 mice  injected with lipoteichoic acid (LTA) from Staphylococcus aureus. RESULTS: Following LPS injection, a significant increase of 15 miRNAs was observed in the whole blood. Among them, only 3 miRNAs showed up-regulated expression in the lung, but no miRNAs showed a high expression level in the other examined tissues. Upregulated expression of the miRNA targets (let-7d, miR-15b, miR-16, miR-25, miR-92a, miR-103, miR-107 and miR-451) following LPS injection on real-time RT-PCR was dose- and time-dependent. miRNA induction occurred after 2 h and persisted for at least 6 h. Exposure to LPS from different bacteria did not induce significantly different expression of these miRNA targets. Additionally, significantly lower expression levels of let-7d, miR-25, miR-92a, miR-103, and miR-107 were observed in whole blood of Tlr4(-/-) mice. In contrast, LTA exposure induced moderate expression of miR-451 but not of the other 7 miRNA targets. CONCLUSIONS: We identified a specific whole blood-derived miRNA signature in mice exposed to LPS, but not to LTA, from different gram-negative bacteria. These whole blood-derived miRNAs are promising as biomarkers for LPS exposure. 
22796662	 Reconstructing gene regulatory networks from high-throughput data is a long-standing challenge. Through the Dialogue on Reverse Engineering Assessment and Methods (DREAM) project, we performed a comprehensive blind assessment of over 30 network inference methods on Escherichia coli, Staphylococcus aureus, Saccharomyces cerevisiae and in silico microarray data. We characterize the performance, data requirements and inherent biases of different inference approaches, and we provide guidelines for algorithm application and development.  We observed that no single inference method performs optimally across all data sets. In contrast, integration of predictions from multiple inference methods shows robust and high performance across diverse data sets. We thereby constructed high-confidence networks for E. coli and S. aureus, each comprising ~1,700 transcriptional interactions at a precision of ~50%. We experimentally tested 53 previously unobserved regulatory interactions in E. coli, of which 23 (43%) were supported. Our results establish community-based methods as a powerful and robust tool for the inference of transcriptional gene regulatory networks. 
22671763	 Label-free methods streamline quantitative proteomics of tissues by alleviating the need for metabolic labeling of proteins with stable isotopes. Here we detail  and implement solutions to common problems in label-free data processing geared toward tissue proteomics by one-dimensional gel electrophoresis followed by liquid chromatography tandem mass spectrometry (geLC MS/MS). Our quantification pipeline showed high levels of performance in terms of duplicate reproducibility, linear dynamic range, and number of proteins identified and quantified. When applied to the liver of an adenomatous polyposis coli (APC) knockout mouse, we demonstrated an 8-fold increase in the number of statistically significant changing proteins compared to alternative approaches, including many more previously unidentified hydrophobic proteins. Better proteome coverage and quantification accuracy revealed molecular details of the perturbed energy metabolism. 
22081366	 From the Camelidae family members, several serotypes of Escherichia coli (E. coli) have recently been isolated from diarrhoeic and non-diarrhoeic faecal samples. To date Shiga toxin-producing E. coli (STEC) strains have never been typed in one-humped camel (Camelus dromedarius). In the present study, two E. coli O157:H7 strains isolated from sick dromedaries were investigated. Virulence  gene profiles were determined using a custom E. coli virulence DNA microarray, composed of 70-mer oligonucleotide probes targeting 264 virulence or related genes of known E. coli pathotypes. Both strains displayed positive hybridization  signals for the Locus of enterocyte effacement (LEE) gene probes (ler, eae, espA, espB, tir genes), two Shiga toxin probes (stx1 and stx2), the O157 O-antigen specific probe, various virulence plasmid (pO157) probes like katP in addition to other accessory virulence genes characterized in STEC. 
22581855	 Lung infections represent a tremendous disease burden and a leading cause of acute lung injury. STAT3 signaling is essential for controlling lung injury during pneumonia. We previously identified LIF as a prominent STAT3-activating cytokine expressed in the airspaces of pneumonic lungs, but its physiological significance in this setting has never been explored. To do so, Escherichia coli  was intratracheally instilled into C57BL/6 mice in the presence of neutralizing anti-LIF IgG or control IgG. Anti-LIF completely eliminated lung LIF detection and markedly exacerbated lung injury compared with control mice as evidenced by airspace albumin content, lung liquid accumulation, and histological analysis. Although lung bacteriology was equivalent between groups, bacteremia was more prevalent with anti-LIF treatment, suggestive of compromised barrier function rather than impaired antibacterial defense as the cause of dissemination. Inflammatory cytokine expression was also exaggerated in anti-LIF-treated lungs,  albeit after injury had ensued. Interestingly, alveolar neutrophil recruitment was modestly but significantly reduced compared with control mice despite elevated cytokine levels, indicating that inflammatory injury was not a consequence of excessive neutrophilic alveolitis. Lastly, the lung transcriptome  was dramatically remodeled during pneumonia, but far more so following LIF neutralization, with gene changes implicating cell death and epithelial homeostasis among other processes relevant to tissue injury. From these findings, we conclude that endogenous LIF facilitates tissue protection during pneumonia. The LIF-STAT3 axis is identified in this study as a critical determinant of lung  injury with clinical implications for pneumonia patients. 
22018732	 Several studies have suggested that the partially fermentable fibre Plantago ovata husk (PO) may have a protective effect on colorectal cancer (CRC). We studied the potentially pro-apoptotic effect of PO and the implicated mechanisms  in CRC cells with different molecular phenotypes (Caco-2, HCT116, LoVo, HT-29, SW480) after PO anaerobic fermentation with colonic bacteria as it occurs in the  human colon. The fermentation products of PO induced apoptosis in all primary tumour and metastatic cell lines, independent of p53, adenomatous polyposis coli, β-catenin or cyclo-oxygenase-2 status. Apoptosis was caspase-dependent and both intrinsic and extrinsic pathways were implicated. The intrinsic pathway was activated through a shift in the balance towards a pro-apoptotic environment with an up-regulation of B-cell lymphoma protein 2 homologous antagonist killer (BAK)  and a down-regulation of B-cell lymphoma-extra large (Bcl-xL) seen in HCT116 and  LoVo cells. This resulted in mitochondrial membrane depolarisation, increased expression of caspase activators second mitochondria-derived activator of caspases (Smac)/Diablo, death effector apoptosis-inducing factor, apoptosome member apoptotic protease activating factor 1 and down-regulation of inhibitors of apoptosis Survivin and X-linked inhibitor of apoptosis in most cells. The extrinsic pathway was activated presumably through the up-regulation of death receptor (DR5). Some important differences were seen between primary tumour and metastatic CRC cells. Thus, metastatic PO-treated LoVo cells had a remarkable up-regulation of TNF-α ligand along with death-inducing signalling complex components receptor interacting protein and TNF-α receptor 1-associated death domain protein. The extrinsic pathway modulator FCICE-inhibitory protein (FLIP),  an inhibitor of both spontaneous death ligand-independent and death receptor-mediated apoptosis, was significantly down-regulated after PO treatment  in all primary tumour cells, but not in metastatic LoVo. These findings suggest that PO could potentially be a useful chemotherapy adjuvant. 
22635025	 OBJECTIVE: To identify obesity-related cancer genes in endometrial and adipose tissue depots of body mass index-matched morbidly obese women with and without endometrial cancer. METHODS: Eight women undergoing hysterectomy (4 women with and 4 women without endometrial cancer) were matched by age (52.6 years) and body mass index (44.5 kg/m). Endometrium, visceral adipose tissue, and subcutaneous adipose tissue were collected and subjected to microarray analysis using Affymetrix Human Genome U133 Plus 2.0 Arrays. Gene set enrichment analysis used to extract biological information from the gene expression data and t test metric ranked and compared genes in the expression data set. Protein expression was measured in the endometrial samples, and serum was collected for hormone/metabolite assays. RESULTS: No significant differences were detected in hormone/metabolite levels between groups. Gene set enrichment analysis comparisons demonstrated that endometrial, visceral adipose and subcutaneous adipose tissues displayed 40, 47,  and 38 alternatively regulated gene set pathways when comparing patients with and without cancer. Nineteen gene sets were alternately regulated in both visceral and subcutaneous adipose tissues; however, eighteen of these were regulated in the opposite direction. Five pathways were significantly and alternately regulated in all 3 tissue types and included glycolysis/gluconeogenesis, ribosome, peroxisome proliferator activated receptor signaling, pathogenic Escherichia coli infection, and natural killer-mediated cytotoxicity. In the malignant endometrium, liver kinase B1 underexpression was observed in all patients with cancer. Liver kinase B1 underexpression decreased adenosine monophosphate-activated protein kinase activity toward acetyl-CoA carboxylase and implied enhanced lipid biosynthesis in obesity-induced endometrial cancer. CONCLUSIONS: Subcutaneous and visceral adipose tissue depots have opposite patterns of gene expression in obese patients with and without endometrial cancer. The altered de novo lipogenesis and individual gene targets identified provide new potential targets for cancer treatment and prevention for at-risk obese women. 
22688431	 Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses each  and every year. Prevention of such outbreaks and minimization of the impact of an ongoing epidemic place an ever-increasing demand for analytical methods that can  accurately identify culprit pathogens at the earliest stage. Although there is a  large array of effective methods for pathogen detection, none of them can satisfy all the following five premier requirements embodied for an ideal detection method: high specificity (detecting only the bacterium of interest), high sensitivity (capable of detecting as low as a single live bacterial cell), short  time-to-results (minutes to hours), great operational simplicity (no need for lengthy sampling procedures and the use of specialized equipment), and cost effectiveness. For example, classical microbiological methods are highly specific but require a long time (days to weeks) to acquire a definitive result.(1) PCR- and antibody-based techniques offer shorter waiting times (hours to days), but they require the use of expensive reagents and/or sophisticated equipment.(2-4) Consequently, there is still a great demand for scientific research towards developing innovative bacterial detection methods that offer improved characteristics in one or more of the aforementioned requirements. Our laboratory is interested in examining the potential of DNAzymes as a novel class of molecular probes for biosensing applications including bacterial detection.(5) DNAzymes (also known as deoxyribozymes or DNA enzymes) are man-made single-stranded DNA molecules with the capability of catalyzing chemical reactions.(6-8) These molecules can be isolated from a vast random-sequence DNA pool (which contains as many as 10(16) individual sequences) by a process known as "in vitro selection" or "SELEX" (systematic evolution of ligands by exponential enrichment).(9-16) These special DNA molecules have been widely examined in recent years as molecular tools for biosensing applications.(6-8) Our laboratory has established in vitro selection procedures for isolating RNA-cleaving fluorescent DNAzymes (RFDs; Fig. 1) and investigated the use of RFDs as analytical tools.(17-29) RFDs catalyze the cleavage of a DNA-RNA chimeric substrate at a single ribonucleotide junction (R) that is flanked by a fluorophore (F) and a quencher (Q). The close proximity of F and Q renders the uncleaved substrate minimal fluorescence. However, the cleavage event leads to the separation of F and Q, which is accompanied by significant increase of fluorescence intensity. More recently, we developed a method of isolating RFDs for bacterial detection.(5) These special RFDs were isolated to "light up" in the presence of the crude extracellular mixture (CEM) left behind by a specific type  of bacteria in their environment or in the media they are cultured (Fig. 1). The  use of crude mixture circumvents the tedious process of purifying and identifying a suitable target from the microbe of interest for biosensor development (which could take months or years to complete). The use of extracellular targets means the assaying procedure is simple because there is no need for steps to obtain intracellular targets. Using the above approach, we derived an RFD that cleaves its substrate (FS1; Fig. 2A) only in the presence of the CEM produced by E. coli  (CEM-EC).(5) This E. coli-sensing RFD, named RFD-EC1 (Fig. 2A), was found to be strictly responsive to CEM-EC but nonresponsive to CEMs from a host of other bacteria (Fig. 3). Here we present the key experimental procedures for setting up E. coli detection assays using RFD-EC1 and representative results. 
22919652	 Shiga toxin-producing Escherichia coli (STEC) is a leading cause of foodborne illness worldwide. The present study developed the use of DNA microarrays with the ampliPHOX colorimetric method to rapidly detect and genotype STEC strains. A  low-density 30-mer oligonucleotide DNA microarray was designed to target O-antigen gene clusters of 11 E. coli serogroups (O26, O45, O91, O103, O104, O111, O113, O121, O128, O145, and O157) that have been associated with the majority of STEC infections. In addition, the DNA microarray targeted 11 virulence genes, encoding adhesins, cytotoxins, proteases, and receptor proteins, which have been implicated in conferring increased ability to cause disease for STEC. Results from the validation experiments demonstrated that this microarray-based colorimetric method allowed for a rapid and accurate genotyping  of STEC reference strains from environmental and clinical sources and from distinct geographical locations. Positive hybridization signals were detected only for probes targeting serotype and virulence genes known to be present in the STEC reference strains. Quantification analysis indicated that the mean pixel intensities of the signal for probes targeting O-antigen or virulence genes were  at least three times higher when compared to the background. Furthermore, this microarray-based colorimetric method was then employed to genotype a group of E.  coli isolates from watershed sediment and animal fecal samples that were collected from an important region for leafy-vegetable production in the central  coast of California. The results indicated an accurate identification of O-type and virulence genes in the tested isolates and confirmed that the ampliPHOX colorimetric method with low-density DNA microarrays enabled a fast assessment of the virulence potential of STEC using low-cost reagents and instrumentation. 
22492318	 BACKGROUND: Klebsiella pneumoniae isolates harboring the K. pneumoniae carbapenemase gene (bla(KPC)) are creating a significant healthcare threat in both acute and long-term care facilities (LTCFs). As part of a study conducted in 2004 to determine the risk of stool colonization with extended-spectrum cephalosporin-resistant gram-negative bacteria, 12 isolates of K. pneumoniae that exhibited nonsusceptibility to extended-spectrum cephalosporins were detected. All were gastrointestinal carriage isolates that were not associated with infection. METHODS: Reassessment of the carbapenem minimum inhibitory concentrations using revised 2011 Clinical Laboratory Standards Institute breakpoints uncovered carbapenem resistance. To further investigate, a DNA microarray assay, PCR-sequencing of bla genes, immunoblotting, repetitive-sequence-based PCR (rep-PCR) and multilocus sequence typing (MLST) were performed. RESULTS: The DNA microarray detected bla(KPC) in all 12 isolates, and bla(KPC-3)  was identified by PCR amplification and sequencing of the amplicon. In addition,  a bla(SHV-11) gene was detected in all isolates. Immunoblotting revealed "low-level" production of the K. pneumoniae carbapenemase, and rep-PCR indicated  that all bla(KPC-3)-positive K. pneumoniae strains were genetically related (≥98% similar). According to MLST, all isolates belonged to sequence type 36. This sequence type has not been previously linked with bla(KPC) carriage. Plasmids from 3 representative isolates readily transferred the bla(KPC-3) to Escherichia  coli J-53 recipients. CONCLUSIONS: Our findings reveal the "silent" dissemination of bla(KPC-3) as part of Tn4401b on a mobile plasmid in Northeast Ohio nearly a decade ago and establish the first report, to our knowledge, of K. pneumoniae containing bla(KPC-3) in an LTCF caring for neurologically impaired children and young adults. 
22322349	 The worldwide dissemination of extended-spectrum-β-lactamase (ESBL)- and carbapenemase-producing Enterobacteriaceae is a major concern in both hospital and community settings. Rapid identification of these resistant pathogens and the genetic determinants they possess is needed to assist in clinical practice and epidemiological studies. A collection of Escherichia coli, Klebsiella pneumoniae, Klebsiella oxytoca, and Proteus mirabilis isolates, including phenotypically ESBL-positive (n = 1,093) and ESBL-negative isolates (n = 59), obtained in 2008-2009 from a longitudinal surveillance study (SMART) was examined using an in vitro nucleic acid-based microarray. This approach was used to detect and identify bla(ESBL) (bla(SHV), bla(TEM), and bla(CTX-M) genes of groups 1, 2, 9, and 8/25) and bla(KPC) genes and was combined with selective PCR amplification and DNA sequencing for complete characterization of the bla(ESBL) and bla(KPC) genes. Of the 1,093 phenotypically ESBL-positive isolates, 1,041 were identified  as possessing at least one bla(ESBL) gene (95.2% concordance), and 59 phenotypically ESBL-negative isolates, used as negative controls, were negative.  Several ESBL variants of bla(TEM) (n = 5), bla(SHV) (n = 11), bla(CTX-M) (n = 19), and bla(KPC) (n = 3) were detected. A new bla(SHV) variant, bla(SHV-129), and a new bla(KPC) variant, bla(KPC-11), were also identified. The most common bla genes found in this study were bla(CTX-M-15), bla(CTX-M-14), and bla(SHV-12). Using nucleic acid microarrays, we obtained a "molecular snapshot" of bla(ESBL) genes in a current global population; we report that CTX-M-15 is still the dominant ESBL and provide the first report of the new β-lactamase variants bla(SHV-129) and bla(KPC-11). 
22411068	 Desmoplastic fibroblastoma (DF) is a benign fibroblastic/myofibroblastic tumor. Cytogenetic analyses have revealed consistent rearrangement of chromosome band 11q12, strongly suggesting that this region harbors a gene of pathogenetic importance. To identify the target gene of the 11q12 rearrangements, we analyzed  six cases diagnosed as DF using chromosome banding, fluorescence in situ hybridization (FISH), single-nucleotide polymorphism array and gene expression approaches. Different structural rearrangements involving 11q12 were found in five of the six cases. Metaphase FISH analyses in two of them mapped the 11q12 breakpoints to an ~20-kb region, harboring FOSL1. Global gene expression profiling followed by quantitative real-time PCR showed that FOSL1 was expressed  at higher levels in DF with 11q12 rearrangements than in desmoid-type fibromatoses. Furthermore, FOSL1 was not upregulated in the single case of DF that did not show cytogenetic involvement of 11q12; instead this tumor was found  to display a hemizygous loss on 5q, including the APC (adenomatous polyposis coli) locus, raising the possibility that it actually was a misdiagnosed Gardner  fibroma. 5'RACE-PCR in two 11q12-positive DF did not identify any fusion transcripts. Thus, in agreement with the finding at chromosome banding analysis that varying translocation partners are involved in the 11q12 rearrangement, the  molecular data suggest that the functional outcome of the 11q12 rearrangements is deregulated expression of FOSL1. 
22497891	 Acquisition of new genetic traits by horizontal gene transfer is a bacterial strategy for adaptation to the environment. We previously showed that Escherichia coli can transmit non-conjugative plasmids laterally in a co-culture containing strains with and without the plasmid. In this study, using the Keio collection, a comprehensive library of E. coli knock-out mutants for non-essential genes, we screened for genes responsible for the execution and promotion of cell-to-cell plasmid transfer in recipient cells. By stepwise screening of 'transfer-down' mutants, two essential genes and six promoting genes were obtained. One of the essential genes was priA, which is involved in DNA replication. This priA mutant  was also unable to be transformed by artificial transformation methods, probably  due to the deficiency of the plasmid maintenance function. The other essential gene was rodZ (yfgA), a gene involved in the regulation of rod-shaped structure of E. coli cells. This rodZ mutant was transformable by all three methods of artificial transformation tested, suggesting that this gene is essential for cell-to-cell plasmid transfer but not for artificial transformation. These are the first data that suggest that rodZ plays an essential role in DNA acquisition. 
22139924	 Characterization of small non-coding ribonucleic acids (sRNA) among the large volume of data generated by high-throughput RNA-seq or tiling microarray analyses remains a challenge. Thus, there is still a need for accurate in silico prediction methods to identify sRNAs within a given bacterial species. After years of effort, dedicated software were developed based on comparative genomic analyses or mathematical/statistical models. Although these genomic analyses enabled sRNAs in intergenic regions to be efficiently identified, they all failed to predict antisense sRNA genes (asRNA), i.e. RNA genes located on the DNA strand complementary to that which encodes the protein. The statistical models enabled any genomic region to be analyzed theorically but not efficiently. We present a new model for in silico identification of sRNA and asRNA candidates within an entire bacterial genome. This model was successfully used to analyze the Gram-negative Escherichia coli and Gram-positive Streptococcus agalactiae. In both bacteria, numerous asRNAs are transcribed from the complementary strand of genes located in pathogenicity islands, strongly suggesting that these asRNAs are regulators of the virulence expression. In particular, we characterized an asRNA  that acted as an enhancer-like regulator of the type 1 fimbriae production involved in the virulence of extra-intestinal pathogenic E. coli. 
22115830	 BACKGROUND & AIMS: Mutational inactivation of adenomatous polyposis coli (APC) is an early event in colorectal cancer (CRC) progression that affects the stability  and increases the activity of β-catenin, a mediator of Wnt signaling. Progression of CRC also involves inactivation of signaling via transforming growth factor β and bone morphogenetic protein (BMP), which are tumor suppressors. However, the interactions between these pathways are not clear. We investigated the effects of loss of the transcription factor Smad4 on levels of β-catenin messenger RNA (mRNA) and Wnt signaling. METHODS: We used microarray analysis to associate levels of Smad4 and β-catenin mRNA in colorectal tumor samples from 250 patients. We performed oligonucleotide-mediated knockdown of Smad4 in human embryonic kidney (HEK293T) and in HCT116 colon cancer cells and transgenically expressed Smad4 in SW480 colon cancer cells. We analyzed adenomas from (APC(Δ1638/+)) and (APC(Δ1638/+)) × (K19Cre(ERT2)Smad4(lox/lox)) mice by using laser capture microdissection. RESULTS: In human CRC samples, reduced levels of Smad4 correlated with increased  levels of β-catenin mRNA. In Smad4-depleted cell lines, levels of β-catenin mRNA  and Wnt signaling increased. Inhibition of BMP or depletion of Smad4 in HEK293T cells increased binding of RNA polymerase II to the β-catenin gene. Expression of Smad4 in SW480 cells reduced Wnt signaling and levels of β-catenin mRNA. In mice  with heterozygous disruption of Apc(APC(Δ1638/+)), Smad4-deficient intestinal adenomas had increased levels of β-catenin mRNA and expression of Wnt target genes compared with adenomas from APC(Δ1638/+) mice that expressed Smad4. CONCLUSIONS: Transcription of β-catenin is inhibited by BMP signaling to Smad4. These findings provide important information about the interaction among transforming growth factor β, BMP, and Wnt signaling pathways in progression of CRC. 
22215741	 Enterotoxigenic Escherichia coli (ETEC) is an important pathogenic variant (pathovar) of E. coli in developing countries from a human health perspective, causing significant morbidity and mortality. Previous studies have examined specific regulatory networks in ETEC, although little is known about the global effects of inter- and intrakingdom signaling on the expression of virulence and colonization factors in ETEC. In this study, an E. coli/Shigella pan-genome microarray, combined with quantitative reverse transcriptase PCR (qRT-PCR) and RNA sequencing (RNA-seq), was used to quantify the expression of ETEC virulence and colonization factors. Biologically relevant chemical signals were combined with ETEC isolate E24377A during growth in either Luria broth (LB) or Dulbecco's  modified Eagle medium (DMEM), and transcription was examined during different phases of the growth cycle; chemical signals examined included glucose, bile salts, and preconditioned media from E. coli/Shigella isolates. The results demonstrate that the presence of bile salts, which are found in the intestine and thought to be bactericidal, upregulates the expression of many ETEC virulence factors, including heat-stable (estA) and heat-labile (eltA) enterotoxin genes. In contrast, the ETEC colonization factors CS1 and CS3 were downregulated in the  presence of bile, consistent with findings in studies of other enteric pathogens. RNA-seq analysis demonstrated that one of the most differentially expressed genes in the presence of bile is a unique plasmid-encoded AraC-like transcriptional regulator (peaR); other previously unknown genetic elements were found as well. These results provide transcriptional targets and putative mechanisms that should help improve understanding of the global regulatory networks and virulence expression in this important human pathogen. 
21656816	 A rapid and accurate method for simultaneous identification of foodborne infectious pathogens was developed based on oligonucleotide microarray technology. The proposed identification method is based on PCR amplification of the target region of the groEL genes with degenerate primers, followed by the PCR products hybridization with oligonucleotide probes specific for species. The groEL gene amplification products of seventeen species of pathogenic bacteria were hybridized to the oligonucleotide array. Hybridization results were analyzed with digoxigenin-linked enzyme reaction. Results indicated that fifteen species of pathogenic bacteria showed high sensitivity and specificity for the oligonucleotide array, while two other species gave cross-reaction with the E. coli. Our results suggested that microarray analysis of foodborne infectious pathogens might be very useful for simultaneous identification of bacterial pathogens. The oligonucleotide array can also be applied to samples collected in  clinical settings of foodborne infections. The superiority of oligonucleotide array over other tests lies on its rapidity, accuracy and efficiency in the diagnosis, treatment and control of foodborne infections. 
22232208	 Hemolytic uremic syndrome (HUS) is a potentially life-threatening condition. It often occurs after gastrointestinal infection with E. coli O157:H7, which produces Shiga toxins (Stx) that cause hemolytic anemia, thrombocytopenia, and renal injury. Stx-mediated changes in endothelial phenotype have been linked to the pathogenesis of HUS. Here we report our studies investigating Stx-induced changes in gene expression and their contribution to the pathogenesis of HUS. Stx function by inactivating host ribosomes but can also alter gene expression at concentrations that minimally affect global protein synthesis. Gene expression profiling of human microvascular endothelium treated with Stx implicated a role for activation of CXCR4 and CXCR7 by their shared cognate chemokine ligand (stromal cell-derived factor-1 [SDF-1]) in Stx-mediated pathophysiology. The changes in gene expression required a catalytically active Stx A subunit and were mediated by enhanced transcription and mRNA stability. Stx also enhanced the association of CXCR4, CXCR7, and SDF1 mRNAs with ribosomes. In a mouse model of Stx-mediated pathology, we noted changes in plasma and tissue content of CXCR4, CXCR7, and SDF-1 after Stx exposure. Furthermore, inhibition of the CXCR4/SDF-1 interaction decreased endothelial activation and organ injury and improved animal survival. Finally, in children infected with E. coli O157:H7, plasma SDF-1 levels were elevated in individuals who progressed to HUS. Collectively, these data implicate the CXCR4/CXCR7/SDF-1 pathway in Stx-mediated pathogenesis and suggest  novel therapeutic strategies for prevention and/or treatment of complications associated with E. coli O157:H7 infection. 
22232693	 The mammalian gut harbors a dense microbial community interacting in multiple ways, including horizontal gene transfer (HGT). Pangenome analyses established particularly high levels of genetic flux between Gram-negative Enterobacteriaceae. However, the mechanisms fostering intraenterobacterial HGT are incompletely understood. Using a mouse colitis model, we found that Salmonella-inflicted enteropathy elicits parallel blooms of the pathogen and of resident commensal Escherichia coli. These blooms boosted conjugative HGT of the  colicin-plasmid p2 from Salmonella enterica serovar Typhimurium to E. coli. Transconjugation efficiencies of ~100% in vivo were attributable to high intrinsic p2-transfer rates. Plasmid-encoded fitness benefits contributed little. Under normal conditions, HGT was blocked by the commensal microbiota inhibiting contact-dependent conjugation between Enterobacteriaceae. Our data show that pathogen-driven inflammatory responses in the gut can generate transient enterobacterial blooms in which conjugative transfer occurs at unprecedented rates. These blooms may favor reassortment of plasmid-encoded genes between pathogens and commensals fostering the spread of fitness-, virulence-, and antibiotic-resistance determinants. 
22172497	 Mercury is a highly toxic metal that can cause significant harm to humans and aquatic ecosystems. This paper describes a novel approach for mercury (Hg(2+)) ion detection by using label-free oligonucleotide probes and Escherichia coli exonuclease I (Exo I) in a microfluidic electrophoretic separated platform. Two single-stranded DNAs (ssDNA) TT-21 and TT-44 with 7 Thymine-Thymine mispairs are  employed to capture mercury ions. Due to the coordination structure of T-Hg(2+)-T, these ssDNAs are folded into hairpin-like double-stranded DNAs (dsDNA) which are more difficult to be digested by Exo I, as confirmed by polyacrylamide gel electrophoresis (PAGE) analysis. A series of microfluidic capillary electrophoretic separation studies are carried out to investigate the effect of Exo I and mercury ion concentrations on the detected fluorescence intensity. This method has demonstrated a high sensitivity of mercury ion detection with the limit of detection around 15 nM or 3 ppb. An excellent selectivity of the probe for mercury ions over five interference ions Fe(3+), Cd(2+), Pb(2+), Cu(2+) and Ca(2+) is also revealed. This method could potentially be used for mercury ion detection with high sensitivity and reliability. 
22499684	 An important challenge in system biology is the inference of biological networks  from postgenomic data. Among these biological networks, a gene transcriptional regulatory network focuses on interactions existing between transcription factors (TFs) and and their corresponding target genes. A large number of reverse engineering algorithms were proposed to infer such networks from gene expression  profiles, but most current methods have relatively low predictive performances. In this paper, we introduce the novel TNIFSED method (Transcriptional Network Inference from Functional Similarity and Expression Data), that infers a transcriptional network from the integration of correlations and partial correlations of gene expression profiles and gene functional similarities through a supervised classifier. In the current work, TNIFSED was applied to predict the  transcriptional network in Escherichia coli and in Saccharomyces cerevisiae, using datasets of 445 and 170 affymetrix arrays, respectively. Using the area under the curve of the receiver operating characteristics and the F-measure as indicators, we showed the predictive performance of TNIFSED to be better than unsupervised state-of-the-art methods. TNIFSED performed slightly worse than the  supervised SIRENE algorithm for the target genes identification of the TF having  a wide range of yet identified target genes but better for TF having only few identified target genes. Our results indicate that TNIFSED is complementary to the SIRENE algorithm, and particularly suitable to discover target genes of "orphan" TFs. 
22038610	 We have engineered Escherichia coli to overproduce saturated and monounsaturated  aliphatic methyl ketones in the C₁₁ to C₁₅ (diesel) range; this group of methyl ketones includes 2-undecanone and 2-tridecanone, which are of importance to the flavor and fragrance industry and also have favorable cetane numbers (as we report here). We describe specific improvements that resulted in a 700-fold enhancement in methyl ketone titer relative to that of a fatty acid-overproducing E. coli strain, including the following: (i) overproduction of β-ketoacyl coenzyme A (CoA) thioesters achieved by modification of the β-oxidation pathway (specifically, overexpression of a heterologous acyl-CoA oxidase and native FadB  and chromosomal deletion of fadA) and (ii) overexpression of a native thioesterase (FadM). FadM was previously associated with oleic acid degradation,  not methyl ketone synthesis, but outperformed a recently identified methyl ketone synthase (Solanum habrochaites MKS2 [ShMKS2], a thioesterase from wild tomato) in β-ketoacyl-CoA-overproducing strains tested. Whole-genome transcriptional (microarray) studies led to the discovery that FadM is a valuable catalyst for enhancing methyl ketone production. The use of a two-phase system with decane enhanced methyl ketone production by 4- to 7-fold in addition to increases from genetic modifications. 
22474543	 A common interest in gene expression data analysis is to identify from a large pool of candidate genes the genes that present significant changes in expression  levels between a treatment and a control biological condition. Usually, it is done using a statistic value and a cutoff value that are used to separate the genes differentially and nondifferentially expressed. In this paper, we propose a Bayesian approach to identify genes differentially expressed calculating sequentially credibility intervals from predictive densities which are constructed using the sampled mean treatment effect from all genes in study excluding the treatment effect of genes previously identified with statistical evidence for difference. We compare our Bayesian approach with the standard ones  based on the use of the t-test and modified t-tests via a simulation study, using small sample sizes which are common in gene expression data analysis. Results obtained report evidence that the proposed approach performs better than standard ones, especially for cases with mean differences and increases in treatment variance in relation to control variance. We also apply the methodologies to a well-known publicly available data set on Escherichia coli bacterium. 
22101309	 Food products, such as milk and meat products including cheese, milk powder, fermented milk, sausage, etc. are susceptible to the contamination by pathogenic  and deteriorative bacteria. These bacteria include Listeria monocytogens, Staphylococcus aureus, Enterobacter sakazakii, Escherichia coli O157:H7, Salmonella spp., Vibrio parahaemolyticus, Streptococcus agalactiae and Pseudomonas fluorescens, etc. Traditional methods for the detection of these microorganisms are laborious and time consuming. Therefore, rapid and accurate diagnostic methods are needed. In this study, we designed the DNA probes and PCR  primers for the detection of aforementioned microorganisms. By using two sets of  multiplex PCR, followed by a chromogenic macroarray system, these organisms in milk or other food products could be simultaneously detected. When the system was used for the inspection of milk or meat homogenate containing 10(0) target cells  per milliliter or gram of the sample, all these bacterial species could be identified after an 8h pre-enrichment step. The system consisting of a multiplex  PCR step followed by macroarray allowed us to detect multiple target bacterial species simultaneously without the use of agarose gel electrophoresis. Compared to the commonly used multiplex PCR method, this approach has the additional advantage of detecting more bacterial strains because some bacterial strains generate PCR products with the same molecular sizes which can be differentiated by macroarray but not by electrophoresis. 
22383870	 Determining the functional structure of biological networks is a central goal of  systems biology. One approach is to analyze gene expression data to infer a network of gene interactions on the basis of their correlated responses to environmental and genetic perturbations. The inferred network can then be analyzed to identify functional communities. However, commonly used algorithms can yield unreliable results due to experimental noise, algorithmic stochasticity, and the influence of arbitrarily chosen parameter values. Furthermore, the results obtained typically provide only a simplistic view of the network partitioned into disjoint communities and provide no information of the relationship between communities. Here, we present methods to robustly detect co-regulated and functionally enriched gene communities and demonstrate their application and validity for Escherichia coli gene expression data. Applying a recently developed community detection algorithm to the network of interactions identified with the context likelihood of relatedness (CLR) method, we show that  a hierarchy of network communities can be identified. These communities significantly enrich for gene ontology (GO) terms, consistent with them representing biologically meaningful groups. Further, analysis of the most significantly enriched communities identified several candidate new regulatory interactions. The robustness of our methods is demonstrated by showing that a core set of functional communities is reliably found when artificial noise, modeling experimental noise, is added to the data. We find that noise mainly acts conservatively, increasing the relatedness required for a network link to be reliably assigned and decreasing the size of the core communities, rather than causing association of genes into new communities. 
23251448	 Oxidative damage to microbial hosts often occurs under stressful conditions during bioprocessing. Classical strain engineering approaches are usually both time-consuming and labor intensive. Here, we aim to improve E. coli performance under oxidative stress via engineering its global regulator cAMP receptor protein (CRP), which can directly or indirectly regulate redox-sensing regulators SoxR and OxyR, and other ~400 genes in E. coli. Error-prone PCR technique was employed to introduce modifications to CRP, and three mutants (OM1~OM3) were identified with improved tolerance via H(2)O(2) enrichment selection. The best mutant OM3 could grow in 12 mM H(2)O(2) with the growth rate of 0.6 h(-1), whereas the growth of wild type was completely inhibited at this H(2)O(2) concentration. OM3  also elicited enhanced thermotolerance at 48°C as well as resistance against cumene hydroperoxide. The investigation about intracellular reactive oxygen species (ROS), which determines cell viability, indicated that the accumulation of ROS in OM3 was always lower than in WT with or without H(2)O(2) treatment. Genome-wide DNA microarray analysis has shown not only CRP-regulated genes have demonstrated great transcriptional level changes (up to 8.9-fold), but also RpoS- and OxyR-regulated genes (up to 7.7-fold). qRT-PCR data and enzyme activity assay suggested that catalase (katE) could be a major antioxidant enzyme in OM3 instead of alkyl hydroperoxide reductase or superoxide dismutase. To our knowledge, this  is the first work on improving E. coli oxidative stress resistance by reframing its transcription machinery through its native global regulator. The positive outcome of this approach may suggest that engineering CRP can be successfully implemented as an efficient strain engineering alternative for E. coli. 
22952791	 Application of high-density microarrays to the diagnostic analysis of microbial communities is challenged by the optimization of oligonucleotide probe sensitivity and specificity, as it is generally unfeasible to experimentally test thousands of probes. This study investigated the adjustment of hybridization stringency using formamide with the idea that sensitivity and specificity can be  optimized during probe design if the hybridization efficiency of oligonucleotides with target and non-target molecules can be predicted as a function of formamide  concentration. Sigmoidal denaturation profiles were obtained using fluorescently  labeled and fragmented 16S rRNA gene amplicon of Escherichia coli as the target with increasing concentrations of formamide in the hybridization buffer. A linear free energy model (LFEM) was developed and microarray-specific nearest neighbor rules were derived. The model simulated formamide melting with a denaturant m-value that increased hybridization free energy (ΔG°) by 0.173 kcal/mol per percent of formamide added (v/v). Using the LFEM and specific probe sets, free energy rules were systematically established to predict the stability of single and double mismatches, including bulged and tandem mismatches. The absolute error in predicting the position of experimental denaturation profiles was less than 5% formamide for more than 90 percent of probes, enabling a practical level of accuracy in probe design. The potential of the modeling approach for probe design and optimization is demonstrated using a dataset including the 16S rRNA gene of Rhodobacter sphaeroides as an additional target molecule. The LFEM and thermodynamic databases were incorporated into a computational tool (ProbeMelt) that is freely available at http://DECIPHER.cee.wisc.edu. 
22912878	 Dendritic cells (DCs) and natural killer (NK) cells are essential components of the innate immunity and play a crucial role in the first phase of host defense against infections and tumors. Listeria monocytogenes (Lm) is an intracellular pathogen that colonizes the cytosol of eukaryotic cells. Recent findings have shown Lm specifically in splenic CD8a(+) DCs shortly after intravenous infection. We examined gene expression profiles of mouse DCs exposed to Lm to elucidate the  molecular mechanisms underlying DCs interaction with Lm. Using a functional genomics approach, we found that Lm infection induced a cluster of late response  genes including type I IFNs and interferon responsive genes (IRGs) in DCs. Type I INFs were produced at the maximal level only at 24 h post infection indicating that the regulation of IFNs in the context of Lm infection is delayed compared to the rapid response observed with viral pathogens. We showed that during Lm infection, IFNγ production and cytotoxic activity were severely impaired in NK cells compared to E. coli infection. These defects were restored by providing an  exogenous source of IFNβ during the initial phase of bacterial challenge. Moreover, when treated with IFNβ during early infection, NK cells were able to reduce bacterial titer in the spleen and significantly improve survival of infected mice. These findings show that the timing of IFNβ production is fundamental to the efficient control of the bacterium during the early innate phase of Lm infection. 
22815904	 Enterotoxigenic Escherichia coli (ETEC) strains that produce heat-stable (ST) and/or heat-labile (LT) enterotoxins are cause of post-weaning diarrhea in piglets. However, the relative importance of the different enterotoxins in host immune responses against ETEC infection has been poorly defined. In the present study, several isogenic mutant strains of an O149:F4ac(+), LT(+) STa(+) STb(+) ETEC strain were constructed that lack the expression of LT in combination with one or both types of ST enterotoxins (STa and/or STb). The small intestinal segment perfusion (SISP) technique and microarray analysis were used to study host early immune responses induced by these mutant strains 4 h after infection in comparison to the wild type strain and a PBS control. Simultaneously, net fluid absorption of pig small intestinal mucosa was measured 4 h after infection, allowing us to correlate enterotoxin secretion with gene regulation. Microarray analysis showed on the one hand a non-toxin related general antibacterial response comprising genes such as PAP, MMP1 and IL8. On the other hand, results suggest a dominant role for STb in small intestinal secretion early after post-weaning infection, as well as in the induced innate immune response through  differential regulation of immune mediators like interleukin 1 and interleukin 17. 
22808141	 BACKGROUND: Gram-negative multidrug-resistant (MDR) bacteria are major causes of  nosocomial infections, and antibiotic resistance in these organisms is often plasmid mediated. Data are scarce pertaining to molecular mechanisms of antibiotic resistance in resource constrained areas such as Iraq. METHODOLOGY/PRINCIPAL FINDINGS: In this study, all MDR Enterobacteriaceae (n = 38) and randomly selected non-MDR counterparts (n = 41) isolated from patients, healthcare workers and environmental surfaces in a newly opened hospital in Iraq  were investigated to characterize plasmids found in these isolates and determine  their contribution to antibiotic resistance. Our results demonstrated that MDR E. coli and K. pneumoniae isolates harbored significantly more (≥ 3) plasmids compared to their non-MDR counterparts, which carried ≤ 2 plasmids (p<0.01). Various large plasmids (~52 to 100 kb) from representative isolates were confirmed to contain multiple resistance genes by DNA microarray analysis. Aminoglycoside (acc, aadA, aph, strA/B, and ksgA), β-lactam (bla(TEM1), bla(AMPC), bla(CTX-M-15), bla(OXA-1), bla(VIM-2) and bla(SHV)), sulfamethoxazole/trimethoprim (sul/dfr), tetracycline (tet) and chloramphenicol (cat) resistance genes were detected on these plasmids. Additionally, multiple plasmids carrying multiple antibiotic resistance genes were found in the same host strain. Genetic transfer-associated genes were identified on the plasmids from both MDR and non-MDR isolates. Seven plasmid replicon types (FII, FIA, FIB,  B/O, K, I1 and N) were detected in the isolates, while globally disseminated IncA/C and IncHI1 plasmids were not detected in these isolates. CONCLUSIONS/SIGNIFICANCE: This is the first report of the characteristics of the  plasmids found in Enterobacteriaceae isolated following the opening of a new hospital in Iraq. The information provided here furthers our understanding of the mechanisms of drug resistance in this specific region and their evolutionary relationship with other parts of world. The large plasmids, carrying resistance genes and transfer-associated genes, may be potential factors for regional dissemination of antibiotic resistance. 
22457712	 Enterotoxigenic Escherichia coli (ETEC) expressing F4 fimbria is the major pathogenic bacteria causing diarrhoea in neonatal and post-weaning piglets. Previous studies have revealed that the susceptibility to ETEC F4ab/F4ac is an autosomal Mendelian dominant trait and the loci controlling the F4ab/F4ac receptor are located on SSC13q41, between markers SW207 and S0283. To pinpoint these loci and further validate previous findings, we performed a genome-wide association study (GWAS) using a two generation family-based population, consisting of 301 piglets with phenotypes of susceptibility to ETEC F4ab/F4ac by  the vitro adhesion test. The DNA of all piglets and their parents was genotyped using the Illumina PorcineSNP60 BeadChip, and 50,972 and 50,483 SNPs were available for F4ab and F4ac susceptibility, respectively, in the association analysis after quality control. In summary, 28 and 18 significant SNPs (p<0.05) were detected associated with F4ab and F4ac susceptibility respectively at genome-wide significance level. From these significant findings, two novel candidate genes, HEG1 and ITGB5, were firstly identified as the most promising genes underlying F4ab/F4ac susceptibility in swine according to their functions and positions. Our findings herein provide a novel evidence for unravelling genetic mechanism of diarrhoea risk in piglets. 
22393375	 Various methods of reconstructing transcriptional regulatory networks infer transcriptional regulatory interactions (TRIs) between strongly coexpressed gene  pairs (as determined from microarray experiments measuring mRNA levels). Alternatively, however, the coexpression of two genes might imply that they are coregulated by one or more transcription factors (TFs), and do not necessarily share a direct regulatory interaction. We explore whether and under what circumstances gene pairs with a high degree of coexpression are more likely to indicate TRIs, coregulation or both. Here we use established TRIs in combination  with microarray expression data from both Escherichia coli (a prokaryote) and Saccharomyces cerevisiae (a eukaryote) to assess the accuracy of predictions of coregulated gene pairs and TRIs from coexpressed gene pairs. We find that coexpressed gene pairs are more likely to indicate coregulation than TRIs for Saccharomyces cerevisiae, but the incidence of TRIs in highly coexpressed gene pairs is higher for Escherichia coli. The data processing inequality (DPI) has previously been applied for the inference of TRIs. We consider the case where a transcription factor gene is known to regulate two genes (one of which is a transcription factor gene) that are known not to regulate one another. According  to the DPI, the non-interacting gene pairs should have the smallest mutual information among all pairs in the triplets. While this is sometimes the case for Escherichia coli, we find that it is almost always not the case for Saccharomyces cerevisiae. This brings into question the usefulness of the DPI sometimes employed to infer TRIs from expression data. Finally, we observe that when a TF gene is known to regulate two other genes, it is rarely the case that one regulatory interaction is positively correlated and the other interaction is negatively correlated. Typically both are either positively or negatively correlated. 
22039053	 Most uncomplicated urinary tract infections (UTIs) are caused by uropathogenic Escherichia coli (UPEC). Both motility and adherence are integral to UTI pathogenesis, yet they represent opposing forces. Therefore, it is logical to reciprocally regulate these functions. In UPEC strain CFT073, PapX, a non-structural protein encoded by one of the two pap operons encoding P fimbria adherence factor, represses flagella-mediated motility and is a putative member of the winged helix transcription factor family. The mechanism of this repression, however, is not understood. papX is found preferentially in more virulent UPEC isolates, being significantly more prevalent in pyelonephritis strains (53% of isolates) than in asymptomatic bacteriuria (32%) or fecal/commensal (12.5%) strains. To examine PapX structure-function, we generated papX linker insertion and site-directed mutants, which identified two key residues for PapX function (Lys(54) and Arg(127)) within domains predicted by modeling with I-TASSER software to be important for dimerization and DNA binding, respectively. To determine the PapX binding site in the CFT073 genome, systematic evolution of ligands by exponential enrichment (SELEX) in conjunction with high throughput sequencing was utilized for the first time to determine a novel binding site for a bacterial transcription factor. This method identified a 29-bp binding site within the flhDC promoter (TTACGGTGAGTTATTTTAACTGTGCGCAA), centered  410 bp upstream of the flhD translational start site. Gel shift experiments demonstrated that PapX binds directly to this site to repress transcription of flagellar genes. 
21962834	 Extended-spectrum beta-lactamase (ESBL) genes are distributed worldwide and their epidemiology is complex. Using the Check-ESBL assay, the distribution of class A  ESBL genes in clinical isolates of aerobic Gram-negative bacilli from three laboratories in the East of The Netherlands was determined. Four patient categories were distinguished: (i) patients admitted to an intensive care unit (ICU); (ii) non-ICU inpatients; (iii) outpatients admitted less than a year before collection of the isolate, (<1); (iv) outpatients admitted more than one-year prior to isolate collection or who had never been hospitalized (>1). From February 2009 until March 2010, out of 491 putative ESBL-positive isolates detected by the Vitek2 or Phoenix automated sensitivity testing systems, ESBL genes were detected in 247 (50.3%) by the Check-ESBL assay. Of these, 116 were from hospitalized patients (35 ICU, 81 non-ICU) and 131 were from outpatients (43 <1, 88 >1). In all, 274 ESBL genes were identified in these 247 isolates: 153 CTX-M-1 group (predominantly in E. coli and K. pneumoniae, 70.4% and 51.6% respectively), 67 CTX-M-9 group (predominantly in E. cloacae, 57.9%), 32 SHV, 14  TEM and 8 CTX-M-2 group. ESBL-producing E. cloacae were significantly more common in hospitalized patients than in outpatients, 20.7% and 3.8% respectively (P=0.001). CTX-M-9 group ESBLs were significantly more prevalent in ICU patients  (P=0.003), whereas SHV ESBLs were more common in hospitalized patients than in outpatients (P<0.001). There was no significant difference in distribution of ESBL genes between the two outpatient groups. 
22122981	 BACKGROUND: Trimethoprim is a widely prescribed antibiotic for a variety of bacterial infections. It belongs to a class of anti-metabolites - antifolates - which includes drugs used against malarial parasites and in cancer therapy. However, spread of bacterial resistance to the drug has severely hampered its clinical use and has necessitated further investigations into its mechanism of action and treatment regimen. Trimethoprim selectively starves bacterial cells for tetrahydrofolate, a vital cofactor necessary for the synthesis of several metabolites. The outcome (bacteriostatic or bactericidal) of such starvation, however, depends on the availability of folate-dependent metabolites in the growth medium. To characterize this dependency, we investigated in detail the regulatory and structural components of Escherichia coli cellular response to trimethoprim in controlled growth and supplementation conditions. RESULTS: We surveyed transcriptional responses to trimethoprim treatment during bacteriostatic and bactericidal conditions and analyzed associated gene sets/pathways. Concurrent starvation of all folate dependent metabolites caused growth arrest, and this was accompanied by induction of general stress and stringent responses. Three gene sets were significantly associated with the bactericidal effect of TMP in different media including LB: genes of the SOS regulon, genes of the pyrimidine nucleotide biosynthetic pathway and members of the multiple antibiotic resistance (mar) regulon controlled by the MarR repressor. However, the SOS response was identified as the only universal transcriptional signature associated with the loss of viability by direct thymine starvation or by folate stress. We also used genome-wide gene knock-out screen to uncover means of sensitization of bacteria to the drug. We observed that among a  number of candidate genes and pathways, the effect of knock-outs in the deoxyribose nucleotide salvage pathway, encoded by the deoCABD operon and under the control of the DeoR repressor, was most informative. CONCLUSION: Transcriptional induction of DNA damage response is an essential feature of the bactericidal effect of trimethoprim. Either the observation of the transcriptional response or DNA damage itself, or both, is made possible by thymine starvation when other folate-dependent metabolites are not limited. The effect of DNA damage by the drug takes place prior to its bactericidal effect, at the beginning of the lag stage of the treatment. Mutations in the deoxyribose nucleotide salvage pathway can affect duration of the lag as well as the rate of  killing. This information can be used to postulate certain mechanistic differences between direct thymine starvation in thymidylate synthase deficient mutants and thymine starvation by anti-folate inhibitors. 
21844313	 Small arylamide foldamers designed to mimic the amphiphilic nature of antimicrobial peptides (AMPs) have shown potent bactericidal activity against both Gram-negative and Gram-positive strains without many of the drawbacks of natural AMPs. These foldamers were shown to cause large changes in the permeability of the outer membrane of Escherichia coli. They cause more limited permeabilization of the inner membrane which reaches critical levels corresponding with the time required to bring about bacterial cell death. Transcriptional profiling of E. coli treated with sublethal concentrations of the arylamides showed induction of genes related to membrane and oxidative stresses,  with some overlap with the effects observed for polymyxin B. Protein secretion into the periplasm and the outer membrane is also compromised, possibly contributing to the lethality of the arylamide compounds. The induction of membrane stress response regulons such as rcs coupled with morphological changes  at the membrane observed by electron microscopy suggests that the activity of the arylamides at the membrane represents a significant contribution to their mechanism of action. 
21835211	 Identification and serotyping of Shiga toxin-producing Escherichia coli during foodborne outbreaks can aid in matching clinical, food, and environmental isolates when trying to identify the source of illness and ultimately food contamination. Herein we describe a Luminex microbead-based suspension array to identify the O serogroup of the ten most clinically relevant STECs: O26, O45, O91, O103, O111, O113, O121, O128, O145, and O157. The use of PCR followed by Luminex xMAP® technology enables the detection of multiple analytes in a single multiplex reaction with high throughput capabilities. One hundred and fourteen STEC isolates were correctly identified with no false positives among forty-six other organisms using this assay. Assay performance was tested in multiple laboratories using a panel of eleven different STEC serogroups on the Bio-Plex 200 and MAGPIX instruments. The STEC microbead-based suspension array can be performed in a 96-well plate format for high throughput screening in less than 4h. Furthermore, it is expandable, allowing for the addition of O serogroups should the need arise. 
21880954	 Previous studies in our laboratory demonstrated that blueberry (BB) extract exhibited antitumor activity against MDA-MB-231 triple negative breast cancer (TNBC) cells and decreased metastatic potential in vitro. The current study tested 2 doses of whole BB powder, 5 and 10% (wt:wt) in the diet, against MDA-MB-231 tumor growth in female nude mice. In this study, tumor volume was 75%  lower in mice fed the 5% BB diet and 60% lower in mice fed the 10% BB diet than in control mice (P ≤ 0.05). Tumor cell proliferation (Ki-67) was lower in the 5 and 10% BB-fed mice and cell death (Caspase 3) was greater in the 10% BB-fed mice compared to control mice (P ≤ 0.05). Gene analysis of tumor tissues from the 5% BB-fed mice revealed significantly altered expression of genes important to inflammation, cancer, and metastasis, specifically, Wnt signaling, thrombospondin-2, IL-13, and IFNγ. To confirm effects on Wnt signaling, analysis  of tumor tissues from 5% BB-fed mice revealed lower β-catenin expression and glycogen synthase kinase-3β phosphorylation with greater expression of the β-catenin inhibitory protein adenomatous polyposis coli compared to controls. A second study tested the ability of the 5% BB diet to inhibit MDA-MB-231-luc-D3H2LN metastasis in vivo. In this study, 5% BB-fed mice developed 70% fewer liver metastases (P = 0.04) and 25% fewer lymph node metastases (P = 0.09) compared to control mice. This study demonstrates the oral antitumor and metastasis activity of whole BB powder against TNBC in mice. 
21951686	 BACKGROUND: Avian pathogenic Escherichia coli (APEC) is detrimental to poultry health and its zoonotic potential is a food safety concern. Regulation of antimicrobials in food-production animals has put greater focus on enhancing host resistance to bacterial infections through genetics. To better define effective mechanism of host resistance, global gene expression in the spleen of chickens, harvested at two times post-infection (PI) with APEC, was measured using microarray technology, in a design that will enable investigation of effects of vaccination, challenge, and pathology level. RESULTS: There were 1,101 genes significantly differentially expressed between severely infected and non-infected groups on day 1 PI and 1,723 on day 5 PI. Very little difference was seen between mildly infected and non-infected groups on either time point. Between birds exhibiting mild and severe pathology, there were 2 significantly differentially expressed genes on day 1 PI and 799 on day 5 PI. Groups with greater pathology had more genes with increased expression than decreased expression levels. Several predominate immune pathways, Toll-like receptor, Jak-STAT, and cytokine signaling, were represented between challenged and non-challenged groups. Vaccination had, surprisingly, no detectible effect on gene expression, although it significantly protected the birds from observable gross lesions. Functional characterization of significantly expressed genes revealed unique gene ontology classifications during each time point, with many unique to a particular treatment or class contrast. CONCLUSIONS: More severe pathology caused by APEC infection was associated with a high level of gene expression differences and increase in gene expression levels. Many of the significantly differentially expressed genes were unique to a particular treatment, pathology level or time point. The present study not only investigates the transcriptomic regulations of APEC infection, but also the degree of pathology associated with that infection. This study will allow for greater discovery into host mechanisms for disease resistance, providing targets  for marker assisted selection and advanced drug development. 
21860376	 By virtue of advances in next generation sequencing technologies, we have access  to new genome sequences almost daily. The tempo of these advances is accelerating, promising greater depth and breadth. In light of these extraordinary advances, the need for fast, parallel methods to define gene function becomes ever more important. Collections of genome-wide deletion mutants in yeasts and E. coli have served as workhorses for functional characterization of gene function, but this approach is not scalable, current gene-deletion approaches require each of the thousands of genes that comprise a genome to be deleted and verified. Only after this work is complete can we pursue high-throughput phenotyping. Over the past decade, our laboratory has refined a portfolio of competitive, miniaturized, high-throughput genome-wide assays that can be performed in parallel. This parallelization is possible because of the inclusion of DNA 'tags', or 'barcodes,' into each mutant, with the barcode serving as a proxy for the mutation and one can measure the barcode abundance to  assess mutant fitness. In this study, we seek to fill the gap between DNA sequence and barcoded mutant collections. To accomplish this we introduce a combined transposon disruption-barcoding approach that opens up parallel barcode  assays to newly sequenced, but poorly characterized microbes. To illustrate this  approach we present a new Candida albicans barcoded disruption collection and describe how both microarray-based and next generation sequencing-based platforms can be used to collect 10,000-1,000,000 gene-gene and drug-gene interactions in a single experiment. 
21593133	 MOTIVATION: Query-based biclustering techniques allow interrogating a gene expression compendium with a given gene or gene list. They do so by searching for genes in the compendium that have a profile close to the average expression profile of the genes in this query-list. As it can often not be guaranteed that the genes in a long query-list will all be mutually coexpressed, it is advisable  to use each gene separately as a query. This approach, however, leaves the user with a tedious post-processing of partially redundant biclustering results. The fact that for each query-gene multiple parameter settings need to be tested in order to detect the 'most optimal bicluster size' adds to the redundancy problem. RESULTS: To aid with this post-processing, we developed an ensemble approach to be used in combination with query-based biclustering. The method relies on a specifically designed consensus matrix in which the biclustering outcomes for multiple query-genes and for different possible parameter settings are merged in  a statistically robust way. Clustering of this matrix results in distinct, non-redundant consensus biclusters that maximally reflect the information contained within the original query-based biclustering results. The usefulness of the developed approach is illustrated on a biological case study in Escherichia coli. AVAILABILITY AND IMPLEMENTATION: Compiled Matlab code is available from http://homes.esat.kuleuven.be/~kmarchal/Supplementary_Information_DeSmet_2011/. 
21733163	 BACKGROUND: The gene content of a diverse group of 183 unique Escherichia coli and Shigella isolates was determined using the Affymetrix GeneChip® E. coli Genome 2.0 Array, originally designed for transcriptome analysis, as a genotyping tool. The probe set design utilized by this array provided the opportunity to determine the gene content of each strain very accurately and reliably. This array constitutes 10,112 independent genes representing four individual E. coli genomes, therefore providing the ability to survey genes of several different pathogen types. The entire ECOR collection, 80 EHEC-like isolates, and a diverse  set of isolates from our FDA strain repository were included in our analysis. RESULTS: From this study we were able to define sets of genes that correspond to, and therefore define, the EHEC pathogen type. Furthermore, our sampling of 63 unique strains of O157:H7 showed the ability of this array to discriminate between closely related strains. We found that individual strains of O157:H7 differed, on average, by 197 probe sets. Finally, we describe an analysis method  that utilizes the power of the probe sets to determine accurately the presence/absence of each gene represented on this array. CONCLUSIONS: These elements provide insights into understanding the microbial diversity that exists within extant E. coli populations. Moreover, these data demonstrate that this novel microarray-based analysis is a powerful tool in the field of molecular epidemiology and the newly emerging field of microbial forensics. 
21483259	 PURPOSE OF REVIEW: This review summarizes the recent developments in support of the immunodeficiency model of Crohn's disease. RECENT FINDINGS: The demonstration of impaired acute inflammation in Crohn's disease provides a novel mechanism for its pathogenesis, with diminished macrophage cytokine production and neutrophil recruitment leading to reduced bacterial clearance. The innate immune response may be further overwhelmed by other factors. The mucosal barrier in Crohn's patients is disrupted, with abnormal ultrastructure as well as antibacterial defensin deficiency. Specific bacterial agents may contribute and one promising candidate, adherent-invasive Escherichia coli, has recently been described. An interaction between Nod2 and the autophagy system has been elucidated, with direct consequences for bacterial  clearance, and the most recent genome-wide association study meta-analysis has extended the number of Crohn's disease susceptibility loci to 71. The spectrum of congenital immunodeficiency disorders recognized to develop Crohn's-like inflammatory bowel disease is also expanding. Conversely, no specific immunodeficiency has so far been observed in ulcerative colitis, in which the defect appears to be failure of inflammation termination and resolution. SUMMARY: Recent advances continue to highlight defects in innate immunity in Crohn's patients. Similar abnormalities may extend to other granulomatous disorders, but not diseases such as ulcerative colitis. 
20843386	 Verotoxigenic Escherichia coli (VTEC) serotype O157:H7 strains from a Swedish cattle prevalence study (n=32), and livestock-derived strains linked to human disease (n=13), were characterized by microarray and PCR detection of virulence genes. The overall aim of the study was to investigate the distribution of known  virulence determinants and determine which genes are linked to increased pathogenicity in humans. A core set of 18 genes or gene variants were found in all strains, while seven genes were variably present. This suggests that the majority of VTEC O157:H7 found in Swedish cattle carry a broad repertoire of virulence genes and should be considered potentially harmful to humans. A single  virulence gene type was significantly associated with strains linked to human disease cases (P=0.012), but no genetic trait to explain the increased virulence  of this genotype could be found. 
21505083	 The enteric bacterium Proteus mirabilis is a common cause of complicated urinary  tract infections. In this study, microarrays were used to analyze P. mirabilis gene expression in vivo from experimentally infected mice. Urine was collected at 1, 3, and 7 days postinfection, and RNA was isolated from bacteria in the urine for transcriptional analysis. Across nine microarrays, 471 genes were upregulated and 82 were downregulated in vivo compared to in vitro broth culture. Genes upregulated in vivo encoded mannose-resistant Proteus-like (MR/P) fimbriae, urease, iron uptake systems, amino acid and peptide transporters, pyruvate metabolism enzymes, and a portion of the tricarboxylic acid (TCA) cycle enzymes.  Flagella were downregulated. Ammonia assimilation gene glnA (glutamine synthetase) was repressed in vivo, while gdhA (glutamate dehydrogenase) was upregulated in vivo. Contrary to our expectations, ammonia availability due to urease activity in P. mirabilis did not drive this gene expression. A gdhA mutant was growth deficient in minimal medium with citrate as the sole carbon source, and loss of gdhA resulted in a significant fitness defect in the mouse model of urinary tract infection. Unlike Escherichia coli, which represses gdhA and upregulates glnA in vivo and cannot utilize citrate, the data suggest that P. mirabilis uses glutamate dehydrogenase to monitor carbon-nitrogen balance, and this ability contributes to the pathogenic potential of P. mirabilis in the urinary tract. 
21718532	 BACKGROUND: E. coli B (BL21), unlike E.coli K-12 (JM109) is insensitive to glucose concentration and, therefore, grows faster and produces less acetate than E. coli K-12, especially when growing to high cell densities at high glucose concentration. By performing genomic analysis, it was demonstrated that the cause of this difference in sensitivity to the glucose concentration is the result of the differences in the central carbon metabolism activity. We hypothesized that the global transcription regulator Cra (FruR) is constitutively expressed in E. coli B and may be responsible for the different behaviour of the two strains. To  investigate this possibility and better understand the function of Cra in the two strains, cra - negative E. coli B (BL21) and E. coli K-12 (JM109) were prepared and their growth behaviour and gene expression at high glucose were evaluated using microarray and real-time PCR. RESULTS: The deletion of the cra gene in E. coli B (BL21) minimally affected the  growth and maximal acetate accumulation, while the deletion of the same gene in E.coli K-12 (JM109) caused the cells to stop growing as soon as acetate concentration reached 6.6 g/L and the media conductivity reached 21 mS/cm. ppsA (gluconeogenesis gene), aceBA (the glyoxylate shunt genes) and poxB (the acetate  producing gene) were down-regulated in both strains, while acs (acetate uptake gene) was down-regulated only in E.coli B (BL21). These transcriptional differences had little effect on acetate and pyruvate production. Additionally, it was found that the lower growth of E. coli K-12 (JM109) strain was the result  of transcription inhibition of the osmoprotectant producing bet operon (betABT). CONCLUSIONS: The transcriptional changes caused by the deletion of cra gene did not affect the activity of the central carbon metabolism, suggesting that Cra does not act alone; rather it interacts with other pleiotropic regulators to create a network of metabolic effects. An unexpected outcome of this work is the  finding that cra deletion caused transcription inhibition of the bet operon in E. coli K-12 (JM109) but did not affect this operon transcription in E. coli B (BL21). This property, together with the insensitivity to high glucose concentrations, makes this the E. coli B (BL21) strain more resistant to environmental changes. 
21639911	 BACKGROUND: Both O157 and non-O157 Shiga toxin - producing Escherichia coli (STECs) cause serious human disease outbreaks through the consumption of contaminated foods. Cattle are considered the main reservoir but it is unclear how STECs affect mature animals. Neonatal calves are the susceptible age class for STEC infections causing severe enteritis. In an earlier study, we determined  that mycotoxins and STECs were part of the disease complex for dairy cattle with  Jejunal Hemorrhage Syndrome (JHS). For STECs to play a role in the development of JHS, we hypothesized that STEC colonization should also be evident in beef cattle with JHS. Aggressive medical and surgical therapies are effective for JHS, but rely on early recognition of clinical signs for optimal outcomes suggesting that  novel approaches must be developed for managing this disease. The main objective  of this study was to confirm that mouldy feeds, mycotoxins and STEC colonization  were associated with the development of JHS in beef cattle. RESULTS: Beef cattle developed JHS after consuming feed containing several types  of mycotoxigenic fungi including Fusarium poae, F. verticillioides, F. sporotrichioides, Penicillium roqueforti and Aspergillus fumigatus. Mixtures of STECs colonized the mucosa in the hemorrhaged tissues of the cattle and no other  pathogen was identified. The STECs expressed Stx1 and Stx2, but more significantly, Stxs were also present in the blood collected from the lumen of the hemorrhaged jejunum. Feed extracts containing mycotoxins were toxic to enterocytes and 0.1% of a prebiotic, Celmanax Trademark, removed the cytotoxicity in vitro. The inclusion of a prebiotic in the care program for symptomatic beef calves was associated with 69% recovery. CONCLUSIONS: The current study confirmed that STECs and mycotoxins are part of the disease complex for JHS in beef cattle. Mycotoxigenic fungi are only relevant in that they produce the mycotoxins deposited in the feed. A prebiotic, Celmanax  Trademark, acted as a mycotoxin binder in vitro and interfered with the progression of disease. 
21288130	 Shiga toxin-producing Escherichia coli O157 is a leading cause of foodborne illness worldwide. To evaluate better methods to rapidly detect and genotype E. coli O157 strains, the present study evaluated the use of ampliPHOX, a novel colorimetric detection method based on photopolymerization, for pathogen identification with DNA microarrays. A low-density DNA oligonucleotide microarray was designed to target stx1 and stx2 genes encoding Shiga toxin production, the eae gene coding for adherence membrane protein, and the per gene encoding the O157-antigen perosamine synthetase. Results from the validation experiments demonstrated that the use of ampliPHOX allowed the accurate genotyping of the tested E. coli strains, and positive hybridization signals were observed for only probes targeting virulence genes present in the reference strains. Quantification showed that the average signal-to-noise ratio values ranged from 47.73 ± 7.12 to  76.71 ± 8.33, whereas average signal-to-noise ratio values below 2.5 were determined for probes where no polymer was formed due to lack of specific hybridization. Sensitivity tests demonstrated that the sensitivity threshold for  E. coli O157 detection was 100-1000 CFU/mL. Thus, the use of DNA microarrays in combination with photopolymerization allowed the rapid and accurate genotyping of E. coli O157 strains. 
21738454	 A general paucity of knowledge about the metabolic state of Mycobacterium tuberculosis within the host environment is a major factor impeding development of novel drugs against tuberculosis. Current experimental methods do not allow direct determination of the global metabolic state of a bacterial pathogen in vivo, but the transcriptional activity of all encoded genes has been investigated in numerous microarray studies. We describe a novel algorithm, Differential Producibility Analysis (DPA) that uses a metabolic network to extract metabolic signals from transcriptome data. The method utilizes Flux Balance Analysis (FBA)  to identify the set of genes that affect the ability to produce each metabolite in the network. Subsequently, Rank Product Analysis is used to identify those metabolites predicted to be most affected by a transcriptional signal. We first apply DPA to investigate the metabolic response of E. coli to both anaerobic growth and inactivation of the FNR global regulator. DPA successfully extracts metabolic signals that correspond to experimental data and provides novel metabolic insights. We next apply DPA to investigate the metabolic response of M. tuberculosis to the macrophage environment, human sputum and a range of in vitro  environmental perturbations. The analysis revealed a previously unrecognized feature of the response of M. tuberculosis to the macrophage environment: a down-regulation of genes influencing metabolites in central metabolism and concomitant up-regulation of genes that influence synthesis of cell wall components and virulence factors. DPA suggests that a significant feature of the  response of the tubercle bacillus to the intracellular environment is a channeling of resources towards remodeling of its cell envelope, possibly in preparation for attack by host defenses. DPA may be used to unravel the mechanisms of virulence and persistence of M. tuberculosis and other pathogens and may have general application for extracting metabolic signals from other "-omics" data. 
21569310	 BACKGROUND: Gene expression profiling studies of mastitis in ruminants have provided key but fragmented knowledge for the understanding of the disease. A systematic combination of different expression profiling studies via meta-analysis techniques has the potential to test the extensibility of conclusions based on single studies. Using the program Pointillist, we performed  meta-analysis of transcription-profiling data from six independent studies of infections with mammary gland pathogens, including samples from cattle challenged in vivo with S. aureus, E. coli, and S. uberis, samples from goats challenged in  vivo with S. aureus, as well as cattle macrophages and ovine dendritic cells infected in vitro with S. aureus. We combined different time points from those studies, testing different responses to mastitis infection: overall (common signature), early stage, late stage, and cattle-specific. RESULTS: Ingenuity Pathway Analysis of affected genes showed that the four meta-analysis combinations share biological functions and pathways (e.g. protein  ubiquitination and polyamine regulation) which are intrinsic to the general disease response. In the overall response, pathways related to immune response and inflammation, as well as biological functions related to lipid metabolism were altered. This latter observation is consistent with the milk fat content depression commonly observed during mastitis infection. Complementarities between early and late stage responses were found, with a prominence of metabolic and stress signals in the early stage and of the immune response related to the lipid metabolism in the late stage; both mechanisms apparently modulated by few genes,  including XBP1 and SREBF1.The cattle-specific response was characterized by alteration of the immune response and by modification of lipid metabolism. Comparison of E. coli and S. aureus infections in cattle in vivo revealed that affected genes showing opposite regulation had the same altered biological functions and provided evidence that E. coli caused a stronger host response. CONCLUSIONS: This meta-analysis approach reinforces previous findings but also reveals several novel themes, including the involvement of genes, biological functions, and pathways that were not identified in individual studies. As such,  it provides an interesting proof of principle for future studies combining information from diverse heterogeneous sources. 
21357721	 Infections of avian pathogenic Escherichia coli (APEC) result in annual multimillion-dollar losses to the poultry industry. Despite this, little is known about the mechanisms by which APEC survives and grows in the bloodstream. Thus, the aim of this study was to identify molecular mechanisms enabling APEC to survive and grow in this critical host environment. To do so, we compared the transcriptome of APEC O1 during growth in Luria-Bertani broth and chicken serum.  Several categories of genes, predicted to contribute to adaptation and growth in  the avian host, were identified. These included several known virulence genes and genes involved in adaptive metabolism, protein transport, biosynthesis pathways,  stress resistance, and virulence regulation. Several genes with unknown function, which were localized to pathogenicity islands or APEC O1's large virulence plasmid, pAPEC-O1-ColBM, were also identified, suggesting that they too contribute to survival in serum. The significantly upregulated genes dnaK, dnaJ,  phoP, and ybtA were subsequently subjected to mutational analysis to confirm their role in conferring a competitive advantage during infection. This genome-wide analysis provides novel insight into processes that are important to  the pathogenesis of APEC O1. 
21559467	 Recent advances in DNA sequencing technology and their focal role in Genome Wide  Association Studies (GWAS) have rekindled a growing interest in the whole-genome  sequence assembly (WGSA) problem, thereby, inundating the field with a plethora of new formalizations, algorithms, heuristics and implementations. And yet, scant attention has been paid to comparative assessments of these assemblers' quality and accuracy. No commonly accepted and standardized method for comparison exists  yet. Even worse, widely used metrics to compare the assembled sequences emphasize only size, poorly capturing the contig quality and accuracy. This paper addresses these concerns: it highlights common anomalies in assembly accuracy through a rigorous study of several assemblers, compared under both standard metrics (N50,  coverage, contig sizes, etc.) as well as a more comprehensive metric (Feature-Response Curves, FRC) that is introduced here; FRC transparently captures the trade-offs between contigs' quality against their sizes. For this purpose, most of the publicly available major sequence assemblers--both for low-coverage long (Sanger) and high-coverage short (Illumina) reads technologies--are compared. These assemblers are applied to microbial (Escherichia coli, Brucella, Wolbachia, Staphylococcus, Helicobacter) and partial human genome sequences (Chr. Y), using sequence reads of various read-lengths, coverages, accuracies, and with and without mate-pairs. It is hoped that, based on these evaluations, computational biologists will identify innovative sequence  assembly paradigms, bioinformaticists will determine promising approaches for developing "next-generation" assemblers, and biotechnologists will formulate more meaningful design desiderata for sequencing technology platforms. A new software  tool for computing the FRC metric has been developed and is available through the AMOS open-source consortium. 
21378057	 A survey was initiated to determine the prevalence of Salmonella enterica in the  environment in and around Monterey County, CA, a major agriculture region of the  United States. Trypticase soy broth enrichment cultures of samples of soil/sediment (n = 617), water (n = 252), wildlife (n = 476), cattle feces (n = 795), and preharvest lettuce and spinach (n = 261) tested originally for the presence of pathogenic Escherichia coli were kept in frozen storage and later used to test for the presence of S. enterica. A multipathogen oligonucleotide microarray was employed to identify a subset of samples that might contain Salmonella in order to test various culture methods to survey a larger number of  samples. Fifty-five of 2,401 (2.3%) samples yielded Salmonella, representing samples obtained from 20 different locations in Monterey and San Benito Counties. Water had the highest percentage of positives (7.1%) among sample types. Wildlife yielded 20 positive samples, the highest number among sample types, with positive samples from birds (n = 105), coyotes (n = 40), deer (n = 104), elk (n = 39), wild pig (n = 41), and skunk (n = 13). Only 16 (2.6%) of the soil/sediment samples tested positive, and none of the produce samples had detectable Salmonella. Sixteen different serotypes were identified among the isolates, including S. enterica serotypes Give, Typhimurium, Montevideo, and Infantis. Fifty-four strains were sensitive to 12 tested antibiotics; one S. Montevideo strain was resistant to streptomycin and gentamicin. Pulsed-field gel electrophoresis (PFGE) analysis of the isolates revealed over 40 different pulsotypes. Several strains were isolated from water, wildlife, or soil over a period of several months, suggesting that they were persistent in this environment. 
21278269	 Bacteriocins (BCNs) are antimicrobial peptides produced by bacteria with narrow or broad spectra of antimicrobial activity. Recently, several unique anti-Campylobacter BCNs have been identified from commensal bacteria isolated from chicken intestines. These BCNs dramatically reduced C. jejuni colonization in poultry and are being directed toward on-farm control of Campylobacter. However, no information concerning prevalence, development, and mechanisms of BCN resistance in Campylobacter exists. In this study, susceptibilities of 137 C. jejuni isolates and 20 C. coli isolates to the anti-Campylobacter BCNs OR-7 and E-760 were examined. Only one C. coli strain displayed resistance to the BCNs (MIC, 64 μg/ml), while others were susceptible, with MICs ranging from 0.25 to 4  μg/ml. The C. coli mutants resistant to BCN OR-7 also were obtained by in vitro selection, but all displayed only low-level resistance to OR-7 (MIC, 8 to 16 μg/ml). The acquired BCN resistance in C. coli could be transferred at intra- and interspecies levels among Campylobacter strains by biphasic natural transformation. Genomic examination of the OR-7-resistant mutants by using DNA microarray and random transposon mutagenesis revealed that the multidrug efflux pump CmeABC contributes to both intrinsic resistance and acquired resistance to the BCNs. Altogether, this study represents the first report of and a major step  forward in understanding BCN resistance in Campylobacter, which will facilitate the development of effective BCN-based strategies to reduce the Campylobacter loads in poultry. 
21149270	 Increasingly large-scale expression compendia for different species are becoming  available. By exploiting the modularity of the coexpression network, these compendia can be used to identify biological processes for which the expression behavior is conserved over different species. However, comparing module networks  across species is not trivial. The definition of a biologically meaningful module is not a fixed one and changing the distance threshold that defines the degree of coexpression gives rise to different modules. As a result when comparing modules  across species, many different partially overlapping conserved module pairs across species exist and deciding which pair is most relevant is hard. Therefore, we developed a method referred to as conserved modules across organisms (COMODO)  that uses an objective selection criterium to identify conserved expression modules between two species. The method uses as input microarray data and a gene  homology map and provides as output pairs of conserved modules and searches for the pair of modules for which the number of sharing homologs is statistically most significant relative to the size of the linked modules. To demonstrate its principle, we applied COMODO to study coexpression conservation between the two well-studied bacteria Escherichia coli and Bacillus subtilis. COMODO is available at: http://homes.esat.kuleuven.be/∼kmarchal/Supplementary_Information_Zarrineh_2010/c omodo/index.html. 
20884136	 Fluoroquinolones resistance in bacteria can be due to chromosomal and plasmid-mediated mechanisms. Of growing concern is the acquisition of genes encoding quinolone resistance in combination with other resistance mechanisms such as extended-spectrum beta-lactamases. In this study we describe the identification of an isolate of Escherichia coli from cattle which carried qnrS1  in combination with a blaCTX-M gene, although they were not co-localised on the same plasmid. In addition, using a DNA array it was possible to identify several  other antimicrobial resistance genes in this isolate. This is the first report of a qnr gene in E. coli from cattle in the UK and highlights the need for surveillance of these emerging resistance mechanisms. 
21405197	 Many methods had been developed on inferring transcriptional network from gene expression. However, it is still necessary to design new method that discloses more detailed and exact network information. Using network-assisted regression, the authors combined the averaged three-way mutual information (AMI3) and non-linear ordinary differential equation (ODE) model to infer the transcriptional network, and to obtain both the topological structure and the regulatory dynamics. Synthetic and experimental data were used to evaluate the performance of the above approach. In comparison with the previous methods based  on mutual information, AMI3 obtained higher precision with the same sensitivity.  To describe the regulatory dynamics between transcription factors and target genes, network-assisted regression and regression without network, respectively,  were applied in the steady-state and time series microarray data. The results revealed that comparing with regression without network, network-assisted regression increased the precision, but decreased the fitting goodness. Then, the authors reconstructed the transcriptional network of Escherichia coli and simulated the regulatory dynamics of genes. Furthermore, the authors' approach identified potential transcription factors regulating yeast cell cycle. In conclusion, network-assisted regression, combined AMI3 and ODE model, was a more  precisely to infer the topological structure and the regulatory dynamics of transcriptional network from microarray data. [Includes supplementary material]. 
21352611	 BACKGROUND: Bovine mastitis is one of the most costly and prevalent diseases affecting dairy cows worldwide. In order to develop new strategies to prevent Escherichia coli-induced mastitis, a detailed understanding of the molecular mechanisms underlying the host immune response to an E. coli infection is necessary. To this end, we performed a global gene-expression analysis of mammary gland tissue collected from dairy cows that had been exposed to a controlled E. coli infection. Biopsy samples of healthy and infected utter tissue were collected at T = 24 h post-infection (p.i.) and at T = 192 h p.i. to represent the acute phase response (APR) and chronic stage, respectively. Differentially expressed (DE) genes for each stage were analyzed and the DE genes detected at T  = 24 h were also compared to data collected from two previous E. coli mastitis studies that were carried out on post mortem tissue. RESULTS: Nine-hundred-eighty-two transcripts were found to be differentially expressed in infected tissue at T = 24 (P < 0.05). Up-regulated transcripts (699) were largely associated with immune response functions, while the down-regulated  transcripts (229) were principally involved in fat metabolism. At T = 192 h, all  of the up-regulated transcripts were associated with tissue healing processes. Comparison of T = 24 h DE genes detected in the three E. coli mastitis studies revealed 248 were common and mainly involved immune response functions. KEGG pathway analysis indicated that these genes were involved in 12 pathways related  to the pro-inflammatory response and APR, but also identified significant representation of two unexpected pathways: natural killer cell-mediated cytotoxicity pathway (KEGG04650) and the Rig-I-like receptor signalling pathway (KEGG04622). CONCLUSIONS: In E. coli-induced mastitis, infected mammary gland tissue was found to significantly up-regulate expression of genes related to the immune response and down-regulate genes related to fat metabolism. Up to 25% of the DE immune response genes common to the three E. coli mastitis studies at T = 24 h were independent of E. coli strain and dose, cow lactation stage and number, tissue collection method and gene analysis method used. Hence, these DE genes likely represent important mediators of the local APR against E. coli in the mammary gland. 
21345178	 BACKGROUND: The osmotic regulator OmpR in Escherichia coli regulates differentially the expression of major porin proteins OmpF and OmpC. In Yersinia  enterocolitica and Y. pseudotuberculosis, OmpR is required for both virulence and survival within macrophages. However, the phenotypic and regulatory roles of OmpR in Y. pestis are not yet fully understood. RESULTS: Y. pestis OmpR is involved in building resistance against phagocytosis and controls the adaptation to various stressful conditions met in macrophages. The ompR mutation likely did not affect the virulence of Y. pestis strain 201 that was a human-avirulent enzootic strain. The microarray-based comparative transcriptome analysis disclosed a set of 224 genes whose expressions were affected by the ompR mutation, indicating the global regulatory role of OmpR in Y. pestis. Real-time RT-PCR or lacZ fusion reporter assay further validated 16 OmpR-dependent genes, for which OmpR consensus-like sequences were found within their upstream DNA regions. ompC, F, X, and R were up-regulated dramatically with the increase of medium osmolarity, which was mediated by OmpR occupying the target promoter regions in a tandem manner. CONCLUSION: OmpR contributes to the resistance against phagocytosis or survival within macrophages, which is conserved in the pathogenic yersiniae. Y. pestis OmpR regulates ompC, F, X, and R directly through OmpR-promoter DNA association.  There is an inducible expressions of the pore-forming proteins OmpF, C, and × at  high osmolarity in Y. pestis, in contrast to the reciprocal regulation of them in E. coli. The main difference is that ompF expression is not repressed at high osmolarity in Y. pestis, which is likely due to the absence of a promoter-distal  OmpR-binding site for ompF. 
21338499	 BACKGROUND: Mucosal infections elicit inflammatory responses via regulated signaling pathways. Infection outcome depends strongly on early events occurring  immediately when bacteria start interacting with cells in the mucosal membrane. Hitherto reported transcription profiles on host-pathogen interactions are strongly biased towards in vitro studies. To detail the local in vivo genetic response to infection, we here profiled host gene expression in a recent experimental model that assures high spatial and temporal control of uropathogenic Escherichia coli (UPEC) infection within the kidney of a live rat. RESULTS: Transcriptional profiling of tissue biopsies from UPEC-infected kidney tissue revealed 59 differentially expressed genes 8 h post-infection. Their relevance for the infection process was supported by a Gene Ontology (GO) analysis. Early differential expression at 3 h and 5 h post-infection was of low  statistical significance, which correlated to the low degree of infection. Comparative transcriptomics analysis of the 8 h data set and online available studies of early local infection and inflammation defined a core of 80 genes constituting a "General tissue response to early local bacterial infections". Among these, 25% were annotated as interferon-γ (IFN-γ) regulated. Subsequent experimental analyses confirmed a systemic increase of IFN-γ in rats with an ongoing local kidney infection, correlating to splenic, rather than renal Ifng induction and suggested this inter-organ communication to be mediated by interleukin (IL)-23. The use of comparative transcriptomics allowed expansion of  the statistical data handling, whereby relevant data could also be extracted from the 5 h data set. Out of the 31 differentially expressed core genes, some represented specific 5 h responses, illustrating the value of comparative transcriptomics when studying the dynamic nature of gene regulation in response to infections. CONCLUSION: Our hypothesis-free approach identified components of infection-associated multi-cellular tissue responses and demonstrated how a comparative analysis allows retrieval of relevant information from lower-quality  data sets. The data further define marked representation of IFN-γ responsive genes and a prompt inter-organ communication as a hallmark of an early local tissue response to infection. 
21364744	 Random mutagenesis and phenotype screening provide a powerful method for dissecting microbial functions, but their results can be laborious to analyze experimentally. Each mutant strain may contain 50-100 random mutations, necessitating extensive functional experiments to determine which one causes the  selected phenotype. To solve this problem, we propose a "Phenotype Sequencing" approach in which genes causing the phenotype can be identified directly from sequencing of multiple independent mutants. We developed a new computational analysis method showing that 1. causal genes can be identified with high probability from even a modest number of mutant genomes; 2. costs can be cut many-fold compared with a conventional genome sequencing approach via an optimized strategy of library-pooling (multiple strains per library) and tag-pooling (multiple tagged libraries per sequencing lane). We have performed extensive validation experiments on a set of E. coli mutants with increased isobutanol biofuel tolerance. We generated a range of sequencing experiments varying from 3 to 32 mutant strains, with pooling on 1 to 3 sequencing lanes. Our statistical analysis of these data (4099 mutations from 32 mutant genomes) successfully identified 3 genes (acrB, marC, acrA) that have been independently validated as causing this experimental phenotype. It must be emphasized that our  approach reduces mutant sequencing costs enormously. Whereas a conventional genome sequencing experiment would have cost $7,200 in reagents alone, our Phenotype Sequencing design yielded the same information value for only $1200. In fact, our smallest experiments reliably identified acrB and marC at a cost of only $110-$340. 
21342568	 BACKGROUND: With the availability of large scale expression compendia it is now possible to view own findings in the light of what is already available and retrieve genes with an expression profile similar to a set of genes of interest (i.e., a query or seed set) for a subset of conditions. To that end, a query-based strategy is needed that maximally exploits the coexpression behaviour of the seed genes to guide the biclustering, but that at the same time is robust  against the presence of noisy genes in the seed set as seed genes are often assumed, but not guaranteed to be coexpressed in the queried compendium. Therefore, we developed ProBic, a query-based biclustering strategy based on Probabilistic Relational Models (PRMs) that exploits the use of prior distributions to extract the information contained within the seed set. RESULTS: We applied ProBic on a large scale Escherichia coli compendium to extend partially described regulons with potentially novel members. We compared ProBic's performance with previously published query-based biclustering algorithms, namely ISA and QDB, from the perspective of bicluster expression quality, robustness of  the outcome against noisy seed sets and biological relevance.This comparison learns that ProBic is able to retrieve biologically relevant, high quality biclusters that retain their seed genes and that it is particularly strong in handling noisy seeds. CONCLUSIONS: ProBic is a query-based biclustering algorithm developed in a flexible framework, designed to detect biologically relevant, high quality biclusters that retain relevant seed genes even in the presence of noise or when  dealing with low quality seed sets. 
20969949	 Verocytoxigenic Escherichia coli (VTEC) are zoonotic pathogens whose natural reservoir is represented by ruminants, particularly cattle. Infections are mainly acquired by consumption of undercooked contaminated food of animal origin, contact with infected animals and contaminated environment. VTEC O157 is the most frequently isolated serogroup from cases of human disease, however, other VTEC serogroups, such as O26, O111, O145 and O103, are increasingly reported as causing Hemolytic Uremic Syndrome (HUS) worldwide. The identification of VTEC is  troublesome, hindering the development of effective prevention strategies. In fact, VTEC are morphologically indistinguishable from harmless E. coli and their  pathogenic potential is not strictly dependent on the serogroup, but relies on the presence of a collection of virulence genes. We developed a diagnostic tool for VTEC based on the Ligation Detection Reaction coupled to Universal Array (LDR-UA) for the simultaneous identification of virulence factors and serogroup-associated genes. The method includes the investigation of 40 sites located in 13 fragments from 12 genes (sodCF1/F2, adfO, terB, ehxA, eae, vtx1, vtx2, ihp1, wzx, wbdI, rfbE, dnaK) and was evaluated by performing a trial on a collection of 67 E. coli strains, both VTEC and VT-negative E. coli, as well as on 25 isolates belonging to other related species. Results of this study showed that the LDR-UA technique was specific in identifying the target microorganism. Moreover, due to its higher throughput, the LDR-UA can be a valid and cheaper alternative to real time PCR-based (rt-PCR) methods for VTEC identification. 
21235753	 BACKGROUND: Pathogen-associated molecular patterns (PAMPs) are structural components of pathogens such as lipopolysaccharide (LPS) and peptidoglycan (PGN)  from bacterial cell walls. PAMP-recognition by the host results in an induction of defence-related genes and often the generation of an inflammatory response. We evaluated both the transcriptomic and inflammatory response in trout (O. mykiss)  macrophages in primary cell culture stimulated with DAP-PGN (DAP; meso-diaminopimelic acid, PGN; peptidoglycan) from two strains of Escherichia coli (PGN-K12 and PGN-O111:B4) over time. RESULTS: Transcript profiling was assessed using function-targeted cDNA microarray hybridisation (n = 36) and results show differential responses to both PGNs that are both time and treatment dependent. Wild type E. coli (K12) generated an increase in transcript number/diversity over time whereas PGN-O111:B4 stimulation resulted in a more specific and intense response. In line with this, Gene Ontology analysis (GO) highlights a specific transcriptomic remodelling for PGN-O111:B4 whereas results obtained for PGN-K12 show a high similarity to a generalised inflammatory priming response where multiple functional classes are related to ribosome biogenesis or cellular metabolism. Prostaglandin release was induced by both PGNs and macrophages were significantly more sensitive to PGN-O111:B4 as suggested from microarray data. CONCLUSION: Responses at the level of the transcriptome and the inflammatory outcome (prostaglandin synthesis) highlight the different sensitivity of the macrophage to slight differences (serotype) in peptidoglycan structure. Such divergent responses are likely to involve differential receptor sensitivity to ligands or indeed different receptor types. Such changes in biological response will likely reflect upon pathogenicity of certain serotypes and the development of disease. 
20981149	 We have developed a new approach to screen bacterial artificial chromosome (BAC)  libraries by recombination selection. To test this method, we constructed an orangutan BAC library using an E. coli strain (DY380) with temperature inducible  homologous recombination (HR) capability. We amplified one library segment, induced HR at 42°C to make it recombination proficient, and prepared electrocompetent cells for transformation with a kanamycin cassette to target sequences in the orangutan genome through terminal recombineering homologies. Kanamycin-resistant colonies were tested for the presence of BACs containing the  targeted genes by the use of a PCR-assay to confirm the presence of the kanamycin insertion. The results indicate that this is an effective approach for screening  clones. The advantage of recombination screening is that it avoids the high costs associated with the preparation, screening, and archival storage of arrayed BAC libraries. In addition, the screening can be conceivably combined with genetic engineering to create knockout and reporter constructs for functional studies. 
21943898	 The Gram-negative bacterium Escherichia coli is the most widely used production host for recombinant proteins in both academia and industry. The Gram-positive bacterium Bacillus megaterium represents an increasingly used alternative for high yield intra- and extracellular protein synthesis. During the past two decades, multiple tools including gene expression plasmids and production strains have been developed. Introduction of free replicating and integrative plasmids into B. megaterium is possible via protoplasts transformation or transconjugation. Using His(6)- and StrepII affinity tags, the intra- or extracellular produced proteins can easily be purified in one-step procedures. Different gene expression systems based on the xylose controlled promoter P(xylA) and various phage RNA polymerase (T7, SP6, K1E) driven systems enable B. megaterium to produce up to 1.25g of recombinant protein per liter. Biomass concentrations of up to 80g/l can be achieved by high cell density cultivations in bioreactors. Gene knockouts and gene replacements in B. megaterium are possible via an optimized gene disruption system. For a safe application in industry, sporulation and protease-deficient as well as UV-sensitive mutants are  available. With the help of the recently published B. megaterium genome sequence, it is possible to characterize bottle necks in the protein production process via systems biology approaches based on transcriptome, proteome, metabolome, and fluxome data. The bioinformatical platform (Megabac, http://www.megabac.tu-bs.de) integrates obtained theoretical and experimental data. 
21601088	 Synthetic riboswitches have emerged as useful tools for controlling gene expression to reprogram cellular behavior. However, advancing beyond proof-of-principle experiments requires the ability to quickly generate new synthetic riboswitches from RNA libraries. In this chapter, we provide a step-by-step overview of the process of obtaining synthetic riboswitches for use  in Escherichia coli, starting from a randomized RNA library. 
21601085	 Manipulating RNA synthesis rates is a primary method the cell uses to adjust its  physiological state. Therefore to design synthetic genetic networks and circuits, precise control of RNA synthesis rates is of the utmost importance. Often, however, a native promoter does not exist that has the precise characteristics required for a given application. Here, we describe two methods to change the rates and regulation of RNA synthesis in cells to create RNA synthesis of a desired specification. First, error-prone PCR is discussed for diversifying the properties of native promoters, that is, changing the rate of synthesis in constitutive promoters and the induction properties for an inducible promoter. Specifically, we describe techniques for generating diversified promoter libraries of the constitutive promoters P(L)tetO-1 in Escherichia coli and TEF1 in Saccharomyces cerevisiae as well as the inducible, oxygen-repressed promoter DAN1 in S. cerevisiae. Beyond generating promoter libraries, we discuss techniques to quantify the parameters of each new promoter. Promoter characteristics for each promoter in hand, the designer can then pick and choose  the promoters needed for the specific genetic circuit described in silico. Second, Chemically Induced Chromosomal Evolution (CIChE) is presented as an alternative method to finely adjust RNA synthesis rates in E. coli by variation of gene cassette copy numbers in tandem gene arrays. Both techniques result in precisely defined RNA synthesis and should be of great utility in synthetic biology. 
20863252	 In the postgenomics era, integrative analysis of several "omics" data is absolutely required for understanding the cell as a system. Integrative analysis  of transcriptomics and metabolomics can lead to elucidation of gene-to-metabolite networks. When integrating different time series "omics" data, it is necessary to take into consideration a time lag between those data. In the present study, we conducted an integrative analysis of time series transcriptomics and metabolomics data of Escherichia coli generated by cDNA microarray and Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR/MS), respectively. We identified a  60-min time lag between transition points of transcriptomics and metabolomics data by using a Linear Dynamical System. Furthermore, we investigated gene-to-metabolite correlations in the context of time lag, obtained the maximum  number of correlated pairs at transcripts leading 60-min time lag, and finally revealed gene-to-metabolite relations in the phospholipid biosynthesis pathway. Taking into consideration the time lag between transcriptomics and metabolomics data in time series analysis could unravel novel gene-to-metabolite relations. According to gene-to-metabolite correlations, phosphatidylglycerol plays a more critical role for membrane balance than phosphatidylethanolamine in E. coli. 
22164293	 Infertility affects one in seven couples and ascending bacterial infections of the male genitourinary tract by Escherichia coli are an important cause of male factor infertility. Thus understanding mechanisms by which immunocompetent cells  such as testicular macrophages (TM) respond to infection and how bacterial pathogens manipulate defense pathways is of importance. Whole genome expression profiling of TM and peritoneal macrophages (PM) infected with uropathogenic E. coli (UPEC) revealed major differences in regulated genes. However, a multitude of genes implicated in calcium signaling pathways was a common feature which indicated a role of calcium-dependent nuclear factor of activated T cells (NFAT)  signaling. UPEC-dependent NFAT activation was confirmed in both cultured TM and in TM in an in vivo UPEC infectious rat orchitis model. Elevated expression of NFATC2-regulated anti-inflammatory cytokines was found in TM (IL-4, IL-13) and PM (IL-3, IL-4, IL-13). NFATC2 is activated by rapid influx of calcium, an activity  delineated to the pore forming toxin alpha-hemolysin by bacterial mutant analysis. Alpha-hemolysin suppressed IL-6 and TNF-α cytokine release from PM and  caused differential activation of MAP kinase and AP-1 signaling pathways in TM and PM leading to reciprocal expression of key pro-inflammatory cytokines in PM (IL-1α, IL-1β, IL-6 downregulated) and TM (IL-1β, IL-6 upregulated). In addition, unlike PM, LPS-treated TM were refractory to NFκB activation shown by the absence of degradation of IκBα and lack of pro-inflammatory cytokine secretion (IL-6, TNF-α). Taken together, these results suggest a mechanism to the conundrum by which TM initiate immune responses to bacteria, while maintaining testicular immune privilege with its ability to tolerate neo-autoantigens expressed on developing spermatogenic cells. 
22132076	 BACKGROUND: High incidence of septic patients increases the pressure of faster and more reliable bacterial identification methods to adapt patient management towards focused and effective treatment options. The aim of this study was to assess two automated DNA extraction solutions with the PCR and microarray-based assay to enable rapid and reliable detection and speciation of causative agents in the diagnosis of sepsis. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated two automated DNA instruments NucliSENS® easyMAG® and NorDiag Arrow for the preparation of blood culture samples. A set of 91 samples flagged as positive during incubation was analyzed prospectively with the high-throughput generation of Prove-it™ Sepsis assay designed to identify over 60 gram-negative and gram-positive bacterial species as well as methicillin resistance marker from a blood culture. Bacterial findings were accurately reported from 77 blood culture samples, whereas 14 samples were reported as negative, containing bacteria not belonging to the pathogen panel of  the assay. No difference was observed between the performance of NorDiag Arrow or NucliSENS® easyMAG® with regard to the result reporting of Prove-it™ Sepsis. In addition, we also assessed the quality and quantity of DNA extracted from the clinical Escherichia coli isolate with DNA extraction instruments. We observed only minor differences between the two instruments. CONCLUSIONS: Use of automated and standardized sample preparation methods together with rapid, multiplex pathogen detection offers a strategy to speed up reliably the diagnostics of septic patients. Both tested DNA extraction devices were shown to be feasible for blood culture samples and the Prove-it™ Sepsis assay, providing an accurate identification of pathogen within 4.5 hours when the detected pathogen was in the repertoire of the test. 
21779320	 BACKGROUND: Microarrays are the main technology for large-scale transcriptional gene expression profiling, but the large bodies of data available in public databases are not useful due to the large heterogeneity. There are several initiatives that attempt to bundle these data into expression compendia, but such resources for bacterial organisms are scarce and limited to integration of experiments from the same platform or to indirect integration of per experiment analysis results. METHODOLOGY/PRINCIPAL FINDINGS: We have constructed comprehensive organism-specific cross-platform expression compendia for three bacterial model organisms (Escherichia coli, Bacillus subtilis, and Salmonella enterica serovar Typhimurium) together with an access portal, dubbed COLOMBOS, that not only provides easy access to the compendia, but also includes a suite of tools for exploring, analyzing, and visualizing the data within these compendia. It is freely available at http://bioi.biw.kuleuven.be/colombos. The compendia are unique in directly combining expression information from different microarray platforms and experiments, and we illustrate the potential benefits of this direct integration with a case study: extending the known regulon of the Fur transcription factor of E. coli. The compendia also incorporate extensive annotations for both genes and experimental conditions; these heterogeneous data  are functionally integrated in the COLOMBOS analysis tools to interactively browse and query the compendia not only for specific genes or experiments, but also metabolic pathways, transcriptional regulation mechanisms, experimental conditions, biological processes, etc. CONCLUSIONS/SIGNIFICANCE: We have created cross-platform expression compendia for several bacterial organisms and developed a complementary access port COLOMBOS, that also serves as a convenient expression analysis tool to extract useful biological information. This work is relevant to a large community of microbiologists by facilitating the use of publicly available microarray experiments to support their research. 
20828834	 Currently there are no non-steroidal anti-inflammatory drugs (NSAIDs) approved for the control of inflammation in swine due to a lack of validated animal models and suitable biomarkers to assess drug efficacy. This study investigates the differential expression of genes altered in response to Escherichia coli lipopolysaccharide (LPS) induced inflammation which may serve as indicators of NSAID efficacy. Unstimulated whole blood from swine was mixed with tissue culture media, stimulated with LPS, and RNA extracted at the following time points 0h, 1h, 3h, 24h and 48h. Total RNA was extracted and analyzed using a commercial swine DNA microarray. The DNA microarray was utilized as a screen to determine potential biomarkers, focusing on the genes that exhibited the greatest degree of differential expression. A master list of 57 genes was formed based on the differential expression as a result of the stimulation. Following analysis, 12 genes whose expressions were significantly altered (8 up- and 4 down-regulated) were chosen for verification via quantitative RT-PCR (qRT-PCR). The qRT-PCR analysis confirmed the differential expression of 11 of the 12 genes chosen via the microarray analyses. Specifically, traditional genes such as SAA, G-CSF, and  IL-10 were up-regulated, while CD4 was down-regulated; all of the genes were altered by 24h or 48h post-stimulation. We demonstrate here that expression of these 11 genes is altered as a direct result of LPS stimulation and consequently  inflammation. 
21190457	 A patient received a diagnosis of adenocarcinoma of the ampulla of Vater at 34 years of age. Two decades later, adenomatous polyps were found, followed by multiple primary invasive adenocarcinomas of both the colon and the stomach. Premature chromatid separation and mosaic variegated aneuploidy, combined with structural chromosomal abnormalities, were detected in his cells. We identified a germline homozygous intronic mutation, c.2386-11A→G, in the spindle-assembly checkpoint gene BUB1B, which creates a de novo splice site that is favored over the authentic (i.e., preferentially used) site. Our findings expand the phenotype associated with BUB1B mutations and the mosaic variegated aneuploidy syndrome to  include common adult-onset cancers and provide evidence for the interdependency of the APC protein (encoded by the adenomatous polyposis coli gene) and the BUBR1 protein (encoded by BUB1B) in humans. (Funded by the Turner Family Cancer Research Fund and others.). 
20855516	 Avian pathogenic Escherichia coli (APEC) strains frequently cause extraintestinal infections and are responsible for significant economic losses in the poultry industry worldwide. APEC isolates are closely related to human extraintestinal pathogenic E. coli (ExPEC) strains and may also act as pathogens for humans. Known APEC virulence factors include adhesins such as type 1 fimbriae and curli,  iron acquisition systems, and cytotoxins. Here we show that APEC strain SEPT362,  isolated from a septicemic hen, expresses a type VI secretion system (T6SS); causes cytoskeleton rearrangements; and invades epithelial cells, replicates within macrophages, and causes lethal disease in chicks. To assess the contribution of the T6SS to SEPT362 pathogenesis, we generated two mutants, hcp (which encodes a protein suggested to be both secreted and a structural component of the T6SS) and clpV (encoding the T6SS ATPase). Both mutants showed decreased adherence and actin rearrangement on epithelial cells. However, only the hcp mutant presented a mild decrease in its ability to invade epithelial cells, and none of these mutants were defective for intramacrophage replication. Transcriptome studies showed that the level of expression of type 1 fimbriae was  decreased in these mutants, which may account for the diminished adhesion and invasion of epithelial cells. The T6SS seems to be important for the disease process, given that both mutants were attenuated for infection in chicks. These results suggest that the T6SS influences the expression of type 1 fimbriae and contributes to APEC pathogenesis. 
20886356	 Strain CFT073 is a bona fide uropathogen, whereas strains 83972 and Nissle 1917 are harmless probiotic strains of urinary tract and faecal origin, respectively.  Despite their different environmental origins and dispositions the three strains  are very closely related and the ancestors of 83972 and Nissle 1917 must have been very similar to CFT073. Here, we report the first functional genome profiling of Nissle 1917 and the first biofilm profiling of a uropathogen. Transcriptomic profiling revealed that Nissle 1917 expressed many UPEC-associated genes and showed that the active genomic profiles of the three strains are closely related. The data demonstrate that the distance from a pathogen to a probiotic strain can be surprisingly short. We demonstrate that Nissle 1917, in spite of its intestinal niche origin, grows well in urine, and is a good biofilm  former in this medium in which it also out-competes CFT073 during planktonic growth. The role in biofilm formation of three up-regulated genes, yhaK, yhcN and ybiJ, was confirmed by knockout mutants in Nissle 1917 and CFT073. Two of these mutants CFT073∆yhcN and CFT073∆ybiJ had significantly reduced motility compared with the parent strain, arguably accounting for the impaired biofilm formation. Although the three strains have very different strategies vis-à-vis the human host their functional gene profiles are surprisingly similar. It is also interesting to note that the only two Escherichia coli strains used as probiotics are in fact deconstructed pathogens. 
21085611	 Murine models of urinary tract infection (UTI) have provided substantial data identifying uropathogenic E. coli (UPEC) virulence factors and assessing their expression in vivo. However, it is unclear how gene expression in these animal models compares to UPEC gene expression during UTI in humans. To address this, we used a UPEC strain CFT073-specific microarray to measure global gene expression in eight E. coli isolates monitored directly from the urine of eight women presenting at a clinic with bacteriuria. The resulting gene expression profiles were compared to those of the same E. coli isolates cultured statically to exponential phase in pooled, sterilized human urine ex vivo. Known fitness factors, including iron acquisition and peptide transport systems, were highly expressed during human UTI and support a model in which UPEC replicates rapidly in vivo. While these findings were often consistent with previous data obtained from the murine UTI model, host-specific differences were observed. Most strikingly, expression of type 1 fimbrial genes, which are among the most highly  expressed genes during murine experimental UTI and encode an essential virulence  factor for this experimental model, was undetectable in six of the eight E. coli  strains from women with UTI. Despite the lack of type 1 fimbrial expression in the urine samples, these E. coli isolates were generally capable of expressing type 1 fimbriae in vitro and highly upregulated fimA upon experimental murine infection. The findings presented here provide insight into the metabolic and pathogenic profile of UPEC in urine from women with UTI and represent the first transcriptome analysis for any pathogenic E. coli during a naturally occurring infection in humans. 
20823207	 Strains of Shiga toxin-producing Escherichia coli (STEC) are a heterogeneous E. coli group that may cause severe disease in humans. STEC have been categorized into seropathotypes (SPTs) based on their phenotypic and molecular characteristics and the clinical features of the associated diseases. SPTs range  from A to E, according to a decreasing rank of pathogenicity. To define the virulence gene asset ("virulome") characterizing the highly pathogenic SPTs, we used microarray hybridization to compare the whole genomes of STEC belonging to SPTs B, C, and D with that of STEC O157 (SPT A). The presence of the open reading frames (ORFs) associated with SPTs A and B was subsequently investigated by PCR in a larger panel of STEC and in other E. coli strains. A genomic island termed OI-57 was present in SPTs A and B but not in the other SPTs. OI-57 harbors the putative virulence gene adfO, encoding a factor enhancing the adhesivity of STEC  O157, and ckf, encoding a putative killing factor for the bacterial cell. PCR analyses showed that OI-57 was present in its entirety in the majority of the STEC genomes examined, indicating that it represents a stable acquisition of the  positive clonal lineages. OI-57 was also present in a high proportion of the human enteropathogenic E. coli genomes assayed, suggesting that it could be involved in the attaching-and-effacing colonization of the intestinal mucosa. In  conclusion, OI-57 appears to be part of the virulome of pathogenic STEC and further studies are needed to elucidate its role in the pathogenesis of STEC infections. 
20964857	 BACKGROUND: The Enterobacteriaceae comprise a large number of clinically relevant species with several individual subspecies. Overlapping virulence-associated gene pools and the high overall genome plasticity often interferes with correct enterobacterial strain typing and risk assessment. Array technology offers a fast, reproducible and standardisable means for bacterial typing and thus provides many advantages for bacterial diagnostics, risk assessment and surveillance. The development of highly discriminative broad-range microbial diagnostic microarrays remains a challenge, because of marked genome plasticity of many bacterial pathogens. RESULTS: We developed a DNA microarray for strain typing and detection of major antimicrobial resistance genes of clinically relevant enterobacteria. For this purpose, we applied a global genome-wide probe selection strategy on 32 available complete enterobacterial genomes combined with a regression model for pathogen classification. The discriminative power of the probe set was further tested in silico on 15 additional complete enterobacterial genome sequences. DNA microarrays based on the selected probes were used to type 92 clinical enterobacterial isolates. Phenotypic tests confirmed the array-based typing results and corroborate that the selected probes allowed correct typing and prediction of major antibiotic resistances of clinically relevant Enterobacteriaceae, including the subspecies level, e.g. the reliable distinction of different E. coli pathotypes. CONCLUSIONS: Our results demonstrate that the global probe selection approach based on longest common factor statistics as well as the design of a DNA microarray with a restricted set of discriminative probes enables robust discrimination of different enterobacterial variants and represents a proof of concept that can be adopted for diagnostics of a wide range of microbial pathogens. Our approach circumvents misclassifications arising from the application of virulence markers, which are highly affected by horizontal gene transfer. Moreover, a broad range of pathogens have been covered by an efficient  probe set size enabling the design of high-throughput diagnostics. 
20810273	 DNA methylation plays an essential role in maintenance of cellular function. A growing number of human diseases have been found to be associated with aberrant DNA methylation, especially cancer. However, current technologies used in DNA methylation detection are complicated and time consuming. A promotor of the Adenomatous polyposis coli (APC) gene, a well-studied tumor suppressor gene, was  used as the detection target DNA sequence. The double recognition mechanism was realized with oligonucleotide probe hybridization and specific protein binding. First, complementary target DNA was captured by the probe immobilized onto a surface plasmon resonance (SPR) sensor chip. Then, the recombinant methyl-CpG binding domain (MBD) protein was passed over the surface to recognize and bind to methylated CpG sites. Binding resulted in an increase in the refractive index, and a detectable optical signal was generated. Five picomoles of methylated APC promotor DNA could be easily detected with this method. The entire detection could be completed within 1h. This work represents the first SPR based biosensor  technology, which achieves simple and specific DNA methylation detection and avoids complicated bisulfite treatment and methylation-sensitive restriction digestion. It will improve our ability to detect DNA methylation specifically and rapidly, and promote our understanding of the role of DNA methylation in gene regulation and diseases. 
20949025	 BACKGROUND: Difficulties associated with implementing gene therapy are caused by  the complexity of the underlying regulatory networks. The forms of interactions between the hundreds of genes, proteins, and metabolites in these networks are not known very accurately. An alternative approach is to limit consideration to genes on the network. Steady state measurements of these influence networks can be obtained from DNA microarray experiments. However, since they contain a large  number of nodes, the computation of influence networks requires a prohibitively large set of microarray experiments. Furthermore, error estimates of the network  make verifiable predictions impossible. METHODOLOGY/PRINCIPAL FINDINGS: Here, we propose an alternative approach. Rather  than attempting to derive an accurate model of the network, we ask what questions can be addressed using lower dimensional, highly simplified models. More importantly, is it possible to use such robust features in applications? We first identify a small group of genes that can be used to affect changes in other nodes of the network. The reduced effective empirical subnetwork (EES) can be computed  using steady state measurements on a small number of genetically perturbed systems. We show that the EES can be used to make predictions on expression profiles of other mutants, and to compute how to implement pre-specified changes  in the steady state of the underlying biological process. These assertions are verified in a synthetic influence network. We also use previously published experimental data to compute the EES associated with an oxygen deprivation network of E.coli, and use it to predict gene expression levels on a double mutant. The predictions are significantly different from the experimental results for less than of genes. CONCLUSIONS/SIGNIFICANCE: The constraints imposed by gene expression levels of mutants can be used to address a selected set of questions about a gene network. 
20946615	 BACKGROUND: Advances in microbial genomics and bioinformatics are offering greater insights into the emergence and spread of foodborne pathogens in outbreak scenarios. The Food and Drug Administration (FDA) has developed a genomics tool,  ArrayTrack™, which provides extensive functionalities to manage, analyze, and interpret genomic data for mammalian species. ArrayTrack™ has been widely adopted by the research community and used for pharmacogenomics data review in the FDA's  Voluntary Genomics Data Submission program. RESULTS: ArrayTrack™ has been extended to manage and analyze genomics data from bacterial pathogens of human, animal, and food origin. It was populated with bioinformatics data from public databases such as NCBI, Swiss-Prot, KEGG Pathway, and Gene Ontology to facilitate pathogen detection and characterization. ArrayTrack™'s data processing and visualization tools were enhanced with analysis capabilities designed specifically for microbial genomics including flag-based hierarchical clustering analysis (HCA), flag concordance heat maps, and mixed scatter plots. These specific functionalities were evaluated on data generated from a custom Affymetrix array (FDA-ECSG) previously developed within the FDA. The FDA-ECSG array represents 32 complete genomes of Escherichia coli and Shigella. The new functions were also used to analyze microarray data focusing on antimicrobial resistance genes from Salmonella isolates in a poultry production environment using a universal antimicrobial resistance microarray developed by the United States Department of Agriculture (USDA). CONCLUSION: The application of ArrayTrack™ to different microarray platforms demonstrates its utility in microbial genomics research, and thus will improve the capabilities of the FDA to rapidly identify foodborne bacteria and their genetic traits (e.g., antimicrobial resistance, virulence, etc.) during outbreak  investigations. ArrayTrack™ is free to use and available to public, private, and  academic researchers at http://www.fda.gov/ArrayTrack. 
20545783	 Lactobacilli are probiotics that, among other health-promoting effects, have been ascribed immunostimulating and virus-preventive properties. Certain Lactobacillus spp. have been shown to possess strong interleukin-12 (IL-12) -inducing properties. As IL-12 production depends on the up-regulation of type I interferons (IFNs), we hypothesized that the strong IL-12-inducing capacity of Lactobacillus acidophilus NCFM in murine bone-marrow-derived dendritic cells (DCs) is caused by an up-regulation of IFN-β, which subsequently induces IL-12 and the double-stranded RNA binding Toll-like receptor-3 (TLR-3). The expression  of the genes encoding IFN-β, TLR-3, IL-12 and IL-10 in DCs upon stimulation with  L. acidophilus NCFM was determined. Lactobacillus acidophilus NCFM induced a much stronger expression of Ifn-β, Il-12 and Il-10 compared with the synthetic double-stranded RNA ligand Poly I:C, whereas the levels of expressed Tlr-3 were similar. Whole genome microarray gene expression analysis revealed that other genes related to viral defence were significantly up-regulated and among the strongest induced genes in DCs stimulated with L. acidophilus NCFM. The ability to induce IFN-β was also detected in another L. acidophilus strain (X37), but was not a property of other probiotic strains tested, i.e. Bifidobacterium bifidum Z9 and Escherichia coli Nissle 1917. The IFN-β expression was markedly reduced in TLR-2(-/-) DCs, dependent on endocytosis, and the major cause of the induction of Il-12 and Tlr-3 in DCs stimulated with L. acidophilus NCFM. Collectively, our results reveal that certain lactobacilli trigger the expression of viral defence  genes in DCs in a TLR-2 manner dependent on IFN-β. 
21046348	 Rapid identification of enteropathogenic bacteria in stool samples is critical for clinical diagnosis and antimicrobial therapy. In this study, we describe the  development of an approach that couples multiplex PCR with hybridization to a DNA microarray, to allow the simultaneous detection of the 10 pathogens. The microarray was synthesized with 20-mer oligonucleotide probes that were designed  to be specific for virulence-factor genes of each strain. The detection limit for genomic DNA from a single strain was approximately 10 fg. In the presence of heterogeneous non-target DNA, the detection sensitivity of the array decreased to approximately 100 fg. We did not observe any non-specific hybridization. In addition, we successfully used this oligonucleotide-based DNA microarray to identify the causative agents in clinical stool samples from patients with food-borne enteritis. 
20927193	 One of the pressing open problems of computational systems biology is the elucidation of the topology of genetic regulatory networks (GRNs) using high throughput genomic data, in particular microarray gene expression data. The Dialogue for Reverse Engineering Assessments and Methods (DREAM) challenge aims to evaluate the success of GRN inference algorithms on benchmarks of simulated data. In this article, we present GENIE3, a new algorithm for the inference of GRNs that was best performer in the DREAM4 In Silico Multifactorial challenge. GENIE3 decomposes the prediction of a regulatory network between p genes into p different regression problems. In each of the regression problems, the expression pattern of one of the genes (target gene) is predicted from the expression patterns of all the other genes (input genes), using tree-based ensemble methods  Random Forests or Extra-Trees. The importance of an input gene in the prediction  of the target gene expression pattern is taken as an indication of a putative regulatory link. Putative regulatory links are then aggregated over all genes to  provide a ranking of interactions from which the whole network is reconstructed.  In addition to performing well on the DREAM4 In Silico Multifactorial challenge simulated data, we show that GENIE3 compares favorably with existing algorithms to decipher the genetic regulatory network of Escherichia coli. It doesn't make any assumption about the nature of gene regulation, can deal with combinatorial and non-linear interactions, produces directed GRNs, and is fast and scalable. In conclusion, we propose a new algorithm for GRN inference that performs well on both synthetic and real gene expression data. The algorithm, based on feature selection with tree-based ensemble methods, is simple and generic, making it adaptable to other types of genomic data and interactions. 
20886104	 Toll-like receptor signaling requires functional Toll/interleukin-1 (IL-1) receptor (TIR) domains to activate innate immunity. By producing TIR homologous proteins, microbes inhibit host response induction and improve their own survival. The TIR homologous protein TcpC was recently identified as a virulence  factor in uropathogenic Escherichia coli (E. coli), suppressing innate immunity by binding to MyD88. This study examined how the host MyD88 genotype modifies the in vivo effects of TcpC and whether additional, TIR-domain containing proteins might be targeted by TcpC. In wild type mice (wt), TcpC enhanced bacterial virulence, increased acute mortality, bacterial persistence and tissue damage after infection with E. coli CFT073 (TcpC+), compared to a ΔTcpC deletion mutant. These effects were attenuated in Myd88(-/-) and Tlr4(-/-) mice. Transcriptomic analysis confirmed that TcpC inhibits MYD88 dependent gene expression in CFT073 infected human uroepithelial cells but in addition the inhibitory effect included targets in the TRIF and IL-6/IL-1 signaling pathways, where MYD88 dependent and independent signaling may converge. The effects of TcpC on bacterial persistence  were attenuated in Trif (-/-) or Il-1β (-/-) mice and innate immune responses to  ΔTcpC were increased, confirming that Trif and Il-1β dependent targets might be involved in vivo, in addition to Myd88. Furthermore, soluble TcpC inhibited Myd88 and Trif dependent TLR signaling in murine macrophages. Our results suggest that  TcpC may promote UTI-associated pathology broadly, through inhibition of TIR domain signaling and downstream pathways. Dysregulation of the host response by microbial TcpC thus appears to impair the protective effects of innate immunity,  while promoting inflammation and tissue damage. 
20886096	 The mucosal immune system identifies and fights invading pathogens, while allowing non-pathogenic organisms to persist. Mechanisms of pathogen/non-pathogen discrimination are poorly understood, as is the contribution of human genetic variation in disease susceptibility. We describe here a new, IRF3-dependent signaling pathway that is critical for distinguishing pathogens from normal flora at the mucosal barrier. Following uropathogenic E. coli infection, Irf3(-/-) mice showed a pathogen-specific increase in acute mortality, bacterial burden, abscess formation and renal damage compared to wild type mice. TLR4 signaling was initiated after ceramide release from glycosphingolipid receptors, through TRAM,  CREB, Fos and Jun phosphorylation and p38 MAPK-dependent mechanisms, resulting in nuclear translocation of IRF3 and activation of IRF3/IFNβ-dependent antibacterial effector mechanisms. This TLR4/IRF3 pathway of pathogen discrimination was activated by ceramide and by P-fimbriated E. coli, which use ceramide-anchored glycosphingolipid receptors. Relevance of this pathway for human disease was supported by polymorphic IRF3 promoter sequences, differing between children with severe, symptomatic kidney infection and children who were asymptomatic bacterial carriers. IRF3 promoter activity was reduced by the disease-associated genotype,  consistent with the pathology in Irf3(-/-) mice. Host susceptibility to common infections like UTI may thus be strongly influenced by single gene modifications  affecting the innate immune response. 
20545348	 The importance and pervasiveness of naturally occurring regulation of RNA function in biology is increasingly being recognized. A common mechanism uses inducible protein-RNA interactions to shape diverse aspects of cellular RNA fate. Recapitulating this regulatory mode in cells using a novel set of protein-RNA interactions is appealing given the potential to subsequently modulate RNA biology in a manner decoupled from endogenous cellular physiology. Achieving this outcome, however, has previously proven challenging. Here, we describe a ligand-responsive protein-RNA interaction module, which can be used to target a specific RNA for subsequent regulation. Using the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) method, RNA aptamers binding to the bacterial Tet Repressor protein (TetR) with low- to subnanomolar affinities were obtained.  This interaction is reversibly controlled by tetracycline in a manner analogous to the interaction of TetR with its cognate DNA operator. Aptamer minimization and mutational analyses support a functional role for two conserved sequence motifs in TetR binding. As an initial illustration of using this system to achieve protein-based regulation of RNA function in living cells, insertion of a  TetR aptamer into the 5'-UTR of a reporter mRNA confers post-transcriptionally regulated, ligand-inducible protein synthesis in E. coli. Altogether, these results define and validate an inducible protein-RNA interaction module that incorporates desirable aspects of a ubiquitous mechanism for regulating RNA function in Nature and can be used as a foundational interaction for functionally and reversibly controlling the multiple fates of RNA in cells. 
20500084	 The proportion of Campylobacter spp. isolates that are resistant to fluoroquinolones, the drugs of choice for campylobacteriosis, has been increasing worldwide. We developed an innovative method based on a Luminex xMAP DNA suspension array that allows the identification of Campylobacter species and, simultaneously, the detection of the most common point mutation in the gyrA gene  (substitution from threonine 86 to isoleucine 86) that is responsible for fluoroquinolone resistance. Ninety-six Campylobacter coli and Campylobacter jejuni isolates collected from turkeys were first investigated by microdilution test to characterize the antimicrobial resistance patterns. The isolates, amplified for the quinolone resistance determining region of the gyrA gene, were  then tested using Luminex suspension array. The reliability of the method was demonstrated by the total concordance between the results obtained using Luminex  and those of the sequencing of gyrA polymerase chain reaction products. The genotypic characterization of fluoroquinolone resistance using Luminex was also consistent with the data on phenotypical resistance obtained by microdilution test. The results of this study strongly support the potential of Luminex xMAP technology as an efficient molecular method for the rapid and accurate identification of C. coli and C. jejuni isolates and the characterization of the  major determinant of fluoroquinolone resistance. 
20675003	 A micro-array has been developed, based on the GeneDisc(R) array, for the genetic identification of 12 O-types and 7 H-types of Shiga toxin-producing Escherichia coli (STEC) including the most clinically relevant enterohemorrhagic E. coli (EHEC) serotypes. The genes selected for determination of the O antigens (rfbE(O157), wzx(O26), wzx(O103), wbd1(O111), ihp1(O145), wzx(O121), wzy(O113), wzy(O91), wzx(O104), wzy(O118), wzx(O45), and wbgN(O55)) and H-types (fliC(H2), fliC(H7), fliC(H8), fliC(H11), fliC(H19), fliC(H21), and fliC(H28)) showed a high specificity and concordance with serology. The micro-array also had a high specificity for EHEC-associated virulence factors, including Shiga toxins 1 and 2 (stx1 and stx2), intimin (eae), enterohemolysin (ehxA), serine protease (espP), catalase peroxidase (katP), the type II secretion system (etpD), subtilase cytotoxin (subA), autoagglutinating adhesin (Saa) and type III secreted effectors encoded in the genomic islands OI-122 (ent/espL2, nleB, and nleE) and OI-71 (nleF, nleH1-2, and nleA). The eae gene was detected in all typical EHEC strains, and the pattern of nle genes encoded in OI-71 and OI-122 was found to be closely  associated with certain serotypes of typical EHEC and emerging EHEC strains. Virulence plasmid associated genes such as katP, espP, and etpD were more common  in EHEC than in STEC strains; this supports their association with virulence. This array constitutes a valuable approach for the identification of STEC strains with a high potential for human virulence. 
20639339	 The Lia system, a cell envelope stress response module of Bacillus subtilis, is comprised of the LiaRS two-component system and a membrane-anchored inhibitor protein, LiaF. It is highly conserved in the Firmicutes bacteria, and all orthologs investigated so far are activated by cell wall antibiotics. In response to envelope stress, the systems in Firmicutes cocci induce the expression of a number of genes that are involved in conferring resistance against its inducers.  In contrast, a complete picture of the LiaR regulon of B. subtilis is still missing and no phenotypes could be associated with mutants lacking LiaRS. Here, we performed genome-wide transcriptomic, proteomic, and in-depth phenotypic profiling of constitutive "Lia ON" and "Lia OFF" mutants to obtain a comprehensive picture of the Lia response of Bacillus subtilis. In addition to the known targets liaIH and yhcYZ-yhdA, we identified ydhE as a novel gene affected by LiaR-dependent regulation. The results of detailed follow-up gene expression studies, together with proteomic analysis, demonstrate that the liaIH  operon represents the only relevant LiaR target locus in vivo. It encodes a small membrane protein (LiaI) and a phage shock protein homolog (LiaH). LiaH forms large oligomeric rings reminiscent of those described for Escherichia coli PspA or Arabidopsis thaliana Vipp1. The results of comprehensive phenotype studies demonstrated that the gene products of the liaIH operon are involved in protecting the cell against oxidative stress and some cell wall antibiotics. Our  data suggest that the LiaFSR system of B. subtilis and, presumably, other Firmicutes bacilli coordinates a phage shock protein-like response. 
20659289	 The recently discovered prokaryotic CRISPR/Cas defence system provides immunity against viral infections and plasmid conjugation. It has been demonstrated that in Escherichia coli transcription of the Cascade genes (casABCDE) and to some extent the CRISPR array is repressed by heat-stable nucleoid-structuring (H-NS) protein, a global transcriptional repressor. Here we elaborate on the control of  the E. coli CRISPR/Cas system, and study the effect on CRISPR-based anti-viral immunity. Transformation of wild-type E. coli K12 with CRISPR spacers that are complementary to phage Lambda does not lead to detectable protection against Lambda infection. However, when an H-NS mutant of E. coli K12 is transformed with the same anti-Lambda CRISPR, this does result in reduced sensitivity to phage infection. In addition, it is demonstrated that LeuO, a LysR-type transcription factor, binds to two sites flanking the casA promoter and the H-NS nucleation site, resulting in derepression of casABCDE12 transcription. Overexpression of LeuO in E. coli K12 containing an anti-Lambda CRISPR leads to an enhanced protection against phage infection. This study demonstrates that in E. coli H-NS  and LeuO are antagonistic regulators of CRISPR-based immunity. 
20653963	 BACKGROUND: Our current understanding of transcription factor binding sites (TFBSs) in sequenced prokaryotic genomes is very limited due to the lack of an accurate and efficient computational method for the prediction of TFBSs at a genome scale. In an attempt to change this situation, we have recently developed  a comparative genomics based algorithm called GLECLUBS for de novo genome-wide prediction of TFBSs in a target genome. Although GLECLUBS has achieved rather high prediction accuracy of TFBSs in a target genome, it is still not efficient enough to be applied to all the sequenced prokaryotic genomes. RESULTS: Here, we designed a new algorithm based on GLECLUBS called extended GLECLUBS (eGLECLUBS) for simultaneous prediction of TFBSs in a group of related prokaryotic genomes. When tested on a group of gamma-proteobacterial genomes including E. coli K12, a group of firmicutes genomes including B. subtilis and a  group of cyanobacterial genomes using the same parameter settings, eGLECLUBS predicts more than 82% of known TFBSs in extracted inter-operonic sequences in both E. coli K12 and B. subtilis. Because each genome in a group is equally treated, it is highly likely that similar prediction accuracy has been achieved for each genome in the group. CONCLUSIONS: We have developed a new algorithm for genome-wide de novo prediction of TFBSs in a group of related prokaryotic genomes. The algorithm has achieved the same level of accuracy and robustness as its predecessor GLECLUBS, but can work on dozens of genomes at the same time. 
20156085	 The existence of two separate genetic lineages of Escherichia coli O157:H7 has previously been reported, and research indicates that lineage I could be more pathogenic toward human hosts than lineage II. We have previously shown that lineage I as a group expresses higher levels of Shiga toxin 2 (Stx2) than lineage II. To help evaluate why lineage II strains do not express appreciable levels of  this toxin, whole-genome microarrays were performed using Agilent custom microarrays. Gene expression of the two representative bovine lineage II strains  (FRIK966 and FRIK2000) were compared with gene expression of E. coli O157:H7 EDL933 (lineage I clinical type strain). Missing or differentially expressed genes and pathways were identified. Quantitative reverse transcription-polymerase chain reaction was performed to validate the microarray data. Draft genomes of FRIK966 and FRIK2000 were sequenced using Roche Applied Science/454 GS-FLX technology shotgun and paired-end approaches followed by de novo assembly. These  assemblies were compared with the lineage I genome sequences from E. coli O157:H7 EDL933. The bacteriophage 933W, which encodes the Stx2 genes, showed a notable repression in gene expression. Polymerase chain reaction primers, based upon EDL933 genomic information, were also designed against all of the potentially missing genes of this bacteriophage. Most of the structural genes associated with the bacteriophage were found to be absent from the genome of the two bovine strains. These analyses, combined with evaluation of the genomic information, suggest that transposon (IS629) rearrangements may be associated with disruption  of the bacteriophage genome in the FRIK strains. The results support the hypothesis that lineage II strains may be less of a risk as human foodborne pathogens. The microarray and genome data have been made available to the scientific community to allow continuing analysis of these cattle-isolated lineage II genomes and their gene expression. 
20418396	 Colicin E2-tolerant (known as Cet2) Escherichia coli K-12 mutants overproduce an  inner membrane protein, CreD, which is believed to cause the Cet2 phenotype. Here, we show that overproduction of CreD in a Cet2 strain results from hyperactivation of the CreBC two-component regulator, but CreD overproduction is  not responsible for the Cet2 phenotype. Through microarray analysis and gene knockout and overexpression studies, we show that overexpression of another CreBC-regulated gene, yieJ (also known as cbrC), causes the Cet2 phenotype. 
20444967	 Urinary tract infections (UTIs) are among the most common infectious diseases of  humans, with Escherichia coli being responsible for >80% of all cases. Asymptomatic bacteriuria (ABU) occurs when bacteria colonize the urinary tract without causing clinical symptoms and can affect both catheterized patients (catheter-associated ABU [CA-ABU]) and noncatheterized patients. Here, we compared the virulence properties of a collection of ABU and CA-ABU nosocomial E. coli isolates in terms of antibiotic resistance, phylogenetic grouping, specific  UTI-associated virulence genes, hemagglutination characteristics, and biofilm formation. CA-ABU isolates were similar to ABU isolates with regard to the majority of these characteristics; exceptions were that CA-ABU isolates had a higher prevalence of the polysaccharide capsule marker genes kpsMT II and kpsMT K1, while more ABU strains were capable of mannose-resistant hemagglutination. To examine biofilm growth in detail, we performed a global gene expression analysis  with two CA-ABU strains that formed a strong biofilm and that possessed a limited adhesin repertoire. The gene expression profile of the CA-ABU strains during biofilm growth showed considerable overlap with that previously described for the prototype ABU E. coli strain, 83972. This is the first global gene expression analysis of E. coli CA-ABU strains. Overall, our data suggest that nosocomial ABU and CA-ABU E. coli isolates possess similar virulence profiles. 
20439311	 Prediction of transcription factor binding sites is an important challenge in genome analysis. The advent of next generation genome sequencing technologies makes the development of effective computational approaches particularly imperative. We have developed a novel training-based methodology intended for prokaryotic transcription factor binding site prediction. Our methodology extends existing models by taking into account base interdependencies between neighbouring positions using conditional probabilities and includes genomic background weighting. This has been tested against other existing and novel methodologies including position-specific weight matrices, first-order Hidden Markov Models and joint probability models. We have also tested the use of gapped and ungapped alignments and the inclusion or exclusion of background weighting. We show that our best method enhances binding site prediction for all of the 22 Escherichia coli transcription factors with at least 20 known binding sites, with many showing substantial improvements. We highlight the advantage of using block  alignments of binding sites over gapped alignments to capture neighbouring position interdependencies. We also show that combining these methods with ChIP-on-chip data has the potential to further improve binding site prediction. Finally we have developed the ungapped likelihood under positional background platform: a user friendly website that gives access to the prediction method devised in this work. 
20617166	 The Varicella Zoster Virus (VZV) is a ubiquitous human alpha-herpesvirus that is  the causative agent of chicken pox and shingles. Although an attenuated VZV vaccine (v-Oka) has been widely used in children in the United States, chicken pox outbreaks are still seen, and the shingles vaccine only reduces the risk of shingles by 50%. Therefore, VZV still remains an important public health concern. Knowledge of VZV replication and pathogenesis remains limited due to its highly cell-associated nature in cultured cells, the difficulty of generating recombinant viruses, and VZV's almost exclusive tropism for human cells and tissues. In order to circumvent these hurdles, we cloned the entire VZV (p-Oka) genome into a bacterial artificial chromosome that included a dual-reporter system (GFP and luciferase reporter genes). We used PCR-based mutagenesis and the homologous recombination system in the E. coli to individually delete each of the genome's 70 unique ORFs. The collection of viral mutants obtained was systematically examined both in MeWo cells and in cultured human fetal skin organ samples. We use our genome-wide deletion library to provide novel functional annotations to 51% of the VZV proteome. We found 44 out of 70 VZV ORFs to be essential for viral replication. Among the 26 non-essential ORF deletion mutants, eight have discernable growth defects in MeWo. Interestingly, four ORFs were found to be required for viral replication in skin organ cultures, but not in MeWo cells, suggesting their potential roles as skin tropism factors. One of the  genes (ORF7) has never been described as a skin tropic factor. The global profiling of the VZV genome gives further insights into the replication and pathogenesis of this virus, which can lead to improved prevention and therapy of  chicken pox and shingles. 
20576138	 BACKGROUND: Serine proteases (SPs) and serine proteases homologs (SPHs) are a large group of proteolytic enzymes, with important roles in a variety of physiological processes, such as cell signalling, defense and development. Genome-wide identification and expression analysis of serine proteases and their  homologs in the silkworm might provide valuable information about their biological functions. RESULTS: In this study, 51 SP genes and 92 SPH genes were systematically identified in the genome of the silkworm Bombyx mori. Phylogenetic analysis indicated that six gene families have been amplified species-specifically in the  silkworm, and the members of them showed chromosomal distribution of tandem repeats. Microarray analysis suggests that many silkworm-specific genes, such as  members of SP_fam12, 13, 14 and 15, show expression patterns that are specific to tissues or developmental stages. The roles of SPs and SPHs in resisting pathogens were investigated in silkworms when they were infected by Escherichia coli, Bacillus bombysepticus, Batrytis bassiana and B. mori nucleopolyhedrovirus, respectively. Microarray experiment and real-time quantitative RT-PCR showed that 18 SP or SPH genes were significantly up-regulated after pathogen induction, suggesting that SP and SPH genes might participate in pathogenic microorganism resistance in B. mori. CONCLUSION: Silkworm SP and SPH genes were identified. Comparative genomics showed that SP and SPH genes belong to a large family, whose members are generated mainly by tandem repeat evolution. We found that silkworm has species-specific SP and SPH genes. Phylogenetic and microarray analyses provide an overview of the silkworm SP and SPHs, and facilitate future functional studies on these enzymes. 
20567214	 tRNA aminoacylation, or charging, levels can rapidly change within a cell in response to the environment[1]. Changes in tRNA charging levels in both prokaryotic and eukaryotic cells lead to translational regulation which is a major cellular mechanism of stress response. Familiar examples are the stringent  response in E. coli and the Gcn2 stress response pathway in yeast ([2-6]). Recent work in E. coli and S. cerevisiae have shown that tRNA charging patterns are highly dynamic and depends on the type of stress experienced by cells [1, 6, 7].  The highly dynamic, variable nature of tRNA charging makes it essential to determine changes in tRNA charging levels at the genomic scale, in order to fully elucidate cellular response to environmental variations. In this review we present a method for simultaneously measuring the relative charging levels of all tRNAs in S. cerevisiae . While the protocol presented here is for yeast, this protocol has been successfully applied for determining relative charging levels in a wide variety of organisms including E. coli and human cell cultures[7, 8]. 
20525227	 BACKGROUND: The identification of non-coding transcripts in human, mouse, and Escherichia coli has revealed their widespread occurrence and functional importance in both eukaryotic and prokaryotic life. In prokaryotes, studies have  shown that non-coding transcripts participate in a broad range of cellular functions like gene regulation, stress and virulence. However, very little is known about non-coding transcripts in Streptococcus pneumoniae (pneumococcus), an obligate human respiratory pathogen responsible for significant worldwide morbidity and mortality. Tiling microarrays enable genome wide mRNA profiling as  well as identification of novel transcripts at a high-resolution. RESULTS: Here, we describe a high-resolution transcription map of the S. pneumoniae clinical isolate TIGR4 using genomic tiling arrays. Our results indicate that approximately 66% of the genome is expressed under our experimental conditions. We identified a total of 50 non-coding small RNAs (sRNAs) from the intergenic regions, of which 36 had no predicted function. Half of the identified sRNA sequences were found to be unique to S. pneumoniae genome. We identified eight overrepresented sequence motifs among sRNA sequences that correspond to sRNAs in different functional categories. Tiling arrays also identified approximately 202 operon structures in the genome. CONCLUSIONS: In summary, the pneumococcal operon structures and novel sRNAs identified in this study enhance our understanding of the complexity and extent of the pneumococcal 'expressed' genome. Furthermore, the results of this study open up new avenues of research for understanding the complex RNA regulatory network governing S. pneumoniae physiology and virulence. 
20351145	 Shiga toxins (Stxs) are bacterial cytotoxins produced by the enteric pathogens Shigella dysenteriae serotype 1 and some serotypes of Escherichia coli that cause bacillary dysentery and hemorrhagic colitis, respectively. To date, approaches to studying the capacity of Stxs to alter gene expression in intoxicated cells have  been limited to individual genes. However, it is known that many of the signaling pathways activated by Stxs regulate the expression of multiple genes in mammalian cells. To expand the scope of analysis of gene expression and to better understand the underlying mechanisms for the various effects of Stxs on host cell functions, we carried out comparative microarray analyses to characterize the global transcriptional response of human macrophage-like THP-1 cells to Shiga toxin type 1 (Stx1) and lipopolysaccharides. The data were analyzed by using a rigorous combinatorial approach with three separate statistical algorithms. A total of 36 genes met the criteria of upregulated expression in response to Stx1  treatment, with 14 genes uniquely upregulated by Stx1. Microarray data were validated by real-time reverse transcriptase PCR for genes encoding early growth  response 1 (Egr-1) (transcriptional regulator), cyclooxygenase 2 (COX-2; inflammation), and dual specificity phosphatase 1 (DUSP1), DUSP5, and DUSP10 (regulation of mitogen-activated protein kinase signaling). Stx1-mediated signaling through extracellular signal-regulated kinase 1/2 and Egr-1 appears to  be involved in the increased expression and production of the proinflammatory mediator tumor necrosis factor alpha. Activation of COX-2 is associated with the  increased production of proinflammatory and vasoactive eicosanoids. However, the  capacity of Stx1 to increase the expression of genes encoding phosphatases suggests that mechanisms to dampen the macrophage proinflammatory response may be built into host response to the toxins. 
20485743	 Recently, simplified graphical modeling approaches based on low-order conditional (in-)dependence calculations have received attention because of their potential to model gene regulatory networks. Such methods are able to reconstruct large-scale gene networks with a small number of experimental measurements, at minimal computational cost. However, unlike Bayesian networks, current low-order  graphical models provide no means to distinguish between cause and effect in gene regulatory relationships. To address this problem, we developed a low-order constraint-based algorithm for gene regulatory network inference. The method is capable of inferring causal directions using limited-order conditional independence tests and provides a computationally-feasible way to analyze high-dimensional datasets while maintaining high reliability. To assess the performance of our algorithm, we compared it to several existing graphical models: relevance networks; graphical Gaussian models; ARACNE; Bayesian networks; and the classical constraint-based algorithm, using realistic synthetic datasets. Furthermore, we applied our algorithm to real microarray data from Escherichia coli Affymetrix arrays and validated the results by comparison to known regulatory interactions collected in RegulonDB. The algorithm was found to be both effective and efficient at reconstructing gene regulatory networks from microarray data. 
19932572	 Escherichia coli strains belonging to serogroups O8, O9, O15, O26, O35, O78, O86, O101, O115 and O119 are commonly associated with septicemia or diarrhea in calves and pose a significant threat to the cattle industry worldwide. In this study, a  microarray detection system targeting O-antigen-specific genes was developed for  the identification of those serogroups. By testing against 186 E. coli and Shigella O-serogroup reference strains, 36 E. coli clinical isolates, and 9 representative strains of other closely related bacterial species, the microarray was shown to be specific and reproducible. The detection sensitivity was determined to be 50 ng genomic DNA. The microarray assay developed here is suitable for the detection and identification of relevant strains from environmental and/or clinical samples, and is especially useful for epidemiologic studies. 
20507366	 AIM: We sought to determine whether triclosan (2,4,4'-trichloro-2'-hydroxydiphenylether), an extensively used anti-plaque agent with broad-spectrum anti-microbial activity, with reported anti-inflammatory effects via inhibition of prostaglandin E2 and interleukin 1 (IL-1)beta, could also more broadly suppress multiple inflammatory gene pathways responsible for the pathogenesis of gingivitis and periodontitis. MATERIALS AND METHODS: As an exploratory study, the effects of triclosan on the inflammatory gene expression profile were assessed ex vivo using peripheral whole blood samples from eight periodontally healthy donors. Ten-millilitres whole blood aliquots were incubated 2 h with 0.3 microg/ml Escherichia coli lipopolysaccharide (LPS) with or without 0.5 microg/ml triclosan. Affymetrix microarray gene expression profiles from isolated leucocytes and pathway-specific quantitative polymerase chain reaction arrays were used to investigate changes in expression of target cytokines and cell signalling molecules. RESULTS: Ex vivo human whole blood assays indicated that triclosan significantly  down-regulated the LPS-stimulated expression of Toll-like receptor signalling molecules and other multiple inflammatory molecules including IL-1 and IL-6 and the dampening of signals that activate the T-helper type 1 acquired immune response via suppression of CD70 with concomitant up-regulation of growth factors related to bone morphogenetic protein (BMP)2 and BMP6 synthesis. CONCLUSIONS: Anti-inflammatory effects were found in this exploratory survey, including suppression of microbial-pathogen recognition pathway molecules and the suppression of acute and chronic mediators of inflammation. 
20138094	 Many of the Enterobacteriaceae carry multiple drug resistance (MDR) genes on large plasmids of replicon type Inc A/C and Inc H1. It is important to understand the transmission of these MDR plasmids because the genes they carry can affect the outcome of antimicrobial therapy. The aim of this study was to design a microarray with oligonucleotide probes for every gene in the six Inc A/C and one  Inc H1 plasmids of interest while representing all redundant sequences only once. The microarray is printed in triplicate with 493 unique oligonucleotide probes 70 nucleotides in length. Salmonella enterica and Escherichia coli control strains and test plasmids (in the parent strain and transformed into a known E. coli background strain) were hybridized to the plasmid microarray. This hybridization  arrays presents a rapid and cost effective method for high-density screening of isolates to evaluate the gene content of Inc A/C and H1 plasmids and will show how plasmids can change content with transmission. 
19833198	 Escherichia coli O157:H7, Salmonella enterica, Listeria monocytogenes and Campylobacter jejuni are considered important pathogens causing the most food-related human illnesses worldwide. Current methods for pathogen detection have limitations in the effectiveness of identifying multiple foodborne pathogens. In this study, a pathogen detection microarray was developed using various 70-mer oligonucleotides specifically targeting the above pathogens. To reduce the cost of detection, each microarray chip was designed and fabricated to accommodate 12 identical arrays which could be used for screening up to 12 different samples. To achieve high detection sensitivity and specificity, target-specific DNA amplification instead of whole genome random amplification was used prior to microarray analysis. Combined with 14-plex PCR amplification of target sequences, the microarray unambiguously distinguished all 4 pathogens with a detection sensitivity of 1 x 10(-4) ng (approximately 20 copies) of each genomic DNA. Applied the assay to 39 fresh meat samples, 16 samples were found to be contaminated by either 1 or 2 of these pathogens. The co-occurrences of Salmonella and E. coli O157:H7, Salmonella and L. monocytogenes in the same meat  samples were also observed. Overall, the microarray combined with multiplex PCR method was able to effectively screen single or multiple pathogens in food samples and to provide important genotypic information related to pathogen virulence. 
20338053	 BACKGROUND: One of main aims of Molecular Biology is the gain of knowledge about  how molecular components interact each other and to understand gene function regulations. Using microarray technology, it is possible to extract measurements  of thousands of genes into a single analysis step having a picture of the cell gene expression. Several methods have been developed to infer gene networks from  steady-state data, much less literature is produced about time-course data, so the development of algorithms to infer gene networks from time-series measurements is a current challenge into bioinformatics research area. In order to detect dependencies between genes at different time delays, we propose an approach to infer gene regulatory networks from time-series measurements starting from a well known algorithm based on information theory. RESULTS: In this paper we show how the ARACNE (Algorithm for the Reconstruction of Accurate Cellular Networks) algorithm can be used for gene regulatory network  inference in the case of time-course expression profiles. The resulting method is called TimeDelay-ARACNE. It just tries to extract dependencies between two genes  at different time delays, providing a measure of these dependencies in terms of mutual information. The basic idea of the proposed algorithm is to detect time-delayed dependencies between the expression profiles by assuming as underlying probabilistic model a stationary Markov Random Field. Less informative dependencies are filtered out using an auto calculated threshold, retaining most  reliable connections. TimeDelay-ARACNE can infer small local networks of time regulated gene-gene interactions detecting their versus and also discovering cyclic interactions also when only a medium-small number of measurements are available. We test the algorithm both on synthetic networks and on microarray expression profiles. Microarray measurements concern S. cerevisiae cell cycle, E. coli SOS pathways and a recently developed network for in vivo assessment of reverse engineering algorithms. Our results are compared with ARACNE itself and with the ones of two previously published algorithms: Dynamic Bayesian Networks and systems of ODEs, showing that TimeDelay-ARACNE has good accuracy, recall and  F-score for the network reconstruction task. CONCLUSIONS: Here we report the adaptation of the ARACNE algorithm to infer gene  regulatory networks from time-course data, so that, the resulting network is represented as a directed graph. The proposed algorithm is expected to be useful  in reconstruction of small biological directed networks from time course data. 
20209085	 Signaling and regulatory pathways that guide gene expression have only been partially defined for most organisms. However, given the increasing number of microarray measurements, it may be possible to reconstruct such pathways and uncover missing connections directly from experimental data. Using a compendium of microarray gene expression data obtained from Escherichia coli, we constructed a series of Bayesian network models for the reactive oxygen species (ROS) pathway as defined by EcoCyc. A consensus Bayesian network model was generated using those networks sharing the top recovered score. This microarray-based network only partially agreed with the known ROS pathway curated from the literature and  databases. A top network was then expanded to predict genes that could enhance the Bayesian network model using an algorithm we termed 'BN+1'. This expansion procedure predicted many stress-related genes (e.g., dusB and uspE), and their possible interactions with other ROS pathway genes. A term enrichment method discovered that biofilm-associated microarray data usually contained high expression levels of both uspE and gadX. The predicted involvement of gene uspE in the ROS pathway and interactions between uspE and gadX were confirmed experimentally using E. coli reporter strains. Genes gadX and uspE showed a feedback relationship in regulating each other's expression. Both genes were verified to regulate biofilm formation through gene knockout experiments. These data suggest that the BN+1 expansion method can faithfully uncover hidden or unknown genes for a selected pathway with significant biological roles. The presently reported BN+1 expansion method is a generalized approach applicable to  the characterization and expansion of other biological pathways and living systems. 
19727872	 Escherichia coli intramammary infection elicits localized and systemic responses, some of which have been characterized in mammary secretory tissue. Our objective  was to characterize gene expression patterns that become activated in different regions of the mammary gland during the acute phase of experimentally induced E.  coli mastitis. Tissues evaluated were from Fürstenburg's rosette, teat cistern (TC), gland cistern (GC), and lobulo-alveolar (LA) regions of control and infected mammary glands, 12 and 24 h after bacterial (or control) infusions. The  main networks activated by E. coli infection pertained to immune and inflammatory response, with marked induction of genes encoding proteins that function in chemotaxis and leukocyte activation and signaling. Genomic response at 12 h post-infection was greatest in tissues of the TC and GC. Only at 24 h post-infection did tissue from the LA region respond, at which time the response  was the greatest of all regions. Similar genetic networks were impacted in all regions during early phases of intramammary infection, although regional differences throughout the gland were noted. Data support an important sentinel function for the teat, as these tissues responded rapidly and intensely, with production of cytokines and antimicrobial peptides. 
19916789	 To understand the mechanisms and epidemiology of antimicrobial resistance (AR), the genetic elements responsible must be identified. Due to the myriad of possible genes, a high-density genotyping technique is needed for initial screening. To achieve this, AR genes in the National Center for Biotechnology Information GenBank database were identified by their annotations and compiled into a nonredundant list of 775 genes. A DNA microarray was constructed of 70mer  oligonucelotide probes designed to detect these genes encoding resistances to aminoglycosides, beta-lactams, chloramphenicols, glycopeptides, heavy metals, lincosamides, macrolides, metronidazoles, polyketides, quaternary ammonium compounds, streptogramins, sulfonamides, tetracyclines, and trimethoprims as well as resistance transfer genes. The microarray was validated with two fully sequenced control strains of Salmonella enterica: Typhimurium LT2 (sensitive) and Typhi CT18 (multidrug resistance [MDR]). All resistance genes encoded on the MDR  plasmid, pHCM1, harbored by CT18 were detected in that strain, whereas no resistance genes were detected in LT2. The microarray was also tested with a variety of bacteria, including MDR Salmonella enterica serovars, Escherichia coli, Campylobacter spp., Enterococcus spp., methicillin-resistant Staphylococcus aureus, Listeria spp., and Clostridium difficile. The results presented here demonstrate that a microarray can be designed to detect virtually all AR genes found in the National Center for Biotechnology Information database, thus reducing the subsequent assays necessary to identify specific resistance gene alleles. 
20184744	 BACKGROUND: Coliform bacteria are the most common etiologic agents in severe mastitis of cows. Escherichia coli infections are mostly restricted to a single udder quarter whereas neighboring quarters stay clinically inapparent, implicating the presence of a systemic defense reaction. To address its underlying mechanism, we performed a transcriptome study of mammary tissue from udder quarters inoculated with E. coli (6 h and 24 h post infection), from neighboring quarters of the same animals, and from untreated control animals. RESULTS: After 6 h 13 probe sets of differentially expressed genes (DEG) were detected in infected quarters versus control animals. Eighteen hours later 2154 and 476 DEG were found in infected and in neighboring quarters vs. control animals. Cluster analysis revealed DEG found only in infected quarters (local response) and DEG detected in both infected and neighboring quarters (systemic response). The first group includes genes mainly involved in immune response and  inflammation, while the systemic reaction comprises antigen processing and presentation, cytokines, protein degradation and apoptosis. Enhanced expression of antimicrobial genes (S100A8, S100A9, S100A12, CXCL2, GNLY), acute phase genes  (LBP, SAA3, CP, BF, C6, C4BPA, IF), and indicators of oxidative stress (GPX3, MT1A, MT2A, SOD2) point to an active defense reaction in infected and neighboring healthy quarters. Its early onset is indicated by increased transcription of NFIL3 at 6 h. NFIL3 is a predicted regulator of many genes of the systemic response at 24 h. The significance of our transcriptome study was evidenced by some recent findings with candidate gene based approaches. CONCLUSIONS: The discovery and holistic analysis of an extensive systemic reaction in the mammary gland significantly expands the knowledge of host-pathogen interactions in mastitis which may be relevant for the development  of novel therapies and for genetic selection towards mastitis resistance. 
19847890	 Familial adenomatous polyposis (FAP) is an autosomal dominantly inherited form of colorectal cancer (CRC) caused by mutation in the adenomatous polyposis coli (APC) gene. However, APC mutations are not detected in 10-50% of FAP patients. We searched for a new cancer gene by performing genome-wide genotyping on members of an APC mutation-negative FAP variant family and ethnicity-matched healthy controls. No common copy number change was found in all affected members using the unaffected members and healthy controls as baseline. A 111 kb copy number variable (CNV) region at 3q26.1 was shown to have copy number loss in all eight polyps compared to matched lymphocytes of two affected members. A common region of loss in all polyps, which are precursors to CRC, is likely to harbor disease-causing gene in accordance to Knudsen's "two-hit" hypothesis. There is, however, no gene within the deleted region. A 2-Mb scan of the genomic region encompassing the deleted region identified PPM1L, coding for a novel serine-threonine phosphatase in the TGF-beta and BMP signaling pathways. Real-time PCR analyses indicate that the 3'UTR of PPM1L transcript was down-regulated more than two-folds in all six polyps and tumors compared to matched mucosa of the affected member. This down-regulation was not observed in APC mutation-positive FAP patients. Our results suggest that the CNV region at 3q26 harbors an element that regulates the expression of an upstream candidate tumor suppressor, PPM1L, thus providing a novel mechanism for colorectal tumorigenesis in APC mutation-negative familial CRC patients. 
19892762	 The Escherichia coli O157 : H7 TW14359 strain was implicated in a multi-state outbreak in North America in 2006, which resulted in high rates of severe disease. Similarly, the O157 : H7 RIMD0509952 (Sakai) strain caused the largest O157 : H7 outbreak to date. Both strains were shown to represent divergent phylogenetic lineages. Here we compared global gene expression patterns before and after epithelial cell exposure, as well as the ability to adhere to and invade epithelial cells, between the two outbreak strains. Epithelial cell assays demonstrated a 2.5-fold greater adherence of the TW14359 strain relative to Sakai, while whole-genome microarrays detected significant differential expression of 914 genes, 206 of which had a fold change >/=1.5. Interestingly, most locus of enterocyte effacement (LEE) genes were upregulated in TW14359, whereas flagellar and chemotaxis genes were primarily upregulated in Sakai, suggesting discordant expression of these genes between the two strains. The Shiga toxin 2 genes were also upregulated in the TW14359 strain, as were several  pO157-encoded genes that promote adherence, including type II secretion genes and their effectors stcE and adfO. Quantitative RT-PCR confirmed the expression differences detected in the microarray analysis, and expression levels were lower for a subset of LEE genes before versus after exposure to epithelial cells. In all, this study demonstrated the upregulation of major and ancillary virulence genes in TW14359 and of flagellar and chemotaxis genes in Sakai, under conditions that precede intimate bacterial attachment to epithelial cells. Differences in the level of adherence to epithelial cells were also observed, implying that these two phylogenetically divergent O157 : H7 outbreak strains vary in their ability to colonize, or initiate the disease process. 
20122231	 BACKGROUND: Gene regulatory network is an abstract mapping of gene regulations in living cells that can help to predict the system behavior of living organisms. Such prediction capability can potentially lead to the development of improved diagnostic tests and therapeutics. DNA microarrays, which measure the expression  level of thousands of genes in parallel, constitute the numeric seed for the inference of gene regulatory networks. In this paper, we have proposed a new approach for inferring gene regulatory networks from time-series gene expression  data using linear time-variant model. Here, Self-Adaptive Differential Evolution, a versatile and robust Evolutionary Algorithm, is used as the learning paradigm. RESULTS: To assess the potency of the proposed work, a well known nonlinear synthetic network has been used. The reconstruction method has inferred this synthetic network topology and the associated regulatory parameters with high accuracy from both the noise-free and noisy time-series data. For validation purposes, the proposed approach is also applied to the simulated expression dataset of cAMP oscillations in Dictyostelium discoideum and has proved it's strength in finding the correct regulations. The strength of this work has also been verified by analyzing the real expression dataset of SOS DNA repair system in Escherichia coli and it has succeeded in finding more correct and reasonable regulations as compared to various existing works. CONCLUSION: By the proposed approach, the gene interaction networks have been inferred in an efficient manner from both the synthetic, simulated cAMP oscillation expression data and real expression data. The computational time of this approach is also considerably smaller, which makes it to be more suitable for larger network reconstruction. Thus the proposed approach can serve as an initiate for the future researches regarding the associated area. 
19880650	 Escherichia coli O157:H7 strains can be classified into different genotypes based on the presence of specific Shiga toxin-encoding bacteriophage insertion sites. Certain O157:H7 genotypes predominate among human clinical cases (clinical genotypes), while others are more frequently found in bovines (bovine-biased genotypes). To determine whether inherent differences in gene expression explain  the variation in infectivity of these genotypes, we compared the expression patterns of clinical genotype 1 strains with those of bovine-biased genotype 5 strains using microarrays. Important O157:H7 virulence factors, including locus of enterocyte effacement genes, the enterohemolysin, and several pO157 genes, showed increased expression in the clinical versus bovine-biased genotypes. In contrast, genes essential for acid resistance (e.g., gadA, gadB, and gadC) and stress fitness were upregulated in bovine-biased genotype 5 strains. Increased expression of acid resistance genes was confirmed functionally using a model stomach assay, in which strains of bovine-biased genotype 5 had a 2-fold-higher survival rate than strains of clinical genotype 1. Overall, these results suggest that the increased prevalence of O157:H7 illness caused by clinical genotype 1 strains is due in part to the overexpression of key virulence genes. The bovine-biased genotype 5 strains, however, are more resistant to adverse environmental conditions, a characteristic that likely facilitates O157:H7 colonization of bovines. 
19906701	 Since 2003, MicrobesOnline (http://www.microbesonline.org) has been providing a community resource for comparative and functional genome analysis. The portal includes over 1000 complete genomes of bacteria, archaea and fungi and thousands  of expression microarrays from diverse organisms ranging from model organisms such as Escherichia coli and Saccharomyces cerevisiae to environmental microbes such as Desulfovibrio vulgaris and Shewanella oneidensis. To assist in annotating genes and in reconstructing their evolutionary history, MicrobesOnline includes a comparative genome browser based on phylogenetic trees for every gene family as well as a species tree. To identify co-regulated genes, MicrobesOnline can search for genes based on their expression profile, and provides tools for identifying regulatory motifs and seeing if they are conserved. MicrobesOnline also includes  fast phylogenetic profile searches, comparative views of metabolic pathways, operon predictions, a workbench for sequence analysis and integration with RegTransBase and other microbial genome resources. The next update of MicrobesOnline will contain significant new functionality, including comparative  analysis of metagenomic sequence data. Programmatic access to the database, along with source code and documentation, is available at http://microbesonline.org/programmers.html. 
20196750	 We present a weighted-LASSO method to infer the parameters of a first-order vector auto-regressive model that describes time course expression data generated by directed gene-to-gene regulation networks. These networks are assumed to own prior internal structures of connectivity which drive the inference method. This  prior structure can be either derived from prior biological knowledge or inferred by the method itself. We illustrate the performance of this structure-based penalization both on synthetic data and on two canonical regulatory networks (the yeast cell cycle regulation network and the E. coli S.O.S. DNA repair network). 
20027300	 BACKGROUND: Choroideremia (CHM) is a progressive X-linked retinopathy caused by mutations in the CHM gene, which encodes Rab escort protein-1 (REP-1), an escort  protein involved in the prenylation of Rabs. Under-prenylation of certain Rabs, as a result of loss of function mutations in REP-1, could affect vesicular trafficking, exocytosis and secretion in peripheral cells of CHM patients. METHODOLOGY/PRINCIPAL FINDINGS: To evaluate this hypothesis, intracellular vesicle transport, lysosomal acidification and rates of proteolytic degradation were studied in monocytes (CD14+ fraction) and primary skin fibroblasts from the  nine age-matched controls and thirteen CHM patients carrying 10 different loss-of-function mutations. With the use of pHrodo BioParticles conjugated with E. coli, collagen I coated FluoSpheres beads and fluorescent DQ ovalbumin with BODYPY FL dye, we demonstrated for the first time that lysosomal pH was increased in monocytes of CHM patients and, as a consequence, the rates of proteolytic degradation were slowed. Microarray analysis of gene expression revealed that some genes involved in the immune response, small GTPase regulation, transcription, cell adhesion and the regulation of exocytosis were significantly  up and down regulated in cells from CHM patients compared to controls. Finally, CHM fibroblasts secreted significantly lower levels of cytokine/growth factors such as macrophage chemoattractant protein-1 (MCP-1), pigment epithelial derived  factor (PEDF), tumor necrosis factor (TNF) alpha, fibroblast growth factor (FGF)  beta and interleukin (lL)-8. CONCLUSIONS/SIGNIFICANCE: We demonstrated for the first time that peripheral cells of CHM patients had increased pH levels in lysosomes, reduced rates of proteolytic degradation and altered secretion of cytokines. Peripheral cells from CHM patients expose characteristics that were not previously recognized and could used as an alternative models to study the effects of different mutations in the  REP-1 gene on mechanism of CHM development in human population. 
19825796	 MOTIVATION: Much of a cell's regulatory response to changing environments occurs  at the transcriptional level. Particularly in higher organisms, transcription factors (TFs), microRNAs and epigenetic modifications can combine to form a complex regulatory network. Part of this system can be modeled as a collection of regulatory modules: co-regulated genes, the conditions under which they are co-regulated and sequence-level regulatory motifs. RESULTS: We present the Combinatorial Algorithm for Expression and Sequence-based Cluster Extraction (COALESCE) system for regulatory module prediction. The algorithm is efficient enough to discover expression biclusters and putative regulatory motifs in metazoan genomes (>20,000 genes) and very large microarray compendia (>10,000 conditions). Using Bayesian data integration, it can also include diverse supporting data types such as evolutionary conservation or nucleosome placement. We validate its performance using a functional evaluation of co-clustered genes, known yeast and Escherichea coli TF targets, synthetic data and various metazoan data compendia. In all cases, COALESCE performs as well or better than current biclustering and motif prediction tools, with high accuracy in functional and TF/target assignments and zero false positives on synthetic data. COALESCE provides an efficient and flexible platform within which large, diverse data collections can be integrated to predict metazoan regulatory  networks. AVAILABILITY: Source code (C++) is available at http://function.princeton.edu/sleipnir, and supporting data and a web interface are provided at http://function.princeton.edu/coalesce. CONTACT: ogt@cs.princeton.edu; hcoller@princeton.edu. SUPPLEMENTARY INFORMATION: Supplementary data are available at Bioinformatics online. 
19690172	 Salmonella are closely related to commensal Escherichia coli but have gained virulence factors enabling them to behave as enteric pathogens. Less well studied are the similarities and differences that exist between the metabolic properties  of these organisms that may contribute toward niche adaptation of Salmonella pathogens. To address this, we have constructed a genome scale Salmonella metabolic model (iMA945). The model comprises 945 open reading frames or genes, 1964 reactions, and 1036 metabolites. There was significant overlap with genes present in E. coli MG1655 model iAF1260. In silico growth predictions were simulated using the model on different carbon, nitrogen, phosphorous, and sulfur  sources. These were compared with substrate utilization data gathered from high throughput phenotyping microarrays revealing good agreement. Of the compounds tested, the majority were utilizable by both Salmonella and E. coli. Nevertheless a number of differences were identified both between Salmonella and E. coli and also within the Salmonella strains included. These differences provide valuable insight into differences between a commensal and a closely related pathogen and within different pathogenic strains opening new avenues for future explorations. 
19806199	 L-forms have been shown to occur among many species of bacteria and are suspected to be involved in persistent infections. Since their discovery in 1935, numerous  studies characterizing L-form morphology, growth, and pathogenic potential have been conducted. However, the molecular mechanisms underlying the formation and survival of L-forms remain unknown. Using unstable L-form colonies of Escherichia coli as a model, we performed genome-wide transcriptome analysis and screened a deletion mutant library to study the molecular mechanisms involved in formation and survival of L-forms. Microarray analysis of L-form versus classical colonies  revealed many up-regulated genes of unknown function as well as multiple over-expressed stress pathways shared in common with persister cells and biofilms. Mutant screens identified three groups of mutants which displayed varying degrees of defects in L-form colony formation. Group 1 mutants, which showed the strongest defect in L-form colony formation, belonged to pathways involved in cell envelope stress, DNA repair, iron homeostasis, outer membrane biogenesis, and drug efflux/ABC transporters. Four (Group 1) mutants, rcsB, a positive response regulator of colanic acid capsule synthesis, ruvA, a recombinational junction binding protein, fur, a ferric uptake regulator and smpA a small membrane lipoprotein were selected for complementation. Complementation of the mutants using a high-copy overexpression vector failed, while utilization  of a low-copy inducible vector successfully restored L-form formation. This work  represents the first systematic genetic evaluation of genes and pathways involved in the formation and survival of unstable L-form bacteria. Our findings provide new insights into the molecular mechanisms underlying L-form formation and survival and have implications for understanding the emergence of antibiotic resistance, bacterial persistence and latent infections and designing novel drugs and vaccines. 
19641057	 Pathogen detection is critical to the process of generating and testing powdered  infant formula (PIF). An obstacle associated with PIF microbial surveillance is that most current procedures are time-consuming and labor-intensive. We have developed a rapid, DNA microarray-based detection technique to identify 10 different pathogenic bacteria associated with PIF contamination based on the 16S-23S rRNA gene internal transcribed spacer (ITS) sequences and wzy (O antigen  polymerase) gene. Using this procedure, Enterobacter sakazakii, Salmonella enterica, Klebsiella pneumoniae, Klebsiella oxytoca, Serratia marcescens, Acinetobacter baumannii, Bacillus cereus, Listeria monocytogenes, Staphylococcus  aureus, and Escherichia coli O157 were identified. One hundred eighty-five strains were used to validate the microarray assay (including 134 target pathogen strains and 51 closely related bacteria). Twenty-seven probes reproducibly detected multiple pathogens with high specificity and sensitivity (0.100 ng genomic DNA or 10(4) CFU/ml). Twenty-one real PIF samples were tested by the microarray with 100% accuracy. The data presented reveal that the designed oligonucleotide microarray is a promising method for basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. 
19709428	 BACKGROUND: Porcine enteropathogenic Escherichia coli (PEPEC) strains of serogroup O45 cause post-weaning diarrhea and produce characteristic attaching and effacing (A/E) lesions. Most O45 PEPEC strains possess the locus of enterocyte effacement (LEE), encoding the virulence factors required for production of A/E lesions, and often possess the paa gene, which is thought to contribute to the early stages of PEPEC pathogenicity. In this study, nine O45 PEPEC strains and a rabbit enteropathogenic (REPEC) strain, known to produce A/E  lesions in vivo, were characterized using an E. coli O157-E. coli K12 whole genome microarray and a virulence gene-specific microarray, and by PCR experiments. RESULTS: Based on their virulence gene profiles, the 10 strains were considered to be atypical EPEC. The differences in their genomes pointed to the identification of two distinct evolutionary groups of O45 PEPEC, Groups I and II, and provided evidence for a contribution of these genetic differences to their virulence in pigs. Group I included the REPEC strain and four O45 PEPEC strains known to induce severe A/E lesions in challenged pigs whereas Group II was composed of the five other O45 PEPEC strains, which induced less severe or no A/E lesions in challenged pigs. Significant differences between Groups I and II were  found with respect to the presence or absence of 50 O-Islands (OIs) or S-loops and 13 K-islands (KIs) or K-loops, including the virulence-associated islands OI#1 (S-loop#1), OI#47 (S-loop#71), OI#57 (S-loop#85), OI#71 (S-loop#108), OI#115, OI#122, and OI#154 (S-loop#253). CONCLUSION: We have genetically characterized a collection of O45 PEPEC strains and classified them into two distinct groups. The differences in their virulence  gene and genomic island content may influence the pathogenicity of O45 PEPEC strains, and explain why Group I O45 PEPEC strains induced more severe A/E lesions in explants and challenged pigs than Group II strains. 
19650909	 BACKGROUND: RpoS is a conserved stress regulator that plays a critical role in survival under stress conditions in Escherichia coli and other gamma-proteobacteria. RpoS is also involved in virulence of many pathogens including Salmonella and Vibrio species. Though well characterized in non-pathogenic E. coli K12 strains, the effect of RpoS on transcriptome expression has not been examined in pathogenic isolates. E. coli O157:H7 is a serious human enteropathogen, possessing a genome 20% larger than that of E. coli K12, and many of the additional genes are required for virulence. The genomic difference may result in substantial changes in RpoS-regulated gene expression. To test this, we compared the transcriptional profile of wild type and rpoS mutants of the E. coli O157:H7 EDL933 type strain. RESULTS: The rpoS mutation had a pronounced effect on gene expression in stationary phase, and more than 1,000 genes were differentially expressed (twofold, P<0.05). By contrast, we found 11 genes expressed differently in exponential phase. Western blot analysis revealed that, as expected, RpoS level was low in exponential phase and substantially increased in stationary phase. The defect in rpoS resulted in impaired expression of genes responsible for stress response (e.g., gadA, katE and osmY), arginine degradation (astCADBE), putrescine degradation (puuABCD), fatty acid oxidation (fadBA and fadE), and virulence (ler, espI and cesF). For EDL933-specific genes on O-islands, we found 50 genes expressed higher in wild type EDL933 and 49 genes expressed higher in the rpoS mutants. The protein levels of Tir and EspA, two LEE-encoded virulence factors, were elevated in the rpoS mutants under LEE induction conditions. CONCLUSION: Our results show that RpoS has a profound effect on global gene expression in the pathogenic strain O157:H7 EDL933, and the identified RpoS regulon, including many EDL933-specific genes, differs substantially from that of laboratory K12 strains. 
19534605	 The relative contribution of competition and cooperation at the microbe-microbe level is not well understood for the bacteria constituting the gut microbiota. The high number and variability of human gut commensals have hampered the analysis. To get some insight into the question how so many different bacterial species can coexist in the mammalian gut, we studied the interaction between three human gut commensals (Escherichia coli K-12, Lactobacillus johnsonii NCC533, and Bifidobacterium longum NCC2705) in the intestine of gnotobiotic mice. The bacterial titers and their anatomical distribution were studied in the colonized mice. L. johnsonii achieved the highest cell counts in the stomach, while B. longum dominated the colon. The colon was also the intestinal location in which B. longum displayed the highest number of expressed genes, followed by the cecum and the small intestine. Addition of further bacterial strains led to strikingly different results. A Lactobacillus paracasei strain coexisted, while a second B. longum strain was excluded from the system. Notably, this strain lacked an operon involved in the degradation, import, and metabolism of mannosylated glycans. Subsequent introduction of the E. coli Nissle strain resulted in the elimination of L. johnsonii NCC533 and E. coli K-12, while B. longum NCC2705 showed a transient decrease in population size, demonstrating the dynamic nature  of microbe-microbe interactions. The study of such simple interacting bacterial systems might help to derive some basic rules governing microbial ecology within  the mammalian gut. 
19528580	 This paper describes a new DNA chip, based on the use of a ligation detection reaction coupled to a universal array, developed to detect and analyze, directly  from milk samples, microbial pathogens known to cause bovine, ovine, and caprine  mastitis or to be responsible for foodborne intoxication or infection, or both. Probes were designed for the identification of 15 different bacterial groups: Staphylococcus aureus, Streptococcus agalactiae, nonaureus staphylococci, Streptococcus bovis, Streptococcus equi, Streptococcus canis, Streptococcus dysgalactiae, Streptococcus parauberis, Streptococcus uberis, Streptococcus pyogenes, Mycoplasma spp., Salmonella spp., Bacillus spp., Campylobacter spp., and Escherichia coli and related species. These groups were identified based on the 16S rRNA gene. For microarray validation, 22 strains from the American Type Culture Collection or other culture collections and 50 milk samples were tested.  The results demonstrated high specificity, with sensitivity as low as 6 fmol. Moreover, the ligation detection reaction-universal array assay allowed for the identification of Mycoplasma spp. in a few hours, avoiding the long incubation times of traditional microbiological identification methods. The universal array  described here is a versatile tool able to identify milk pathogens efficiently and rapidly. 
19563677	 BACKGROUND: Many approaches have been used to study the evolution, population structure and genetic diversity of Escherichia coli O157:H7; however, observations made with different genotyping systems are not easily relatable to each other. Three genetic lineages of E. coli O157:H7 designated I, II and I/II have been identified using octamer-based genome scanning and microarray comparative genomic hybridization (mCGH). Each lineage contains significant phenotypic differences, with lineage I strains being the most commonly associated with human infections. Similarly, a clade of hyper-virulent O157:H7 strains implicated in the 2006 spinach and lettuce outbreaks has been defined using single-nucleotide polymorphism (SNP) typing. In this study an in silico comparison of six different genotyping approaches was performed on 19 E. coli genome sequences from 17 O157:H7 strains and single O145:NM and K12 MG1655 strains to provide an overall picture of diversity of the E. coli O157:H7 population, and to compare genotyping methods for O157:H7 strains. RESULTS: In silico determination of lineage, Shiga-toxin bacteriophage integration site, comparative genomic fingerprint, mCGH profile, novel region distribution profile, SNP type and multi-locus variable number tandem repeat analysis type was performed and a supernetwork based on the combination of these  methods was produced. This supernetwork showed three distinct clusters of strains that were O157:H7 lineage-specific, with the SNP-based hyper-virulent clade 8 synonymous with O157:H7 lineage I/II. Lineage I/II/clade 8 strains clustered closest on the supernetwork to E. coli K12 and E. coli O55:H7, O145:NM and sorbitol-fermenting O157 strains. CONCLUSION: The results of this study highlight the similarities in relationships derived from multi-locus genome sampling methods and suggest a "common genotyping language" may be devised for population genetics and epidemiological studies. Future genotyping methods should provide data that can be stored centrally and accessed locally in an easily transferable, informative and extensible format based on comparative genomic analyses. 
19342437	 Spaceflight conditions have a significant impact on a number of physiological functions due to psychological stress, radiation, and reduced gravity. To explore the effect of the flight environment on immunity, C57BL/6NTac mice were flown on  a 13-day space shuttle mission (STS-118). In response to flight, animals had a reduction in liver, spleen, and thymus masses compared with ground (GRD) controls (P < 0.005). Splenic lymphocyte, monocyte/macrophage, and granulocyte counts were significantly reduced in the flight (FLT) mice (P < 0.05). Although spontaneous blastogenesis of splenocytes in FLT mice was increased, response to lipopolysaccharide (LPS), a B-cell mitogen derived from Escherichia coli, was decreased compared with GRD mice (P < 0.05). Secretion of IL-6 and IL-10, but not TNF-alpha, by LPS-stimulated splenocytes was increased in FLT mice (P < 0.05). Finally, many of the genes responsible for scavenging reactive oxygen species were upregulated after flight. These data indicate that exposure to the spaceflight environment can increase anti-inflammatory mechanisms and change the  ex vivo response to LPS, a bacterial product associated with septic shock and a prominent Th1 response. 
19383688	 Helicobacter pylori is a motile Gram-negative bacterium that colonizes and persists in the human gastric mucosa. The flagellum gene regulatory circuitry of  H. pylori is unique in many aspects compared with the Salmonella/Escherichia coli paradigms, and some regulatory checkpoints remain unclear. FliK controls the hook length during flagellar assembly. Microarray analysis of a fliK-null mutant revealed increased transcription of genes under the control of the sigma(54) sigma factor RpoN. This sigma factor has been shown to be responsible for transcription of the class II flagellar genes, including flgE and flaB. No genes  higher in the flagellar hierarchy had altered expression, suggesting specific and localized FliK-dependent feedback on the RpoN regulon. FliK thus appears to be involved in three processes: hook-length control, export substrate specificity and control of RpoN transcriptional activity. 
19157568	 The immunological function of the metatherian mammary gland plays a crucial part  in neonatal survival of the marsupial young. Marsupial pouch young do not develop adult like immune responses until just prior to leaving the pouch. The immune components of the maternal milk secretions are important during this vulnerable early post-partum period. In addition, infection of the mammary gland has not been recognized in metatherians, despite the ready availability of pathogens in the pouch. Regardless of which, little is known about the immunobiology of the mammary gland and the immune responses of mammary epithelial cells in metatherians. In this study, a molecular approach was utilized to examine the response of tammar (Macropus eugenii) mammary epithelial cells to Escherichia coli derived lipopolysaccharide (LPS) and Staphylococcus aureus derived lipoteichoic acid (LTA). Using custom-made cDNA microarrays, candidate genes were identified in the transciptome, which were involved in antigen presentation, inflammation, cell growth and proliferation, cellular damage and apoptosis. Quantification of mRNA expression of several of these candidate genes, along with seven other genes (TLR4, CD14, TNF-alpha, cathelicidin, PRDX1, IL-5 and ABCG2) associated with innate immunity in LPS and LTA challenged mammary epithelial cells and leukocytes, was assessed for up to 24 h. Differences in genes associated with cellular damage and pro-inflammatory cytokine production were seen between stimulated mammary epithelial cells and leukocytes. LTA challenge tended to result in lower level induction of pro-inflammatory cytokines, increased PRDX1 mRNA levels, suggesting increased oxidative stress, and increased CD14 expression, but in a non-TLR4-dependent manner. The use of functional genomic tools in the tammar identified differences in the response of tammar mammary epithelial cells (MEC) and leukocytes to challenge with LPS and LTA, and  validates the utility of the approach. The results of this study are consistent with a model in which tammar mammary epithelial cells have the capacity to elicit a complex and robust immune response to pathogens. 
19255192	 While in transit within and between hosts, uropathogenic Escherichia coli (UPEC)  encounters multiple stresses, including substantial levels of nitric oxide and reactive nitrogen intermediates. Here we show that UPEC, the primary cause of urinary tract infections, can be conditioned to grow at higher rates in the presence of acidified sodium nitrite (ASN), a model system used to generate nitrosative stress. When inoculated into the bladder of a mouse, ASN-conditioned  UPEC bacteria are far more likely to establish an infection than nonconditioned bacteria. Microarray analysis of ASN-conditioned bacteria suggests that several NsrR-regulated genes and other stress- and polyamine-responsive factors may be partially responsible for this effect. Compared to K-12 reference strains, most UPEC isolates have increased resistance to ASN, and this resistance can be substantially enhanced by addition of the polyamine cadaverine. Nitrosative stress, as generated by ASN, can stimulate cadaverine synthesis by UPEC, and growth of UPEC in cadaverine-supplemented broth in the absence of ASN can also promote UPEC colonization of the bladder. These results suggest that UPEC interactions with polyamines or stresses such as reactive nitrogen intermediates  can in effect reprogram the bacteria, enabling them to better colonize the host. 
19153633	 INTRODUCTION AND HYPOTHESIS: To investigate the molecular signature underlying experimental interstitial cystitis (IC) using cDNA microarray. METHODS: Microarray gene expression profiles are studied in bladder epithelium of C57BL/6 mice with ovalbumin or substance P-induced experimental IC versus Escherichia coli lipopolysaccharide-induced bacterial cystitis. RESULTS: Main findings are summarized as follows: firstly, a "75-gene" model was  discovered to contain high expressions of bladder epithelium which feature in experimental IC. Secondly, glucose, lipid, nucleotide, xenobiotics, and amino acid metabolisms are involved in. Thirdly, T-cell-mediated immune and inflammatory responses are observed. Fourthly, Wnt, Tgf-beta, Mapk, and insulin growth factor receptor signaling pathways are also involved in. In addition, experimental IC leads to Ephrin- and Semaphorin-mediated axon guidance promoting  parasympathetic inflammatory reflexes. CONCLUSIONS: Further characterization of human IC-induced gene expression profiles would enable the use of genome-based expression profiling for the therapeutic targets and diagnosis of IC. 
19436718	 Microbial biofilms are a dominant feature of many human infections. However, developing effective strategies for controlling biofilms requires an understanding of the underlying biology well beyond what currently exists. Using  a novel strategy, we have induced formation of a robust biofilm in Escherichia coli by utilizing an exogenous source of poly-N-acetylglucosamine (PNAG) polymer, a major virulence factor of many pathogens. Through microarray profiling of competitive selections, carried out in both transposon insertion and over-expression libraries, we have revealed the genetic basis of PNAG-based biofilm formation. Our observations reveal the dominance of electrostatic interactions between PNAG and surface structures such as lipopolysaccharides. We  show that regulatory modulation of these surface structures has significant impact on biofilm formation behavior of the cell. Furthermore, the majority of clinical isolates which produced PNAG also showed the capacity to respond to the  exogenously produced version of the polymer. 
19412337	 Bacteriophages are major genetic factors promoting horizontal gene transfer (HGT) between bacteria. Their roles in dynamic bacterial genome evolution have been increasingly highlighted by the fact that many sequenced bacterial genomes contain multiple prophages carrying a wide range of genes. Enterohemorrhagic Escherichia coli O157 is the most striking case. A sequenced strain (O157 Sakai)  possesses 18 prophages (Sp1-Sp18) that encode numerous genes related to O157 virulence, including those for two potent cytotoxins, Shiga toxins (Stx) 1 and 2. However, most of these prophages appeared to contain multiple genetic defects. To understand whether these defective prophages have the potential to act as mobile  genetic elements to spread virulence determinants, we looked closely at the Sp1-Sp18 sequences, defined the genetic defects of each Sp, and then systematically analyzed all Sps for their biological activities. We show that many of the defective prophages, including the Stx1 phage, are inducible and released from O157 cells as particulate DNA. In fact, some prophages can even be  transferred to other E. coli strains. We also show that new Stx1 phages are generated by recombination between the Stx1 and Stx2 phage genomes. The results indicate that these defective prophages are not simply genetic remnants generated in the course of O157 evolution, but rather genetic elements with a high potential for disseminating virulence-related genes and other genetic traits to other bacteria. We speculate that recombination and various other types of inter-prophage interactions in the O157 prophage pool potentiate such activities. Our data provide new insights into the potential activities of the defective prophages embedded in bacterial genomes and lead to the formulation of a novel concept of inter-prophage interactions in defective prophage communities. 
19366454	 BACKGROUND: Network reconstruction methods that rely on covariance of expression  of transcription regulators and their targets ignore the fact that transcription  of regulators and their targets can be controlled differently and/or independently. Such oversight would result in many erroneous predictions. However, accurate prediction of gene regulatory interactions can be made possible through modeling and estimation of transcriptional activity of groups of co-regulated genes. RESULTS: Incomplete regulatory connectivity and expression data are used here to  construct a consensus network of transcriptional regulation in Escherichia coli (E. coli). The network is updated via a covariance model describing the activity  of gene sets controlled by common regulators. The proposed model-selection algorithm was used to annotate the likeliest regulatory interactions in E. coli on the basis of two independent sets of expression data, each containing many microarray experiments under a variety of conditions. The key regulatory predictions have been verified by an experiment and literature survey. In addition, the estimated activity profiles of transcription factors were used to describe their responses to environmental and genetic perturbations as well as drug treatments. CONCLUSION: Information about transcriptional activity of documented co-regulated genes (a core regulon) should be sufficient for discovering new target genes, whose transcriptional activities significantly co-vary with the activity of the core regulon members. Our ability to derive a highly significant consensus network by applying the regulon-based approach to two very different data sets demonstrated the efficiency of this strategy. We believe that this approach can be used to reconstruct gene regulatory networks of other organisms for which partial sets of known interactions are available. 
19201791	 Burkholderia cenocepacia utilizes quorum sensing to control gene expression, including the expression of genes involved in virulence. In addition to CepR and  CciR, a third LuxR homolog, CepR2, was found to regulate gene expression and virulence factor production. All B. cenocepacia strains examined contained this orphan LuxR homolog, which was not associated with an adjacent N-acyl-homoserine  lactone synthase gene. Expression of cepR2 was negatively autoregulated and was negatively regulated by CciR in strain K56-2. Microarray analysis and quantitative reverse transcription-PCR determined that CepR2 did not influence expression of cepIR or cciIR. However, in strain K56-2, CepR2 negatively regulated expression of several known quorum-sensing-controlled genes, including  genes encoding zinc metalloproteases. CepR2 exerted positive and negative regulation on genes on three chromosomes, including strong negative regulation of a gene cluster located adjacent to cepR2. In strain H111, which lacks the CciIR quorum-sensing system, CepR2 positively regulated pyochelin production by controlling transcription of one of the operons required for the biosynthesis of  the siderophore in an N-acyl-homoserine lactone-independent manner. CepR2 activation of a luxI promoter was demonstrated in a heterologous Escherichia coli host, providing further evidence that CepR2 can function in the absence of signaling molecules. This study demonstrates that the orphan LuxR homolog CepR2 contributes to the quorum-sensing regulatory network in two distinct strains of B. cenocepacia. 
19188257	 Synthetic biology aims to the design or redesign of biological systems. In particular, one possible goal could be the rewiring of the transcription regulation network by exchanging the endogenous promoters. To achieve this objective, we have adapted current methods to the inference of a model based on ordinary differential equations that is able to predict the network response after a major change in its topology. Our procedure utilizes microarray data for  training. We have experimentally validated our inferred global regulatory model in Escherichia coli by predicting transcriptomic profiles under new perturbations. We have also tested our methodology in silico by providing accurate predictions of the underlying networks from expression data generated with artificial genomes. In addition, we have shown the predictive power of our methodology by obtaining the gene profile in experimental redesigns of the E. coli genome, where rewiring the transcriptional network by means of knockouts of  master regulators or by upregulating transcription factors controlled by different promoters. Our approach is compatible with most network inference methods, allowing to explore computationally future genome-wide redesign experiments in synthetic biology. 
19348651	 This paper describes the technique designated best performer in the 2nd conference on Dialogue for Reverse Engineering Assessments and Methods (DREAM2) Challenge 5 (unsigned genome-scale network prediction from blinded microarray data). Existing algorithms use the pairwise correlations of the expression levels of genes, which provide valuable but insufficient information for the inference of regulatory interactions. Here we present a computational approach based on the recently developed context likelihood of related (CLR) algorithm, extracting additional complementary information using the information theoretic measure of synergy and assigning a score to each ordered pair of genes measuring the degree  of confidence that the first gene regulates the second. When tested on a set of publicly available Escherichia coli gene-expression data with known assumed ground truth, the synergy augmented CLR (SA-CLR) algorithm had significantly improved prediction performance when compared to CLR. There is also enhanced potential for biological discovery as a result of the identification of the most  likely synergistic partner genes involved in the interactions. 
19246760	 Listeria monocytogenes is a foodborne pathogen able to infect humans and many other mammalian species, leading to serious, often fatal disease. We have previously identified a five-gene locus in the genome of L. monocytogenes EGD-e which comprised three contiguous genes encoding paralogous type I signal peptidases. In the present study, we focused on the two distal genes of the locus (lmo1272 and lmo1273), encoding proteins sharing significant similarities with the YlqF and RnhB proteins, respectively, of Bacillus subtilis. lmo1273 could complement an Escherichia coli rnhA-rnhB thermosensitive growth phenotype, suggesting that it encodes a functional RNase H. Strikingly, inactivation of lmo1273 provoked a strong attenuation of virulence in the mouse model, and kinetic studies in infected mice revealed that multiplication of the lmo1273 mutant in target organs was significantly impaired. However, the mutation did not impair L. monocytogenes intracellular multiplication or cell-to-cell spread in cell culture models. Transcriptional profiles obtained with an lmo1273-overexpressing strain were compared to those of the wild-type strain, using microarray analyses. The data obtained suggest a pleiotropic regulatory role of Lmo1273 and possible links with amino acid uptake. 
19236707	 BACKGROUND: The Salmonella PreA/PreB two-component system (TCS) is an ortholog of the QseBC TCS of Escherichia coli. In both Salmonella and E. coli, this system has been shown to affect motility and virulence in response to quorum-sensing and hormonal signals, and to affect the transcription of the Salmonella enterica serovar Typhimurium (S. Typhimurium) pmrAB operon, which encodes an important virulence-associated TCS. RESULTS: To determine the PreA/PreB regulon in S. Typhimurium, we performed DNA microarrays comparing the wild type strain and various preA and/or preB mutants in the presence of ectopically expressed preA (qseB). These data confirmed our previous findings of the negative effect of PreB on PreA gene regulation and identified candidate PreA-regulated genes. A proportion of the activated loci were previously identified as PmrA-activated genes (yibD, pmrAB, cptA, etc.) or were genes located in the local region around preA, including the preAB operon. The transcriptional units were defined in this local region by RT-PCR, suggesting three PreA activated operons composed of preA-preB, mdaB-ygiN, and ygiW-STM3175.  Several putative virulence-related phenotypes were examined for preAB mutants, resulting in the observation of a host cell invasion and slight virulence defect  of a preAB mutant. Contrary to previous reports on this TCS, we were unable to show a PreA/PreB-dependent effect of the quorum-sensing signal AI-2 or of epinephrine on S. Typhimurium with regard to bacterial motility. CONCLUSION: This work further characterizes this unorthadox OmpR/EnvZ class TCS and provides novel candidate regulated genes for further study. This first in-depth study of the PreA/PreB regulatory system phenotypes and regulation suggests significant comparative differences to the reported function of the orthologous QseB/QseC in E. coli. 
19178140	 Reverse engineering bioinformatic procedures applied to high-throughput experimental data have become instrumental in generating new hypotheses about molecular regulatory mechanisms. This has been particularly the case for gene expression microarray data, where a large number of statistical and computational methodologies have been developed in order to assist in building network models of transcriptional regulation. A major challenge faced by every different procedure is that the number of available samples n for estimating the network model is much smaller than the number of genes p forming the system under study.  This compromises many of the assumptions on which the statistics of the methods rely, often leading to unstable performance figures. In this work, we apply a recently developed novel methodology based in the so-called q-order limited partial correlation graphs, qp-graphs, which is specifically tailored towards molecular network discovery from microarray expression data with p >> n. Using experimental and functional annotation data from Escherichia coli, here we show how qp-graphs yield more stable performance figures than other state-of-the-art methods when the ratio of genes to experiments exceeds one order of magnitude. More importantly, we also show that the better performance of the qp-graph method on such a gene-to-sample ratio has a decisive impact on the functional coherence  of the reverse-engineered transcriptional regulatory modules and becomes crucial  in such a challenging situation in order to enable the discovery of a network of  reasonable confidence that includes a substantial number of genes relevant to the essayed conditions. An R package, called qpgraph implementing this method is part of the Bioconductor project and can be downloaded from (www.bioconductor.org). A  parallel standalone version for the most computationally expensive calculations is available from (http://functionalgenomics.upf.xsedu/qpgraph). 
19049862	 Sensitive and specific pre-analytical sample processing methods are needed to enhance our ability to detect and quantify food borne pathogens from complex food and environmental samples. In this study, DNA aptamers were selected and evaluated for the capture and detection of Salmonella enterica serovar. Typhimurium. A total of 66 candidate sequences were enriched against S. Typhimurium outer membrane proteins (OMPs) with counter-selection against Escherichia coli OMPs and lipopolysaccharides (LPS). Specificity of the selected  aptamers was evaluated by gel-shift analysis against S. Typhimurium OMP. Five Salmonella-specific aptamer candidates were selected for further characterization. A dilution-to-extinction capture protocol using pure cultures of S. Typhimurium further narrowed the field to two candidates (aptamers 33 and 45) which showed low-end detection limits of 10-40CFU. DNase protection assays applied to these aptamers confirmed sequence-specific binding to S. Typhimurium OMP preparations, while South-Western blot analysis combined with mass spectrometry identified putative membrane proteins as targets for aptamer binding. Aptamer 33 was bound to magnetic beads and used for the capture of S. Typhimurium seeded into whole carcass chicken rinse samples, followed by detection using quantitative real-time RT-PCR. In a pull-down assay format, detection limits were 10(1)-10(2)CFU S. Typhimurium/9mL rinsate, while in a recirculation format, detection limits were 10(2)-10(3)CFU/25mL rinsate. Reproducible detection at <10(1)S. typhimurium CFU/g was also achieved in spike-and-recovery experiments using bovine feces. The pull-down analysis using aptamer 33 was validated on 3 naturally infected chicken litter samples confirming their applicability in the field. This study demonstrates the applicability of Salmonella specific aptamers for pre-analytical sample processing as applied to food and environmental sample matrices. 
18826428	 Systemic acquired resistance (SAR), a natural disease response in plants, can be  induced chemically. Salicylic acid (SA) acts as a key endogenous signaling molecule that mediates SAR in dicotyledonous plants. However, the role of SA in monocotyledonous plants has yet to be elucidated. In this study, the mode of action of the agrochemical protectant chemical probenazole was assessed by microarray-based determination of gene expression. Cloning and characterization of the most highly activated probenazole-responsive gene revealed that it encodes UDP-glucose:SA glucosyltransferase (OsSGT1), which catalyzes the conversion of free SA into SA O-beta-glucoside (SAG). We found that SAG accumulated in rice leaf tissue following treatment with probenazole or 2,6-dichloroisonicotinic acid. A putative OsSGT1 gene from the rice cultivar Akitakomachi was cloned and the gene product expressed in Escherichia coli was characterized, and the results suggested that probenazole-responsive OsSGT1 is involved in the production of SAG. Furthermore, RNAi-mediated silencing of the OsSGT1 gene significantly reduced the probenazole-dependent development of resistance against blast disease, further supporting the suggestion that OsSGT1 is a key mediator of development of chemically induced disease resistance. The OsSGT1 gene may contribute to the SA signaling mechanism by inducing up-regulation of SAG in rice plants. 
19172522	 Platelet activation contributes to microvascular thrombosis and organ failure in  systemic inflammation. We tested the hypothesis whether anti-platelet drugs might favourably affect outcome in patients at risk for organ failure as well as in a mouse model of endotoxin shock. Two hundred twenty-four consecutive patients who  were admitted for community acquired pneumonia over a time period of 5 years to a University Hospital were enrolled; about 20% of whom received anti-platelet drugs (acetylsalicylic acid, thienopyridines) for secondary prevention of cardiovascular disease. Patients with anti-platelet drugs were about 12 years old but did not differ in SOFA score and routine laboratory parameters at admission.  Logistic regression and 2 x 2 table analysis in age-matched subgroups indicated that anti-platelet drugs may reduce the need of intensive care treatment (odds ratio (OR) 0.32 [95% confidential interval: 0.10-1.00] and 0.19 [0.04-0.87], respectively). In age-matched subgroups, the use of anti-platelet drugs was also  associated with a shorter stay in hospital (13.9 +/- 6.2 vs. 18.2 +/- 10.2 days;  p < 0.02). In the animal model Balb/c mice were pre-treated with clopidogrel (added to drinking water) for 4 days prior to intraperitoneal (i.p.) administration of endotoxin (lipopolsaccharide (LPS) from Escherichia coli 0111:B4). Within the first 48 hours after LPS there were no differences between clopidogrel and control animals (n = 26 each) in macro-haemodynamics. However, clopidogrel abolished the LPS-induced drop in platelet count and reduced fibrin deposition in lung tissue. Using DNA microarray technology, we could show that clopidogrel suppressed endotoxin-induced up-regulation of inflammation-relevant genes, including arachidonate-5-lipoxygenase activating protein and leukotriene B4 receptor 1. According to our data a possible benefit of anti-platelet drugs in patients on risk for systemic inflammation and organ failure should be tested in  a prospective trial. 
18997023	 The yjbEFGH operon is implicated in the production of an exopolysaccharide of an  unknown function and is induced by osmotic stress and negatively regulated by the general stress response sigma factor RpoS. Despite the obvious importance of RpoS, negative selection for rpoS has been reported to take place in starved cultures, suggesting an adaptive occurrence allowing the overexpression of RpoD-dependent uptake and nutrient-scavenging systems. The trade-off of the RpoS-dependent functions for improved nutrient utilization abilities makes the bacterium more sensitive to environmental stressors, e.g., osmotic stress. In this work, we addressed the hypothesis that overinduction of genes in rpoS-deficient strains indicates their essentiality. Using DNA microarrays, real-time PCR, and transcriptional fusions, we show that genes of the wca operon, implicated in the production of the colanic acid exopolysaccharide, previously shown to be induced by osmotic stress, are also negatively controlled by RpoS. Both exopolysaccharides in the synthesis of which yjb and wca are involved are overproduced in an rpoS mutant during osmotic stress. We also show that both operons are essential in an rpoS-deficient strain but not in the wild type; promoters of both operons are constitutively active in yjb rpoS mutants; this strain produces extremely mucoid colonies, forms long filaments, and exhibits a reduced growth capability. In addition, the wca rpoS mutant's growth is inhibited by osmotic stress. These results indicate that although induced in the wild type, both operons are much more valuable for an rpoS-deficient strain, suggesting that the overproduction of both exopolysaccharides is an adaptive action. 
19293938	 BACKGROUND: The pathogenesis of enterohemorrhagic Escherichia coli (EHEC) O157:H7 infection is attributed to virulence factors encoded on multiple pathogenicity islands. Previous studies have shown that EHEC O157:H7 modulates host cell signal transduction cascades, independent of toxins and rearrangement of the cytoskeleton. However, the virulence factors and mechanisms responsible for EHEC-mediated subversion of signal transduction remain to be determined. Therefore, the purpose of this study was to first identify differentially regulated genes in response to EHEC O157:H7 grown in the presence of epithelial cells, compared to growth in the absence of epithelial cells (that is, growth in  minimal essential tissue culture medium alone, minimal essential tissue culture medium in the presence of 5% CO(2), and Penassay broth alone) and, second, to identify EHEC virulence factors responsible for pathogen modulation of host cell  signal transduction. METHODOLOGY/PRINCIPAL FINDINGS: Overnight cultures of EHEC O157:H7 were incubated for 6 hr at 37 degrees C in the presence or absence of confluent epithelial (HEp-2) cells. Total RNA was then extracted and used for microarray analyses (Affymetrix E. coli Genome 2.0 gene chips). Relative to bacteria grown in each of the other conditions, EHEC O157:H7 cultured in the presence of cultured epithelial cells displayed a distinct gene-expression profile. A 2.0-fold increase in the expression of 71 genes and a 2.0-fold decrease in expression of 60 other genes were identified in EHEC O157:H7 grown in the presence of epithelial cells, compared to bacteria grown in media alone. CONCLUSION/SIGNIFICANCE: Microarray analyses and gene deletion identified a protease on O-island 50, gene Z1787, as a potential virulence factor responsible  for mediating EHEC inhibition of the interferon (IFN)-gamma-Jak1,2-STAT-1 signal  transduction cascade. Up-regulated genes provide novel targets for use in developing strategies to interrupt the infectious process. 
19214232	 In microarray gene expression data analysis, it is often of interest to identify  genes that share similar expression profiles with a particular gene such as a key regulatory protein. Multiple studies have been conducted using various correlation measures to identify co-expressed genes. While working well for small datasets, the heterogeneity introduced from increased sample size inevitably reduces the sensitivity and specificity of these approaches. This is because most co-expression relationships do not extend to all experimental conditions. With the rapid increase in the size of microarray datasets, identifying functionally related genes from large and diverse microarray gene expression datasets is a key challenge. We develop a model-based gene expression query algorithm built under the Bayesian model selection framework. It is capable of detecting co-expression  profiles under a subset of samples/experimental conditions. In addition, it allows linearly transformed expression patterns to be recognized and is robust against sporadic outliers in the data. Both features are critically important for increasing the power of identifying co-expressed genes in large scale gene expression datasets. Our simulation studies suggest that this method outperforms  existing correlation coefficients or mutual information-based query tools. When we apply this new method to the Escherichia coli microarray compendium data, it identifies a majority of known regulons as well as novel potential target genes of numerous key transcription factors. 
19105805	 BACKGROUND: Characterizing transcription factor binding motifs is a common bioinformatics task. For transcription factors with variable binding sites, we need to get many suboptimal binding sites in our training dataset to get accurate estimates of free energy penalties for deviating from the consensus DNA sequence. One procedure to do that involves a modified SELEX (Systematic Evolution of Ligands by Exponential Enrichment) method designed to produce many such sequences. RESULTS: We analyzed low stringency SELEX data for E. coli Catabolic Activator Protein (CAP), and we show here that appropriate quantitative analysis improves our ability to predict in vitro affinity. To obtain large number of sequences required for this analysis we used a SELEX SAGE protocol developed by Roulet et al. The sequences obtained from here were subjected to bioinformatic analysis. The resulting bioinformatic model characterizes the sequence specificity of the protein more accurately than those sequence specificities predicted from previous analysis just by using a few known binding sites available in the literature. The consequences of this increase in accuracy for prediction of in vivo binding sites (and especially functional ones) in the E. coli genome are also discussed. We measured the dissociation constants of several putative CAP binding sites by EMSA (Electrophoretic Mobility Shift Assay) and compared the affinities to the bioinformatics scores provided by methods like the weight matrix method and QPMEME (Quadratic Programming Method of Energy Matrix Estimation) trained on known binding sites as well as on the new sites from SELEX SAGE data. We also checked predicted genome sites for conservation in the related species S. typhimurium. We found that bioinformatics scores based on SELEX SAGE data does better in terms of prediction of physical binding energies as well as in detecting functional sites. CONCLUSION: We think that training binding site detection algorithms on datasets  from binding assays lead to better prediction. The improvements in accuracy came  from the unbiased nature of the SELEX dataset rather than from the number of sites available. We believe that with progress in short-read sequencing technology, one could use SELEX methods to characterize binding affinities of many low specificity transcription factors. 
18838520	 In vivo accumulation of D-serine by Escherichia coli CFT073 leads to elevated expression of PAP fimbriae and hemolysin by an unknown mechanism. Loss of D-serine catabolism by CFT073 leads to a competitive advantage during murine urinary tract infection (UTI), but loss of both D- and L-serine catabolism results in attenuation. Serine is the first amino acid to be consumed in closed tryptone broth cultures and precedes the production of acetyl phosphate, a high-energy molecule involved in intracellular signaling, and the eventual secretion of acetate. We propose that the colonization defect associated with the loss of serine catabolism is due to perturbations of acetate metabolism. CFT073 grows more rapidly on acetogenic substrates than does E. coli K-12 isolate MG1655. As shown by transcription microarray results, D-serine is catabolized into acetate via the phosphotransacetylase (pta) and acetate kinase (ackA) genes  while downregulating expression of acetyl coenzyme A synthase (acs). CFT073 acs,  which is unable to reclaim secreted acetate, colonized mouse bladders and kidneys in the murine model of UTI indistinguishably from the wild type. Both pta and ackA are involved in the maintenance of intracellular acetyl phosphate. CFT073 pta and ackA mutants were screened to investigate the role of acetyl phosphate in UTI pathogenesis. Both single mutants are at a competitive disadvantage relative  to the wild type in the kidneys but normally colonize the bladder. CFT073 ackA pta was attenuated in both the bladder and the kidneys. Thus, we demonstrate that CFT073 is adapted to acetate metabolism as a result of requiring a proper cycling of the acetyl phosphate pathway for colonization of the upper urinary tract. 
18337190	 Microarray data is a key source of experimental data for modelling gene regulatory interactions from expression levels. With the rapid increase of publicly available microarray data comes the opportunity to produce regulatory network models based on multiple datasets. Such models are potentially more robust with greater confidence, and place less reliance on a single dataset. However, combining datasets directly can be difficult as experiments are often conducted on different microarray platforms, and in different laboratories leading to inherent biases in the data that are not always removed through pre-processing such as normalisation. In this paper we compare two frameworks for combining microarray datasets to model regulatory networks: pre- and post-learning aggregation. In pre-learning approaches, such as using simple scale-normalisation prior to the concatenation of datasets, a model is learnt from a combined dataset, whilst in post-learning aggregation individual models are learnt from each dataset and the models are combined. We present two novel approaches for post-learning aggregation, each based on aggregating high-level features of Bayesian network models that have been generated from different microarray expression datasets. Meta-analysis Bayesian networks are based on combining statistical confidences attached to network edges whilst Consensus Bayesian networks identify consistent network features across all datasets. We apply both approaches to multiple datasets from synthetic and real (Escherichia coli and yeast) networks and demonstrate that both methods can improve on networks learnt from a single dataset or an aggregated dataset formed using a standard scale-normalisation. 
18834908	 A microarray technique for the detection and identification of enteropathogenic bacteria at the species and subspecies levels was developed in this study, and the target bacteria included pathogenic Escherichia coli, Vibrio cholerae, Vibrio parahaemolyticus, Salmonella enterica, Campylobacter jejuni, Shigellae, Yersinia  enterocolitica, and Listeria monocytogenes. The virulence gene of each pathogen was chosen as the amplification target, labeled with a fluorescence dye by multiplex polymerase chain reaction (PCR), and hybridized to the specific virulence gene probes that had been immobilized on a microchip. Stool specimens from 34 patients with diarrhea were tested in this study. Five were positive for  multiple genera. Nested PCRs and sequencing were used to amplify and identify the related genes, which were found to share 95.8% to 100% of the nucleotide identity with the corresponding regions in the Genbank database. Real-time PCR was used to determine the number of gene copies to determine the sensitivity of this technique, which was shown to be 58 copies/microl. The results indicated that the microarray technique which targets multiple virulence genes of enteropathogenic bacteria at the species and subspecies levels is an attractive diagnostic tool for rapidly and simultaneously identifying multiple enteropathogenic pathogens in clinical practice, especially in patients with infectious diarrhea. 
18723126	 DNA damage from exogenous and endogenous sources can promote mutations and cell death. Fortunately, cells contain DNA repair and damage signaling pathways to reduce the mutagenic and cytotoxic effects of DNA damage. The identification of specific DNA repair proteins and the coordination of DNA repair pathways after damage has been a central theme to the field of genetic toxicology and we have developed a tool for use in this area. We have produced 99 molecular bar-coded Escherichia coli gene-deletion mutants specific to DNA repair and damage signaling pathways, and each bar-coded mutant can be tracked in pooled format using bar-code specific microarrays. Our design adapted bar-codes developed for the Saccharomyces cerevisiae gene-deletion project, which allowed us to utilize an available microarray product for pooled gene-exposure studies. Microarray-based screens were used for en masse identification of individual mutants sensitive to methyl methanesulfonate (MMS). As expected, gene-deletion mutants specific to direct, base excision, and recombinational DNA repair pathways were identified as MMS-sensitive in our pooled assay, thus validating our resource. We have demonstrated that molecular bar-codes designed for S. cerevisiae are transferable to E. coli, and that they can be used with pre-existing microarrays to perform competitive growth experiments. Further, when comparing microarray to traditional plate-based screens both overlapping and distinct results were obtained, which is a novel technical finding, with discrepancies between the two approaches explained by differences in output measurements (DNA content versus cell mass). The microarray-based classification  of Deltatag and DeltadinG cells as depleted after MMS exposure, contrary to plate-based methods, led to the discovery that Deltatag and DeltadinG cells show  a filamentation phenotype after MMS exposure, thus accounting for the discrepancy. A novel biological finding is the observation that while DeltadinG cells filament in response to MMS they exhibit wild-type sulA expression after exposure. This decoupling of filamentation from SulA levels suggests that DinG is associated with the SulA-independent filamentation pathway. 
18794292	 Adherence of pathogenic Escherichia coli strains to intestinal epithelia is essential for infection. For enterohemorrhagic E. coli (EHEC) serotype O157:H7, we have previously demonstrated that multiple factors govern this pathogen's adherence to HeLa cells (A. G. Torres and J. B. Kaper, Infect. Immun. 71:4985-4995, 2003). One of these factors is CadA, a lysine decarboxylase, and this protein has been proposed to negatively regulate virulence in several enteric pathogens. In the case of EHEC strains, CadA modulates expression of the  intimin, an outer membrane adhesin involved in pathogenesis. Here, we inactivated cadA in O157:H7 strain 86-24 to investigate the role of this gene in EHEC adhesion to tissue-cultured monolayers, global gene expression patterns, and colonization of the infant rabbit intestine. The cadA mutant did not possess lysine decarboxylation activity and was hyperadherent to tissue-cultured cells. Adherence of the cadA mutant was nearly twofold greater than that of the wild type, and the adherence phenotype was independent of pH, lysine, or cadaverine in the media. Additionally, complementation of the cadA defect reduced adherence back to wild-type levels, and it was found that the mutation affected the expression of the intimin protein. Disruption of the eae gene (intimin-encoding gene) in the cadA mutant significantly reduced its adherence to tissue-cultured cells. However, adherence of the cadA eae double mutant was greater than that of  an 86-24 eae mutant, suggesting that the enhanced adherence of the cadA mutant is not entirely attributable to enhanced expression of intimin in this background. Gene array analysis revealed that the cadA mutation significantly altered EHEC gene expression patterns; expression of 1,332 genes was downregulated and that of 132 genes was upregulated in the mutant compared to the wild-type strain. Interestingly, the gene expression variation shows an EHEC-biased gene alteration including intergenic regions. Two putative adhesins, flagella and F9 fimbria, were upregulated in the cadA mutant, suggestive of their association with adherence in the absence of the Cad regulatory mechanism. In the infant rabbit model, the cadA mutant outcompeted the wild-type strain in the ileum but not in the cecum or mid-colon, raising the possibility that CadA negatively regulates EHEC pathogenicity in a tissue-specific fashion. 
18725421	 Escherichia coli O157:H7 is an important food-borne pathogen that specifically binds to the follicle-associated epithelium in the intestine, which rapidly brings this bacterial pathogen in contact with underlying human macrophages. Very little information is available about the interaction between E. coli O157:H7 and human macrophages. We evaluated the uptake and survival of strain EDL933 during infection of human macrophages. Surprisingly, EDL933 survived and multiplied in human macrophages at 24 h postinfection. The global gene expression profile of this pathogen during macrophage infection was determined. Inside human macrophages, upregulation of E. coli O157:H7 genes carried on O islands (such as  pagC, the genes for both of the Shiga toxins, and the two iron transport system operons fit and chu) was observed. Genes involved in acid resistance and in the SOS response were upregulated. However, genes of the locus of enterocyte effacement or genes involved in peroxide resistance were not differentially expressed. Many genes with putative or unknown functions were upregulated inside  human macrophages and may be newly discovered virulence factors. As the Shiga toxin genes were upregulated in macrophages, survival and cytotoxicity assays were performed with isogenic Shiga toxin mutants. The initial uptake of Shiga toxins mutants was higher than that of the wild type; however, the survival rates were significantly lower at 24 h postinfection. Thus, Shiga toxins are implicated in the interaction between E. coli O157:H7 and human macrophages. Understanding the molecular mechanisms used by E. coli to survive within macrophages may help in the identification of targets for new therapeutic agents. 
18655810	 Multiplex PCR and DNA microarray were combined with tyramide signal amplification (TSA) to develop a reliable method suitable for simultaneous detection of six species of human diarrheal pathogens (Yersinia enterocolitica, Shigella spp, Salmonella typhi, Brucella spp, Vibrio cholera and Escherichia coli O157:H7). Meanwhile, our method could distinguish V. cholera serotype O1 from O139, and O157:H7 from O157: non-H7. This assay conferred a specificity of 100% for target  pathogens. The limit of detection was 103 degrees CFU/mL approximately. The results of 98.6% (357/362) clinical specimens and 100% (5/5) mocked double-blind  samples were the same to that from conventional assay. Consequently this assay is sensitive and a specific tool suitable for diagnostic detection and surveillance  of multiple human pathogens. 
17904518	 The envelope of Escherichia coli is a complex organelle composed of the outer membrane, periplasm-peptidoglycan layer and cytoplasmic membrane. Each compartment has a unique complement of proteins, the proteome. Determining the proteome of the envelope is essential for developing an in silico bacterial model, for determining cellular responses to environmental alterations, for determining the function of proteins encoded by genes of unknown function and for development and testing of new experimental technologies such as mass spectrometric methods for identifying and quantifying hydrophobic proteins. The availability of complete genomic information has led several groups to develop computer algorithms to predict the proteome of each part of the envelope by searching the genome for leader sequences, beta-sheet motifs and stretches of alpha-helical hydrophobic amino acids. In addition, published experimental data has been mined directly and by machine learning approaches. In this review we examine the somewhat confusing available literature and relate published experimental data to the most recent gene annotation of E. coli to describe the predicted and experimental proteome of each compartment. The problem of characterizing integral versus membrane-associated proteins is discussed. The E.  coli envelope proteome provides an excellent test bed for developing mass spectrometric techniques for identifying hydrophobic proteins that have generally been refractory to analysis. We describe the gel based and solution based proteome analysis approaches along with protein cleavage and proteolysis methods  that investigators are taking to tackle this difficult problem. 
18677321	 Physical and functional interactions define the molecular organization of the cell. Genetic interactions, or epistasis, tend to occur between gene products involved in parallel pathways or interlinked biological processes. High-throughput experimental systems to examine genetic interactions on a genome-wide scale have been devised for Saccharomyces cerevisiae, Schizosaccharomyces pombe, Caenorhabditis elegans and Drosophila melanogaster, but have not been reported previously for prokaryotes. Here we describe the development of a quantitative screening procedure for monitoring bacterial genetic interactions based on conjugation of Escherichia coli deletion or hypomorphic strains to create double mutants on a genome-wide scale. The patterns of synthetic sickness and synthetic lethality (aggravating genetic interactions)  we observed for certain double mutant combinations provided information about functional relationships and redundancy between pathways and enabled us to group  bacterial gene products into functional modules. 
18714358	 BACKGROUND: The concept of reverse engineering a gene network, i.e., of inferring a genome-wide graph of putative gene-gene interactions from compendia of high throughput microarray data has been extensively used in the last few years to deduce/integrate/validate various types of "physical" networks of interactions among genes or gene products. RESULTS: This paper gives a comprehensive overview of which of these networks emerge significantly when reverse engineering large collections of gene expression data for two model organisms, E. coli and S. cerevisiae, without any prior information. For the first organism the pattern of co-expression is shown to reflect in fine detail both the operonal structure of the DNA and the regulatory effects exerted by the gene products when co-participating in a protein complex. For the second organism we find that direct transcriptional control (e.g., transcription factor-binding site interactions) has little statistical significance in comparison to the other regulatory mechanisms (such as co-sharing a protein complex, co-localization on a metabolic pathway or compartment), which are however resolved at a lower level of detail than in E. coli. CONCLUSION: The gene co-expression patterns deduced from compendia of profiling experiments tend to unveil functional categories that are mainly associated to stable bindings rather than transient interactions. The inference power of this systematic analysis is substantially reduced when passing from E. coli to S. cerevisiae. This extensive analysis provides a way to describe the different complexity between the two organisms and discusses the critical limitations affecting this type of methodologies. 
18515419	 Environmental phosphate is an important signal for microorganism gene regulation, and it has recently been shown to trigger some key bacterial virulence mechanisms. In many bacteria, the Pho regulon is the major circuit involved in adaptation to phosphate limitation. The Pho regulon is controlled jointly by the  two-component regulatory system PhoR/PhoB and by the phosphate-specific transport (Pst) system, which both belong to the Pho regulon. We showed that a pst mutation results in virulence attenuation in extraintestinal pathogenic Escherichia coli (ExPEC) strains. Our results indicate that the bacterial cell surface of the pst  mutants is altered. In this study, we show that pst mutants of ExPEC strains display an increased sensitivity to different cationic antimicrobial peptides and vancomycin. Remarkably, the hexa-acylated 1-pyrophosphate form of lipid A is significantly less abundant in pst mutants. Among differentially expressed genes  in the pst mutant, lpxT coding for an enzyme that transfers a phosphoryl group to lipid A, forming the 1-diphosphate species, was found to be downregulated. Our results strongly suggest that the Pho regulon is involved in lipid A modifications, which could contribute to bacterial surface perturbations. Since the Pho regulon and the Pst system are conserved in many bacteria, such a lipid A modification mechanism could be widely distributed among gram-negative bacterial  species. 
18651954	 BACKGROUND: The vast quantities of gene expression profiling data produced in microarray studies, and the more precise quantitative PCR, are often not statistically analysed to their full potential. Previous studies have summarised  gene expression profiles using simple descriptive statistics, basic analysis of variance (ANOVA) and the clustering of genes based on simple models fitted to their expression profiles over time. We report the novel application of statistical non-linear regression modelling techniques to describe the shapes of  expression profiles for the fungus Agaricus bisporus, quantified by PCR, and for  E. coli and Rattus norvegicus, using microarray technology. The use of parametric non-linear regression models provides a more precise description of expression profiles, reducing the "noise" of the raw data to produce a clear "signal" given  by the fitted curve, and describing each profile with a small number of biologically interpretable parameters. This approach then allows the direct comparison and clustering of the shapes of response patterns between genes and potentially enables a greater exploration and interpretation of the biological processes driving gene expression. RESULTS: Quantitative reverse transcriptase PCR-derived time-course data of genes were modelled. "Split-line" or "broken-stick" regression identified the initial time of gene up-regulation, enabling the classification of genes into those with  primary and secondary responses. Five-day profiles were modelled using the biologically-oriented, critical exponential curve, y(t) = A + (B + Ct)Rt + epsilon. This non-linear regression approach allowed the expression patterns for  different genes to be compared in terms of curve shape, time of maximal transcript level and the decline and asymptotic response levels. Three distinct regulatory patterns were identified for the five genes studied. Applying the regression modelling approach to microarray-derived time course data allowed 11%  of the Escherichia coli features to be fitted by an exponential function, and 25% of the Rattus norvegicus features could be described by the critical exponential  model, all with statistical significance of p < 0.05. CONCLUSION: The statistical non-linear regression approaches presented in this study provide detailed biologically oriented descriptions of individual gene expression profiles, using biologically variable data to generate a set of defining parameters. These approaches have application to the modelling and greater interpretation of profiles obtained across a wide range of platforms, such as microarrays. Through careful choice of appropriate model forms, such statistical regression approaches allow an improved comparison of gene expression profiles, and may provide an approach for the greater understanding of common regulatory mechanisms between genes. 
18423816	 Conventional microbial water quality test methods are well known for their technical limitations, such as lack of direct pathogen detection capacity and low throughput capability. The microarray assay has recently emerged as a promising alternative for environmental pathogen monitoring. In this study, bacterial pathogens were detected in municipal wastewater using a microarray equipped with  short oligonucleotide probes targeting 16S rRNA sequences. To date, 62 probes have been designed against 38 species, 4 genera, and 1 family of pathogens. The detection sensitivity of the microarray for a waterborne pathogen Aeromonas hydrophila was determined to be approximately 1.0% of the total DNA, or approximately 10(3)A. hydrophila cells per sample. The efficacy of the DNA microarray was verified in a parallel study where pathogen genes and E. coli cells were enumerated using real-time quantitative PCR (qPCR) and standard membrane filter techniques, respectively. The microarray and qPCR successfully detected multiple wastewater pathogen species at different stages of the disinfection process (i.e. secondary effluents vs. disinfected final effluents) and at two treatment plants employing different disinfection methods (i.e. chlorination vs. UV irradiation). This result demonstrates the effectiveness of the DNA microarray as a semi-quantitative, high throughput pathogen monitoring tool for municipal wastewater. 
18487207	 In human cancers, mutations in components of the Wnt signaling pathway lead to beta-catenin stabilization and result in augmented gene transcription. HCT116 colon cancer cells carry stabilizing mutations in beta-catenin and exhibit an elevated activation of Wnt signaling. To clarify the role of an overactive Wnt signaling, we used DNA microarray analysis to search for genes whose expression is up-regulated after knockdown of the wild type adenomatous polyposis coli (APC) tumor suppressor in HCT116 cells, which further enhances Wnt signaling activation. Serum and glucocorticoid-inducible kinase 1 (SGK1) was among the most up-regulated genes following APC knockdown through small interfering RNA. Up-regulation of SGK1 in response to small interfering RNA against APC was inhibited by concomitant knockdown of beta-catenin. Quantitative real time reverse transcription-PCR, Western blot, and chromatin immunoprecipitation analyses confirmed that SGK1 is a direct beta-catenin target gene. SGK1 negatively regulates the pro-apoptotic transcription factor Forkhead box O3a (FoxO3a) via phosphorylation and exclusion from the nucleus. We show that Wnt signaling activation results in FoxO3a exclusion from the nucleus and inhibits expression of FoxO3a target genes. Importantly, FoxO3a mutants that fail to be phosphorylated and therefore are regulated by SGK1 are not influenced by activation of Wnt signaling. In line, knockdown of SGK1 relieves the effects of Wnt signaling on FoxO3a localization and FoxO3a-dependent transcription. Finally, we show that induction of Wnt signaling inhibits FoxO3a-induced apoptosis. Collectively our results indicate that evasion of apoptosis is another feature employed by an overactive Wnt signaling. 
18339413	 Bi-directional communication between the neuroendocrine and immune systems is designed, in part, to maintain or restore homeostasis during physiological stress. Exposure to endotoxin during Gram-negative bacterial infection for example, elicits the release of pro-inflammatory cytokines that activate the hypothalamic-pituitary-adrenal axis (HPAA). The secretion of adrenal glucocorticoids subsequently down regulates the host inflammatory response, minimizing potential tissue damage. Sequence and epigenetic variants in genes involved in regulating the neuroendocrine and immune systems are likely to contribute to individual differences in the HPAA response, and this may influence the host anti-inflammatory response to toxin exposure and susceptibility to inflammatory disease. In this study, high (HCR) and low (LCR) cortisol responders were selected from a normal population of 110 female sheep challenged iv with Escherichia coli endotoxin (400 ng/kg) to identify potential determinants that contribute to variation in the cortisol response phenotype. This phenotype was stable over several years in the HCR and LCR animals, and did not appear to be attributed to differences in expression of hepatic immune-related genes or systemic pro-inflammatory cytokine concentrations. Mechanistic studies using corticotrophin-releasing factor (0.5 microg/kg body weight), arginine vasopressin (0.5 microg/kg), and adrenocorticotropic hormone (0.5 microg/kg) administered iv  demonstrated that variation in this phenotype is largely determined by signalling within the HPAA. Future studies will use this ovine HCR/LCR model to investigate  potential genetic and epigenetic variants that may contribute to variation in cortisol responsiveness to bacterial endotoxin. 
18578884	 BACKGROUND: Obtaining physiological insights from microarray experiments requires computational techniques that relate gene expression data to functional information. Traditionally, this has been done in two consecutive steps. The first step identifies important genes through clustering or statistical techniques, while the second step assigns biological functions to the identified  groups. Recently, techniques have been developed that identify such relationships in a single step. RESULTS: We have developed an algorithm that relates patterns of gene expression  in a set of microarray experiments to functional groups in one step. Our only assumption is that patterns co-occur frequently. The effectiveness of the algorithm is demonstrated as part of a study of regulation by two-component systems in Escherichia coli. The significance of the relationships between expression data and functional annotations is evaluated based on density histograms that are constructed using product similarity among expression vectors. We present a biological analysis of three of the resulting functional groups of proteins, develop hypotheses for further biological studies, and test one of these hypotheses experimentally. A comparison with other algorithms and a  different data set is presented. CONCLUSION: Our new algorithm is able to find interesting and biologically meaningful relationships, not found by other algorithms, in previously analyzed data sets. Scaling of the algorithm to large data sets can be achieved based on a theoretical model. 
18565227	 BACKGROUND: Little is known about bacterial transcriptional regulatory networks (TRNs). In Escherichia coli, which is the organism with the largest wet-lab validated TRN, its set of interactions involves only approximately 50% of the repertoire of transcription factors currently known, and ~25% of its genes. Of those, only a small proportion describes the regulation of processes that are clinically relevant, such as drug resistance mechanisms. RESULTS: We designed feed-forward (FF) and bi-fan (BF) motif predictors for E. coli using multi-layer perceptron artificial neural networks (ANNs). The motif predictors were trained using a large dataset of gene expression data; the collection of motifs was extracted from the E. coli TRN. Each network motif was mapped to a vector of correlations which were computed using the gene expression  profile of the elements in the motif. Thus, by combining network structural information with transcriptome data, FF and BF predictors were able to classify with a high precision of 83% and 96%, respectively, and with a high recall of 86% and 97%, respectively. These results were found when motifs were represented using different types of correlations together, i.e., Pearson, Spearman, Kendall, and partial correlation. We then applied the best predictors to hypothesize new regulations for 16 operons involved with multidrug resistance (MDR) efflux pumps, which are considered as a major bacterial mechanism to fight antimicrobial agents. As a result, the motif predictors assigned new transcription factors for  these MDR proteins, turning them into high-quality candidates to be experimentally tested. CONCLUSION: The motif predictors presented herein can be used to identify novel regulatory interactions by using microarray data. The presentation of an example  motif to predictors will make them categorize whether or not the example motif is a BF, or whether or not it is an FF. This approach is useful to find new "pieces" of the TRN, when inspecting the regulation of a small set of operons. Furthermore, it shows that correlations of expression data can be used to discriminate between elements that are arranged in structural motifs and those in random sets of transcripts. 
18467556	 The homeostatic framework has dominated our understanding of cellular physiology. We question whether homeostasis alone adequately explains microbial responses to  environmental stimuli, and explore the capacity of intracellular networks for predictive behavior in a fashion similar to metazoan nervous systems. We show that in silico biochemical networks, evolving randomly under precisely defined complex habitats, capture the dynamical, multidimensional structure of diverse environments by forming internal representations that allow prediction of environmental change. We provide evidence for such anticipatory behavior by revealing striking correlations of Escherichia coli transcriptional responses to  temperature and oxygen perturbations-precisely mirroring the covariation of these parameters upon transitions between the outside world and the mammalian gastrointestinal tract. We further show that these internal correlations reflect  a true associative learning paradigm, because they show rapid decoupling upon exposure to novel environments. 
18483247	 Mutation of the genes encoding the WNT signaling components adenomatous polyposis coli or beta-catenin plays a critical role in the initiation of colorectal cancer. These mutations cause constitutively active beta-catenin/TCF-mediated transcription, driving the transformation of intestinal crypts to colorectal cancer precursor lesions, called dysplastic aberrant crypt foci. CD44 is a prominent WNT signaling target in the intestine and is selectively expressed on the renewing epithelial cells lining the crypts. The expression of CD44 is dramatically increased in aberrant crypt foci in both humans and tumor-susceptible Apc(Min/+) mice, suggesting a role for CD44 in intestinal tumorigenesis. To study this role, we crossed C57BL/6J-Cd44(-/-) mice with C57BL/6J-Apc(Min/+) mice. Compared with C57BL/6J-Cd44(+/+)/Apc(Min/+) mice, C57BL/6J-Cd44(-/-)/Apc(Min/+) mice showed an almost 50% reduction in the number of intestinal adenomas. This reduction was primarily caused by a decrease in the  formation of aberrant crypts, implying the involvement of CD44 in tumor initiation. The absence of CD44 in the normal (nonneoplastic) crypts of Cd44(-/-)/Apc(Min/+) mice did not alter the proliferative capacity and size of the intestinal stem cell and transit-amplifying compartments. However, compared with Cd44(+/+)/Apc(Min/+) mice, Cd44(-/-)/Apc(Min/+) showed an increase in the number of apoptotic epithelial cells at the base of the crypt which correlated with an increased expression of the proapoptotic genes Bok and Dr6. Our results show an important role for CD44 in intestinal tumorigenesis and suggest that CD44 does not affect proliferation but is involved in the control of the balance between survival and apoptosis in the intestinal crypt. 
18478124	 Emerging known and unknown pathogens create profound threats to public health. Platforms for rapid detection and characterization of microbial agents are critically needed to prevent and respond to disease outbreaks. Available detection technologies cannot provide broad functional information about known or novel organisms. As a step toward developing such a system, we have produced and  tested a series of high-density functional gene arrays to detect elements of virulence and antibiotic resistance mechanisms. Our first generation array targets genes from Escherichia coli strains K12 and CFT073, Enterococcus faecalis and Staphylococcus aureus. We determined optimal probe design parameters for gene family detection and discrimination. When tested with organisms at varying phylogenetic distances from the four target strains, the array detected orthologs for the majority of targeted gene families present in bacteria belonging to the same taxonomic family. In combination with whole-genome amplification, the array  detects femtogram concentrations of purified DNA, either spiked in to an aerosol  sample background, or in combinations from one or more of the four target organisms. This is the first report of a high density NimbleGen microarray system targeting microbial antibiotic resistance and virulence mechanisms. By targeting  virulence gene families as well as genes unique to specific biothreat agents, these arrays will provide important data about the pathogenic potential and drug  resistance profiles of unknown organisms in environmental samples. 
18455529	 OBJECTIVE: The objective of the study was to investigate changes in the expression of angiogenesis-related genes during the common terminal pathway of parturition including spontaneous labor at term, as well as preterm labor (PTL),  induced by either bacteria or ovariectomy. STUDY DESIGN: Preterm pregnant mice (14.5 days of gestation) were treated with the following: (1) intrauterine injection of media; (2) intrauterine injection of heat-inactivated Escherichia coli; (3) ovariectomy; and (4) sham operation. Tissues from mice at term (19.5 days of gestation) were collected at term not in  labor, term in labor, and 12 hours postpartum. Angiogenesis-related gene expression levels were quantitated by the measurement of specific mRNAs in uterine tissue by RT-qPCR and analyzed by repeated-measures analysis of variance. RESULTS: The following results were found: (1) microarray analysis of the uterine transcriptome indicated an enrichment for the gene ontology category of angiogenesis in bacteria-induced PTL samples (P < or = .093); (2) several genes related to angiogenesis demonstrated significantly increased expression in samples in either term spontaneous labor or preterm labor; and (3) qRT-PCR measurements demonstrated that spontaneous term labor and preterm labor induced by either bacteria or ovariectomy all substantially increased the expression of multiple angiogenesis-related genes (P < or = .0003; Angpt2, Ctgf, Cyr61, Dscr1,  Pgf, Serpine1, Thbs1, and Wisp 1). CONCLUSION: Spontaneous labor at term, as well as pathologically induced preterm  labor, all result in greatly increased expression of angiogenesis-related genes in the uterus. 
18243668	 We describe the development of a miniaturised microarray for the detection of antimicrobial resistance genes in Gram-negative bacteria. Included on the array are genes encoding resistance to aminoglycosides, trimethoprim, sulphonamides, tetracyclines and beta-lactams, including extended-spectrum beta-lactamases. Validation of the array with control strains demonstrated a 99% correlation between polymerase chain reaction and array results. There was also good correlation between phenotypic and genotypic results for a large panel of Escherichia coli and Salmonella isolates. Some differences were also seen in the  number and type of resistance genes harboured by E. coli and Salmonella strains.  The array provides an effective, fast and simple method for detection of resistance genes in clinical isolates suitable for use in diagnostic laboratories, which in future will help to understand the epidemiology of isolates and to detect gene linkage in bacterial populations. 
18317809	 Escherichia coli strains are the major cause of urinary tract infections in humans. Such strains can be divided into virulent, UPEC strains causing symptomatic infections, and asymptomatic, commensal-like strains causing asymptomatic bacteriuria, ABU. The best-characterized ABU strain is strain 83972. Global gene expression profiling of strain 83972 has been carried out under seven different sets of environmental conditions ranging from laboratory minimal medium to human bladders. The data reveal highly specific gene expression responses to different conditions. A number of potential fitness factors for the human urinary tract could be identified. Also, presence/ absence data of the gene expression was used as an adaptive genomics tool to model the gene pool of 83972 using primarily UPEC strain CFT073 as a scaffold. In our analysis, 96% of the transcripts filtered present in strain 83972 can be found in CFT073, and genes on six of the seven pathogenicity islands were expressed in 83972. Despite the very  different patient symptom profiles, the two strains seem to be very similar. Genes expressed in CFT073 but not in 83972 were identified and can be considered  as virulence factor candidates. Strain 83972 is a deconstructed pathogen rather than a commensal strain that has acquired fitness properties. 
18421347	 Sequencing DNA from several organisms has revealed that duplication and drift of  existing genes have primarily moulded the contents of a given genome. Though the  effect of knocking out or overexpressing a particular gene has been studied in many organisms, no study has systematically explored the effect of adding new links in a biological network. To explore network evolvability, we constructed 598 recombinations of promoters (including regulatory regions) with different transcription or sigma-factor genes in Escherichia coli, added over a wild-type genetic background. Here we show that approximately 95% of new networks are tolerated by the bacteria, that very few alter growth, and that expression level  correlates with factor position in the wild-type network hierarchy. Most importantly, we find that certain networks consistently survive over the wild type under various selection pressures. Therefore new links in the network are rarely a barrier for evolution and can even confer a fitness advantage. 
18375804	 The human-pathogenic yersiniae represent an ideal species group to study the evolution of highly virulent bacteria, with Yersinia pestis having emerged from the enteropathogen Y. pseudotuberculosis an estimated 20 000 years ago. Sequence  data reveal that the Y. pestis genome is in the early stages of decay and contains hundreds of non-functioning pseudogenes, some of which may be important  in the enteric lifestyle of Y. pseudotuberculosis. Bioinformatic analysis of pseudogenes from seven Y. pestis genome sequences identified rcsD as a gene disrupted early in the evolution of this organism. This phosphotransfer protein is part the of the Rcs phosphorelay, a two-component system present in the Enterobacteriaceae which has been shown to regulate the expression of capsular polysaccharide and other virulence determinants in several species including Escherichia coli and Salmonella. Using microarray analysis, we determined that the Y. pseudotuberculosis Rcs phosphorelay regulates the expression of 136 coding sequences, of which 60 % are predicted to affect the cell envelope. Several putative virulence determinants were identified as being regulated by this phosphorelay, along with proteins involved in biofilm formation, motility, mammalian cell adhesion and stress survival. Phenotypic assays on defined mutants confirmed a role for the phosphorelay in these processes in both Y. pseudotuberculosis and Y. enterocolitica. 
18286531	 BACKGROUND: Aberrant DNA methylation of the CpG islands for cancer-related genes  is among the earliest and most frequent alterations in cancer and may be useful for diagnosing cancer or evaluating recurrent disease. METHODS: In this study, a 3-dimensional (3-D), polyacrylamide gel-based DNA microarray coupled with linker-polymerase chain reaction (PCR) was developed to detect hypermethylation of CpG islands in multiple genes from a large group of different samples. The authors determined the frequency of aberrant promoter methylation of 15 genes in 28 resected primary nonsmall cell lung cancers (NSCLCs) and in 12 corresponding nonmalignant lung tissues. RESULTS: Methylation frequencies in the tumor samples were detected in 18% of samples for the breast cancer 1 gene BRCA1, in 43% of samples for the tissue inhibitor of metalloproteinase 3 gene TIMP-3, in 38% of samples for the cyclin-dependent kinase inhibitor 4A gene p16INK4a, in 54% of samples for the cadherin 13 gene CDH13, in 50% of samples for the death-associated protein kinase gene DAPK, in 11% of samples for the E-cadherin gene ECAD, in 25% of samples for  the insulin-like growth factor binding protein 7 gene IGFBP7, in 18% of samples for the Ras association domain family 1 gene RASSF1, in 68% of samples for the adenomatous polyposis coli gene APC, in 7% of samples for the cyclin-dependent kinase inhibitor gene p15, in 18% of samples for the CD44 cell adhesion molecule  gene, in 29% of samples for the human Mut-L homolog gene hMLH, in 32% of samples  for the human telomerase reverse transcriptase gene hTERT, in 64% of samples for  the calcitonin gene-related polypeptide alpha gene CALCA, and in 54% of samples for the estrogen receptor gene ER; however, methylation was not observed in the majority of corresponding nonmalignant tissues. Six samples in from 28 tumors had >6 genes methylated, and 1 sample had 13 genes methylated. Methylation of these genes was correlated with some clinicopathologic patient characteristics. CONCLUSIONS: This study demonstrated that a 3-D microarray could be used to detect DNA hypermethylation and provided a high-throughput platform for DNA hypermethylation analysis. 
18220337	 Transcription factors (TFs) play a central role in regulating gene expression and in providing interconnecting regulatory networks between related pathway elements. Although single TF assays provide some insights into pathway regulation, a method that allows the parallel investigation of all active TFs is  highly desired to elucidate the complex inter-regulated cellular mechanisms. We have developed a novel oligonucleotide array-based transcription factor assay platform for genome-wide active TF profiling of Saccharomyces cerevisiae, which can simultaneously analyze the activities of 93 different TFs. The platform has been validated using 28 purified TFs produced in Escherichia coli, cell extracts  from yeast strains overexpressing particular TFs, and by detailed control experiments. We then used the platform to examine the activity changes of all yeast TFs during diauxic shift, and results showed, in good agreement with previous studies, that the Sip4 was induced specifically. Other individual TFs required for growth in synthetic complete medium were also identified. Genome-wide analysis of TF activity is extremely useful in investigating complex  gene regulatory networks and for the development of systematic understanding of the complexity of genomic functions. These results obtained in this report demonstrate the validity, and for the first time the utility, of this technology  for genome-wide investigation of TF activities. 
18262744	 Escherichia coli K-12, B, C and W strains and their derivates are declared in biological safety guidelines as risk group 1 organisms as they are unable to colonise the human gut. Differentiation and identification of these safety strains is mainly based on pulsed-field gel electrophoresis (PFGE), phage sensitivity tests or PCR-based methods. However, these methods are either tedious and time consuming (phage sensitivity, PFGE) or based on single specific fragments (PCR) or patterns (PFGE) lacking additional information for further differentiation of the strains. In the current study, subtractive hybridisation techniques were applied to detect specific DNA fragments which were used to design a microarray (chip) for accurate and simple identification of these organisms, and to differentiate them from other E. coli strains. The chip can be  used to identify E. coli safety strains and monitor them during ongoing experiments for changes in their genome and culture purity. The hybridisation layout of the microarray was arranged in such a way that the respective lineages  of safety strains could be easily identified as distinct letters (K, B, C or W).  Differentiation of single strains or subtyping was possible with further probes.  In addition, a set of probes targeting genes coding for common virulence factors  has been included, both to differentiate safety strains from pathogenic variants  and to make sure that no transfer of these genes happens during handling or storage. The reliability of the approach has been tested on a comprehensive selection of E. coli laboratory strains and pathogenic representatives. 
18284674	 BACKGROUND: In the bacterium Escherichia coli the transcriptional regulation of gene expression involves both dedicated regulators binding specific DNA sites with high affinity and also global regulators - abundant DNA architectural proteins of the bacterial nucleoid binding multiple sites with a wide range of affinities and thus modulating the superhelical density of DNA. The first form of transcriptional regulation is predominantly pairwise and specific, representing digitial control, while the second form is (in strength and distribution) continuous, representing analog control. RESULTS: Here we look at the properties of effective networks derived from significant gene expression changes under variation of the two forms of control and find that upon limitations of one type of control (caused e.g. by mutation of a global DNA architectural factor) the other type can compensate for compromised  regulation. Mutations of global regulators significantly enhance the digital control, whereas in the presence of global DNA architectural proteins regulation  is mostly of the analog type, coupling spatially neighboring genomic loci. Taken  together our data suggest that two logically distinct - digital and analog - types of control are balancing each other. CONCLUSION: By revealing two distinct logical types of control, our approach provides basic insights into both the organizational principles of transcriptional regulation and the mechanisms buffering genetic flexibility. We anticipate that the general concept of distinguishing logical types of control will apply to many complex biological networks. 
18282299	 BACKGROUND: The evolution of antibiotic resistance in bacteria is a topic of major medical importance. Evolution is the result of natural selection acting on  variant phenotypes. Both the rigid base sequence of DNA and the more plastic expression patterns of the genes present define phenotype. RESULTS: We investigated the evolution of resistant E. coli when exposed to low concentrations of antibiotic. We show that within an isogenic population there are heritable variations in gene expression patterns, providing phenotypic diversity for antibiotic selection to act on. We studied resistance to three different antibiotics, ampicillin, tetracycline and nalidixic acid, which act by  inhibiting cell wall synthesis, protein synthesis and DNA synthesis, respectively. In each case survival rates were too high to be accounted for by spontaneous DNA mutation. In addition, resistance levels could be ramped higher by successive exposures to increasing antibiotic concentrations. Furthermore, reversion rates to antibiotic sensitivity were extremely high, generally over 50%, consistent with an epigenetic inheritance mode of resistance. The gene expression patterns of the antibiotic resistant E. coli were characterized with microarrays. Candidate genes, whose altered expression might confer survival, were tested by driving constitutive overexpression and determining antibiotic resistance. Three categories of resistance genes were identified. The endogenous  beta-lactamase gene represented a cryptic gene, normally inactive, but when by chance expressed capable of providing potent ampicillin resistance. The glutamate decarboxylase gene, in contrast, is normally expressed, but when overexpressed has the incidental capacity to give an increase in ampicillin resistance. And the DAM methylase gene is capable of regulating the expression of other genes, including multidrug efflux pumps. CONCLUSION: In this report we describe the evolution of antibiotic resistance in  bacteria mediated by the epigenetic inheritance of variant gene expression patterns. This provides proof in principle that epigenetic inheritance, as well as DNA mutation, can drive evolution. 
18070900	 An Escherichia coli oligonucleotide microarray based on three sequenced genomes was validated for comparative genomic microarray hybridization and used to study  the diversity of E. coli O157 isolates from human infections and food and animal  sources. Among 26 test strains, 24 (including both Shiga toxin [Stx]-positive and -negative strains) were found to be related to the two sequenced E. coli O157:H7  strains, EDL933 and Sakai. However, these strains showed much greater genetic diversity than those reported previously, and most of them could not be categorized as either lineage I or II. Some genes were found more often in isolates from human than from nonhuman sources; e.g., ECs1202 and ECs2976, associated with stx2AB and stx1AB, were in all isolates from human sources but in only 40% of those from nonhuman sources. Some (but not all) lineage I-specific or -dominant genes were also more frequently associated with isolates from human. The results suggested that it might be more effective to concentrate our efforts  on finding markers that are directly related to infection rather than those specific to certain lineages. In addition, two Stx-negative O157 cattle isolates  (one confirmed to be H7) were significantly different from other Stx-positive and -negative E. coli O157:H7 strains and were more similar to MG1655 in their gene content. This work demonstrates that not all E. coli O157:H7 strains belong to the same clonal group, and those that were similar to E. coli K-12 might be less  virulent. 
18227260	 Typical enteropathogenic Escherichia coli (EPEC) O55 : H7 is regarded as the closest relative of enterohaemorrhagic E. coli (EHEC) O157 : H7. Both serotypes usually express the gamma1 intimin subclass and trigger actin polymerization by the Tir-TccP pathway. However, atypical O55 : H7 strains capable of triggering actin polymerization via the Tir-Nck pathway have recently been identified. In this study, we investigated the genotypic differences and phylogenetic relationships between typical and atypical O55 : H7 strains. We show that the atypical O55 : H7 strains, which express the theta intimin subclass and lack both tccP and tccP2, belong to an E. coli lineage distinct from the typical O55 : H7 and from the EPEC O55 : H6, which also uses the Tir-Nck actin polymerization pathway. We conducted genomic comparisons of the chromosomal regions covering the O-antigen gene cluster and its flanking regions between the three O55 lineages by RFLP analysis of PCR products and DNA sequencing analysis of about 65 kb chromosomal regions. This unexpectedly revealed that horizontal transfer of large fragments (> or =40 kb) encoding the O55-antigen gene cluster and part of the neighbouring colanic acid gene cluster was involved in the emergence of the three O55 E. coli lineages. The data provide new insights into the mechanisms involved  in the generation of a wide variety of O-serotypes in Gram-negative bacteria. 
18282111	 The extent and nature of epistatic interactions between mutations are issues of fundamental importance in evolutionary biology. However, they are difficult to study and their influence on adaptation remains poorly understood. Here, we use a systems-level approach to examine epistatic interactions that arose during the evolution of Escherichia coli in a defined environment. We used expression arrays to compare the effect on global patterns of gene expression of deleting a central regulatory gene, crp. Effects were measured in two lineages that had independently evolved for 20,000 generations and in their common ancestor. We found that deleting crp had a much more dramatic effect on the expression profile of the two evolved lines than on the ancestor. Because the sequence of the crp gene was unchanged during evolution, these differences indicate epistatic interactions between crp and mutations at other loci that accumulated during evolution. Moreover, a striking degree of parallelism was observed between the two independently evolved lines; 115 genes that were not crp-dependent in the ancestor became dependent on crp in both evolved lines. An analysis of changes in crp dependence of well-characterized regulons identified a number of regulatory genes as candidates for harboring beneficial mutations that could account for these parallel expression changes. Mutations within three of these genes have previously been found and shown to contribute to fitness. Overall, these findings indicate that epistasis has been important in the adaptive evolution of these lines, and they provide new insight into the types of genetic changes through which epistasis can evolve. More generally, we demonstrate that expression profiles can be profitably used to investigate epistatic interactions. 
18230148	 BACKGROUND: Microarray based comparative genomic hybridisation (CGH) experiments  have been used to study numerous biological problems including understanding genome plasticity in pathogenic bacteria. Typically such experiments produce large data sets that are difficult for biologists to handle. Although there are some programmes available for interpretation of bacterial transcriptomics data and CGH microarray data for looking at genetic stability in oncogenes, there are  none specifically to understand the mosaic nature of bacterial genomes. Consequently a bottle neck still persists in accurate processing and mathematical analysis of these data. To address this shortfall we have produced a simple and robust CGH microarray data analysis process that may be automated in the future to understand bacterial genomic diversity. RESULTS: The process involves five steps: cleaning, normalisation, estimating gene presence and absence or divergence, validation, and analysis of data from test against three reference strains simultaneously. Each stage of the process is described and we have compared a number of methods available for characterising bacterial genomic diversity, for calculating the cut-off between gene presence and absence or divergence, and shown that a simple dynamic approach using a kernel density estimator performed better than both established, as well as a more sophisticated mixture modelling technique. We have also shown that current methods commonly used for CGH microarray analysis in tumour and cancer cell lines are not appropriate for analysing our data. CONCLUSION: After carrying out the analysis and validation for three sequenced Escherichia coli strains, CGH microarray data from 19 E. coli O157 pathogenic test strains were used to demonstrate the benefits of applying this simple and robust process to CGH microarray studies using bacterial genomes. 
19026863	 Author information:  (1)Department of Biological Sciences, University of Warwick, Coventry CV4 7AL, UK. 
18039828	 The gene expression profiles of Escherichia coli strains grown anaerobically with or without Acacia mearnsii (black wattle) extract were compared to identify tannin resistance strategies. The cell envelope stress protein gene spy and the multidrug transporter-encoding operon mdtABCD, both under the control of the BaeSR two-component regulatory system, were significantly up-regulated in the presence of tannins. BaeSR mutants were more tannin sensitive than their wild-type counterparts. 
18817297	 Infectious bursal disease virus (IBDV) causes highly contagious, immunosuppressive disease that leads to high mortality in young chickens. The purpose of this study was to look for the genetic regulation of the immune acute  immune response to IBDV in our selected lines. Chicks of a F2 generation of two lines divergently selected for early high (HH) or low (LL) antibody (Ab) response to Escherichia coLi vaccination were challenged with virulent IBDV. Viral load in infected bursae was used to determine resistant (R) and susceptible (S) birds. By using a 13K chicken cDNA microarray, and pooled spleen mRNA of R, S and non-challenged, control (C) chicks, several genes were identified with differential expression associated with host resistance to IBDV. These genes were also subjected to RT-PCR on individual samples to verify the results obtained from microarrays. The major finding was the co-upregulation of seven genes--ETS2, H963, RGS1, ABIN-2, CREM/ICER, DUSP1 and CXCR4- in several R, but not S or C individuals, and characterized by a high correlation of expression levels. Resistance also generally coincided with reduced transcript levels of acute-phase serum amyloid A (A-SAA) and increased levels of IL-8. Based on reported functions of these genes, these findings suggest that resistance was mediated by the activation of specific cellular mechanisms, indicated by increased activity of splenic macrophages and T-lymphocytes 3 days post-challenge. 
18759112	 DNA aptamers were developed against lipopolysaccharide (LPS) from E. coli O111:B4 and shown to bind both LPS and E. coli by a colorimetric enzyme-based microplate  assay. The polyclonal aptamers were coupled to human C1qrs protein either directly using a bifunctional linker or indirectly using biotinylated aptamers and a streptavidin-C1qrs complex. Both systems significantly reduced colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10x dilutions of the bacteria in the presence of human serum; it was diluted 1: 10(3) in order to avoid significant bacterial lysis by the competing alternate pathway  of complement activation. A number of candidate DNA aptamer sequences were cloned and sequenced from the anti-LPS aptamer library for future screening of antibacterial or "antibiotic" potential and to aid in eventual development of an  alternative therapy for antibiotic-resistant bacterial infections. 
17981979	 Shiga toxin 2 (Stx2), one of the principal virulence factors of enterohemorrhagic Escherichia coli, is encoded by 933W, a lambda-like prophage. 933W prophage induction contributes to Stx2 production, and here, we provide evidence that Dam  methyltransferase is essential for maintenance of 933W lysogeny. Our findings are consistent with the idea that the 933W prophage has a relatively low threshold for induction, which may promote Stx2 production during infection. 
18566685	 Activation of NF-kappaB is known to prevent apoptosis but may also act as proapoptotic factor in order to eliminate inflammatory cells. Here, we show that  classical NF-kappaB activation in RAW 264.7 and bone marrow-derived macrophages upon short E. coli coculture is necessary to promote cell death at late time points. At 48 hours subsequent to short-term, E. coli challenge increased survival of NF-kappaB-suppressed macrophages was associated with pattern of autophagy whereas macrophages with normal NF-kappaB signalling die. Cell death of normal macrophages was indicated by preceding downregulation of autophagy associated genes atg5 and beclin1. Restimulation of macrophages with LPS at 48 hours after E. coli treatment results in augmented proinflammatory cytokine production in NF-kappaB-suppressed macrophages compared to control cells. We thus demonstrate that classical NF-kappaB activation inhibits autophagy and promotes delayed programmed cell death. This mechanism is likely to prevent the recovery of inflammatory cells and thus contributes to the resolution of inflammation. 
19161837	 The decay of mRNA plays an important role in the regulation of gene expression. Although relatively ignored for many years and regarded as a simple ribonucleotide salvage pathway, mRNA decay has been established in recent years as a well-defined cellular process that plays an integral role in determining gene expression. The recent application of microarray methods to the study of diverse organisms will help us to better understand these gene regulatory circuits and the influence of transcript stability on gene expression. DNA microarray technology is the method of choice to study individual mRNA half-lives on a global scale. It is important to standardize these methods to generate reproducible and reliable results. In this chapter, we describe experimental designs for the analysis of mRNA decay on a genome-wide scale and provide detailed protocols for each experimental step. We also present an analysis of the decay of chromosomally encoded mRNAs in E. coli. 
18433644	 The study of bacterial responses to nitric oxide (NO), nitrosating agents, and other agents of nitrosative stress has a short history but has rapidly produced important insights into the interactions of these agents with model microbial systems as well as pathogenic species. Several methodological problems arise in attempting to define the global responses to these agents, whether in simply measuring growth or performing "omic" experiments in which the objective is to determine the genome-wide (transcriptomic) or proteome-wide responses. The first  problem is the relatively long timescale over which the experiments are conducted--minutes, hours, or days in the case of slow-growing cultures. The second problem is not unique to NO and its congeners but concerns the difficulties encountered when sensitive and comprehensive analytical techniques (such as transcriptomics) are applied to cultures whose growth and physiology are perturbed by an inhibitor. In essence, the problem is "seeing the wood for the trees." This chapter reviews briefly the state of knowledge of NO responses and mechanisms in bacteria, particularly Escherichia coli and Campylobacter jejuni. Continuous culture has several advantages for investigating the consequences of NO exposure, and this approach is outlined with examples of recent results and conclusions. The major advantage of the chemostat is establishment of a reproducible quasi-steady state in growth, in which the growth rate can be controlled and maintained. Contrary to common belief, neither the concept nor the apparatus is difficult. Commercially available and homemade systems are described with practical advice. Establishing continuous cultures paves the way for other "omic" approaches, particularly proteomics and metabolomics, which are not covered here, as their application to the field of NO biology is in its infancy.  A key to the literature describing methods suitable for assessing toxicity to microbes of NO and reactive nitrogen species is given. 
18174135	 Urinary tract infection (UTI) is the most common infection in patients with indwelling urinary catheters, and bacterial biofilm formation is a major problem  in this type of infection. Escherichia coli is responsible for the large majority of UTIs. Free iron is strictly limited in the human urinary tract and there is fierce competition between the host and infectious bacteria for this essential metal. Urinary tract infectious E. coli have highly efficient mechanisms of iron  acquisition, one of which is the yersiniabactin system. The fyuA gene, encoding the yersiniabactin receptor, is one of the most upregulated genes in biofilm; it  was upregulated 63-fold in the E. coli UTI strain VR50. FyuA was found to be highly important for biofilm formation in iron-poor environments such as human urine. Mutants in fyuA show aberrant biofilm formation and the cells become filamentous; a VR50fyuA mutant showed a 92 % reduction in biofilm formation in urine flow-cell chambers compared with the wild-type. The FyuA/yersiniabactin system is known to be important for virulence. Here we demonstrate a direct link  between FyuA and biofilm formation in iron-poor environments. We also show that the availability of iron greatly influences UTI strains' ability to form biofilm. 
17999997	 ERIC, the Enteropathogen Resource Integration Center (www.ericbrc.org), is a new  web portal serving as a rich source of information about enterobacteria on the NIAID established list of Select Agents related to biodefense-diarrheagenic Escherichia coli, Shigella spp., Salmonella spp., Yersinia enterocolitica and Yersinia pestis. More than 30 genomes have been completely sequenced, many more exist in draft form and additional projects are underway. These organisms are increasingly the focus of studies using high-throughput experimental technologies and computational approaches. This wealth of data provides unprecedented opportunities for understanding the workings of basic biological systems and discovery of novel targets for development of vaccines, diagnostics and therapeutics. ERIC brings information together from disparate sources and supports data comparison across different organisms, analysis of varying data types and visualization of analyses in human and computer-readable formats. 
17932051	 Many Microbe Microarrays Database (M3D) is designed to facilitate the analysis and visualization of expression data in compendia compiled from multiple laboratories. M3D contains over a thousand Affymetrix microarrays for Escherichia coli, Saccharomyces cerevisiae and Shewanella oneidensis. The expression data is  uniformly normalized to make the data generated by different laboratories and researchers more comparable. To facilitate computational analyses, M3D provides raw data (CEL file) and normalized data downloads of each compendium. In addition, web-based construction, visualization and download of custom datasets are provided to facilitate efficient interrogation of the compendium for more focused analyses. The experimental condition metadata in M3D is human curated with each chemical and growth attribute stored as a structured and computable set of experimental features with consistent naming conventions and units. All versions of the normalized compendia constructed for each species are maintained  and accessible in perpetuity to facilitate the future interpretation and comparison of results published on M3D data. M3D is accessible at http://m3d.bu.edu/. 
18784435	 Wilms tumor (WT), a tumor composed of three histological components - blastema (BL), epithelia and stroma - is considered an appropriate model system to study the biological relationship between differentiation and tumorigenesis. To investigate molecular associations between nephrogenesis and WT, the gene expression pattern of individual cellular components was analyzed, using a customized platform containing 4,608 genes. WT gene expression patterns were compared to genes regulated during kidney differentiation. BL had a closer gene expression pattern to the earliest stage of normal renal development. The BL gene expression pattern was compared to that of fetal kidney (FK) and also between FK  and mature kidney, identifying 25 common deregulated genes supposedly involved in the earliest events of WT onset. Quantitative RT-PCR was performed, confirming the difference in expression levels for 13 of 16 genes (81.2%) in the initial set and 8 of 13 (61.5%) in an independent set of samples. An overrepresentation of genes belonging to the Wnt signaling pathway was identified, namely PLCG2, ROCK2  and adenomatous polyposis coli (APC). Activation of the Wnt pathway was confirmed in WT, using APC at protein level and PLCG2 at mRNA and protein level. APC showed positive nuclear immunostaining for an independent set of WT samples, similarly to the FK in week 11. Lack of PLCG2 expression was confirmed in WT and in FK until week 18. Taken together, these results provided molecular evidence of the recapitulation of the embryonic kidney by WT as well as involvement of the Wnt pathway in the earliest events of WT onset. 
17967352	 We verified the efficacy of lipopolysaccharide (LPS) in activating the cecropin B gene (CecB) in an immune-competent Bombyx mori cell line. Strong activation of CecB by the LPSs from Escherichia coli, Pseudomonas aeruginosa, and Salmonella minnesota were completely eliminated after digestion of the LPSs with muramidase. The results clearly indicate that a polymer form of PGN in the LPSs elicited CecB. An oligonucleotide microarray screen revealed that none of the 16,000 genes on the array were activated by LPS in the cells. In contrast, E. coli PGN strongly elicited five antibacterial peptide genes and numerous other genes, and  PGN from Micrococcus luteus activated only several genes. Semi-quantitative RT-PCR revealed that all antibacterial genes activated by both PGNs, but the extents were 10-100 times higher with E. coli PGN. Similarly, higher elicitor activity of E. coli than M. luteus was indicated using peptidoglycan recognition  protein gene, which is involved in pro-phenol oxidase cascade. 
18093005	 Pathogens that infect and/or are transmitted by mosquitoes typically are exposed  to the body cavity, and to haemocytes circulating therein, during development or  dissemination. Aedes aegypti haemocytes produce a range of immune response-related gene products, and an endpoint response of phagocytosis and/or melanization that is temporally and structurally distinct for the invading pathogen. Expressed sequence tags were generated from haemocyte libraries and then used to design oligonucleotide microarrays. Arrays were screened with haemocyte material collected 1-, 8- and 24-h post-inoculation with Escherichia coli or Micrococcus luteus bacteria. Data from these studies support the discovery of novel immune response-activated genes, provide an expanded understanding of antimicrobial peptide biology and highlight the coordination of  immune factors that leads to an endpoint response. 
17395545	 High-throughput technologies such as DNA microarray are in the process of revolutionizing the way modern biological research is being done. Bioinformatics  tools are becoming increasingly important to assist biomedical scientists in their quest in understanding complex biological processes. Gene expression analysis has attracted a large amount of attention over the last few years mostly in the form of algorithms, exploring cluster and regulatory relationships among genes of interest, and programs that try to display the multidimensional microarray data in appropriate formats so that they make biological sense. To reduce the dimensionality of microarray data and make the corresponding analysis  more biologically relevant, in this paper we propose a biologically-led approach  to biochemical pathway analysis using microarray data and relevant biological knowledge. The method selects a subset of genes for each pathway that describes the behaviour of the pathway at a given experimental condition, and transforms them into pathway signatures. The metabolic pathways of Escherichia coli are used as a case study. 
17956427	 Aspartokinase III, encoded by lysC, is responsible for the first step of lysine biosynthesis in Escherichia coli. In this study, a lysC knockout E. coli W3110 strain was generated to study the differential gene expression profiles of wild type and lysC knockout strains. Several significant changes were observed, including biosynthesis of lysine, oxaloacetate, alpha-ketoglutarate and glutamate genes. Genes related to transporters and heat shock proteins were also affected by lysC knockout. The results indicated that the lysC knockout strain exhibited some phenomena similar to lysine starvation. The data generated by this study further clarify the systematic role of lysC in lysine biosynthesis. 
18053574	 The aim of this paper was to describe, and when possible compare, the multivariate methods used by the participants in the EADGENE WP1.4 workshop. The  first approach was for class discovery and class prediction using evidence from the data at hand. Several teams used hierarchical clustering (HC) or principal component analysis (PCA) to identify groups of differentially expressed genes with a similar expression pattern over time points and infective agent (E. coli or S. aureus). The main result from these analyses was that HC and PCA were able  to separate tissue samples taken at 24 h following E. coli infection from the other samples. The second approach identified groups of differentially co-expressed genes, by identifying clusters of genes highly correlated when animals were infected with E. coli but not correlated more than expected by chance when the infective pathogen was S. aureus. The third approach looked at differential expression of predefined gene sets. Gene sets were defined based on  information retrieved from biological databases such as Gene Ontology. Based on these annotation sources the teams used either the GlobalTest or the Fisher exact test to identify differentially expressed gene sets. The main result from these analyses was that gene sets involved in immune defence responses were differentially expressed. 
18053573	 A large variety of methods has been proposed in the literature for microarray data analysis. The aim of this paper was to present techniques used by the EADGENE (European Animal Disease Genomics Network of Excellence) WP1.4 participants for data quality control, normalisation and statistical methods for  the detection of differentially expressed genes in order to provide some more general data analysis guidelines. All the workshop participants were given a real data set obtained in an EADGENE funded microarray study looking at the gene expression changes following artificial infection with two different mastitis causing bacteria: Escherichia coli and Staphylococcus aureus. It was reassuring to see that most of the teams found the same main biological results. In fact, most of the differentially expressed genes were found for infection by E. coli between uninfected and 24 h challenged udder quarters. Very little transcriptional variation was observed for the bacteria S. aureus. Lists of differentially expressed genes found by the different research teams were, however, quite dependent on the method used, especially concerning the data quality control step. These analyses also emphasised a biological problem of cross-talk between infected and uninfected quarters which will have to be dealt with for further microarray studies. 
17897936	 OBJECTIVES: To characterize and subtype multidrug-resistant Salmonella isolates by determining the virulence factors, prophage sequences and antimicrobial resistance genes using a novel Salmonella-specific oligonucleotide microarray. METHODS: Preliminary screening of 24 Salmonella clinical isolates was carried out by using susceptibility testing, plasmid profiling and class 1 integron PCR. Subsequently, oligonucleotide microarray was involved in genotypic characterization and localization of monitored genetic markers. The presence of antimicrobial resistance genes was also detected and confirmed by PCR and subsequent sequencing. The potential spread of emerging bla(SHV-2) was investigated by bacterial conjugation. RESULTS: All Salmonella strains revealed resistance to two or more (up to nine) antibiotics. Nineteen of them carried class 1 integrons including dfrA1, dfrA12,  aadA1, aadA2, bla(PSE-1) and bla(TEM-1) gene cassettes, respectively. Twenty-three out of 24 Salmonella isolates possessed one or more plasmids. Oligonucleotide microarray characterization and typing revealed the conserved character of Salmonella pathogenicity island virulence factors among three Salmonella enterica serovars, significant variability in prophage sequences and many different antimicrobial resistance gene patterns. Differential labelling of  genomic and plasmid DNA, respectively, and hybridization to the microarray made it possible to localize important resistance determinants. Microarray results were successfully confirmed and verified by using PCR. The emerging bla(SHV-2) gene from Salmonella Kentucky SK10944 conferring resistance to ceftriaxone and cefotaxime was transferred via bacterial conjugation to Escherichia coli K-12 3110. CONCLUSIONS: Salmonella isolates were quickly and thoroughly characterized by a novel oligonucleotide microarray, which could become a useful tool for detection  of virulence and resistance genes and monitoring of their dissemination among salmonellae and closely related bacteria. 
17628606	 DNA microarray technology, originally developed to measure the level of gene expression, has become one of the most widely used tools in genomic study. The crux of microarray design lies in how to select a unique probe that distinguishes a given genomic sequence from other sequences. Due to its significance, probe selection attracts a lot of attention. Various probe selection algorithms have been developed in recent years. Good probe selection algorithms should produce a  small number of candidate probes. Efficiency is also crucial because the data involved are usually huge. Most existing algorithms are usually not sufficiently  selective and quite a large number of probes are returned. We propose a new direction to tackle the problem and give an efficient algorithm based on randomization to select a small set of probes and demonstrate that such a small set of probes is sufficient to distinguish each sequence from all the other sequences. Based on the algorithm, we have developed probe selection software RandPS, which runs efficiently in practice. The software is available on our website (http://www.csc.liv.ac.uk/ approximately cindy/RandPS/RandPS.htm). We test our algorithm via experiments on different genomes (Escherichia coli, Saccharamyces cerevisiae, etc.) and our algorithm is able to output unique probes for most of the genes efficiently. The other genes can be identified by a combination of at most two probes. 
17869072	 OBJECTIVE: The prediction of operons is critical to the reconstruction of regulatory networks at the whole genome level. Multiple genome features have been used for predicting operons. However, multiple genome features are usually dealt  with using only single method in the literatures. The aim of this paper is to develop a combined method for operon prediction by using different methods to preprocess different genome features in order for exerting their unique characteristics. METHODS: A novel multi-approach-guided genetic algorithm for operon prediction is presented. We exploit different methods for intergenic distance, cluster of orthologous groups (COG) gene functions, metabolic pathway and microarray expression data. A novel local-entropy-minimization method is proposed to partition intergenic distance. Our program can be used for other newly sequenced  genomes by transferring the knowledge that has been obtained from Escherichia coli data. We calculate the log-likelihood for COG gene functions and Pearson correlation coefficient for microarray expression data. The genetic algorithm is  used for integrating the four types of data. RESULTS: The proposed method is examined on E. coli K12 genome, Bacillus subtilis genome, and Pseudomonas aeruginosa PAO1 genome. The accuracies of prediction for  these three genomes are 85.9987%, 88.296%, and 81.2384%, respectively. CONCLUSION: Simulated experimental results demonstrate that in the genetic algorithm the preprocessing for genome data using multiple approaches ensures the effective utilization of different biological characteristics. Experimental results also show that the proposed method is applicable for predicting operons in prokaryote. 
17635870	 Intrakingdom cell-to-cell communication and interkingdom cell-to-cell communication play essential roles in the virulence of enterohemorrhagic Escherichia coli (EHEC). Four signals, autoinducer 2 (AI-2), AI-3, and the human  hormones epinephrine and norepinephrine, are important in this communication. The effect of these signaling compounds on the transcriptome of EHEC was examined in  this study. We demonstrated that the luxS mutation affects primarily central metabolic genes in both pathogenic and nonpathogenic strains of E. coli and that  addition of exogenous AI-2 does not fully restore the expression profile in a luxS-deficient strain lacking the ability to synthesize AI-2. Addition of AI-3 or epinephrine increased expression of the locus of enterocyte effacement regulon, which is known to play a pivotal role in EHEC virulence. Moreover, when epinephrine was added to the culture medium, the greatest number of gene alterations was observed. These alterations included a greater proportion of alterations in EHEC genes than in MG1655 genes, suggesting that epinephrine may be a global virulence signal. Detailed examination with real-time reverse transcriptase PCR (RT-PCR) confirmed the increases in virulence gene expression with addition of AI-3 and epinephrine. Additional studies with real-time RT-PCR examining the EHEC secreted effectors and putative fimbrial gene expression showed a variable expression profile, indicating that there is differential regulation of the secreted molecules. This study began to examine the global signaling networks in EHEC and revealed expression profiles that are signal and pathogen specific. 
17606598	 Bartonella quintana is a gram-negative microorganism that causes trench fever and chronic bacteremia. B. quintana lipopolysaccharide (LPS) was unable to induce the production of proinflammatory cytokines in human monocytes. Interestingly, B. quintana LPS is a potent antagonist of Toll-like receptor 4 (TLR4), as it inhibited both mRNA transcription and the release of tumor necrosis factor alpha, interleukin 1beta (IL-1beta), and IL-6 by Escherichia coli LPS in human monocytes, at ratios ranging from 1,000:1 to 10:1 (B. quintana LPS to E. coli LPS). Likewise, B. quintana LPS blocked the interaction of E. coli LPS with TLR4  in transfected cell lines. The extent of the inhibitory effect of B. quintana LPS was demonstrated in microarray studies, which showed downregulation of practically all genes induced by LPS in monocytes. Because of the role of TLR4 in inflammation, B. quintana LPS may prove useful as a potent anti-TLR4 agent with therapeutic potential in both infections and autoimmune inflammation. 
17482874	 Urinary tract infections (UTI) are among the most common bacterial infections in  humans, with Escherichia coli being the major cause of infection. Fluoroquinolone resistance of uropathogenic E. coli has increased significantly over the last decade. In this study a microarray-based assay was developed and applied, which provides a rapid, sensitive and specific detection of fluoroquinolone-resistant E. coli in urine. The capture probes were designed against previously identified  and described hotspots for quinolone resistance (codons 83 and 87 of gyrA). The key goals of this development were to reduce assay time while increasing the sensitivity and specificity as compared with a pilot version of a gyrA genotyping DNA microarray. The performance of the assay was demonstrated with pure cultures  of 30 E. coli isolates as well as with urine samples spiked with 6 E. coli isolates. The microarray results were confirmed by standard DNA sequencing and were in full agreement with the phenotypic antimicrobial susceptibility testing using standard methods. The DNA microarray test displayed an assay time of 3.5h,  a sensitivity of 100CFU/ml, and the ability to detect fluoroquinolone-resistant E. coli in the presence of a 10-fold excess of fluoroquinolone-susceptible E. coli cells. As a consequence, we believe that this microarray-based determination of antibiotics resistance has a true potential for the application in clinical routine laboratories in the future. 
17880708	 BACKGROUND: The design of long oligonucleotides for spotted DNA microarrays requires detailed attention to ensure their optimal performance in the hybridization process. The main challenge is to select an optimal oligonucleotide element that represents each genetic locus/gene in the genome and is unique, devoid of internal structures and repetitive sequences and its Tm is uniform with all other elements on the microarray. Currently, all of the publicly available programs for DNA long oligonucleotide microarray selection utilize various combinations of cutoffs in which each parameter (uniqueness, Tm, and secondary structure) is evaluated and filtered individually. The use of the cutoffs can, however, lead to information loss and to selection of suboptimal oligonucleotides, especially for genomes with extreme distribution of the GC content, a large proportion of repetitive sequences or the presence of large gene families with highly homologous members. RESULTS: Here we present the program OligoRankPick which is using a weighted rank-based strategy to select microarray oligonucleotide elements via an integer  weighted linear function. This approach optimizes the selection criteria (weight  score) for each gene individually, accommodating variable properties of the DNA sequence along the genome. The designed algorithm was tested using three microbial genomes Escherichia coli, Saccharomyces cerevisiae and the human malaria parasite species Plasmodium falciparum. In comparison to other published  algorithms OligoRankPick provides significant improvements in oligonucleotide design for all three genomes with the most significant improvements observed in the microarray design for P. falciparum whose genome is characterized by large fluctuations of GC content, and abundant gene duplications. CONCLUSION: OligoRankPick is an efficient tool for the design of long oligonucleotide DNA microarrays which does not rely on direct oligonucleotide exclusion by parameter cutoffs but instead optimizes all parameters in context of each other. The weighted rank-sum strategy utilized by this algorithm provides high flexibility of oligonucleotide selection which accommodates extreme variability of DNA sequence properties along genomes of many organisms. 
17630299	 The detection of virulence determinants harbored by pathogenic Escherichia coli is important for establishing the pathotype responsible for infection. A sensitive and specific miniaturized virulence microarray containing 60 oligonucleotide probes was developed. It detected six E. coli pathotypes and will be suitable in the future for high-throughput use. 
17767165	 To identify new components that regulate the inflammatory cascade during sepsis,  we characterized the functions of myeloid-related protein-8 (Mrp8, S100A8) and myeloid-related protein-14 (Mrp14, S100A9), two abundant cytoplasmic proteins of  phagocytes. We now demonstrate that mice lacking Mrp8-Mrp14 complexes are protected from endotoxin-induced lethal shock and Escherichia coli-induced abdominal sepsis. Both proteins are released during activation of phagocytes, and Mrp8-Mrp14 complexes amplify the endotoxin-triggered inflammatory responses of phagocytes. Mrp8 is the active component that induces intracellular translocation of myeloid differentiation primary response protein 88 and activation of interleukin-1 receptor-associated kinase-1 and nuclear factor-kappaB, resulting in elevated expression of tumor necrosis factor-alpha (TNF-alpha). Using phagocytes expressing a nonfunctional Toll-like receptor 4 (TLR4), HEK293 cells transfected with TLR4, CD14 and MD2, and by surface plasmon resonance studies in  vitro, we demonstrate that Mrp8 specifically interacts with the TLR4-MD2 complex, thus representing an endogenous ligand of TLR4. Therefore Mrp8-Mrp14 complexes are new inflammatory components that amplify phagocyte activation during sepsis upstream of TNFalpha-dependent effects. 
17697349	 BACKGROUND: Large-scale sequencing of entire genomes has ushered in a new age in  biology. One of the next grand challenges is to dissect the cellular networks consisting of many individual functional modules. Defining co-expression networks without ambiguity based on genome-wide microarray data is difficult and current methods are not robust and consistent with different data sets. This is particularly problematic for little understood organisms since not much existing  biological knowledge can be exploited for determining the threshold to differentiate true correlation from random noise. Random matrix theory (RMT), which has been widely and successfully used in physics, is a powerful approach to distinguish system-specific, non-random properties embedded in complex systems from random noise. Here, we have hypothesized that the universal predictions of RMT are also applicable to biological systems and the correlation threshold can be determined by characterizing the correlation matrix of microarray profiles using random matrix theory. RESULTS: Application of random matrix theory to microarray data of S. oneidensis, E. coli, yeast, A. thaliana, Drosophila, mouse and human indicates that there is  a sharp transition of nearest neighbour spacing distribution (NNSD) of correlation matrix after gradually removing certain elements insider the matrix.  Testing on an in silico modular model has demonstrated that this transition can be used to determine the correlation threshold for revealing modular co-expression networks. The co-expression network derived from yeast cell cycling microarray data is supported by gene annotation. The topological properties of the resulting co-expression network agree well with the general properties of biological networks. Computational evaluations have showed that RMT approach is sensitive and robust. Furthermore, evaluation on sampled expression data of an in silico modular gene system has showed that under-sampled expressions do not affect the recovery of gene co-expression network. Moreover, the cellular roles of 215 functionally unknown genes from yeast, E. coli and S. oneidensis are predicted by the gene co-expression networks using guilt-by-association principle, many of which are supported by existing information or our experimental verification, further demonstrating the reliability of this approach for gene function prediction. CONCLUSION: Our rigorous analysis of gene expression microarray profiles using RMT has showed that the transition of NNSD of correlation matrix of microarray profile provides a profound theoretical criterion to determine the correlation threshold for identifying gene co-expression networks. 
17697354	 BACKGROUND: Pathogen identification in clinical routine is based on the cultivation of microbes with subsequent morphological and physiological characterisation lasting at least 24 hours. However, early and accurate identification is a crucial requisite for fast and optimally targeted antimicrobial treatment. Molecular biology based techniques allow fast identification, however discrimination of very closely related species remains still difficult. RESULTS: A molecular approach is presented for the rapid identification of pathogens combining PCR amplification with microarray detection. The DNA chip comprises oligonucleotide capture probes for 25 different pathogens including Gram positive cocci, the most frequently encountered genera of Enterobacteriaceae, non-fermenter and clinical relevant Candida species. The observed detection limits varied from 10 cells (e.g. E. coli) to 10(5) cells (S.  aureus) per mL artificially spiked blood. Thus the current low sensitivity for some species still represents a barrier for clinical application. Successful discrimination of closely related species was achieved by a signal pattern recognition approach based on the k-nearest-neighbour method. A prototype software providing this statistical evaluation was developed, allowing correct identification in 100 % of the cases at the genus and in 96.7 % at the species level (n = 241). CONCLUSION: The newly developed molecular assay can be carried out within 6 hours in a research laboratory from pathogen isolation to species identification. From  our results we conclude that DNA microarrays can be a useful tool for rapid identification of closely related pathogens particularly when the protocols are adapted to the special clinical scenarios. 
17526711	 Using DNA microarrays, we identified 126 genes in Escherichia coli K-12 whose expression is increased at human body temperature (37 degrees C) compared to growth at 23 degrees C. Genes involved in the uptake and utilization of amino acids, carbohydrates, and iron dominated the list, supporting a model in which temperature serves as a host cue to increase expression of bacterial genes needed for growth. Using quantitative real-time PCR, we investigated the thermoregulatory response for representative genes in each of these three categories (hisJ, cysP, srlE, garP, fes, and cirA), along with the fimbrial gene  papB. Increased expression at 37 degrees C compared to 23 degrees C was retained  in both exponential and stationary phases for all of the genes and in most of the various media tested, supporting the relative importance of this cue in adapting  to changing environments. Because iron acquisition is important for both growth and virulence, we analyzed the regulation of the iron utilization genes cirA and  fes and found that growth in iron-depleted medium abrogated the thermoregulatory  effect, with high-level expression at both temperatures, contrasting with papB thermoregulation, which was not greatly altered by limiting iron levels. A positive role for the environmental regulator H-NS was found for fes, cirA, hisJ, and srlE transcription, whereas it had a primarily negative effect on cysP and garP expression. Together, these studies indicate that temperature is a broadly used cue for regulating gene expression in E. coli and that H-NS regulates iron,  carbohydrate, and amino acid utilization gene expression. 
17485431	 MOTIVATION: Inferring a gene regulatory network exclusively from microarray expression profiles is a difficult but important task. The aim of this work is to compare the predictive power of some of the most popular algorithms in different  conditions (like data taken at equilibrium or time courses) and on both synthetic and real microarray data. We are in particular interested in comparing similarity measures both of linear type (like correlations and partial correlations) and of  non-linear type (mutual information and conditional mutual information), and in investigating the underdetermined case (less samples than genes). RESULTS: In our simulations we see that all network inference algorithms obtain better performances from data produced with 'structural' perturbations, like gene knockouts at steady state, than with any dynamical perturbation. The predictive power of all algorithms is confirmed on a reverse engineering problem from Escherichia coli gene profiling data: the edges of the 'physical' network of transcription factor-binding sites are significantly overrepresented among the highest weighting edges of the graph that we infer directly from the data without any structure supervision. Comparing synthetic and in vivo data on the same network graph allows us to give an indication of how much more complex a real transcriptional regulation program is with respect to an artificial model. AVAILABILITY: Software is freely available at the URL http://people.sissa.it/~altafini/papers/SoBiAl07/. SUPPLEMENTARY INFORMATION: Supplementary data are available at Bioinformatics online. 
17630338	 The genus Entamoeba contains many species, six of which (Entamoeba histolytica, Entamoeba dispar, Entamoeba moshkovskii, Entamoeba polecki, Entamoeba coli, and Entamoeba hartmanni) reside in the human intestinal lumen. Entamoeba histolytica  is the causative agent of amebiasis and is considered a leading parasitic cause of death worldwide in humans. Although recent studies highlight the recovery of E. dispar and E. moshkovskii from patients with gastrointestinal symptoms, there  is still no convincing evidence of a causal link between the presence of these two species and the symptoms of the host. New approaches to the identification of E. histolytica are based on detection of E. histolytica-specific antigen and DNA  in stool and other clinical samples. Several molecular diagnostic tests, including conventional and real-time PCR, have been developed for the detection and differentiation of E. histolytica, E. dispar, and E. moshkovskii in clinical  samples. The purpose of this review is to discuss different methods that exist for the identification of E. histolytica, E. dispar, and E. moshkovskii which are available to the clinical diagnostic laboratory. To address the need for a specific diagnostic test for amebiasis, a substantial amount of work has been carried out over the last decade in different parts of the world. The molecular diagnostic tests are increasingly being used for both clinical and research purposes. In order to minimize undue treatment of individuals infected with other species of Entamoeba such as E. dispar and E. moshkovskii, efforts have been made for specific diagnosis of E. histolytica infection and not to treat based simply  on the microscopic examination of Entamoeba species in the stool. The incorporation of many new technologies into the diagnostic laboratory will lead to a better understanding of the public health problem and measures to control the disease. 
17450416	 To study the functions of nuclear genes involved in chloroplast development, we systematically analyzed albino and pale green Arabidopsis thaliana mutants by use of the Activator/Dissociation (Ac/Ds) transposon tagging system. In this study, we focused on one of these albino mutants, designated apg3-1 (for a lbino or p ale g reen mutant 3). A gene encoding a ribosome release factor 1 (RF1) homologue was disrupted by the insertion of a Ds transposon into the APG3 gene; a T-DNA insertion into the same gene caused a similar phenotype (apg3-2). The APG3 gene (At3g62910) has 15 exons and encodes a protein (422-aa) with a transit peptide that functions in targeting the protein to chloroplasts. The amino acid sequence  of APG3 showed 40.6% homology with an RF1 of Escherichia coli, and complementation analysis using the E. coli rf1 mutant revealed that APG3 functions as an RF1 in E. coli, although complementation was not successful in the RF2-deficient (rf2) mutants of E. coli. These results indicate that the APG3  protein is an orthologue of E. coli RF1, and is essential for chloroplast translation machinery; it was accordingly named AtcpRF1. Since the chloroplasts of apg3-1 plants contained few internal thylakoid membranes, and chloroplast proteins related to photosynthesis were not detected by immunoblot analysis, AtcpRF1 is thought to be essential for chloroplast development. 
17449692	 Escherichia coli strains causing postweaning diarrhea (PWD) and edema disease (ED) in pigs are limited to a number of serogroups, with O8, O45, O138, O139, O141, O147, O149, and O157 being the most commonly reported worldwide. In this study, a DNA microarray based on the O-antigen-specific genes of all 8 E. coli serogroups, as well as 11 genes encoding adhesion factors and exotoxins associated with PWD and ED, was developed for the identification of related serogroups and virulence gene patterns. The microarray method was tested against  186 E. coli and Shigella O-serogroup reference strains, 13 E. coli reference strains for virulence markers, 43 E. coli clinical isolates, and 12 strains of other bacterial species and shown to be highly specific with reproducible results. The detection sensitivity was 0.1 ng of genomic DNA or 10(3) CFU per 0.3 g of porcine feces in mock samples. Seventeen porcine feces samples from local hoggeries were examined using the microarray, and the result for one sample was verified by the conventional serotyping methods. This microarray can be readily used to screen for the presence of PWD- and ED-associated E. coli in porcine feces samples. 
17416693	 To explore the use of DNA microarrays for pathogen detection in food, we produced DNA oligonucleotide arrays to simultaneously determine the presence of Arcobacter and the presence of Campylobacter in retail chicken samples. Probes were selected that target housekeeping and virulence-associated genes in both Arcobacter butzleri and thermotolerant Campylobacter jejuni and Campylobacter coli. These microarrays showed a high level of probe specificity; the signal intensities detected for A. butzleri, C. coli, or C. jejuni probes were at least 10-fold higher than the background levels. Specific identification of A. butzleri, C. coli, and C. jejuni was achieved without the need for a PCR amplification step. By adapting an isolation method that employed membrane filtration and selective media, C. jejuni isolates were recovered from package liquid from whole chicken carcasses prior to enrichment. Increasing the time of enrichment resulted in the  isolation of A. butzleri and increased the recovery of C. jejuni. C. jejuni isolates were further classified by using an additional subset of probes targeting the lipooligosaccharide (LOS) biosynthesis locus. Our results demonstrated that most of the C. jejuni isolates likely possess class B, C, or H  LOS. Validation experiments demonstrated that the DNA microarray had a detection  sensitivity threshold of approximately 10,000 C. jejuni cells. Interestingly, the use of C. jejuni sequence-specific primers to label genomic DNA improved the sensitivity of this DNA microarray for detection of C. jejuni in whole chicken carcass samples. C. jejuni was efficiently detected directly both in package liquid from whole chicken carcasses and in enrichment broths. 
17435007	 In an aerobic environment, responding to oxidative cues is critical for physiological adaptation (acclimation) to changing environmental conditions. The  unicellular alga Chlamydomonas reinhardtii was tested for the ability to acclimate to specific forms of oxidative stress. Acclimation was defined as the ability of a sublethal pretreatment with a reactive oxygen species to activate defense responses that subsequently enhance survival of that stress. C. reinhardtii exhibited a strong acclimation response to rose bengal, a photosensitizing dye that produces singlet oxygen. This acclimation was dependent upon photosensitization and occurred only when pretreatment was administered in the light. Shifting cells from low light to high light also enhanced resistance to singlet oxygen, suggesting an overlap in high-light and singlet oxygen response pathways. Microarray analysis of RNA levels indicated that a relatively  small number of genes respond to sublethal levels of singlet oxygen. Constitutive overexpression of either of two such genes, a glutathione peroxidase gene and a glutathione S-transferase gene, was sufficient to enhance singlet oxygen resistance. Escherichia coli and Saccharomyces cerevisiae exhibit well-defined responses to reactive oxygen but did not acclimate to singlet oxygen, possibly reflecting the relative importance of singlet oxygen stress for photosynthetic organisms. 
17525199	 PURPOSE: Consistent with clinical observations that posterior uveitis frequently  involves the retinal vasculature and recent recognition of vascular heterogeneity, the hypothesis for this study was that retinal vascular endothelium was a cell population of unique molecular phenotype. METHODS: Donor-matched cultures of primary retinal and choroidal endothelial cells from six human cadavers were incubated with either Toxoplasma gondii tachyzoites (10:1, parasites per cell) or Escherichia coli lipopolysaccharide (100 ng/mL); control cultures were simultaneously incubated with medium. Gene expression profiling of endothelial cells was performed using oligonucleotide arrays containing probes designed to detect 8746 human transcripts. After normalization, differential gene expression was assessed by the significance analysis of microarrays, with the false-discovery rate set at 5%. For selected genes, differences in the level of expression between retinal and choroidal cells were evaluated by real-time RT-PCR. RESULTS: Graphic descriptive analysis demonstrated a strong correlation between gene expression of unstimulated retinal and choroidal endothelial cells, but also highlighted distinctly different patterns of expression that were greater than differences noted between donors or between unstimulated and stimulated cells. Overall, 779 (8.9%) of 8746 transcripts were differentially represented. Of note, the 330 transcripts that were present at higher levels in retinal cells included  a larger percentage of transcripts encoding molecules involved in the immune response. Differential gene expression was confirmed for 12 transcripts by RT-PCR. CONCLUSIONS: Retinal and choroidal vascular endothelial cells display distinctive gene expression profiles. The findings suggest the possibility of treating posterior uveitis by targeting specific interactions between the retinal endothelial cell and an infiltrating leukocyte. 
17511876	 BACKGROUND: As a stationary phase signal, indole is secreted in large quantities  into rich medium by Escherichia coli and has been shown to control several genes  (e.g., astD, tnaB, gabT), multi-drug exporters, and the pathogenicity island of E. coli; however, its impact on biofilm formation has not been well-studied. RESULTS: Through a series of global transcriptome analyses, confocal microscopy,  isogenic mutants, and dual-species biofilms, we show here that indole is a non-toxic signal that controls E. coli biofilms by repressing motility, inducing  the sensor of the quorum sensing signal autoinducer-1 (SdiA), and influencing acid resistance (e.g., hdeABD, gadABCEX). Isogenic mutants showed these associated proteins are directly related to biofilm formation (e.g., the sdiA mutation increased biofilm formation 50-fold), and SdiA-mediated transcription was shown to be influenced by indole. The reduction in motility due to indole addition results in the biofilm architecture changing from scattered towers to flat colonies. Additionally, there are 12-fold more E. coli cells in dual-species biofilms grown in the presence of Pseudomonas cells engineered to express toluene o-monooxygenase (TOM, which converts indole to an insoluble indigoid) than in biofilms with pseudomonads that do not express TOM due to a 22-fold reduction in  extracellular indole. Also, indole stimulates biofilm formation in pseudomonads.  Further evidence that the indole effects are mediated by SdiA and homoserine lactone quorum sensing is that the addition of N-butyryl-, N-hexanoyl-, and N-octanoyl-L-homoserine lactones repress E. coli biofilm formation in the wild-type strain but not with the sdiA mutant. CONCLUSION: Indole is an interspecies signal that decreases E. coli biofilms through SdiA and increases those of pseudomonads. Indole may be manipulated to control biofilm formation by oxygenases of bacteria that do not synthesize it in  a dual-species biofilm. Furthermore, E. coli changes its biofilm in response to signals it cannot synthesize (homoserine lactones), and pseudomonads respond to signals they do not synthesize (indole). 
17472535	 Sporadic colon cancer is a major cause of death throughout the world. Multistage  development of the disease has been associated with remarkable genetic events, mainly at the level of oncogenes and oncosuppressor genes, most notably APC (adenomatous polyposis coli), ras and p53. Despite all of these efforts, the development of a sensitive and convenient diagnostic system for detecting colorectal cancers at the early stage is still in progress. In recent years, cDNA and oligonucleotide microarray technologies have made the analysis of gene expression profiles of colorectal tumours at the genomic level possible and have  identified signatures of gene expression associated with pre-cancerous phenotypes, cancers of the early stage and/or metastatic cancer. The contribution of this powerful technology in identification of novel important genes for prognosis, diagnosis and therapy of sporadic colorectal will be discussed. 
17351047	 Uropathogenic Escherichia coli (UPEC) strains are responsible for the majority of uncomplicated urinary tract infections, which can present clinically as cystitis  or pyelonephritis. UPEC strain CFT073, isolated from the blood of a patient with  acute pyelonephritis, was most cytotoxic and most virulent in mice among our strain collection. Based on the genome sequence of CFT073, microarrays were utilized in comparative genomic hybridization (CGH) analysis of a panel of uropathogenic and fecal/commensal E. coli isolates. Genomic DNA from seven UPEC (three pyelonephritis and four cystitis) isolates and three fecal/commensal strains, including K-12 MG1655, was hybridized to the CFT073 microarray. The CFT073 genome contains 5,379 genes; CGH analysis revealed that 2,820 (52.4%) of these genes were common to all 11 E. coli strains, yet only 173 UPEC-specific genes were found by CGH to be present in all UPEC strains but in none of the fecal/commensal strains. When the sequences of three additional sequenced UPEC strains (UTI89, 536, and F11) and a commensal strain (HS) were added to the analysis, 131 genes present in all UPEC strains but in no fecal/commensal strains were identified. Seven previously unrecognized genomic islands (>30 kb) were delineated by CGH in addition to the three known pathogenicity islands. These genomic islands comprise 672 kb of the 5,231-kb (12.8%) genome, demonstrating the importance of horizontal transfer for UPEC and the mosaic structure of the genome. UPEC strains contain a greater number of iron acquisition systems than do fecal/commensal strains, which is reflective of the adaptation to the iron-limiting urinary tract environment. Each strain displayed distinct differences in the number and type of known virulence factors. The large number of hypothetical genes in the CFT073 genome, especially those shown to be UPEC specific, strongly suggests that many urovirulence factors remain uncharacterized. 
17464060	 Recently, a number of attenuated mutants of Yersinia pseudotuberculosis have been identified using a bioinformatics approach. One of the target genes identified in that study was vagH, which the authors now characterized further. VagH shows homology to HemK of Escherichia coli, possessing methyltransferase activity similar to that of HemK, and targeting release factors 1 and 2. Microarray studies comparing the wild-type and the vagH mutant revealed that the mRNA levels of only a few genes were altered in the mutant. By proteome analysis, expression  of the virulence determinant YopD was found to be increased, indicating a possible connection between VagH and the virulence plasmid-encoded type III secretion system (T3SS). Further analysis showed that Yop expression and secretion were repressed in a vagH mutant. This phenotype could be suppressed by  trans-complementation with the wild-type vagH gene or by deletion of the negative regulator yopD. Also, in a similar manner to a T3SS-negative mutant, the avirulent vagH mutant was rapidly cleared from Peyer's patches and could not reach the spleen after oral infection of mice. In a manner analogous to that of T3SS mutants, the vagH mutant could not block phagocytosis by macrophages. However, a vagH mutant showed no defects in the T3SS-independent ability to proliferate intracellularly and replicated to levels similar to those of the wild-type in macrophages. In conclusion, the vagH mutant exhibits a virulence phenotype similar to that of a T3SS-negative mutant, indicating a tight link between VagH and type III secretion in Y. pseudotuberculosis. 
17166236	 The ability of lipid A structural variants to elicit unique endothelial cell gene expression was examined by measuring global gene expression profiles in human umbilical cord vein endothelial cells (HUVEC) using Affymetrix full genome chips. Two lipid A structural variants obtained from Porphyromonas gingivalis designated PgLPS(1435/1449) and PgLPS(1690) as well as LPS obtained from Escherichia coli wild type and an E. coli msbB mutant (missing myristic acid in the lipid A) were  examined. Each of these lipid A structures has been shown to interact with TLR4;  however, PgLPS(1435/1449) and E. coli msbB LPS have been shown to be TLR4 antagonists while PgLPS(1690) and wild-type E. coli LPS are TLR4 agonists. It was found that PgLPS(1435/1449) and PgLPS(1690) as well as E. coli msbB LPS activated a subset of those genes significantly transcribed in response to E. coli wild-type LPS. Furthermore, the subset of genes expressed in response to the different lipid A structural forms were those most significantly activated by wild-type E. coli LPS demonstrating a hierarchy in TLR4-dependent endothelial cell gene activation. A unique gene expression profile for the weak TLR4 agonist  PgLPS(1690) was observed and represents a TLR4 hierarchy in endothelial cell gene activation. 
17251301	 Mucosal immunization of mice with chimeric, Escherichia coli-expressed VP6, the protein that comprises the intermediate capsid layer of the rotavirus particle, together with attenuated E. coli heat-labile toxin LT(R192G) as an adjuvant, reduces fecal shedding of rotavirus antigen by >95% after murine rotavirus challenge, and the only lymphocytes required for protection are CD4+ T cells. Because these cells produce cytokines with antiviral properties, the cytokines whose expression is upregulated in intestinal memory CD4+ T cells immediately after rotavirus challenge of VP6/LT(R192G)-immunized mice may be directly or indirectly responsible for the rapid suppression of rotavirus shedding. This study was designed to identify which cytokines are significantly upregulated in intestinal effector sites and secondary lymphoid tissues of intranasally immunized BALB/c mice after challenge with murine rotavirus strain EDIM. Initially, this was done by using microarray analysis to quantify mRNAs for 96 murine common cytokines. With this procedure, the synthesis of mRNAs for gamma interferon (IFN-gamma) and interleukin-17 (IL-17) was found to be temporarily upregulated in intestinal lymphoid cells of VP6/LT(R192G)-immunized mice at 12 h  after rotavirus challenge. These cytokines were also produced in CD4+ T cells obtained from intestinal sites specific to VP6/LT(R192G)-immunized mice after in  vitro exposure to VP6 as determined by intracellular cytokine staining and secretion of cytokines. Although genetically modified mice that lack receptors for either IFN-gamma or IL-17 remained protected after immunization, these results provide suggestive evidence that these cytokines may play direct or indirect roles in protection against rotavirus after mucosal immunization of mice with VP6/LT(R192G). 
17300222	 Research programmes for constructing a 'cell factory' have been funded in several countries. In Japan, the 'Minimum genome factory' (MGF) project was launched in 2001. In this project, several model microbes have been genetically reconstructed to obtain a cell with fewer genes on a chromosome of reduced size. A microbe with a 'minimum genome' is expected to exhibit less regulation and therefore to be an  ideal platform for a cell-factory system. The goal of this project is to construct such a minimum genome microbe for a cell factory. In this project, the  4.6 Mbp genome of Escherichia coli K-12 has been successfully reduced to 3.6 Mbp. The constructed reduced-genome strain, MGF-01, shows better growth and higher threonine production compared with the wild-type strain. Furthermore functional analyses of all E. coli genes have also been performed. CGH (comparative genomic  hybridization) analysis revealed that about 2600 genes were commonly conserved in the 23 E. coli strains tested. This set of conserved genes was hypothesized as a  core set for E. coli species. Phenotype array analysis of a nearly complete collection of single-gene knockout mutants of E. coli provided insights into E. coli metabolic networks. The data sets from the functional genomics will be used  to improve design of an E. coli MGF. The present minireview summarizes the progress of the E. coli MGF project and overviews related research. 
17105821	 Each infectious agent represents a unique combination of pathogen-associated molecular patterns that interact with specific pattern-recognition receptors expressed on immune cells. Therefore, we surmised that the blood immune cells of  individuals with different infections might bear discriminative transcriptional signatures. Gene expression profiles were obtained for 131 peripheral blood samples from pediatric patients with acute infections caused by influenza A virus, Gram-negative (Escherichia coli) or Gram-positive (Staphylococcus aureus and Streptococcus pneumoniae) bacteria. Thirty-five genes were identified that best discriminate patients with influenza A virus infection from patients with either E coli or S pneumoniae infection. These genes classified with 95% accuracy (35 of 37 samples) an independent set of patients with either influenza A, E coli, or S pneumoniae infection. A different signature discriminated patients with E coli versus S aureus infections with 85% accuracy (34 of 40). Furthermore, distinctive gene expression patterns were observed in patients presenting with respiratory infections of different etiologies. Thus, microarray analyses of patient peripheral blood leukocytes might assist in the differential diagnosis of infectious diseases. 
17220229	 Salmonella enterica serovar Typhimurium must successfully transition the broad fluctuations in oxygen concentrations encountered in the host. In Escherichia coli, FNR is one of the main regulatory proteins involved in O2 sensing. To assess the role of FNR in serovar Typhimurium, we constructed an isogenic fnr mutant in the virulent wild-type strain (ATCC 14028s) and compared their transcriptional profiles and pathogenicities in mice. Here, we report that, under anaerobic conditions, 311 genes (6.80% of the genome) are regulated directly or indirectly by FNR; of these, 87 genes (28%) are poorly characterized. Regulation  by FNR in serovar Typhimurium is similar to, but distinct from, that in E. coli.  Thus, genes/operons involved in aerobic metabolism, NO. detoxification, flagellar biosynthesis, motility, chemotaxis, and anaerobic carbon utilization are regulated by FNR in a fashion similar to that in E. coli. However, genes/operons  existing in E. coli but regulated by FNR only in serovar Typhimurium include those coding for ethanolamine utilization, a universal stress protein, a ferritin-like protein, and a phosphotransacetylase. Interestingly, Salmonella-specific genes/operons regulated by FNR include numerous virulence genes within Salmonella pathogenicity island 1 (SPI-1), newly identified flagellar genes (mcpAC, cheV), and the virulence operon (srfABC). Furthermore, the role of FNR as a positive regulator of motility, flagellar biosynthesis, and  pathogenesis was confirmed by showing that the mutant is nonmotile, lacks flagella, is attenuated in mice, and does not survive inside macrophages. The inability of the mutant to survive inside macrophages is likely due to its sensitivity to the reactive oxygen species generated by NADPH phagocyte oxidase. 
17992580	 Bacterial production of recombinant proteins offers several advantages over alternative expression methods and remains the system of choice for many structural genomics projects. However, a large percentage of targets accumulate as insoluble inclusion bodies rather than soluble protein, creating a significant bottleneck in the protein production pipeline. Numerous strategies have been reported that can improve in vivo protein solubility, but most do not scale easily for high-throughput expression screening. To understand better the host cell response to the accumulation of insoluble protein, we determined genome-wide changes in bacterial gene expression upon induction of either soluble or insoluble target proteins. By comparing transcriptional profiles for multiple examples from the soluble or insoluble class, we identified a pattern of gene expression that correlates strongly with protein solubility. Direct targets of the sigma32 heat shock sigma factor, which includes genes involved in protein folding and degradation, were highly expressed in response to induction of insoluble protein. This same group of genes was also upregulated by insoluble protein accumulation under a different growth regime, indicating that sigma32-mediated gene expression is a general response to protein insolubility. This knowledge provides a starting point for the rational design of growth parameters and host strains with improved protein solubility characteristics. Summary Problems with protein solubility are frequently encountered when recombinant proteins are expressed in E. coli. The bacterial host responds to this problem by increasing expression of the protein folding machinery via the heat shock sigma factor sigma32. Manipulation of the sigma32 regulon might provide a general mechanism for improving recombinant protein solubility. 
17251202	 Gene co-expression, in many cases, implies the presence of a functional linkage between genes. Co-expression analysis has uncovered gene regulatory mechanisms in model organisms such as Escherichia coli and yeast. Recently, accumulation of Arabidopsis microarray data has facilitated a genome-wide inspection of gene co-expression profiles in this model plant. An approach using network analysis has provided an intuitive way to represent complex co-expression patterns between many genes. Co-expression network analysis has enabled us to extract modules, or  groups of tightly co-expressed genes, associated with biological processes. Furthermore, integrated analysis of gene expression and metabolite accumulation has allowed us to hypothesize the functions of genes associated with specific metabolic processes. Co-expression network analysis is a powerful approach for data-driven hypothesis construction and gene prioritization, and provides novel insights into the system-level understanding of plant cellular processes. 
17158618	 Escherichia coli is currently used as an indicator of fecal pollution and to assess water quality. While several genotypic techniques have been used to determine potential sources of fecal bacteria impacting waterways and beaches, they do not allow for the rapid analysis of a large number of samples in a relatively short period of time. Here we report that gene probes identified by Hamilton and colleagues (M. J. Hamilton, T. Yan, and M. J. Sadowsky, Appl. Environ. Microbiol. 72:4012-4019, 2006) were useful for the development of a high-throughput and quantitative macroarray hybridization system to determine numbers of E. coli bacteria originating from geese/ducks. The procedure we developed, using a QBot robot for picking and arraying of colonies, allowed us to simultaneously analyze up to 20,736 E. coli colonies from water samples, with minimal time and human input. Statistically significant results were obtained by  analyzing 700 E. coli colonies per water sample, allowing for the analysis of approximately 30 sites per macroarray. Macroarray hybridization studies done on E. coli collected from water samples obtained from two urban Minnesota lakes and  one rural South Carolina lake indicated that geese/ducks contributed up to 51% of the fecal bacteria in the urban lake water samples, and the level was below the detection limit in the rural lake water sample. This technique, coupled with the  use of other host source-specific gene probes, holds great promise as a new quantitative microbial source tracking tool to rapidly determine the origins of E. coli in waterways and on beaches. 
17108073	 Classical antibody-based serotyping of Escherichia coli is an important method in diagnostic microbiology for epidemiological purposes, as well as for a rough virulence assessment. However, serotyping is so tedious that its use is restricted to a few reference laboratories. To improve this situation we developed and validated a genetic approach for serotyping based on the microarray technology. The genes encoding the O-antigen flippase (wzx) and the O-antigen polymerase (wzy) were selected as target sequences for the O antigen, whereas fliC and related genes, which code for the flagellar monomer, were chosen as representatives for the H phenotype. Starting with a detailed bioinformatic analysis and oligonucleotide design, an ArrayTube-based assay was established: a  fast and robust DNA extraction method was coupled with a site-specific, linear multiplex labeling procedure and hybridization analysis of the biotinylated amplicons. The microarray contained oligonucleotide DNA probes, each in duplicate, representing 24 of the epidemiologically most relevant of the over 180 known O antigens (O antigens 4, 6 to 9, 15, 26, 52, 53, 55, 79, 86, 91, 101, 103, 104, 111, 113, 114, 121, 128, 145, 157, and 172) as well as 47 of the 53 different H antigens (H antigens 1 to 12, 14 to 16, 18 to 21, 23 to 34, 37 to 43, 45, 46, 48, 49, 51 to 54, and 56). Evaluation of the microarray with a set of defined strains representing all O and H serotypes covered revealed that it has a high sensitivity and a high specificity. All of the conventionally typed 24 O groups and all of the 47 H serotypes were correctly identified. Moreover, strains which were nonmotile or nontypeable by previous serotyping assays yielded unequivocal results with the novel ArrayTube assay, which proved to be a valuable alternative to classical serotyping, allowing processing of single colonies within a single working day. 
17029709	 A DNA microarray has been developed for the simultaneous characterisation and typing of Salmonella enterica subsp. enterica isolates. One-hundred and nine 35-40 mer oligonucleotides probes detect flagellar and somatic antigen encoding genes (serogroup or serotype specific), important virulence genes located within  or outside the pathogenicity islands, phage-associated genes and antibiotic resistance determinants. The probes were printed on glass slides and whole genomic Cy5-labelled Salmonella DNA was hybridised to the substrate. A set of 19  different Salmonella strains and one Escherichia coli strain has been selected as positive and negative controls for each probe. The validity of the results is confirmed by gene-specific PCRs or phenotypic methods (serotyping, MIC determination for various antimicrobial agents). Of 2071 data points generated, an agreement of 97.4% has been obtained between microarray and PCR/phenotypic results. Twenty-six data points (1.3%) were classified as uncertain and, similarly, 1.3% showed a discordant result. The microarray described here is a new tool to study the epidemiology of Salmonella strains on the genotypic level and might become a powerful method in risk assessment studies. 
17244365	 BACKGROUND: Gene expression microarray and other multiplex data hold promise for  addressing the challenges of cellular complexity, refined diagnoses and the discovery of well-targeted treatments. A new approach to the construction and quantification of transcriptional regulatory networks (TRNs) is presented that integrates gene expression microarray data and cell modeling through information  theory. Given a partial TRN and time series data, a probability density is constructed that is a functional of the time course of transcription factor (TF)  thermodynamic activities at the site of gene control, and is a function of mRNA degradation and transcription rate coefficients, and equilibrium constants for TF/gene binding. RESULTS: Our approach yields more physicochemical information that compliments the results of network structure delineation methods, and thereby can serve as an element of a comprehensive TRN discovery/quantification system. The most probable TF time courses and values of the aforementioned parameters are obtained by maximizing the probability obtained through entropy maximization. Observed time delays between mRNA expression and activity are accounted for implicitly since the time course of the activity of a TF is coupled by probability functional maximization, and is not assumed to be proportional to expression level of the mRNA type that translates into the TF. This allows one to investigate post-translational and TF activation mechanisms of gene regulation. Accuracy and  robustness of the method are evaluated. A kinetic formulation is used to facilitate the analysis of phenomena with a strongly dynamical character while a  physically-motivated regularization of the TF time course is found to overcome difficulties due to omnipresent noise and data sparsity that plague other methods of gene expression data analysis. An application to Escherichia coli is presented. CONCLUSION: Multiplex time series data can be used for the construction of the network of cellular processes and the calibration of the associated physicochemical parameters. We have demonstrated these concepts in the context of gene regulation understood through the analysis of gene expression microarray time series data. Casting the approach in a probabilistic framework has allowed us to address the uncertainties in gene expression microarray data. Our approach  was found to be robust to error in the gene expression microarray data and mistakes in a proposed TRN. 
17123456	 A major challenge in microbial diagnostics is the parallel detection and identification of low-bundance pathogens within a complex microbial community. In addition, a high specificity providing robust, reliable identification at least at the species level is required. A microbial diagnostic microarray approach, using single nucleotide extension labeling with gyrB as the marker gene, was developed. We present a novel concept applying competitive oligonucleotide probes to improve the specificity of the assay. Our approach enabled the sensitive and specific detection of a broad range of pathogenic bacteria. The approach was tested with a set of 35 oligonucleotide probes targeting Escherichia coli, Shigella spp., Salmonella spp., Aeromonas hydrophila, Vibrio cholerae, Mycobacterium avium, Mycobacterium tuberculosis, Helicobacter pylori, Proteus mirabilis, Yersinia enterocolitica, and Campylobacter jejuni. The introduction of competitive oligonucleotides in the labeling reaction successfully suppressed cross-reaction by closely related sequences, significantly improving the performance of the assay. Environmental applicability was tested with environmental and veterinary samples harboring complex microbial communities. Detection sensitivity in the range of 0.1% has been demonstrated, far below the 5% detection limit of traditional microbial diagnostic microarrays. 
17675854	 A second-generation 4,959 element cDNA microarray has been created and evaluated  for its potential use in examining the avian innate immune response. The elements in this array were obtained from EST libraries of stimulated avian PMNC-derived monocytes/macrophages and supplemented by genes of interest from several specific innate immune pathways. The elements are spotted in triplicate resulting in 14,877 total spots per slide. The avian innate immunity microarray (AIIM) contains 25 avian interleukin, chemokine, and cytokine elements. The array also contains elements for several innate immune pathways, including genes involved in the Toll-like receptor (TLR) pathway (including six of the currently known avian  TLR receptors), avian interferon/antiviral response pathway genes, and genes involved in apoptosis, antigen presentation and the oxidative burst. The AIIM can be used to evaluate global gene expression patterns in a number of immunologically relevant tissues and in chickens, turkeys and ducks. The array has also been evaluated for its ability to monitor the avian immune response to both bacterial (avian pathogenic Escherichia coli) and viral (avian influenza) avian pathogens. 
18088402	 BACKGROUND: Microarrays have recently emerged as a novel procedure to evaluate the genetic content of bacterial species. So far, microarrays have mostly covered single or few strains from the same species. However, with cheaper high-throughput sequencing techniques emerging, multiple strains of the same species are rapidly becoming available, allowing for the definition and characterization of a whole species as a population of genomes--the 'pan-genome'. RESULTS: Using 32 Escherichia coli and Shigella genome sequences we estimate the  pan- and core genome of the species. We designed a high-density microarray in order to provide a tool for characterization of the E. coli pan-genome. Technical performance of this pan-genome microarray based on control strain samples (E. coli K-12 and O157:H7) demonstrated a high sensitivity and relatively low false positive rate. A single-channel analysis approach is robust while allowing the possibility for deriving presence/absence predictions for any gene included on our pan-genome microarray. Moreover, the array was highly sufficient to investigate the gene content of non-pathogenic isolates, despite the strong bias  towards pathogenic E. coli strains that have been sequenced so far. CONCLUSION: This high-density microarray provides an excellent tool for characterizing the genetic makeup of unknown E. coli strains and can also deliver insights into phylogenetic relationships. Its design poses a considerably larger  challenge and involves different considerations than the design of single strain  microarrays. Here, lessons learned and future directions will be discussed in order to optimize design of microarrays targeting entire pan-genomes. 
17711596	 BACKGROUND: Enterohemorrhagic Escherichia coli (EHEC) O157 causes severe food-borne illness in humans. The chromosome of O157 consists of 4.1 Mb backbone  sequences shared by benign E. coli K-12, and 1.4 Mb O157-specific sequences encoding many virulence determinants, such as Shiga toxin genes (stx genes) and the locus of enterocyte effacement (LEE). Non-O157 EHECs belonging to distinct clonal lineages from O157 also cause similar illness in humans. According to the  'parallel' evolution model, they have independently acquired the major virulence  determinants, the stx genes and LEE. However, the genomic differences between O157 and non-O157 EHECs have not yet been systematically analyzed. RESULTS: Using microarray and whole genome PCR scanning analyses, we performed a  whole genome comparison of 20 EHEC strains of O26, O111, and O103 serotypes with  O157. In non-O157 EHEC strains, although genome sizes were similar with or rather larger than O157 and the backbone regions were well conserved, O157-specific regions were very poorly conserved. Around only 20% of the O157-specific genes were fully conserved in each non-O157 serotype. However, the non-O157 EHECs contained a significant number of virulence genes that are found on prophages and plasmids in O157, and also multiple prophages similar to, but significantly divergent from, those in O157. CONCLUSION: Although O157 and non-O157 EHECs have independently acquired a huge amount of serotype- or strain-specific genes by lateral gene transfer, they share an unexpectedly large number of virulence genes. Independent infections of similar but distinct bacteriophages carrying these virulence determinants are deeply involved in the evolution of O157 and non-O157 EHECs. 
17074858	 Deletional inactivation of the gene encoding d-serine deaminase, dsdA, in uropathogenic Escherichia coli strain CFT073 results in a hypermotile strain with a hypercolonization phenotype in the bladder and kidneys of mice in a model of urinary tract infection (UTI). The in vivo gene expression profiles of CFT073 and CFT073 dsdA were compared by isolating RNA directly from the urine of mice challenged with each strain individually. Hybridization of cDNAs derived from these samples to CFT073-specific microarrays allowed identification of genes that were up- or down-regulated in the dsdA deletion strain during UTI. Up-regulated genes included the known d-serine-responsive gene dsdX, suggesting in vivo intracellular accumulation of d-serine by CFT073 dsdA. Genes encoding F1C fimbriae, both copies of P fimbriae, hemolysin, OmpF, a dipeptide transporter DppA, a heat shock chaperone IbpB, and clusters of open reading frames with unknown functions were also up-regulated. To determine the role of these genes as well as motility in the hypercolonization phenotype, mutants were constructed in  the CFT073 dsdA background and tested in competition against the wild type in the murine model of UTI. Strains with deletions of one or both of the two P fimbrial  operons, hlyA, fliC, ibpB, c0468, locus c3566 to c3568, or c2485 to c2490 colonized mouse bladders and kidneys at levels indistinguishable from wild type.  CFT073 dsdA c2398 and CFT073 dsdA focA maintained a hypercolonization phenotype.  A CFT073 dsdA dppA mutant was attenuated 10- to 50-fold in its colonization ability compared to CFT073. Our results support a role for d-serine catabolism and signaling in global virulence gene regulation of uropathogenic E. coli. 
17596995	 M cells interspersed in the follicle-associated epithelium of Peyer's patches represent the major antigen sampling cells of the intestinal mucosa providing immune surveillance for particulate antigens. Despite their crucial role in immune defense our knowledge about these elusive cells is still only rudimentary. A Caco-2 co-culture model for the induction of M cell-like cells and DNA microarray analysis for differential gene expression profiling were employed to identify (a) putative suitable surface marker(s). Induction of M cell-like cells  was demonstrated morphologically by electron microscopy, evaluated by infection with Yersinia enterocolitica and enteropathogenic Escherichia coli strain E2348/69 and further monitored by changes in binding of the lectin UEA-1. The differentiation of Caco-2 cells was found to be reversible, dependent on (a) lymphocyte-derived soluble factor(s) and accompanied by the up-regulation of the  glycoprotein lectin galectin-9, which was specifically expressed on these cells as well as on human follicle-associated epithelial (FAE) cells. Galectin-9 represents a novel surface marker which might be employed for molecular targeting to the Peyer's patches thereby opening new opportunities for drug and vaccine development. 
17085555	 Staphylococcus aureus infections can be difficult to treat due to both multidrug  resistance and the organism's remarkable ability to persist in the host. Persistence and the evolution of resistance may be related to several complex regulatory networks, such as the SOS response, which modifies transcription in response to environmental stress. To understand how S. aureus persists during antibiotic therapy and eventually emerges resistant, we characterized its global  transcriptional response to ciprofloxacin. We found that ciprofloxacin induces prophage mobilization as well as significant alterations in metabolism, most notably the up-regulation of the tricarboxylic acid cycle. In addition, we found  that ciprofloxacin induces the SOS response, which we show, by comparison of a wild-type strain and a non-SOS-inducible lexA mutant strain, includes the derepression of 16 genes. While the SOS response of S. aureus is much more limited than those of Escherichia coli and Bacillus subtilis, it is similar to that of Pseudomonas aeruginosa and includes RecA, LexA, several hypothetical proteins, and a likely error-prone Y family polymerase whose homologs in other bacteria are required for induced mutation. We also examined induced mutation and found that either the inability to derepress the SOS response or the lack of the  LexA-regulated polymerase renders S. aureus unable to evolve antibiotic resistance in vitro in response to UV damage. The data suggest that up-regulation of the tricarboxylic acid cycle and induced mutation facilitate S. aureus persistence and evolution of resistance during antibiotic therapy. 
17956941	 Diabetic subjects are susceptible to atherosclerosis. It has been postulated that inflammation plays a crucial role in atherogenesis. Since previous studies suggested persistent low-grade infection by Gram-negative bacteria such as Chlamydia spp. and/or periodontal infection is associated with increased atherogenesis among diabetic subjects, we hypothesized that macrophages under hyperglycemia respond to lipopolysaccharide (LPS) challenge in a more exaggerated manner than under normal glucose conditions. Therefore, we examined cytokine productivity and associated signal transduction molecules in LPS-stimulated the monocytic cell line THP-1, under conditions of hyperglycemia. Differentiated THP-1 cells were cultured under normal and high glucose conditions without fetal  bovine serum, and were stimulated with Escherichia coli LPS in the presence of LPS binding protein. Following stimulation, activated signal transduction molecules were detected by protein microarray and confirmed thereafter. Results indicated that c-jun N-terminal kinase (JNK) was highly-phosphorylated at high glucose concentrations, and this was confirmed by Western-immunoblotting. Tumor necrosis factor-alpha and monocyte chemo-attractant protein-1 production were significantly enhanced under these conditions. SP600125, a selective inhibitor of JNK, dose-dependently suppressed the production of these cytokine. Therefore, we  suggest that this may be one of the mechanisms by which sub-clinical infection by Gram-negative bacteria promotes atherosclerosis in diabetic subjects. 
17693717	 Escherichia coli has many periplasmic phosphatase activities. To test whether it  can take up and excrete purine nucleotides, we attempted to completely disrupt periplasmic 5'-nucleotidase activity. A 5'-nucleotidase activity was induced in ushA knockout mutant cells, which lack major 5'-nucleotidase activity, when they  were grown with purine nucleotides as the sole carbon source. Using DNA macroarrays to compare global gene expression in wild-type and ushA knockout mutant cells cultured with IMP or GMP as the sole carbon source, we identified two genes that were induced in the ushA knockout mutant cells and encoded signal  sequence needed for secretion. One of the genes, aphA, encoded a 5'-nucleotidase  activity and was induced by IMP or inosine. An ushA aphA double knockout mutant was shown to be unable to grow on purine nucleotides as the sole carbon source. To investigate the excretion of purine nucleotides, we constructed an ushAaphA double knockout mutant of an inosine-producing strain and found that it accumulated IMP in the medium. In addition, when the guaBA operon was introduced  into the ushAaphA double knockout IMP producer, GMP was released into the medium. These observations imply the existence of efflux activity for purine nucleotides  in E. coli. 
17099705	 We report a genome-wide, multiscale approach to simultaneously measure the effect that the increased copy of each gene and/or operon has on a desired trait or phenotype. The method involves (i) growth selections on a mixture of several different plasmid-based genomic libraries of defined insert sizes or SCALEs, (ii) microarray studies of enriched plasmid DNA, and a (iii) mathematical multiscale analysis that precisely identifies the relevant genetic elements. This approach allows for identification of all single open reading frames and larger multigene  fragments within a genomic library that alter the expression of a given phenotype. We have demonstrated this method in Escherichia coli by monitoring, in parallel, a population of >10(6) genomic library clones of different insert sizes, throughout continuous selections over a period of 100 generations. 
17337437	 Signals from different oligonucleotide probes against the same target show great  variation in intensities. However, detection of differences along a sequence e.g. to reveal intron/exon architecture, transcription boundary as well as simple absent/present calls depends on comparisons between different probes. It is therefore of great interest to correct for the variation between probes. Much of  this variation is sequence dependent. We demonstrate that a thermodynamic model for hybridization of either DNA or RNA to a DNA microarray, which takes the sequence-dependent probe affinities into account significantly reduces the signal fluctuation between probes targeting the same gene transcript. For a test set of  tightly tiled yeast genes, the model reduces the variance by up to a factor approximately 1/3. As a consequence of this reduction, the model is shown to yield a more accurate determination of transcription start sites for a subset of  yeast genes. In another application, we identify present/absent calls for probes  hybridized to the sequenced Escherichia coli strain O157:H7 EDL933. The model improves the correct calls from 85 to 95% relative to raw intensity measures. The model thus makes applications which depend on comparisons between probes aimed at different sections of the same target more reliable. 
17214507	 Machine learning approaches offer the potential to systematically identify transcriptional regulatory interactions from a compendium of microarray expression profiles. However, experimental validation of the performance of these methods at the genome scale has remained elusive. Here we assess the global performance of four existing classes of inference algorithms using 445 Escherichia coli Affymetrix arrays and 3,216 known E. coli regulatory interactions from RegulonDB. We also developed and applied the context likelihood of relatedness (CLR) algorithm, a novel extension of the relevance networks class of algorithms. CLR demonstrates an average precision gain of 36% relative to the  next-best performing algorithm. At a 60% true positive rate, CLR identifies 1,079 regulatory interactions, of which 338 were in the previously known network and 741 were novel predictions. We tested the predicted interactions for three transcription factors with chromatin immunoprecipitation, confirming 21 novel interactions and verifying our RegulonDB-based performance estimates. CLR also identified a regulatory link providing central metabolic control of iron transport, which we confirmed with real-time quantitative PCR. The compendium of  expression data compiled in this study, coupled with RegulonDB, provides a valuable model system for further improvement of network inference algorithms using experimental data. 
17149863	 We screened a library of 117 bisphosphonates for antibacterial activity against Escherichia coli. The most potent growth inhibitors where N-[methyl(4-phenylalkyl)]-3-aminopropyl-1-hydroxy-1,1-bisphosphonates, known potent bone resorption inhibitors, and there was a generally good correlation between cell growth inhibition and E. coli farnesyl diphosphate synthase (FPPS) inhibition. However, some potent FPPS inhibitors had no activity in cell growth inhibition, and based on the result of Catalyst pharmacophore modeling, this could be attributed to the requirement of a large hydrophobic feature for cellular activity (due most likely to transport). The activity of the most potent compound, N-[methyl(4-phenylbutyl)]-3-aminopropyl-1-hydroxy-1,1-bisphosphonate (13), was strongly potentiated by the drug fosmidomycin. The transcription profiles for 13 or fosmidomycin alone were different from those found with carbenicillin or ciprofloxacin alone, but there were many similarities between the combination (13-fosmidomycin) and carbenicillin or ciprofloxacin, reflecting  the more potent bactericidal activity of the drug combination on bacterial growth. 
17049458	 Escherichia coli A0 34/86 (O83:K24:H31) is a commensal strain that has been used  for prophylactic and therapeutic colonization of the intestine of newborn infants. To identify traits specific for E. coli A0 34/86, we used a minimal tiling set of 148 BAC clones of A0 34/86 genomic DNA, to construct restriction-digested BAC arrays. Hybridization with genomic DNA from four E. coli strains (CFT073; O157:H7; K12 and Nissle 1917) allowed selection of two BAC clones that were sequenced to identify A0 34/86-specific regions. Genes for the yersiniabactin siderophore system, several proteins homologous to Salmonella enterica serovar Typhimurium vitamin B12 synthesis proteins, as well as genes necessary for the degradation of propanediol, the pix fimbriae determinant and genes coding for a putative phosphoglycerate transport system present also on pathogenicity island V of E. coli strain 536 were all identified in E. coli A0 34/86. This comparative analysis underlines the important genome heterogeneity between E. coli strains. 
17082244	 Hemolytic uremic syndrome (HUS), which is caused by Shiga toxin-producing Escherichia coli infection, is the leading cause of acute renal failure in children. At present, there is no complete small animal model of this disease. This study investigated a mouse model using intraperitoneal co-injection of purified Shiga toxin 2 (Stx2) plus LPS. Through microarray, biochemical, and histologic analysis, it was found to be a valid model of the human disease. Biochemical and microarray analysis of mouse kidneys revealed the Stx2 plus LPS challenge to be distinct from the effects of either agent alone. Microarrays identified differentially expressed genes that were demonstrated previously to play a role in this disease. Blood and serum analysis of these mice showed neutrophilia, thrombocytopenia, red cell hemolysis, and increased serum creatinine and blood urea nitrogen. In addition, histologic analysis and electron microscopy of mouse kidneys demonstrated glomerular fibrin deposition, red cell congestion, microthrombi formation, and glomerular ultrastructural changes. It was established that this C57BL/6 mouse is a complete model of HUS that includes  the thrombocytopenia, hemolytic anemia, and renal failure that define the human disease. In addition, a time course of HUS disease progression that will be useful for identification of therapeutic targets and development of new treatments for HUS is described. 
16997949	 Transcriptomic analyses during growth in Luria-Bertani medium were performed in strain SL1344 of Salmonella enterica serovar Typhimurium and in two isogenic derivatives lacking Dam methylase. More genes were repressed than were activated  by Dam methylation (139 versus 37). Key genes that were differentially regulated  by Dam methylation were verified independently. The largest classes of Dam-repressed genes included genes belonging to the SOS regulon, as previously described in Escherichia coli, and genes of the SOS-inducible Salmonella prophages ST64B, Gifsy-1, and Fels-2. Dam-dependent virulence-related genes were  also identified. Invasion genes in pathogenicity island SPI-1 were activated by Dam methylation, while the fimbrial operon std was repressed by Dam methylation.  Certain flagellar genes were repressed by Dam methylation, and Dam(-) mutants of  S. enterica showed reduced motility. Altered expression patterns in the absence of Dam methylation were also found for the chemotaxis genes cheR (repressed by Dam) and STM3216 (activated by Dam) and for the Braun lipoprotein gene, lppB (activated by Dam). The requirement for DNA adenine methylation in the regulation of specific virulence genes suggests that certain defects of Salmonella Dam(-) mutants in the mouse model may be caused by altered patterns of gene expression. 
17134499	 BACKGROUND: During systemic gram-negative bacterial infections, lipopolysaccharide (LPS) ligation to the hepatic Toll-like receptor-4 complex induces the production of hepatic acute phase proteins that are involved in the host response to infection and limit the associated inflammatory process. Identifying the genes that regulate this hepatic response to LPS in ruminants may provide insight into the pathogenesis of bacterial diseases and eventually facilitate breeding of more disease resistant animals. The objective of this research was to profile the expression of ovine hepatic genes in response to Escherichia coli LPS challenge (0, 200, 400 ng/kg) using a bovine cDNA microarray and quantitative real-time PCR (qRT-PCR). RESULTS: Twelve yearling ewes were challenged iv with E. coli LPS (0, 200, 400 ng/kg) and liver biopsies were collected 4-5 hours post-challenge to assess hepatic gene expression profiles by bovine cDNA microarray and qRT-PCR analyses.  The expression of CD14, C3, IL12R, NRAMP1, SOD and IGFBP3 genes was down regulated, whereas the expression of ACTHR, IFNalphaR, CD1, MCP-1 and GH was increased during LPS challenge. With the exception of C3, qRT-PCR analysis of 7 of these genes confirmed the microarray results and demonstrated that GAPDH is not a suitable housekeeping gene in LPS challenged sheep. CONCLUSION: We have identified several potentially important genes by bovine cDNA microarray and qRT-PCR analyses that are differentially expressed during the ovine hepatic response to systemic LPS challenge. Their potential role in regulating the inflammatory response to LPS warrants further investigation. 
16940057	 Bacterial genes defining intrinsic resistance to antibiotics encode proteins that can be targeted by antibiotic potentiators. To find such genes, a transposon insertion library of Acinetobacter baylyi was screened with subinhibitory concentrations of various antibiotics to find supersusceptible mutants. A DNA microarray printer was used to replica plate 10,000 individual library clones to  select mutants unable to grow at 1/10 the MICs of 12 different antibiotics. Transposon insertions in 11 genes were found to cause an eightfold or higher hypersusceptibility to at least one antibiotic. Most of the mutants identified exhibited hypersusceptibility to beta-lactam antibiotics. These included mutants  with disruptions of genes encoding proteins involved in efflux (acrB and oprM) as well as genes pertaining to peptidoglycan synthesis and modification (ampD, mpl,  and pbpG). However, disruptions of genes encoding proteins with seemingly unrelated functions (gph, argH, hisF, and ACIAD0795) can also render cells hypersusceptible to beta-lactam antibiotics. A knockout of gshA, involved in glutathione biosynthesis, enhanced the susceptibility to metronidazole, while a knockout of recD, involved in recombination and repair, made the bacteria hypersusceptible to ciprofloxacin. Disruption of acrB in Escherichia coli rendered the cells hypersusceptible to several antibiotics. However, knockout mutants of other homologous genes in E. coli showed no significant changes in antibiotic MICs, indicating that the intrinsic resistance genes are species specific. 
16963574	 We describe the design and evaluate the use of a high-density oligonucleotide microarray covering seven sequenced Escherichia coli genomes in addition to several sequenced E. coli plasmids, bacteriophages, pathogenicity islands, and virulence genes. Its utility is demonstrated for comparative genomic profiling of two unsequenced strains, O175:H16 D1 and O157:H7 3538 (Deltastx(2)::cat) as well  as two well-known control strains, K-12 W3110 and O157:H7 EDL933. By using fluorescently labeled genomic DNA to query the microarrays and subsequently analyze common virulence genes and phage elements and perform whole-genome comparisons, we observed that O175:H16 D1 is a K-12-like strain and confirmed that its phi3538 (Deltastx(2)::cat) phage element originated from the E. coli 3538 (Deltastx(2)::cat) strain, with which it shares a substantial proportion of  phage elements. Moreover, a number of genes involved in DNA transfer and recombination was identified in both new strains, providing a likely explanation  for their capability to transfer phi3538 (Deltastx(2)::cat) between them. Analyses of control samples demonstrated that results using our custom-designed microarray were representative of the true biology, e.g., by confirming the presence of all known chromosomal phage elements as well as 98.8 and 97.7% of queried chromosomal genes for the two control strains. Finally, we demonstrate that use of spatial information, in terms of the physical chromosomal locations of probes, improves the analysis. 
16912041	 Interferon-beta (IFN-beta) has been identified as the signature cytokine induced  via the Toll-like receptor (TLR) 4, "MyD88-independent" signaling pathway in macrophages stimulated by Gram-negative bacterial lipopolysaccharide (LPS). In this study, we analyzed the responses of macrophages derived from wild-type (IFN-beta(+/+)) mice or mice with a targeted mutation in IFN-beta (IFN-beta(-/-)) to the prototype TLR4 agonist, Escherichia coli LPS. A comparison of basal and LPS-induced gene expression (by reverse transcription-PCR, real-time PCR, and Affymetrix microarray analyses) resulted in the identification of four distinct patterns of gene expression affected by IFN-beta deficiency. Analysis of a subset of each group of differentially regulated genes by computer-assisted promoter analysis revealed putative IFN-responsive elements in all genes examined. LPS-induced activation of intracellular signaling molecules, STAT1 Tyr-701, STAT1 Ser-727, and Akt, but not p38, JNK, and ERK MAPK proteins, was significantly diminished in IFN-beta(-/-) versus IFN-beta(+/+) macrophages. "Priming" of IFN-beta(-/-) macrophages with exogenous recombinant IFN-beta significantly increased levels of LPS-induced gene expression for induction of monocyte chemotactic protein 5, inducible nitric-oxide synthase, IP-10, and IL-12 p40 mRNA, whereas no increase or relatively small increases were observed for IL-1beta, IL-6, monocyte chemotactic protein 1, and MyD88 mRNA. Finally, IFN-beta(-/-) mice challenged in vivo with LPS exhibited increased survival when  compared with wild-type IFN-beta(+/+) controls, indicating that IFN-beta contributes to LPS-induced lethality; however, not to the extent that one observes in mice with more complete pathway deficiencies (e.g. TLR4(-/-) or TRIF(-/-) mice). Collectively, these findings reveal unanticipated regulatory roles for IFN-beta in response to LPS in vitro and in vivo. 
17015662	 The expression of many virulence-associated genes in Streptococcus pyogenes is controlled in a growth phase-dependent manner. Unlike the model organisms Escherichia coli and Bacillus subtilis, such regulation is apparently not dependent upon alternative sigma factors but appears to rely on complex interactions among several transcriptional regulators, including Rgg. The purpose of this study was to identify changes in gene expression associated with inactivation of the rgg gene in S. pyogenes strain NZ131 (serotype M49). To this  end, the transcriptomes of wild-type and rgg mutant strains were analyzed during  both the exponential and postexponential phases of growth using Affymetrix NimbleExpress gene chips. Genomewide differences in transcript levels were identified in both phases of growth. Inactivation of rgg disrupted coordinate expression of genes associated with the metabolism of nonglucose carbon sources,  such as fructose, mannose, and sucrose. The changes were associated with an inability of the mutant strain to grow using these compounds as the primary carbon source. Bacteriophage transcript levels were also altered in the mutant strain and were associated with decreased induction of at least one prophage. Finally, transcripts encoding virulence factors involved in cytolysin-mediated translocation of NAD-glycohydrolase, including the immunity factor IFS and the cytolysin (streptolysin O [SLO]), were more abundant in the mutant strain, which  correlated with the amount of NADase and SLO activities in culture supernatant fluids. The results provide further evidence that Rgg contributes to growth phase-dependent gene regulation in strain NZ131. 
16766562	 NetAlign is a web-based tool designed to enable comparative analysis of protein interaction networks (PINs). NetAlign compares a query PIN with a target PIN by combining interaction topology and sequence similarity to identify conserved network substructures (CoNSs), which may derive from a common ancestor and disclose conserved topological organization of interactions in evolution. To exemplify the application of NetAlign, we perform two genome-scale comparisons with (1) the Escherichia coli PIN against the Helicobacter pylori PIN and (2) the Saccharomyces cerevisiae PIN against the Caenorrhabditis elegans PIN. Many of the identified CoNSs correspond to known complexes; therefore, cross-species PIN comparison provides a way for discovery of conserved modules. In addition, based  on the species-to-species differences in CoNSs, we reformulate the problems of protein-protein interaction (PPI) prediction and species divergence from a network perspective.AVAILABILITY: http://www1.ustc.edu.cn/lab/pcrystal/NetAlign. 
16925561	 Clostridium difficile is an emerging nosocomial pathogen of increasing importance and virulence but our ability to study the molecular mechanisms underlying the pathogenesis of C. difficile-associated disease has been limited because of a lack of tools for its genetic manipulation. We have now developed a reproducible  method for the targeted insertional inactivation of chromosomal C. difficile genes. The approach relies on the observation that an Escherichia coli-Clostridium perfringens shuttle vector is unstable in C. difficile and can be used as a form of conditional lethal vector to deliver gene constructs to the  chromosome. We have used this methodology to insertionally inactivate two putative response regulator genes, rgaR and rgbR, which encode proteins with similarity to the toxin gene regulator, VirR, from C. perfringens. Transcriptomic analysis demonstrated that the C. difficile RgaR protein positively regulated four genes, including a putative agrBD operon. The RgaR protein was also purified and shown to bind specifically to sites that contained two consensus VirR boxes located just upstream of the putative promoters of these genes. The development of this methodology will significantly enhance our ability to use molecular approaches to develop a greater understanding of the ability of C. difficile to cause disease. 
16925558	 Enteroaggregative Escherichia coli (EAEC) is defined by aggregative adherence (AA) to HEp-2 cells, where bacteria display adherence to cell surfaces and also to the intervening substratum in a stacked-brick configuration. We previously showed that an AraC homologue designated AggR is required for the expression of plasmid-encoded genes that mediate AA of EAEC strain 042. In this study, we hypothesized that AggR also controls the expression of other virulence determinants in EAEC 042. Using proteomic and microarray analysis, we identified  for the first time that AggR activates the expression of chromosomal genes, including 25 contiguous genes (aaiA-Y), which are localized to a 117 kb pathogenicity island (PAI) inserted at pheU. Many of these genes have homologues  in other Gram-negative bacteria and were recently proposed to constitute a type VI secretion system (T6SS). AaiC was identified as a secreted protein that has no apparent homologues within GenBank. EAEC strains carrying in-frame deletions of aaiB, aaiG, aaiO or aaiP still synthesized AaiC; however, AaiC secretion was abolished. Cloning of aai genes into E. coli HB101 suggested that aaiA-P are sufficient for AaiC secretion. A second T6SS was identified within the pheU PAI that secretes a protein unrelated by sequence identity to AaiC. Distribution studies indicated that aaiA and aaiC are commonly found in EAEC isolates worldwide, particularly in strains defined as typical EAEC. These data support the hypothesis that AggR is a global regulator of EAEC virulence determinants, and builds on the hypothesis that T6SS is an importance mediator of pathogenesis. 
16907975	 BACKGROUND: The highly dimensional data produced by functional genomic (FG) studies makes it difficult to visualize relationships between gene products and experimental conditions (i.e., assays). Although dimensionality reduction methods such as principal component analysis (PCA) have been very useful, their application to identify assay-specific signatures has been limited by the lack of appropriate methodologies. This article proposes a new and powerful PCA-based method for the identification of assay-specific gene signatures in FG studies. RESULTS: The proposed method (PM) is unique for several reasons. First, it is the only one, to our knowledge, that uses gene contribution, a product of the loading and expression level, to obtain assay signatures. The PM develops and exploits two types of assay-specific contribution plots, which are new to the application  of PCA in the FG area. The first type plots the assay-specific gene contribution  against the given order of the genes and reveals variations in distribution between assay-specific gene signatures as well as outliers within assay groups indicating the degree of importance of the most dominant genes. The second type plots the contribution of each gene in ascending or descending order against a constantly increasing index. This type of plots reveals assay-specific gene signatures defined by the inflection points in the curve. In addition, sharp regions within the signature define the genes that contribute the most to the signature. We proposed and used the curvature as an appropriate metric to characterize these sharp regions, thus identifying the subset of genes contributing the most to the signature. Finally, the PM uses the full dataset to  determine the final gene signature, thus eliminating the chance of gene exclusion by poor screening in earlier steps. The strengths of the PM are demonstrated using a simulation study, and two studies of real DNA microarray data--a study of classification of human tissue samples and a study of E. coli cultures with different medium formulations. CONCLUSION: We have developed a PCA-based method that effectively identifies assay-specific signatures in ranked groups of genes from the full data set in a more efficient and simplistic procedure than current approaches. Although this work demonstrates the ability of the PM to identify assay-specific signatures in  DNA microarray experiments, this approach could be useful in areas such as proteomics and metabolomics. 
16861666	 The mucosa-associated microflora is increasingly considered to play a pivotal role in the pathogenesis of inflammatory bowel disease. This study explored the possibility that an abnormal mucosal flora is involved in the etiopathogenesis of granulomatous colitis of Boxer dogs (GCB). Colonic biopsy samples from affected dogs (n = 13) and controls (n = 38) were examined by fluorescent in situ hybridization (FISH) with a eubacterial 16S rRNA probe. Culture, 16S ribosomal DNA sequencing, and histochemistry were used to guide subsequent FISH. GCB-associated Escherichia coli isolates were evaluated for their ability to invade and persist in cultured epithelial cells and macrophages as well as for serotype, phylogenetic group, genome size, overall genotype, and presence of virulence genes. Intramucosal gram-negative coccobacilli were present in 100% of  GCB samples but not controls. Invasive bacteria hybridized with FISH probes to E. coli. Three of four GCB-associated E. coli isolates adhered to, invaded, and replicated within cultured epithelial cells. Invasion triggered a "splash"-type response, was decreased by cytochalasin D, genistein, colchicine, and wortmannin, and paralleled the behavior of the Crohn's disease-associated strain E. coli LF 82. GCB E. coli and LF 82 were diverse in serotype and overall genotype but similar in phylogeny (B2 and D), in virulence gene profiles (fyuA, irp1, irp2, chuA, fepC, ibeA, kpsMII, iss), in having a larger genome size than commensal E.  coli, and in the presence of novel multilocus sequence types. We conclude that GCB is associated with selective intramucosal colonization by E. coli. E. coli strains associated with GCB and Crohn's disease have an adherent and invasive phenotype and novel multilocus sequence types and resemble E. coli associated with extraintestinal disease in phylogeny and virulence gene profile. 
16825354	 Bloodstream infections are potentially life-threatening and require rapid identification and antibiotic susceptibility testing of the causative pathogen in order to facilitate specific antimicrobial therapy. We developed a prototype DNA  microarray for the identification and characterization of three important bacteremia-causing species: Staphylococcus aureus, Escherichia coli, and Pseudomonas aeruginosa. The array consisted of 120 species-specific gene probes 200 to 800 bp in length that were amplified from recombinant plasmids. These probes represented genes encoding housekeeping proteins, virulence factors, and antibiotic resistance determinants. Evaluation with 42 clinical isolates, 3 reference strains, and 13 positive blood cultures revealed that the DNA microarray was highly specific in identifying S. aureus, E. coli, and P. aeruginosa strains and in discriminating them from closely related gram-positive  and gram-negative bacterial strains also known to be etiological agents of bacteremia. We found a nearly perfect correlation between phenotypic antibiotic resistance determined by conventional susceptibility testing and genotypic antibiotic resistance by hybridization to the S. aureus resistance gene probes mecA (oxacillin-methicillin resistance), aacA-aphD (gentamicin resistance), ermA  (erythromycin resistance), and blaZ (penicillin resistance) and the E. coli resistance gene probes blaTEM-106 (penicillin resistance) and aacC2 (aminoglycoside resistance). Furthermore, antibiotic resistance and virulence gene probes permitted genotypic discrimination within a species. This novel DNA microarray demonstrates the feasibility of simultaneously identifying and characterizing bacteria in blood cultures without prior amplification of target DNA or preidentification of the pathogen. 
16804593	 Optimal detection of a pathogen present in biological samples depends on the ability to extract DNA molecules rapidly and efficiently. In this paper, we report a novel method for efficient DNA extraction and subsequent real-time detection in a single microchip by combining laser irradiation and magnetic beads. By using a 808 nm laser and carboxyl-terminated magnetic beads, we demonstrate that a single pulse of 40 seconds lysed pathogens including E. coli and Gram-positive bacterial cells as well as the hepatitis B virus mixed with human serum. We further demonstrate that the real-time pathogen detection was performed with pre-mixed PCR reagents in a real-time PCR machine using the same microchip, after laser irradiation in a hand-held device equipped with a small laser diode. These results suggest that the new sample preparation method is well suited to be integrated into lab-on-a-chip application of the pathogen detection  system. 
16705313	 Overexpression of the transcriptional activator beta-catenin, mostly owing to loss-of-function mutations of the adenomatous polyposis coli (APC) tumour suppressor gene, is crucial for the initiation and progression of human colorectal carcinogenesis. Securin is a regulator of chromosome separation and its overexpression has been shown to be involved in different tumour-promoting processes, like transformation, hyperproliferation and angiogenesis, and correlates with tumour cell invasion. However, the molecular mechanism leading to securin overexpression in human colorectal cancer is unknown. Here we show a correlated high expression of beta-catenin and securin (hPTTG1) in colorectal adenomas and carcinomas and further demonstrate that securin is a target of beta-catenin transcriptional activation. This implies that deregulation of the beta-catenin/T-cell factor-signalling pathway leads to overexpression of securin  in human colorectal cancer, which subsequently may contribute to tumour progression. 
16749936	 BACKGROUND: The learning of global genetic regulatory networks from expression data is a severely under-constrained problem that is aided by reducing the dimensionality of the search space by means of clustering genes into putatively co-regulated groups, as opposed to those that are simply co-expressed. Be cause genes may be co-regulated only across a subset of all observed experimental conditions, biclustering (clustering of genes and conditions) is more appropriate than standard clustering. Co-regulated genes are also often functionally (physically, spatially, genetically, and/or evolutionarily) associated, and such  a priori known or pre-computed associations can provide support for appropriately grouping genes. One important association is the presence of one or more common cis-regulatory motifs. In organisms where these motifs are not known, their de novo detection, integrated into the clustering algorithm, can help to guide the process towards more biologically parsimonious solutions. RESULTS: We have developed an algorithm, cMonkey, that detects putative co-regulated gene groupings by integrating the biclustering of gene expression data and various functional associations with the de novo detection of sequence motifs. CONCLUSION: We have applied this procedure to the archaeon Halobacterium NRC-1, as part of our efforts to decipher its regulatory network. In addition, we used cMonkey on public data for three organisms in the other two domains of life: Helicobacter pylori, Saccharomyces cerevisiae, and Escherichia coli. The biclusters detected by cMonkey both recapitulated known biology and enabled novel predictions (some for Halobacterium were subsequently confirmed in the laboratory). For example, it identified the bacteriorhodopsin regulon, assigned additional genes to this regulon with apparently unrelated function, and detected its known promoter motif. We have performed a thorough comparison of cMonkey results against other clustering methods, and find that cMonkey biclusters are more parsimonious with all available evidence for co-regulation. 
16751532	 Escherichia coli is generally described as a commensal species with occasional pathogenic strains. Due to technological limitations, there is currently little information concerning the prevalence of pathogenic E. coli strains in the environment. For the first time, using a DNA microarray capable of detecting all  currently described virulence genes and commonly found antimicrobial resistance genes, a survey of environmental E. coli isolates from recreational waters was carried out. A high proportion (29%) of 308 isolates from a beach site in the Great Lakes carried a pathotype set of virulence-related genes, and 14% carried antimicrobial resistance genes, findings consistent with a potential risk for public health. The results also showed that another 8% of the isolates had unusual virulence gene combinations that would be missed by conventional screening. This new application of a DNA microarray to environmental waters will  likely have an important impact on public health, epidemiology, and microbial ecology in the future. 
16714589	 Urinary tract infections (UTIs) are an important health problem worldwide, with many million cases each year. Escherichia coli is the most common organism causing UTIs in humans. The asymptomatic bacteriuria E. coli strain 83972 is an excellent colonizer of the human urinary tract, where it causes long-term bladder colonization. The strain has been used for prophylactic purposes in patients prone to more severe and recurrent UTIs. For this study, we used DNA microarrays  to monitor the expression profile of strain 83972 in the human urinary tract. Significant differences in expression levels were seen between the in vivo expression profiles of strain 83972 in three patients and the corresponding in vitro expression profiles in lab medium and human urine. The data revealed an in  vivo lifestyle of microaerobic growth with respiration of nitrate coupled to degradation of sugar acids and amino acids, with no signs of attachment to host tissues. Interestingly, genes involved in NO protection and metabolism showed significant up-regulation in the patients. This is one of the first studies to address bacterial whole-genome expression in humans and the first study to investigate global gene expression of an E. coli strain in the human urinary tract. 
16239042	 As a first step toward building a comprehensive microarray, two low density DNA microarrays were constructed and evaluated for the accurate detection of wastewater pathogens. The first one involved the direct hybridization of wastewater microbial genomic DNA to the functional gene probes while the second involved PCR amplification of 23S ribosomal DNA. The genomic DNA microarray employed 10 functional genes as detection targets. Sensitivity of the microarray  was determined to be approximately 1.0 microg of Esherichia coli genomic DNA, or  2 x 10(8) copies of the target gene, and only E. coli DNA was detected with the microarray assay using municipal raw sewage. Sensitivity of the microarray was enhanced approximately by 6 orders of magnitude when the target 23S rRNA gene sequences were PCR amplified with a novel universal primer set and allowed hybridization to 24 species-specific oligonucleotide probes. The minimum detection limit was estimated to be about 100 fg of E. coli genomic DNA or 1.4 x  10(2) copies of the 23S rRNA gene. The PCR amplified DNA microarray successfully  detected multiple bacterial pathogens in wastewater. As a parallel study to verify efficiency of the DNA microarray, a real-time quantitative PCR assay was also developed based on the fluorescent TaqMan probes (Applied Biosystems). 
16735742	 Escherichia coli is the most common organism associated with asymptomatic bacteriuria (ABU). In contrast to uropathogenic E. coli (UPEC), which causes symptomatic urinary tract infection (UTI), very little is known about the mechanisms by which these strains colonize the urinary tract. Bacterial adhesion  conferred by specific surface-associated adhesins is normally considered as a prerequisite for colonization of the urinary tract. The prototype ABU E. coli strain 83972 was originally isolated from a girl who had carried it asymptomatically for 3 years. This study characterized the molecular status of one of the primary adhesion factors known to be associated with UTI, namely F1C fimbriae, encoded by the foc gene cluster. F1C fimbriae recognize receptors present in the human kidney and bladder. Expression of the foc genes was found to be up-regulated in human urine. It was also shown that although strain 83972 contains a seemingly intact foc gene cluster, F1C fimbriae are not expressed. Sequencing and genetic complementation revealed that the focD gene, encoding a component of the F1C transport and assembly system, was non-functional, explaining the inability of strain 83972 to express this adhesin. The data imply  that E. coli 83972 has lost its ability to express this important colonization factor as a result of host-driven evolution. The ancestor of the strain seems to  have been a pyelonephritis strain of phylogenetic group B2. Strain 83972 therefore represents an example of bacterial adaptation from pathogenicity to commensalism through virulence factor loss. 
16537102	 DNA microarrays were developed for rapid identification of different serogroups of Escherichia coli in a single platform. Oligonucleotides, as well as PCR products from genes in the O antigen gene clusters of E. coli serogroups O7, O104, O111, and O157 were spotted onto glass slides. This was followed by hybridization with labeled long PCR products of the entire O antigen gene clusters of these serogroups. Results demonstrated that microarrays consisting of either oligonucleotides or PCR products generated specific signals for each serogroup. This is the first report describing the development of model DNA microarrays for determining the serogroup of E. coli strains. 
16707426	 Antithrombin, a serpin family protease inhibitor crucial to hemostasis, acquires  antiangiogenic properties on undergoing conformational alterations induced by limited proteolysis or elevated temperature. To better understand the biochemical mechanisms underlying antithrombin antiangiogenic activity, we did genome-wide expression profiling, coupled with quantitative reverse transcription-PCR, Northern blot, and Western blot analyses, to characterize the gene expression patterns that are induced by antiangiogenic antithrombin in cultured primary human umbilical vein endothelial cells. Overall, 35 genes with significantly increased expression and 93 genes with significantly reduced expression (> or =2-fold changes) due to antiangiogenic antithrombin treatment were identified. More than half of the down-regulated genes have well-established proangiogenic functions in endothelial cells, including cell-surface and matrix proteoglycans (e.g., perlecan, biglycan, and syndecans 1 and 3) and mitogenesis-related signaling proteins (e.g., mitogen-activated protein kinase 3, signal transducers  and activators of transcription 2, 3, and 6, and early growth response factor 1). In contrast, most up-regulated genes (e.g., caspase-3, p21, tissue inhibitor of metalloproteinases 1, 2, and 3, and adenomatosis polyposis coli) are known for their antiangiogenic functions which include the promotion of cell apoptosis and  cell cycle arrest and the inhibition of tumor growth and metastasis. These results show that the antiangiogenic activity of antithrombin is mediated at least in part by a global genetic reprogramming of endothelial cells and strongly implicate an endothelial cell ligand-receptor signaling mechanism in this reprogramming. 
16672535	 An oligonucleotide microarray detecting 189 Escherichia coli virulence genes or markers and 30 antimicrobial resistance genes was designed and validated using DNA from known reference strains. This microarray was confirmed to be a powerful  diagnostic tool for monitoring emerging E. coli pathotypes and antimicrobial resistance, as well as for environmental, epidemiological, and phylogenetic studies including the evaluation of genome plasticity. 
16597882	 To accurately determine the pathotypes of Escherichia coli strains, a comprehensive assessment of each strain that targets multiple genes is required.  A new approach to the identification and characterization of E. coli pathotypes was developed by constructing gene-specific probes (70-mers) for not only the virulence genes associated with each E. coli pathotype but also the O157-, CFT073-, and K-12-specific and common genes of each pathotype. Analysis of oligonucleotide probes with reference and clinical isolates of E. coli pathotypes indicated that the array could differentiate the pathotypes on the basis of their virulence and specific gene patterns. Probes targeting common genes of E. coli were present in all the reference and clinical strains. Salmonella enterica subsp. enterica-specific genes and Salmonella core genes were used as negative controls. The entire E. coli pathotype showed reactivity to only 4 of the 81 Salmonella-specific gene probes. Characterization of the genetic and virulence profiles of a single strain by using probes for virulence factors and specific and common genes in the spotted array is an ideal diagnostic tool for determination of E. coli pathotypes and could also have a significant impact on the epidemiological analysis of E. coli infections. 
16723004	 BACKGROUND: As a variety of functional genomic and proteomic techniques become available, there is an increasing need for functional analysis methodologies that integrate heterogeneous data sources. METHODS: In this paper, we address this issue by proposing a general framework for gene function prediction based on the k-nearest-neighbor (KNN) algorithm. The choice of KNN is motivated by its simplicity, flexibility to incorporate different data types and adaptability to irregular feature spaces. A weakness of  traditional KNN methods, especially when handling heterogeneous data, is that performance is subject to the often ad hoc choice of similarity metric. To address this weakness, we apply regression methods to infer a similarity metric as a weighted combination of a set of base similarity measures, which helps to locate the neighbors that are most likely to be in the same class as the target gene. We also suggest a novel voting scheme to generate confidence scores that estimate the accuracy of predictions. The method gracefully extends to multi-way  classification problems. RESULTS: We apply this technique to gene function prediction according to three well-known Escherichia coli classification schemes suggested by biologists, using information derived from microarray and genome sequencing data. We demonstrate that our algorithm dramatically outperforms the naive KNN methods and is competitive with support vector machine (SVM) algorithms for integrating heterogenous data. We also show that by combining different data sources, prediction accuracy can improve significantly CONCLUSION: Our extension of KNN with automatic feature weighting, multi-class prediction, and probabilistic inference, enhance prediction accuracy significantly while remaining efficient, intuitive and flexible. This general framework can also be applied to similar classification problems involving heterogeneous datasets. 
16403793	 MOTIVATION: In a gene regulatory network, genes are typically regulated by transcription factors (TFs). Transcription factor activity (TFA) is more difficult to measure than gene expression levels are. Other models have extracted information about TFA from gene expression data, but without explicitly modeling  feedback from the genes. We present a state-space model (SSM) with hidden variables. The hidden variables include regulatory motifs in the gene network, such as feedback loops and auto-regulation, making SSM a useful complement to existing models. RESULTS: A gene regulatory network incorporating, for example, feed-forward loops, auto-regulation and multiple-inputs was constructed with an SSM model. First, the gene expression data were simulated by SSM and used to infer the TFAs. The ability of SSM to infer TFAs was evaluated by comparing the profiles of the inferred and simulated TFAs. Second, SSM was applied to gene expression data obtained from Escherichia coli K12 undergoing a carbon source transition and from the Saccharomyces cerevisiae cell cycle. The inferred activity profile for each TF was validated either by measurement or by activity information from the literature. The SSM model provides a probabilistic framework to simulate gene regulatory networks and to infer activity profiles of hidden variables. AVAILABILITY: Supplementary data and Matlab code will be made available at the URL below. SUPPLEMENTARY INFORMATION: http://www.chems.msu.edu/groups/chan/ssm.zip. 
16368767	 MOTIVATION: In systems like Escherichia Coli, the abundance of sequence information, gene expression array studies and small scale experiments allows one to reconstruct the regulatory network and to quantify the effects of transcription factors on gene expression. However, this goal can only be achieved if all information sources are used in concert. RESULTS: Our method integrates literature information, DNA sequences and expression arrays. A set of relevant transcription factors is defined on the basis of literature. Sequence data are used to identify potential target genes and the results are used to define a prior distribution on the topology of the regulatory network. A Bayesian hidden component model for the expression array data allows us to identify which of the potential binding sites are actually used by the regulatory proteins in the studied cell conditions, the strength of their  control, and their activation profile in a series of experiments. We apply our methodology to 35 expression studies in E.Coli with convincing results. AVAILABILITY: www.genetics.ucla.edu/labs/sabatti/software.html SUPPLEMENTARY INFORMATION: The supplementary material are available at Bioinformatics online. 
16386323	 Rapid identification of the genus and species of bacteria in foods and clinical specimens is important. In this report, DNA sequences of bacterial 16S rDNA were  used to develop the oligonucleotide array for the identification of bacterial strains of Bacillus spp., Escherichia coli, Salmonella spp., Staphylococcus spp.  and Vibrio spp. Most of these bacterial strains may cause food-borne outbreaks or sporadic cases. A rapid (<4 h) detection method that used universal PCR primers to amplify the variable regions of bacterial 16S rDNA, followed by reverse hybridization of the PCR products, which were biotin labeled, to the oligonucleotides arrayed on the chip was developed. Fifteen oligonucleotide probes were selected and spotted on the nylon strip to determine the array hybridization patterns. It was successful in discriminating Bacillus spp., E. coli, Salmonella spp., Staphylococcus spp. and Vibrio spp. with identification, in general, to the genus level, not species level. As 182 randomly selected strains were assayed, the detection rate was found higher than 98%. Except for 3  strains, the remaining 179 strains were correctly identified and no cross reactions were observed. These 179 strains generated five hybridization patterns. Adding more oligonucleotide probes to the array may allow the detection of more bacterial genera and species without significantly increasing the complexity or cost. 
16766508	 Escherichia coli O157, an etiological agent of hemorrhagic colitis and hemolytic  uremic syndrome, is one of the leading worldwide public health threats. Genome sequencing of two O157 strains have revealed that the chromosome is comprised of  a 4.1 Mb backbone shared by K-12 and a total of 1.4 Mb O157-specific sequences. Most of the large O157-specific sequences are prophages and prophage-like elements, which have carried many virulence genes into the O157 genome. This suggests that bacteriophages have played the key roles in the emergence of O157.  The Whole Genome PCR Scanning (WGPScanning) analysis of O157 strains, on the other hand, revealed a high level of genomic diversity in O157. Variation of prophages has also been suggested as a major factor generating such diversity. In this study, we analyzed the gene content of O157 strains, by an oligoDNA microarray, using the same set of strains as examined by the WGPScanning method.  Although most of the strains were typical O157 : H7, they differed remarkably in  gene composition, particularly in those on prophages, and we identified more than 400 'variably absent or present' genes which included virulence-related genes. This confirms the role of prophages in generating the genomic diversity, and raises a possibility that some level of variation in potential virulence is present among O157 strains. Fine comparison of the two datasets obtained by microarray and WGPScanning provided much further details on the O157 genome diversity than illustrated by each method alone, indicating the usefulness of this combinational approach in the genomic comparison of closely related strains. 
16417522	 Exposure of Escherichia coli to nitric oxide (NO) or nitrosating agents causes significant changes in patterns of gene expression. Three recent studies have used microarrays to analyse the response of the E. coli transcriptome to NO and nitrosative stress. Drawing on the array data, I review our current understanding of the E. coli regulatory systems that are involved. 
16452189	 Wnt signaling plays a key role in development and adult tissues via effects on cell proliferation, motility, and differentiation. The cellular response to Wnt ligands largely depends on their ability to stabilize beta-catenin and the ability of beta-catenin to bind and activate T-cell factor (TCF) transcription factors. Roughly 40% of ovarian endometrioid adenocarcinomas (OEA) have constitutive activation of Wnt signaling as a result of oncogenic mutations in the beta-catenin protein or inactivating mutations in key negative regulators of  beta-catenin, such as the adenomatous polyposis coli and Axin tumor suppressor proteins. We used oligonucleotide microarrays to identify genes of which expression was activated in OEAs with beta-catenin dysregulation compared with OEAs lacking Wnt/beta-catenin pathway defects. Using microarray and quantitative  PCR-based approaches, we found that fibroblast growth factor (FGF9) expression was increased >6-fold in primary OEAs with Wnt/beta-catenin pathway defects compared with OEAs lacking such defects. Evidence that beta-catenin and TCFs regulate FGF9 expression in several epithelial cell lines was obtained. We found  FGF9 was mitogenic for epithelial cells and fibroblasts and FGF9 could stimulate  invasion of epithelial and endothelial cells through Matrigel in transwell assays. Furthermore, FGF9 could promote neoplastic transformation of the E1A-immortalized RK3E epithelial cell line, and short hairpin RNA-mediated inhibition of endogenous FGF9 expression in the OEA cell line TOV112D, which carries a beta-catenin mutation, inhibited neoplastic growth properties of the cells. Our findings support the notion that FGF9 is a key factor contributing to  the cancer phenotype of OEAs carrying Wnt/beta-catenin pathway defects. 
16384888	 BACKGROUND: Shiga toxin-producing Escherichia coli (STEC) and enteropathogenic E. coli (EPEC) are important emerging pathogens that can cause a severe and sometimes fatal illness. Differentiation of eae, tir, espA, espD, and espB gene variants of the locus of enterocyte effacement (LEE) pathogenicity island represents an important tool for typing in routine diagnostics as well as in pathogenesis, epidemiologic, clonal, and immunologic studies. METHODS: Type-specific oligonucleotide microarrays and a PCR scheme were designed and constructed for the detection and typing of genetic variants of the LEE genes. Oligonucleotide probes were tested for their specificity against the corresponding type strain by microarray hybridization using fluorescent DNA, either PCR-amplified (single, multiplex, long-range), chromosomal, or amplified chromosomal DNA. RESULTS: The PCR scheme and the oligonucleotide microarray allowed us to distinguish 16 variants (alpha1, alpha2, beta1, beta2, gamma1, gamma2/theta, delta/kappa, epsilon, zeta, eta, iota, lambda, mu, nu, xi, omicron) of the eae gene, 4 variants (alpha1, beta1, gamma1, gamma2/theta) of the tir gene, 4 variants (alpha1, beta1, beta2, gamma1) of the espA gene, 3 variants (alpha1, beta1, gamma1) of the espB gene, and 3 variants (alpha1, beta1, gamma1) of the espD gene. We found a total of 12 different combinations of tir, espA, espB, and  espD genes among the 25 typed strains. CONCLUSIONS: The PCR scheme and the oligonucleotide microarray described are effective tools to rapidly screen multiple virulence genes and their variants in  E. coli strains isolated from human and animal infections. The results demonstrate the great genetic diversity among LEE genes of human and animal STEC  and EPEC strains. 
16409635	 BACKGROUND: Clustering of gene expression patterns is a well-studied technique for elucidating trends across large numbers of transcripts and for identifying likely co-regulated genes. Even the best clustering methods, however, are unlikely to provide meaningful results if too much of the data is unreliable. With the maturation of microarray technology, a wealth of research on statistical analysis of gene expression data has encouraged researchers to consider error and uncertainty in their microarray experiments, so that experiments are being performed increasingly with repeat spots per gene per chip and with repeat experiments. One of the challenges is to incorporate the measurement error information into downstream analyses of gene expression data, such as traditional clustering techniques. RESULTS: In this study, a clustering approach is presented which incorporates both gene expression values and error information about the expression measurements. Using repeat expression measurements, the error of each gene expression measurement in each experiment condition is estimated, and this measurement error information is incorporated directly into the clustering algorithm. The algorithm, CORE (Clustering Of Repeat Expression data), is presented and its performance is validated using statistical measures. By using error information about gene expression measurements, the clustering approach is  less sensitive to noise in the underlying data and it is able to achieve more accurate clusterings. Results are described for both synthetic expression data as well as real gene expression data from Escherichia coli and Saccharomyces cerevisiae. CONCLUSION: The additional information provided by replicate gene expression measurements is a valuable asset in effective clustering. Gene expression profiles with high errors, as determined from repeat measurements, may be unreliable and may associate with different clusters, whereas gene expression profiles with low errors can be clustered with higher specificity. Results indicate that including error information from repeat gene expression measurements can lead to significant improvements in clustering accuracy. 
16749941	 BACKGROUND: Recent studies have shown that microarray-derived gene-expression data are useful for operon prediction. However, it is apparent that genes within  an operon do not conform to the simple notion that they have equal levels of expression. RESULTS: To investigate the relative transcript levels of intra-operonic genes, we have used a Z-score approach to normalize the expression levels of all genes within an operon to expression of the first gene of that operon. Here we demonstrate that there is a general downward trend in expression from the first to the last gene in Streptomyces coelicolor operons, in contrast to what we observe in Escherichia coli. Combining transcription-factor binding-site prediction with the identification of operonic genes that exhibited higher transcript levels than the first gene of the same operon enabled the discovery of putative internal promoters. The presence of transcription terminators and abundance of putative transcriptional control sequences in S. coelicolor operons  are also described. CONCLUSION: Here we have demonstrated a polarity of expression in operons of S. coelicolor not seen in E. coli, bringing caution to those that apply operon prediction strategies based on E. coli 'equal-expression' to divergent species. We speculate that this general difference in transcription behavior could reflect the contrasting lifestyles of the two organisms and, in the case of Streptomyces, might also be influenced by its high G+C content genome. Identification of putative internal promoters, previously thought to cause problems in operon prediction strategies, has also been enabled. 
16369018	 Escherichia coli is the most common organism associated with asymptomatic bacteriuria (ABU). In contrast to uropathogenic E. coli (UPEC), which causes symptomatic urinary tract infections (UTI), very little is known about the mechanisms by which these strains colonize the human urinary tract. The prototype ABU E. coli strain 83972 was originally isolated from a girl who had carried it asymptomatically for 3 years. Deliberate colonization of UTI-susceptible individuals with E. coli 83972 has been used successfully as an alternative approach for the treatment of patients who are refractory to conventional therapy. Colonization with strain 83972 appears to prevent infection with UPEC strains in such patients despite the fact that this strain is unable to express the primary adhesins involved in UTI, viz. P and type 1 fimbriae. Here we investigated the growth characteristics of E. coli 83972 in human urine and show  that it can outcompete a representative spectrum of UPEC strains for growth in urine. The unique ability of ABU E. coli 83972 to outcompete UPEC in urine was also demonstrated in a murine model of human UTI, confirming the selective advantage over UPEC in vivo. Comparison of global gene expression profiles of E.  coli 83972 grown in lab medium and human urine revealed significant differences in expression levels in the two media; significant down-regulation of genes encoding virulence factors such as hemolysin, lipid A, and capsular polysaccharides was observed in cells grown in urine. Clearly, divergent abilities of ABU E. coli and UPEC to exploit human urine as a niche for persistence and survival suggest that these key differences may be exploited for  preventative and/or therapeutic approaches. 
16405681	 AIMS: To compare genetic composition of plasmids using microarrays composed of randomly selected fragments of plasmid DNA. METHODS AND RESULTS: Separate shotgun libraries were constructed from plasmid DNA pooled from Escherichia coli and Salmonella enterica. Cloned fragments were used  as probes for microarrays. Plasmid targets were labelled, hybridized overnight, and bound targets were imaged after enzymatic signal amplification. Control hybridizations demonstrated significantly higher signal when probes and targets shared >95% sequence identity. Diagnostic sensitivity and specificity of the assay was 95 and 99%, respectively. Cluster analysis showed close matches for replicate experiments with a high correlation between replicates (r = 0.91) compared with the correlation for nonreplicates (r = 0.09). Analysis of hybridization data from 43 plasmids generated five distinct clusters, two for known serovar-specific plasmids, one for enterohemorrhagic E. coli plasmids, and  two for plasmids harboring a recently disseminated antibiotic resistance gene (bla(CMY-2)). CONCLUSION: Mixed-plasmid microarrays are suitable for comparing genetic content  of wild-type plasmids and hybridization results from this study suggest several novel hypotheses about plasmid gene exchange between E. coli and S. enterica. SIGNIFICANCE AND IMPACT OF STUDY: Mixed-plasmid microarrays permit rapid, low cost analysis and comparison of many plasmids. This ability is critical to understanding the source, fate, and transport of plasmids amongst commensal and pathogenic bacteria. 
16390449	 The transcriptional regulation of membrane fatty acid composition in the human pathogen Streptococcus pneumoniae is distinct from the systems utilized in the model organisms Escherichia coli and Bacillus subtilis. The genes encoding the components of type II fatty acid biosynthesis cluster at a single location within the S. pneumoniae genome, and the second gene in this cluster (SPR0376) encodes a transcription factor (FabT) that belongs to the MarR superfamily. Derivatives of  S. pneumoniae strain D39 were constructed that lacked functional FabT. This strain had significantly elevated levels of saturated fatty acids and longer chain lengths than the control strain, was unable to grow at pH 5.5 and had increased sensitivity to detergent. Eliminating FabT function increased the expression levels of all of fab genes with the notable exception of fabM. FabT was purified and bound to the DNA palindrome located within the promoter regions  of the fabT and fabK genes within the cluster. The analysis of cells with increased expression of individual genes leads to a model where the physical properties of the S. pneumoniae membrane is controlled primarily by the activity  of FabK, the enoyl reductase, which diverts intermediates to saturated fatty acid formation, in contrast to E. coli where FabB, an elongation condensing enzyme, pulls the pathway in the direction of unsaturated acid synthesis. 
16390447	 In this paper the essential GTPase YlqF is shown to participate in the biogenesis of the 50S ribosomal subunit in Bacillus subtilis. Cells depleted of YlqF displayed gene expression profiles and nucleoid morphologies that were consistent with a function for YlqF in translation. In addition, YlqF is evolutionarily linked to two eukaryotic GTPases, Nog2p and Nug1p, that are involved in the biogenesis and the nuclear export of the 60S ribosomal subunit. Analysis of ribosomes from cells depleted of YlqF demonstrated that the formation of 70S ribosomes was greatly reduced and the large subunit sedimented at 45S. Cells grown with varying depleted levels of YlqF, yielding doubling times ranging from  38 min to 150 min, all displayed the 45S intermediate. Purified YlqF-His(6) protein associates with the 45S intermediate, but not the mature 50S subunit in vitro. Analysis of proteins from the 45S intermediate indicated that ribosomal protein L16, which is added late during in vitro Escherichia coli 50S ribosome biogenesis, was missing from the 45S intermediate. These results support a model  in which YlqF participates in the formation of active 70S ribosomes in the cell by functioning in a late step of 50S subunit biogenesis. Based on these results we propose to rename the ylqF gene rbgA (ribosome biogenesis GTPase A). 
17000638	 Miniaturized integrated DNA analysis systems have largely been based on a multi-chamber design with microfluidic control to process the sample sequentially from one module to another. This microchip design in connection with optics involved hinders the deployment of this technology for point-of-care applications. In this work, we demonstrate the implementation of sample preparation, DNA amplification, and electrochemical detection in a single silicon and glass-based microchamber and its application for the multiplexed detection of Escherichia coli and Bacillus subtilis cells. The microdevice has a thin-film heater and temperature sensor patterned on the silicon substrate. An array of indium tin oxide (ITO) electrodes was constructed within the microchamber as the  transduction element. Oligonucleotide probes specific to the target amplicons are individually positioned at each ITO surface by electrochemical copolymerization of pyrrole and pyrrole-probe conjugate. These immobilized probes were stable to the thermal cycling process and were highly selective. The DNA-based identification of the two model pathogens involved a number of steps including a  thermal lysis step, magnetic particle-based isolation of the target genomes, asymmetric PCR, and electrochemical sequence-specific detection using silver-enhanced gold nanoparticles. The microchamber platform described here offers a cost-effective and sample-to-answer technology for on-site monitoring of multiple pathogens. 
16357206	 A principal aim of systems biology is to develop in silico models of whole cells  or cellular processes that explain and predict observable cellular phenotypes. Here, we use a model of a genome-scale reconstruction of the integrated metabolic and transcriptional regulatory networks for Escherichia coli, composed of 1,010 gene products, to assess the properties of all functional states computed in 15,580 different growth environments. The set of all functional states of the integrated network exhibits a discernable structure that can be visualized in 3-dimensional space, showing that the transcriptional regulatory network governing metabolism in E. coli responds primarily to the available electron acceptor and the presence of glucose as the carbon source. This result is consistent with recently published experimental data. The observation that a complex network composed of 1,010 genes is organized to achieve few dominant modes demonstrates the utility of the systems approach for consolidating large amounts of genome-scale molecular information about a genome and its regulation to elucidate an organism's preferred environments and functional capabilities. 
16332846	 A small-oligonucleotide microarray prototype was designed with probes specific for the universal 16S rRNA and cpn60 genes of several pathogens that are usually  encountered in wastewaters. In addition to these two targets, wecE-specific oligonucleotide probes were included in the microarray to enhance its discriminating power within the Enterobacteriaceae family. Universal PCR primers  were used to amplify variable regions of 16S rRNA, cpn60, and wecE genes directly in Escherichia coli and Salmonella enterica serovar Typhimurium genomic DNA mixtures (binary); E. coli, S. enterica serovar Typhimurium, and Yersinia enterocolitica genomic DNA mixtures (ternary); or wastewater total DNA. Amplified products were fluorescently labeled and hybridized on the prototype chip. The detection sensitivity for S. enterica serovar Typhimurium was estimated to be on  the order of 0.1% (10(4) S. enterica genomes) of the total DNA for the combination of PCR followed by microarray hybridization. The sensitivity of the prototype could be increased by hybridizing amplicons generated by PCR targeting  genes specific for a bacterial subgroup, such as wecE genes, instead of universal taxonomic amplicons. However, there was evidence of PCR bias affecting the detection limits of a given pathogen as increasing amounts of a different pathogen were spiked into the test samples. These results demonstrate the feasibility of using DNA microarrays in the detection of waterborne pathogens within mixed populations but also raise the problem of PCR bias in such experiments. 
16243450	 A DNA microarray was used to analyze the distribution of plasmid and chromosomal  genes among strains of enteroaggregative Escherichia coli (EAEC) isolated from a  prospective diarrhoea surveillance study in the United Kingdom. Target genes were extracted from existing databases and from the genome sequence of prototype EAEC  strain 042. We found that strains exhibiting the aggregative adherence (AA) phenotype could be broadly divided into two groups depending upon whether they harboured genes from the EAEC virulence plasmid (pAA) and a set of chromosomal genes found in EAEC strain 042. Several chromosomal loci were inherited en bloc,  and were more common in strains which we designated Group 1; genes at the pheU locus were particularly conserved. Genes encoded on the pAA plasmid and those under control of the master regulator AggR were also concentrated in the Group 1  EAEC. A gene encoding a type 1 pilin allele was detected more frequently in Group 2 EAEC. Our data suggest that strains previously designated as typical EAEC harbour a large number of conserved plasmid and chromosomal loci, further illuminating a package of virulence genes common to the most important EAEC. 
16299280	 We have performed microarray hybridization studies on 40 clinical isolates from 12 common serovars within Salmonella enterica subspecies I to identify the conserved chromosomal gene pool. We were able to separate the core invariant portion of the genome by a novel mathematical approach using a decision tree based on genes ranked by increasing variance. All genes within the core component were confirmed using available sequence and microarray information for S. enterica subspecies I strains. The majority of genes within the core component had conserved homologues in Escherichia coli K-12 strain MG1655. However, many genes present in the conserved set which were absent or highly divergent in K-12  had close homologues in pathogenic bacteria such as Shigella flexneri and Pseudomonas aeruginosa. Genes within previously established virulence determinants such as SPI1 to SPI5 were conserved. In addition several genes within SPI6, all of SPI9, and three fimbrial operons (fim, bcf, and stb) were conserved within all S. enterica strains included in this study. Although many phage and insertion sequence elements were missing from the core component, approximately half the pseudogenes present in S. enterica serovar Typhi were conserved. Furthermore, approximately half the genes conserved in the core set encoded hypothetical proteins. Separation of the core and variant gene sets within S.enterica subspecies I has offered fundamental biological insight into the genetic basis of phenotypic similarity and diversity across S. enterica subspecies I and shown how the core genome of these pathogens differs from the closely related E. coli K-12 laboratory strain. 
16207244	 Enteroaggregative Escherichia coli (EAEC) causes watery diarrhoea that is often mildly inflammatory. Previous studies have reported that the flagellin of EAEC induces IL-8 from intestinal epithelial cells (IECs) in culture. To characterize  more fully the inflammatory response to EAEC, we infected IECs with EAEC prototype strain 042 and assessed cellular responses by macroarray and reverse transcriptase polymerase chain reaction (RT-PCR). Genes upregulated in 042-infected non-polarized T84 cells included IL-8, IL-6, TNF-alpha, GRO-alpha, GRO-gamma, ICAM-1, GM-CSF and IL-1alpha. RT-PCR analyses performed with cDNA from T84 and HT-29 cells infected with an aflagellar mutant (042fliC) suggested that these responses were primarily mediated by flagellin. To better reproduce the conditions of the infection for this non-invasive pathogen, we assessed the responses of polarized IECs to strain 042 infection. As expected, 042 induced IL-8 production from both polarized T84 and HT-29 cells. However, significant IL-8 secretion was induced in polarized T84 cells infected with 042fliC, suggesting that a factor other than flagellin contributes to inflammation in this model. This non-flagellar IL-8 response required expression of the aggregative adherence fimbria (AAF) adhesin, and was related to the presence of the minor fimbria-associated protein AafB. Our data suggest that multiple factors contribute to EAEC-induced inflammation, and further characterization of the nature of EAEC proinflammatory factors will greatly advance our understanding of  this emerging pathogen. 
16239562	 Uropathogenic Escherichia coli is the most common etiological agent of urinary tract infections. Bacteria can often express multiple adhesins during infection in order to favor attachment to specific niches within the urinary tract. We have recently demonstrated that type 1 fimbria, a phase-variable virulence factor involved in adherence, was the most highly expressed adhesin during urinary tract infection. Here, we examine whether the expression of type 1 fimbriae can affect  the expression of other adhesins. Type 1 fimbrial phase-locked mutants of E. coli strain CFT073, which harbors genes for numerous adhesins, were employed in this study. CFT073-specific DNA microarray analysis of these strains demonstrates that the expression of type 1 fimbriae coordinately affects the expression of P fimbriae in an inverse manner. This represents evidence for direct communication  between genes relating to pathogenesis, perhaps to aid the sequential occupation  of different urinary tract tissues. While the role of type 1 fimbriae during infection has been clear, the role of P fimbriae must be further defined to assert the relevance of coordinated regulation in vivo. Therefore, we examined the ability of P fimbrial isogenic mutants, constructed in a type 1 fimbrial-negative background, to compete in the murine urinary tract over a period of 168 h. No differences in the colonization of these mutants were observed. However, comparison of these results with previous studies suggests that inversely coordinated expression of adhesin gene clusters does occur in vivo. Interestingly, the mutant that was incapable of expressing either type 1 or P fimbriae compensated by synthesizing F1C fimbriae. 
16141204	 In bacterial adaptation to the dynamic environment, metabolic genes are typically thought to be the executors, whereas global transcription regulators are regarded as the decision makers. Although the feedback from metabolic consequence is believed to be important, much less is understood. This work demonstrates that the gluconeogenic genes in Escherichia coli, ppsA, sfcA, and maeB, provide a feedback loop to the global regulator, cAMP receptor protein (CRP), in carbon source transition. Disruption of one of the gluconeogenic pathways has no phenotype in balanced growth, but causes a significant delay in the diauxic transition from glucose to acetate. To investigate the underlying mechanism, we measured the transcriptome profiles during the transition using DNA microarray, and network component analysis was employed to obtain the transcription factor activities. Results showed that one of the global regulators, CRP, was insufficiently activated during the transition in the ppsA deletion mutant. Indeed, addition of cAMP partially rescued the delay in transition. These results suggest that the gluconeogenic flux to phosphoenolpyruvate is important for full  activation of adenylate cyclase through the phosphorylated enzyme IIA(glu) of the phosphotransferase system. Reduction of this flux causes insufficient activation  of CRP and a global metabolic deficiency, which exemplifies a significant feedback interaction from metabolism to the a global regulatory system. 
16163390	 The Imd signaling cascade, similar to the mammalian TNF-receptor pathway, controls antimicrobial peptide expression in Drosophila. We performed a large-scale RNAi screen to identify novel components of the Imd pathway in Drosophila S2 cells. In all, 6713 dsRNAs from an S2 cell-derived cDNA library were analyzed for their effect on Attacin promoter activity in response to Escherichia coli. We identified seven gene products required for the Attacin response in vitro, including two novel Imd pathway components: inhibitor of apoptosis 2 (Iap2) and transforming growth factor-activated kinase 1 (TAK1)-binding protein (TAB). Iap2 is required for antimicrobial peptide response also by the fat body in vivo. Both these factors function downstream of Imd. Neither TAB nor Iap2 is required for Relish cleavage, but may be involved in Relish nuclear localization in vitro, suggesting a novel mode of regulation of the Imd pathway. Our results show that an RNAi-based approach is suitable to identify genes in conserved signaling cascades. 
17044167	 The authors recently introduced a framework, named Network Component Analysis (NCA), for the reconstruction of the dynamics of transcriptional regulators' activities from gene expression assays. The original formulation had certain shortcomings that limited NCA's application to a wide class of network dynamics reconstruction problems, either because of limitations in the sample size or because of the stringent requirements imposed by the set of identifiability conditions. In addition, the performance characteristics of the method for various levels of data noise or in the presence of model inaccuracies were never  investigated. In this article, the following aspects of NCA have been addressed,  resulting in a set of extensions to the original framework: 1) The sufficient conditions on the a priori connectivity information (required for successful reconstructions via NCA) are made less stringent, allowing easier verification of whether a network topology is identifiable, as well as extending the class of identifiable systems. Such a result is accomplished by introducing a set of identifiability requirements that can be directly tested on the regulatory architecture, rather than on specific instances of the system matrix. 2) The two-stage least square iterative procedure used in NCA is proven to identify stationary points of the likelihood function, under Gaussian noise assumption, thus reinforcing the statistical foundations of the method. 3) A framework for the simultaneous reconstruction of multiple regulatory subnetworks is introduced, thus overcoming one of the critical limitations of the original formulation of the decomposition, for example, occurring for poorly sampled data (typical of microarray experiments). A set of monte carlo simulations we conducted with synthetic data suggests that the approach is indeed capable of accurately reconstructing regulatory signals when these are the input of large-scale networks that satisfy the suggested identifiability criteria, even under fairly noisy conditions. The sensitivity of the reconstructed signals to inaccuracies in the hypothesized network topology is also investigated. We demonstrate the feasibility of our approach for the simultaneous reconstruction of multiple regulatory subnetworks from the same data set with a successful application of the technique to gene expression measurements of the bacterium Escherichia coli. 
15979746	 Detection of pathogenic microorganisms in environmental samples is a difficult process. Concentration of the organisms of interest also co-concentrates inhibitors of many end-point detection methods, notably, nucleic acid methods. In addition, sensitive, highly multiplexed pathogen detection continues to be problematic. The primary function of the BEADS (Biodetection Enabling Analyte Delivery System) platform is the automated concentration and purification of target analytes from interfering substances, often present in these samples, via  a renewable surface column. In one version of BEADS, automated immunomagnetic separation (IMS) is used to separate cells from their samples. Captured cells are transferred to a flow-through thermal cycler where PCR, using labeled primers, is performed. PCR products are then detected by hybridization to a DNA suspension array. In another version of BEADS, cell lysis is performed, and community RNA is purified and directly labeled. Multiplexed detection is accomplished by direct hybridization of the RNA to a planar microarray. The integrated IMS/PCR version of BEADS can successfully purify and amplify 10 E. coli O157:H7 cells from river  water samples. Multiplexed PCR assays for the simultaneous detection of E. coli O157:H7, Salmonella, and Shigella on bead suspension arrays was demonstrated for  the detection of as few as 100 cells for each organism. Results for the RNA version of BEADS are also showing promising results. Automation yields highly purified RNA, suitable for multiplexed detection on microarrays, with microarray  detection specificity equivalent to PCR. Both versions of the BEADS platform show great promise for automated pathogen detection from environmental samples. Highly multiplexed pathogen detection using PCR continues to be problematic, but may be  required for trace detection in large volume samples. The RNA approach solves the issues of highly multiplexed PCR and provides "live vs. dead" capabilities. However, sensitivity of the method will need to be improved for RNA analysis to replace PCR. 
16101999	 The differentiating bacterium Streptomyces coelicolor harbours some 66 sigma factors, which support its complex life cycle. sigma(B), a functional homologue of sigma(S) from Escherichia coli, controls both osmoprotection and differentiation in S. coelicolor A3(2). Microarray analysis revealed sigma(B)-dependent induction of more than 280 genes by 0.2 M KCl. These genes encode several sigma factors, oxidative defence proteins, chaperones, systems to  provide osmolytes, cysteine, mycothiol, and gas vesicle. sigma(B) controlled induction of itself and its two paralogues (sigma(L) and sigma(M)) in a hierarchical order of sigma(B)-->sigma(L)-->sigma(M), as revealed by S1 mapping and Western blot analyses. The phenotype of each sigma mutant suggested a sequential action in morphological differentiation; sigma(B) in forming aerial mycelium, sigma(L) in forming spores and sigma(M) for efficient sporulation. sigma(B) was also responsible for the increase in cysteine and mycothiol, the major thiol buffer in actinomycetes, upon osmotic shock, revealing an overlap between protections against osmotic and oxidative stresses. Proteins in sigB mutant were more oxidized (carbonylated) than the wild type. These results support a hypothesis that sigma(B) serves as a master regulator that triggers other related sigma factors in a cascade, and thus regulates differentiation and  osmotic and oxidative response in S. coelicolor. 
16053320	 Salmonella spp. are one of the most problematic food pathogens in public health,  as they are responsible for food poisoning associated with contamination of meat, poultry, and eggs. Thus, rapid and sensitive detection of Salmonella spp. is required to ensure food safety. In this study, a fiber-optic DNA microarray using microsphere-immobilized oligonucleotide probes specific for the Salmonella invA and spvB genes was developed for detection of Salmonella spp. Microarrays were prepared by randomly distributing DNA probe-functionalized microspheres (3.1-microm diameter) into microwells created by etching optical fiber bundles. Hybridization of the probe-functionalized microspheres to target DNA from Salmonella was performed and visualized using Cy3-labeled secondary probes in a sandwich-type assay format. In this study, 10(3)-10(4) cfu/mL of the target organism could be detected after 1-h hybridization without any additional amplification. The DNA microarray showed no cross-reactivity with other common food pathogens, including E. coli and Y. enterocolitica, and could even detect Salmonella spp. from cocktails of bacterial strains with only moderate loss of sensitivity due to nonspecific binding. This work suggests that fiber-optic DNA microarrays can be used for rapid and sensitive detection of Salmonella spp. Since fiber-optic microarrays can be prepared with different probes, this approach could also enable the simultaneous detection of multiple food pathogens. 
16081976	 We established a protocol for isolation of microarray-grade bacterial RNA from Escherichia coli K1 interacting with human brain microvascular endothelial cells. The extracted RNA was free of human RNA contamination. More importantly, microarray analysis demonstrated that no bias was introduced in the gene expression pattern during the RNA isolation procedure. 
16095938	 Escherichia coli is one of the best elucidated organisms. However, about 40% of E. coli genes have not been assigned to their function yet. We analyzed 1440 single gene knock-out mutants using the GN2-MicroPlate, which permits assay of 95 carbon-source utilizations simultaneously. In the knock-out library there are 1044 of so called y-genes with no apparent function. The raw dataset was analyzed and genes were interrelated by the clustering method of the GeneSpring software.  In the resulted dendrogram of genes, a group of genes with known and related function tended to be assembled into a cluster. Our clustering method would be useful for functional assignment of so called y-genes with no apparent function,  since the resulted dendrogram could connect y-genes to phenotype and function of  well-studied genes. 
15985688	 In this study, blood culture and PCR-microarray analysis were used to examine 172 cases of suspected septicemia. Primers and oligonucleotide probes, based on the sequences of bacterial 16SrRNA gene, were arrayed by imprinting on microarray slides. Blood specimens collected from 172 cases of suspected septicemia were cultured and then tested separately by PCR for the bacterial 16S rRNA. Of the 172 clinical cases, 17 cases tested positive by PCR. The number of positives identified by PCR (9.88%) was significantly higher than the number of positives identified by the blood culture (4.65%). When blood culture was used as control,  the sensitivity of PCR was 100%, the specificity was 97.85%, and the index of accurate diagnosis was 0.979. When the 17 PCR positive specimens were further analyzed by hybridization against the microarrays, five were found to be probe positive for E. coli, four were positive for S. epidermidis, four were positive for CoNS, and two were positive for Bacillus and Propionibacterium, respectively. In the eight specimens showing positive results by both PCR and blood culture, the species determined by microarray analysis corresponded with the result obtained from blood culture. Detection of the bacterial 16SrRNA genes in clinical specimens by PCR and microarray analysis can be used to accurately diagnose neonatal sepsis. This method has a higher sensitivity and specificity than blood  culture and can provide a rapid way for the etiological diagnosis of neonatal septicemia. 
15982419	 BACKGROUND: APC (Adenomatous polyposis coli) plays an important role in the pathogenesis of both familial and sporadic colorectal cancer. Patients carrying germline APC mutations develop multiple colonic adenomas at younger age and higher frequency than non-carrier cases which indicates that silencing of one APC allele may be sufficient to initiate the transformation process. METHODS: To elucidate the biological dysregulation underlying adenoma formation we examined global gene expression profiles of adenomas and corresponding normal  mucosa from an FAP patient. Differential expression of the most significant gene  identified in this study was further validated by mRNA in situ hybridization, reverse transcriptase PCR and Northern blotting in different sets of adenomas, tumours and cancer cell lines. RESULTS: Eighty four genes were differentially expressed between all adenomas and corresponding normal mucosa, while only seven genes showed differential expression within the adenomas. The first group included pregnancy specific beta-1 glycoprotein 9 (PSG9) (p < 0.006). PSG9 is a member of the carcinoembryonic antigen (CEA)/PSG family and is produced at high levels during pregnancy, mainly by syncytiotrophoblasts. Further analysis of sporadic and familial colorectal cancer confirmed that PSG9 is ectopically upregulated in vivo by cancer cells. In total, deregulation of PSG9 mRNA was detected in 78% (14/18)  of FAP adenomas and 75% (45/60) of sporadic colorectal cancer cases tested. CONCLUSION: Detection of PSG9 expression in adenomas, and at higher levels in FAP cases, indicates that germline APC mutations and defects in Wnt signalling modulate PSG9 expression. Since PSG9 is not found in the non-pregnant adult except in association with cancer, and it appears to be an early molecular event  associated with colorectal cancer monitoring of its expression may be useful as a biomarker for the early detection of this disease. 
15978125	 BACKGROUND: The study of the network between transcription factors and their targets is important for understanding the complex regulatory mechanisms in a cell. Unfortunately, with standard microarray experiments it is not possible to measure the transcription factor activities (TFAs) directly, as their own transcription levels are subject to post-translational modifications. RESULTS: Here we propose a statistical approach based on partial least squares (PLS) regression to infer the true TFAs from a combination of mRNA expression and DNA-protein binding measurements. This method is also statistically sound for small samples and allows the detection of functional interactions among the transcription factors via the notion of "meta"-transcription factors. In addition, it enables false positives to be identified in ChIP data and activation and suppression activities to be distinguished. CONCLUSION: The proposed method performs very well both for simulated data and for real expression and ChIP data from yeast and E. Coli experiments. It overcomes the limitations of previously used approaches to estimating TFAs. The estimated profiles may also serve as input for further studies, such as tests of  periodicity or differential regulation. An R package "plsgenomics" implementing the proposed methods is available for download from the CRAN archive. 
15929794	 BACKGROUND: The distribution and location of insertion elements in a genome is an excellent tool to track the evolution of bacterial strains and a useful molecular marker to distinguish between closely related bacterial isolates. The information about the genomic locations of IS elements is available in public sequence databases. However, the locations of mobile elements may vary from strain to strain and within the population of an individual strain. Tools that allow de novo localization of IS elements and are independent of existing sequence information are essential to map insertion elements and advance our knowledge of  the role that such elements play in gene regulation and genome plasticity in bacteria. RESULTS: In this study, we present an efficient and reliable method for linear mapping of mobile elements using whole-genome DNA microarrays. In addition, we describe an algorithm for analysis of microarray data that can be applied to find DNA sequences physically juxtaposed with a target sequence of interest. This approach was used to map the locations of the IS5 elements in the genome of Escherichia coli K12. All IS5 elements present in the E. coli genome known from GenBank sequence data were identified. Furthermore, previously unknown insertion  sites were predicted with high sensitivity and specificity. Two variants of E. coli K-12 MG1655 within a population of this strain were predicted by our analysis. The only significant difference between these two isolates was the presence of an IS5 element upstream of the main flagella regulator, flhDC. Additional experiments confirmed this prediction and showed that these isolates were phenotypically distinct. The effect of IS5 on the transcriptional activity of motility and chemotaxis genes in the genome of E. coli strain MG1655 was examined. Comparative analysis of expression profiles revealed that the presence  of IS5 results in a mild enhancement of transcription of the flagellar genes that translates into a slight increase in motility. CONCLUSION: In summary, this work presents a case study of an experimental and analytical application of DNA microarrays to map insertion elements in bacteria and gains an insight into biological processes that might otherwise be overlooked by relying solely on the available genome sequence data. 
15797820	 Characterization of antimicrobial resistance and virulence gene profiles provides important information on the potential pathogenicity of bacteria. This information can be used to facilitate prompt and effective treatment of bacterial infections. We developed and tested a PCR-based microarray platform for detecting virulence and antimicrobial resistance genes in Salmonella serovars and Escherichia coli. Twelve Salmonella and seven E. coli isolates were screened for  the presence of 25 virulence and 23 antimicrobial resistance genes. All S. Typhimurium DT104 isolates harbored virulence plasmids. E. coli O157:H7 isolates  possessed virulence genes typical of enterohemorrhagic E. coli (EHEC), whereas E. coli O126 isolates contained virulence genes characteristic of enteropathogenic E. coli (EPEC) and E. coli O111, O78 and O147 isolates had virulence genes characteristic of enterotoxigenic E. coli (ETEC). Correlation between antimicrobial resistance phenotype and genotype was observed for each isolate. The aadA, tetA, and sulI genes were most commonly detected in bacteria resistant  to streptomycin, tetracycline and sulfonamide, respectively. All isolates exhibiting resistance to third generation cephalosporins harbored the bla(CMY-2)  and bla(TEM-1) genes. Microarray analysis is an effective method to rapidly screen Salmonella and E. coli for multiple antimicrobial resistance and virulence genes. 
15936653	 Recent work has shown how comparative genomic and microarray analyses can provide insights into the transcriptional state of uropathogenic Escherichia coli (UPEC)  during infection. This study will serve as an important platform from which to identify virulence determinants and the principle mechanisms of adaptation to the urinary tract. 
15797331	 The TP53 gene has been the subject of intense research since the realisation that inactivation of this gene is common to most cancer types. Numerous publications have linked TP53 mutations in general or at specific locations to patient prognosis and therapy response. The findings of many studies using general approaches such as immunohistochemistry or sequencing are contradictory. However, the detection of specific mutations, especially those occurring in the structurally important L2 and L3 zinc binding domains, which are the most common  sites of TP53 mutations, have been linked to patient prognosis and more strongly  to radiotherapy and chemotherapy resistance in several major cancers. In this study, the TI-SPR-1 surface plasmon resonance system and Texas Instruments Spreeta chips were used to develop a DNA biosensor based on thiolated probes complementary to these domains. The sensors were able to detect these mutations in both oligonucleotides and PCR products with normal and mutant TP53 DNA, but the difference in hybridisation signal was small. Preliminary experiments to enhance the signal using Escherichia coli mismatch repair proteins, MutS and single strand binding protein were carried out. It was found that MutS was unable to bind to mismatch oligonucleotides, but single strand binding protein was able  to bind to single stranded probes, which had not hybridised to the target, resulting in a three-fold increase in the sensitivity of the biosensor. While further work needs to be carried out to optimise the system, these preliminary experiments indicate that the TI-SPR-1 can be used for the detection of clinically relevant mutations in the TP53 gene and that the sensitivity can be increased significantly using single strand binding protein. This system has a number of advantages over current mutation detection technologies, including lower cost, ease of sensor preparation and measurement procedures, technical simplicity and increased speed due to the lack of need for gel electrophoresis. 
15808309	 The intestine is a complex and dynamic ecosystem, in which nutrients, exogenous compounds and micro-flora interact, and its condition is influenced by the complex interaction between these factors and host genetic elements. Furthermore, interactions of immune cells with the other components of the intestinal mucosa are essential in the defense against pathogens. The outcomes of these complex interactions determine resistance to infectious diseases. The development of genomic tools and techniques allows for analysis of multiple and complex host responses. We have constructed a porcine small intestinal micro-array, based on cDNA from jejunal mucosal scrapings. Material from two developmental distinct stages (4- and 12-week-old pigs) was used in order to assure a reasonably broad representation of mucosal transcripts. The micro-array consists of 3468 cDNAs spotted in quadruplicate. Comparison of the 4-week-old versus 12-week-old pigs revealed a differential expression in at least 300 spots. Furthermore, we report  the early gene expression response of pig small intestine jejunal mucosa to infection with enterotoxigenic E. coli (ETEC) using the small intestinal segment  perfusion (SISP) technique. A response pattern was found in which a marker for innate defense dominated, demonstrating the strength of this applied technology.  Further analysis of these response patterns will contribute to a better understanding of enteric health and disease in pigs. The great similarity between pig and human suggest results from these continuing studies should be applicable  for both agricultural and human biomedical purposes. 
15831905	 BACKGROUND AND AIMS: The mechanisms by which commensal bacteria provoke intestinal inflammation in animal models of inflammatory bowel disease (IBD) remain incompletely defined, leading to increasing interest in the innate immune  response of the colonic mucosa to bacterial colonisation. METHODS: Using gene expression profiling of colonic RNA from C.B17.SCID germ free mice and those colonised with altered Schaedler's flora, we investigated the innate immune response to bacterial colonisation in vivo. The two most consistently induced gene groups were RegIIIbeta and gamma as well as interferon  gamma (IFN-gamma) response genes. RESULTS: Using quantitative reverse transcription-polymerase chain reaction, we showed that RegIIIbeta, RegIIIgamma, and IFN-gamma were constitutively expressed  in the colon of conventionally housed SCID mice compared with either germ free SCID or conventionally housed BALB/c mice. Induction of these genes was reproduced by chronic monoassociation of germ free SCID mice with either of two separate gut commensal bacterial species-segmented filamentous bacteria and Schaedler's Escherichia coli. The cellular source for IFN-gamma on monoassociation of SCID mice with Schaedler's E coli was localised to a subset of intraepithelial natural killer (IENK) cells that express asialo-GM1. In vivo IFN-gamma immunoneutralisation studies failed to demonstrate any alteration in RegIIIbeta or gamma expression. CONCLUSIONS: Thus bacterial colonisation of the colon independently activates two distinct innate immune cell types at the mucosal interface with the colonic lumen, intestinal epithelial cells, and IENK cells, a response that may be regulated by the adaptive immune system. These innate immune responses may play a role in the pathogenesis of colitis in SCID adoptive transfer models in mice and  possibly in patients with IBD. 
15742388	 The transcriptome profiles for wild-type (plasmid-free) and recombinant (plasmid-bearing) Escherichia coli during well-controlled synchronized high-cell-density fed-batch cultures were analyzed by DNA microarrays. It was observed that the growth phase significantly affected the transcriptome profiles, and the transcriptome profiles were significantly different for the recombinant and wild-type cultures. The response of the wild-type and recombinant cultures to an isopropyl-1-thio-beta-D-galactopyranoside- (IPTG-) addition was examined, where IPTG induced recombinant protein production in the plasmid-bearing cultures. The IPTG-addition significantly altered the transcriptome response of the wild-type cultures entering the stationary phase. The IPTG-induced recombinant protein production resulted in a significant down-regulation of many  energy synthesis genes (atp, nuo, cyo), as well as nearly all transcription- and  translation-related genes (rpo, rpl, rpm, rps, rrf, rrl, rrs). Numerous phage (psp, hfl) and transposon-related genes (tra, ins) were significantly regulated in the recombinant cultures due to the IPTG-induction. These results indicate that the signaling mechanism, associated with the recombinant protein production, may induce a metabolic burden in the form of a phage defense mechanism. Taken together, these results indicated that recombinant protein production initiated a cascade of transcriptome responses that down-regulated the very genes needed to sustain productivity. 
15777795	 Insect hemocytes play multiple roles in immunity and carry out cellular responses like phagocytosis, encapsulation and melanization as well as producing humoral effector proteins in the first line of defense after injury and invasion of microorganisms. In this work, we used the Drosophila melanogaster hemocyte-like cell line mbn-2 and Affymetrix Drosophila GeneChips to investigate the transcriptome of a single type of immune competent tissue exposed to Gram-negative cell wall components (crude LPS) or high dose infection with live Escherichia coli. We found that gene expression profiles of both treatments overlap but show important differences in expression levels of several genes involved in immunity. In addition, cell morphology during infection was monitored and revealed distinct alterations in cell shape and adhesion. Presence of large numbers of bacteria also increased the number of cells taking on crystal cell fate. Taken together, our results indicate that hemocytes sense and respond differently to purified bacterial surface molecules and infection with live and actively growing bacteria both at the level of gene expression and in cell behavior. 
15513998	 MOTIVATION: The relations between the promoter sequences and their strengths were extensively studied in the 1980s. Although these studies uncovered strong sequence-strength correlations, the cost of their elaborate experimental methods  have been too high to be applied to a large number of promoters. On the contrary, a recent increase in the microarray data allows us to compare thousands of gene expressions with their DNA sequences. RESULTS: We studied the relations between the promoter sequences and their strengths using the Escherichia coli microarray data. We modeled those relations  using a simple weight matrix, which was optimized with a novel support vector regression method. It was observed that several non-consensus bases in the '-35'  and '-10' regions of promoter sequences act positively on the promoter strength and that certain consensus bases have a minor effect on the strength. We analyzed outliers for which the observed gene expressions deviate from the promoter strength predictions, and identified several genes with enhanced expressions due  to multiple promoters and genes under strong regulation by transcription factors. Our method is applicable to other procaryotes for which both the promoter sequences and the microarray data are available. 
15883881	 The PhoPQ two-component system acts as a transcriptional regulator that responds  to Mg(2+) starvation both in Escherichia coli and Salmonella typhimurium (Garcia  et al. 1996; Kato et al. 1999). By monitoring the availability of extracellular Mg(2+), this two-component system allows S. typhimurium to sense the transition from an extracellular environment to a subcellular location. Concomitantly with this transition, a set of virulence factors essential for survival in the intracellular environment is activated by the PhoPQ system (Groisman et al. 1989; Miller et al. 1989). Compared to nonpathogenic strains, such as E. coli K12, the  PhoPQ regulon in pathogens must contain target genes specifically contributing to the virulence phenotype. To verify this hypothesis, we compared the composition of the PhoPQ regulon between E. coli and S. typhimurium using a combination of expression experiments and motif data. PhoPQ-dependent genes in both organisms were identified from PhoPQ-related microarray experiments. To distinguish between direct and indirect targets, we searched for the presence of the regulatory motif in the promoter region of the identified PhoPQ-dependent genes. This allowed us to reconstruct the direct PhoPQ-dependent regulons in E. coli K12 and S. typhimurium LT2. Comparison of both regulons revealed a very limited overlap of PhoPQ-dependent genes between both organisms. These results suggest that the PhoPQ system has acquired a specialized function during evolution in each of these closely related species that allows adaptation to the specificities of their lifestyles (e.g., pathogenesis in S. typhimurium). 
15486043	 MOTIVATION: One of the present challenges in biological research is the organization of the data originating from high-throughput technologies. One way in which this information can be organized is in the form of networks of influences, physical or statistical, between cellular components. We propose an experimental method for probing biological networks, analyzing the resulting data and reconstructing the network architecture. METHODS: We use networks of known topology consisting of nodes (genes), directed  edges (gene-gene interactions) and a dynamics for the genes' mRNA concentrations  in terms of the gene-gene interactions. We proposed a network reconstruction algorithm based on the conditional correlation of the mRNA equilibrium concentration between two genes given that one of them was knocked down. Using simulated gene expression data on networks of known connectivity, we investigated how the reconstruction error is affected by noise, network topology, size, sparseness and dynamic parameters. RESULTS: Errors arise from correlation between nodes connected through intermediate nodes (false positives) and when the correlation between two directly connected nodes is obscured by noise, non-linearity or multiple inputs to the target node (false negatives). Two critical components of the method are as follows: (1) the choice of an optimal correlation threshold for predicting connections and (2) the reduction of errors arising from indirect connections (for which a novel algorithm is proposed). With these improvements, we can reconstruct networks with the topology of the transcriptional regulatory network  in Escherichia coli with a reasonably low error rate. 
15716450	 Genome comparisons have demonstrated that dramatic genetic change often underlies the emergence of new bacterial pathogens. Evolutionary analysis of Escherichia coli O157:H7, a pathogen that has emerged as a worldwide public health threat in  the past two decades, has posited that this toxin-producing pathogen evolved in a series of steps from O55:H7, a recent ancestor of a nontoxigenic pathogenic clone associated with infantile diarrhea. We used comparative genomic hybridization with 50-mer oligonucleotide microarrays containing probes from both pathogenic and nonpathogenic genomes to infer when genes were acquired and lost. Many ancillary virulence genes identified in the O157 genome were already present in an O55:H7-like progenitor, with 27 of 33 genomic islands of >5 kb and specific for O157:H7 (O islands) that were acquired intact before the split from this immediate ancestor. Most (85%) of variably absent or present genes are part of prophages or phage-like elements. Divergence in gene content among these closely  related strains was approximately 140 times greater than divergence at the nucleotide sequence level. A >100-kb region around the O-antigen gene cluster contained highly divergent sequences and also appears to be duplicated in its entirety in one lineage, suggesting that the whole region was cotransferred in the antigenic shift from O55 to O157. The beta-glucuronidase-positive O157 variants, although phylogenetically closest to the Sakai strain, were divergent for multiple adherence factors. These observations suggest that, in addition to gains and losses of phage elements, O157:H7 genomes are rapidly diverging and radiating into new niches as the pathogen disseminates. 
15750055	 Forty Escherichia coli strains isolated primarily from neonatal meningitis, urinary tract infections and feces were screened for the presence of virulence genes with a newly developed microarray on the array tube format. A total of 32 gene probes specific for extraintestinal as well as intestinal E. coli pathotypes were included. Eighty-eight percent of the analyzed strains were positive for the K1-specific probe on the microarray and could be confirmed with a specific antiserum against the K1 capsular polysaccharide. The gene for the hemin receptor ChuA was predominantly found in 95% of strains. Other virulence genes associated  with K1 and related strains were P, S, and F1C fimbriae specific for extraintestinal E. coli, the genes for aerobactin, the alpha-hemolysin and the cytotoxic necrotizing factor. In two strains, the O157-specific catalase gene and the gene for the low-molecular-weight heat-stable toxin AstA were detected, respectively. A total of 19 different virulence gene patterns were observed. No correlation was observed between specific virulence gene patterns and a clinical  outcome. The data indicate that virulence genes typical of extraintestinal E. coli are predominantly present in K1 strains. Nevertheless, some of them can carry virulence genes known to be characteristic of intestinal E. coli. The distribution and combination of virulence genes show that K1 isolates constitute  a heterogeneous group of E. coli. 
15699189	 Colonization by the commensal Escherichia coli strain A0 34/86 (O83 : K24 : H31)  has proved to be safe and efficient in the prophylaxis and treatment of nosocomial infections and diarrhoea of preterm and newborn infants in Czech paediatric clinics over the past three decades. In searching for traits contributing to this beneficial effect related to the gut colonization capacity of the strain, the authors have analysed its genome by DNA-DNA hybridization to E. coli K-12 (MG1655) genomic DNA arrays and to 'Pathoarrays', as well as by multiplex PCR, bacterial artificial chromosome (BAC) library cloning and shotgun  sequencing. Four hundred and ten E. coli K-12 ORFs were absent from A0 34/86, while 72 out of 456 genes associated with pathogenicity islands of E. coli and Shigella were also detected in E. coli A0 34/86. Furthermore, extraintestinal pathogenic E. coli-related genes involved in iron uptake and adhesion were detected by multiplex PCR, and genes encoding the HlyA and cytotoxic necrotizing  factor toxins, together with 21 genes of the uropathogenic E. coli 536 pathogenicity island II, were identified by analysis of 2304 shotgun and 1344 BAC clone sequences of A0 34/86 DNA. Multiple sequence comparisons identified 31 kb of DNA specific for E. coli A0 34/86; some of the genes carried by this DNA may prove to be implicated in the colonization capacity of the strain, enabling it to outcompete pathogens. Among 100 examined BAC clones roughly covering the A0 34/86 genome, one reproducibly conferred on the laboratory strain DH10B an enhanced capacity to persist in the intestine of newborn piglets. Sequencing revealed that this BAC clone carried gene clusters encoding gluconate and mannonate metabolism, adhesion (fim), invasion (ibe) and restriction/modification functions. Hence, the genome of this clinically safe and highly efficient colonizer strain appears to harbour many 'virulence-associated' genes. These results highlight the thin line  between bacterial 'virulence' and 'fitness' or 'colonization' factors, and question the definition of enterobacterial virulence factors. 
15623311	 An allele-specific oligonucleotide microarray was developed for rapid typing of pathogens based on analysis of genomic variations. Using a panel of Escherichia coli strains as a model system, selected loci were sequenced to uncover differences, such as single- or multiple-nucleotide polymorphisms as well as insertion/deletions (indels). While typical genomic profiling experiments employ  specific sequences targeted to genomic DNA unique to a single strain or virulent  gene, the present array is designed to type bacteria based on a patterned signature response across multiple loci. In the signature concept, all strains are interrogated by hybridizing their amplified DNA to an array containing multiple probe sequences. Allele-specific oligonucleotide probe sequences targeting each of these variable regions were synthesized and included in a custom fiber-optic array. For each locus, a set of specific probe sequences is selected, such that hybridization gives a binary signal/no signal response to each of the probes. Using this strategy for multiple loci, many pathogens or microorganisms could be classified using a limited number of probes. Because of the advantages of the fiber-optic array platform over other array formats, including sensitivity and speed, the platform described in this paper is capable  of supporting a high-throughput diagnostic strategy. 
15640221	 Complete genome sequences in combination with global screening methods allow parallel analysis of multiple mutant loci to determine the requirement for specific genes in different environments. In this paper we describe a high-definition microarray approach for investigating the growth effects of Tn5 insertions in Escherichia coli K-12. Libraries of insertion mutants generated by  a unique Tn5 mutagenesis system were grown competitively in defined media. Biotin-labeled runoff RNA transcripts were generated in vitro from transposon insertions in each population of mutants. These transcripts were then hybridized  to custom-designed oligonucleotide microarrays to detect the presence of each mutant in the population. By using this approach, the signal associated with 25 auxotrophic insertions in a 50-mutant pool was not detectable following nine generations of growth in glucose M9 minimal medium. It was found that individual  insertion sites could be mapped to within 50 bp of their genomic locations, and 340 dispensable regions in the E. coli chromosome were identified. Tn5 insertions were detected in 15 genes for which no previous insertions have been reported. Other applications of this method are discussed. 
15618144	 Shigella flexneri, the etiologic agent of bacillary dysentery, invades epithelial cells as well as macrophages and dendritic cells and escapes into the cytosol soon after invasion. Dissection of the global gene expression profile of the bacterium in its intracellular niche is essential to fully understand the biology of Shigella infection. We have determined the complete gene expression profiles for S. flexneri infecting human epithelial HeLa cells and human macrophage-like U937 cells. Approximately one quarter of the S. flexneri genes showed significant transcriptional adaptation during infection; 929 and 1,060 genes were up- or down-regulated within HeLa cells and U937 cells, respectively. The key S. flexneri virulence genes, ipa-mxi-spa and icsA, were drastically down-regulated during intracellular growth. This theme seems to be common in bacterial infection, because the Ipa-Mxi-Spa-like type III secretion systems were also down-regulated during mammalian cell infection by Salmonella enterica serovar Typhimurium and Escherichia coli O157. The bacteria experienced restricted levels of iron, magnesium, and phosphate in both host cell types, as shown by up-regulation of the sitABCD system, the mgtA gene, and genes of the phoBR regulon. Interestingly, ydeO and other acid-induced genes were up-regulated only  in U937 cells and not in HeLa cells, suggesting that the cytosol of U937 cells is acidic. Comparison with the gene expression of intracellular Salmonella serovar Typhimurium, which resides within the Salmonella-containing vacuole, indicated that S. flexneri is exposed to oxidative stress in U937 cells. This work will facilitate functional studies of hundreds of novel intracellularly regulated genes that may be important for the survival and growth strategies of Shigella in the human host. 
16078385	 This article proposes nonparametric inference procedures for analyzing microarray gene expression data that are reliable, robust, and simple to implement. They are conceptually transparent and require no special-purpose software. The analysis begins by normalizing gene expression data in a unique way. The resulting adjusted observations consist of gene-treatment interaction terms (representing differential expression) and error terms. The error terms are considered to be exchangeable, which is the only substantial assumption. Thus, under a family null hypothesis of no differential expression, the adjusted observations are exchangeable and all permutations of the observations are equally probable. The investigator may use the adjusted observations directly in a distribution-free test method or use their ranks in a rank-based method, where the ranking is taken over the whole data set. For the latter, the essential steps are as follows: (1)  Calculate a Wilcoxon rank-sum difference or a corresponding Kruskal-Wallis rank statistic for each gene. (2) Randomly permute the observations and repeat the previous step. (3) Independently repeat the random permutation a suitable number  of times. Under the exchangeability assumption, the permutation statistics are independent random draws from a null cumulative distribution function (c.d.f) approximated by the empirical c.d.f Reference to the empirical c.d.f tells if the test statistic for a gene is outlying and, hence, shows differential expression.  This feature is judged by using an appropriate rejection region or computing a p-value for each test statistic, taking into account multiple testing. The distribution-free analog of the rank-based approach is also available and has parallel steps which are described in the article. The proposed nonparametric analysis tends to give good results with no additional refinement, although a few refinements are presented that may interest some investigators. The implementation is illustrated with a case application involving differential gene expression in wild-type and knockout mice of an E. coli lipopolysaccharide (LPS)  endotoxin treatment, relative to a baseline untreated condition. 
15701279	 Ependymomas are glial cell-derived tumors characterized by varying degrees of chromosomal abnormalities and variability in clinical behavior. Cytogenetic analysis of pediatric ependymoma has failed to identify consistent patterns of abnormalities, with the exception of monosomy of 22 or structural abnormalities of 22q. In this study, a total of 19 pediatric ependymoma samples were used in a  series of expression profiling, quantitative real-time PCR (Q-PCR), and loss of heterozygosity experiments to identify candidate genes involved in the development of this type of pediatric malignancy. Of the 12,627 genes analyzed, a subset of 112 genes emerged as being abnormally expressed when compared to three  normal brain controls. Genes with increased expression included the oncogene WNT5A; the p53 homologue p63; and several cell cycle, cell adhesion, and proliferation genes. Underexpressed genes comprised the NF2 interacting gene SCHIP-1 and the adenomatous polyposis coli (APC)-associated gene EB1 among others. We validated the abnormal expression of six of these genes by Q-PCR. The  subset of differentially expressed genes also included four underexpressed transcripts mapping to 22q12.313.3. By Q-PCR we show that one of these genes, 7 CBX7(22q13.1), was deleted in 55% of cases. Other genes mapping to cytogenetic hot spots included two overexpressed and three underexpressed genes mapping to 1q31-41 and 6q21-q24.3, respectively. These genes represent candidate genes involved in ependymoma tumorigenesis. To the authors' knowledge, this is the first time microarray analysis and Q-PCR have been linked to identify heterozygous/homozygous deletions. 
15576765	 Bacterial populations produce persisters, cells that neither grow nor die in the  presence of bactericidal agents, and thus exhibit multidrug tolerance (MDT). The  mechanisms of MDT and the nature of persisters have remained elusive. Our previous research has shown that persisters are largely responsible for the recalcitrance of biofilm infections. A general method for isolating persisters was developed, based on lysis of regular cells by ampicillin. A gene expression profile of persisters contained toxin-antitoxin (TA) modules and other genes that can block important cellular functions such as translation. Bactericidal antibiotics kill cells by corrupting the target function (for example, aminoglycosides interrupt translation, producing toxic peptides). We reasoned that inhibition of translation will lead to a shutdown of cellular functions, preventing antibiotics from corrupting their targets, giving rise to MDT persister cells. Overproduction of the RelE toxin, an inhibitor of translation, caused a sharp increase in persisters. Functional expression of a putative HipA toxin also increased persisters, while deletion of the hipBA module caused a sharp decrease in persisters in both stationary and biofilm populations. HipA is  thus the first validated persister-MDT gene. We suggest that random fluctuation in the levels of MDT proteins leads to the formation of rare persister cells. The function of these specialized dormant cells is to ensure the survival of the population in the presence of lethal factors. 
15501767	 A uropathogenic Escherichia coli strain CFT073-specific DNA microarray that includes each open reading frame was used to analyze the transcriptome of CFT073  bacteria isolated directly from the urine of infected CBA/J mice. The in vivo expression profiles were compared to that of E. coli CFT073 grown statically to exponential phase in rich medium, revealing the strategies this pathogen uses in  vivo for colonization, growth, and survival in the urinary tract environment. The most highly expressed genes overall in vivo encoded translational machinery, indicating that the bacteria were in a rapid growth state despite specific nutrient limitations. Expression of type 1 fimbriae, a virulence factor involved  in adherence, was highly upregulated in vivo. Five iron acquisition systems were  all highly upregulated during urinary tract infection, as were genes responsible  for capsular polysaccharide and lipopolysaccharide synthesis, drug resistance, and microcin secretion. Surprisingly, other fimbrial genes, such as pap and foc/sfa, and genes involved in motility and chemotaxis were downregulated in vivo. E. coli CFT073 grown in human urine resulted in the upregulation of iron acquisition, capsule, and microcin secretion genes, thus partially mimicking growth in vivo. On the basis of gene expression levels, the urinary tract appears to be nitrogen and iron limiting, of high osmolarity, and of moderate oxygenation. This study represents the first assessment of any E. coli pathotype's transcriptome in vivo and provides specific insights into the mechanisms necessary for urinary tract pathogenesis. 
15225125	 The NGF (nerve growth factor) from Naja sputatrix has been purified by gel filtration followed by reversed-phase HPLC. The protein showed a very high ability to induce neurite formation in PC12 cells relative to the mouse NGF. Two  cDNAs encoding isoforms of NGF have been cloned and an active recombinant NGF, sputa NGF, has been produced in Escherichia coli as a His-tagged fusion protein.  Sputa NGF has been found to be non-toxic under both in vivo and in vitro conditions. The induction of neurite outgrowth by this NGF has been found to involve the high-affinity trkA-p75NTR complex of receptors. The pro-survival mechanism of p75NTR has been mediated by the activation of nuclear factor kappaB  gene by a corresponding down-regulation of inhibitory kappaB gene. Real-time PCR  and protein profiling (by surface-enhanced laser-desorption-ionization time-of-flight) have confirmed that sputa NGF up-regulates the expression of the  endogenous NGF in PC12 cells. Preliminary microarray analysis has also shown that sputa NGF is capable of promoting additional beneficial effects such as the up-regulation of arginine vasopressin receptor 1A, voltage-dependent T-type calcium channel. Hence, sputa NGF forms a new and useful NGF. 
15385505	 Escherichia coli K1 survival in the blood is a critical step for the onset of meningitis in neonates. Therefore, the circulating bacteria are impelled to avoid host defense mechanisms by finding a niche to survive and multiply. Our recent studies have shown that E. coli K1 enters and survives in both monocytes and macrophages in the newborn rat model of meningitis as well as in macrophage cell  lines. Here we demonstrate that E. coli K1 not only extends the survival of human and murine infected macrophage cell lines but also renders them resistant to apoptosis induced by staurosporine. Macrophages infected with wild-type E. coli expressing outer membrane protein A (OmpA), but not with OmpA- E. coli, are resistant to DNA fragmentation and phosphatidylserine exposure induced by staurosporine. Infection with OmpA+ E. coli induces the expression of Bcl(XL), an antiapoptotic protein, both at the mRNA level as assessed by gene array analysis  and at the protein level as evaluated by immunoblotting. OmpA- E. coli infection  of macrophages induced the release of cytochrome c from mitochondria into the cytosol and the activation of caspases 3, 6, and 9, events that were significantly blocked in OmpA+ E. coli-infected macrophages. In addition, OmpA+ E. coli-infected cells were resistant to a decrease in the transmembrane potential of mitochondria induced by staurosporine as measured by the MitoCapture fluorescence technique. Complementation of OmpA- E. coli with a plasmid containing the ompA gene restored the ability of OmpA- E. coli to inhibit the apoptosis of infected macrophages, further demonstrating that E. coli OmpA expression is critical for inducing macrophage survival and thereby finding a safe haven for its growth. 
15317768	 The Bacillus subtilis lmrAB operon is involved in multidrug resistance. LmrA is a repressor of its own operon, while LmrB acts as a multidrug efflux transporter. LmrA was produced in Escherichia coli cells and was shown to bind to the lmr promoter region, in which an LmrA-binding site was identified. Genome-wide screening involving DNA microarray analysis allowed us to conclude that LmrA also repressed yxaGH, which was not likely to contribute to the multidrug resistance.  LmrA bound to a putative yxaGH promoter region, in which two tandem LmrA-binding  sites were identified. The LmrA regulon was thus determined to comprise lmrAB and yxaGH. All three LmrA-binding sites contained an 18-bp consensus sequence, TAGACCRKTCWMTATAWT, which could play an important role in LmrA binding. 
15279944	 A rapid and accurate method for detection for common pathogenic bacteria in foodborne infections was established by using oligonucleotide array technology. Nylon membrane was used as the array support. A mutation region of the 23S rRNA gene was selected as the discrimination target from 14 species (genera) of bacteria causing foodborne infections and two unrelated bacterial species. A pair of universal primers was designed for PCR amplification of the 23S rRNA gene. Twenty-one species (genera)-specific oligonucleotide detection probes were synthesized and spotted onto the nylon membranes. The 23S rRNA gene amplification products of 14 species of pathogenic bacteria were hybridized to the oligonucleotide array. Hybridization results were analyzed with digoxigenin-linked enzyme reaction. Results indicated that nine species of pathogenic bacteria (Escherichia coli, Campylobacter jejuni, Shigella dysenteriae, Vibrio cholerae, Vibrio parahaemolyticus, Proteus vulgaris, Bacillus cereus, Listeria monocytogenes and Clostridium botulinum) showed high sensitivity and specificity for the oligonucleotide array. Two other species (Salmonella enterica and Yersinia enterocolitica) gave weak cross-reaction with E. coli, but  the reaction did not affect their detection. After redesigning the probes, positive hybridization results were obtained with Staphylococcus aureus, but not  with Clostridium perfringens and Streptococcus pyogenes. The oligonucleotide array can also be applied to samples collected in clinical settings of foodborne  infections. The superiority of oligonucleotide array over other tests lies on its rapidity, accuracy and efficiency in the diagnosis, treatment and control of foodborne infections. 
15190067	 Development of normal colon epithelial cells proceeds through a systematic differentiation of cells that emerge from stem cells within the base of colon crypts. Genetic mutations in the adenomatous polyposis coli (APC) gene are thought to cause colon adenoma and carcinoma formation by enhancing colonocyte proliferation and impairing differentiation. We currently have a limited understanding of the cellular mechanisms that promote colonocyte differentiation. Herein, we present evidence supporting a lack of retinoic acid biosynthesis as a  mechanism contributing to the development of colon adenomas and carcinomas. Microarray and reverse transcriptase-PCR analyses revealed reduced expression of  two retinoid biosynthesis genes: retinol dehydrogenase 5 (RDH5) and retinol dehydrogenase L (RDHL) in colon adenomas and carcinomas as compared with normal colon. Consistent with the adenoma and carcinomas samples, seven colon carcinoma  cell lines also lacked expression of RDH5 and RDHL. Assessment of RDH enzymatic activity within these seven cell lines showed poor conversion of retinol into retinoic acid when compared with normal cells such as normal human mammary epithelial cells. Reintroduction of wild type APC into an APC-deficient colon carcinoma cell line (HT29) resulted in increased expression of RDHL without affecting RDH5. APC-mediated induction of RDHL was paralleled by increased production of retinoic acid. Investigations into the mechanism responsible for APC induction of RDHL indicated that beta-catenin fails to repress RDHL. The colon-specific transcription factor CDX2, however, activated an RDHL promoter construct and induced endogenous RDHL. Finally, the induction of RDHL by APC appears dependent on the presence of CDX2. We propose a novel role for APC and CDX2 in controlling retinoic acid biosynthesis and in promoting a retinoid-induced program of colonocyte differentiation. 
15342544	 We have developed programs to facilitate analysis of microarray data in Escherichia coli. They fall into two categories: manipulation of microarray images and identification of known biological relationships among lists of genes. A program in the first category arranges spots from glass-slide DNA microarrays according to their position in the E. coli genome and displays them compactly in  genome order. The resulting genome image is presented in a web browser with an image map that allows the user to identify genes in the reordered image. Another  program in the first category aligns genome images from two or more experiments.  These images assist in visualizing regions of the genome with common transcriptional control. Such regions include multigene operons and clusters of operons, which are easily identified as strings of adjacent, similarly colored spots. The images are also useful for assessing the overall quality of experiments. The second category of programs includes a database and a number of  tools for displaying biological information about many E. coli genes simultaneously rather than one gene at a time, which facilitates identifying relationships among them. These programs have accelerated and enhanced our interpretation of results from E. coli DNA microarray experiments. Examples are given. 
15297528	 Standard clinical procedures for pathogen resistance identification are laborious and usually require 2 days of cultivation before the resistance can be determined unequivocally. In contrast, clinicians and patients face increasing threats from  antibiotic-resistant pathogenic bacteria in terms of their frequencies and levels of resistance. A major class of microbial resistance stems from the occurrence of beta-lactamases, which, if mutated, can cause the severe extended-spectrum beta-lactamase (ESBL) or inhibitor-resistant TEM (IRT) phenotype, which cause resistance to extended-spectrum cephalosporins, monobactams, and beta-lactamase inhibitors. We describe an oligonucleotide microarray for identification of the single nucleotide polymorphisms (SNPs) of 96% of the TEM beta-lactamase variants  described to date which are related to the ESBL and/or IRT phenotype. The target  DNA, originating from Escherichia coli, Enterobacter cloacae, and Klebsiella pneumoniae cells isolated from clinical samples, was amplified and fluorescently  labeled by PCR with consensus primers in the presence of cyanine 5-labeled nucleotides. The total assay, including PCR, hybridization, and image analysis, could be performed in 3.5 h. The microarray results were validated by standard clinical procedures. The microarray outperformed the standard procedures in terms of assay time and the depth of information provided. In conclusion, this array offers an attractive option for the identification and epidemiologic monitoring of TEM beta-lactamases in the routine clinical diagnostic laboratory. 
15283978	 Data from high throughput technologies, such as DNA microarrays, necessitated the development of new computational methodologies for analyzing the high dimensional information contained within the gene expression data. Liao's group suggested the use of network component analysis to predict transcription factor activities by integrating gene expression data from Escherichia coli with known connectivity information between their genes and transcription factors. This introduces an approach for obtaining novel information from gene expression data. 
15175305	 Escherichia coli, including the closely related genus Shigella, is a highly diverse species in terms of genome structure. Comparative genomic hybridization (CGH) microarray analysis was used to compare the gene content of E. coli K-12 with the gene contents of pathogenic strains. Missing genes in a pathogen were detected on a microarray slide spotted with 4,071 open reading frames (ORFs) of W3110, a commonly used wild-type K-12 strain. For 22 strains subjected to the CGH microarray analyses 1,424 ORFs were found to be absent in at least one strain. The common backbone of the E. coli genome was estimated to contain about 2,800 ORFs. The mosaic distribution of absent regions indicated that the genomes of pathogenic strains were highly diversified because of insertions and deletions. Prophages, cell envelope genes, transporter genes, and regulator genes in the K-12 genome often were not present in pathogens. The gene contents of the strains tested were recognized as a matrix for a neighbor-joining analysis. The phylogenic tree obtained was consistent with the results of previous studies. However, unique relationships between enteroinvasive strains and Shigella, uropathogenic, and some enteropathogenic strains were suggested by the results of this study. The data demonstrated that the CGH microarray technique is useful not only for genomic comparisons but also for phylogenic analysis of E. coli at the strain level. 
15001460	 Sepsis is the most common cause of death in patients in the intensive care unit.  Genome-wide gene expression analysis can provide insights into the molecular alterations of sepsis. Total mRNA was extracted from the livers of 6 uninfected control mice and 60 septic mice after infusion of either live Escherichia coli or Staphylococcus aureus. Using a murine complementary DNA microarray system, changes in gene expression were monitored at six time points (uninfected, 2, 8, 24, 48, and 72 hours). Overall, 4.8% of 6,144 assessed genes were differentially  regulated with a greater than twofold change across all time points. Most of the  genes with altered expression were commonly present in gram-negative and gram-positive sepsis, but the expression levels of 17 genes were different between both types of sepsis at particular time points after infection. The microarray results support the hypothesis that both gram-positive and gram-negative sepsis share a final common pathway involved in the pathogenesis of sepsis, but certain genes are differentially expressed under distinct regulation. These results may provide insights into the pathogenesis of sepsis and may also help identify some altered genes that can serve as new targets for diagnostic tools and therapeutic strategies. 
15123798	 Whole-genome expression profiling revealed Escherichia coli MG1655 genes induced  by growth on mucus, conditions designed to mimic nutrient availability in the mammalian intestine. Most were nutritional genes corresponding to catabolic pathways for nutrients found in mucus. We knocked out several pathways and tested the relative fitness of the mutants for colonization of the mouse intestine in competition with their wild-type parent. We found that only mutations in sugar pathways affected colonization, not phospholipid and amino acid catabolism, not gluconeogenesis, not the tricarboxylic acid cycle, and not the pentose phosphate  pathway. Gluconate appeared to be a major carbon source used by E. coli MG1655 to colonize, having an impact on both the initiation and maintenance stages. N-acetylglucosamine and N-acetylneuraminic acid appeared to be involved in initiation, but not maintenance. Glucuronate, mannose, fucose, and ribose appeared to be involved in maintenance, but not initiation. The in vitro order of preference for these seven sugars paralleled the relative impact of the corresponding metabolic lesions on colonization: gluconate > N-acetylglucosamine  > N-acetylneuraminic acid = glucuronate > mannose > fucose > ribose. The results  of this systematic analysis of nutrients used by E. coli MG1655 to colonize the mouse intestine are intriguing in light of the nutrient-niche hypothesis, which states that the ecological niches within the intestine are defined by nutrient availability. Because humans are presumably colonized with different commensal strains, differences in nutrient availability may provide an open niche for infecting E. coli pathogens in some individuals and a barrier to infection in others. 
15031318	 DNA microarrays are powerful tools for comparing gene expression profiles from closely related organisms. However, a single microarray design is frequently used in these studies. Therefore, the levels of certain transcripts can be grossly underestimated due to sequence differences between the transcripts and the arrayed DNA probes. Here, we seek to improve the sensitivity and specificity of oligonucleotide microarray-based gene expression analysis by using genomic sequence information to predict the hybridization efficiency of orthologous transcripts to a given microarray. To test our approach, we examine hybridization patterns from three Escherichia coli strains on E.coli K-12 MG1655 gene expression microarrays. We create electronic mask files to discard data from probes predicted to have poor hybridization sensitivity and specificity to cDNA targets from each strain. We increased the accuracy of gene expression analysis and identified genes that cannot be accurately interrogated in each strain using  these microarrays. Overall, these studies provide guidelines for designing effective electronic masks for gene expression analysis in organisms where substantial genome sequence information is available. 
14660579	 The Wnt signaling pathway is activated in most human colorectal tumors. Mutational inactivation in the tumor suppressor adenomatous polyposis coli (APC), as well as activation of beta-catenin, causes the accumulation of beta-catenin, which in turn associates with the T cell factor/lymphoid enhancer factor (TCF/LEF) family of transcription factors and activates transcription of their target genes. Here we show that beta-catenin activates transcription of the BMP and activin membrane-bound inhibitor (BAMBI)/NMA gene. The expression level of BAMBI was found to be aberrantly elevated in most colorectal and hepatocellular carcinomas relative to the corresponding non-cancerous tissues. Expression of BAMBI in colorectal tumor cell lines was repressed by a dominant-negative mutant  of TCF-4 or by an inhibitor of beta-catenin-TCF interaction, suggesting that beta-catenin is responsible for the aberrant expression of BAMBI in colorectal tumor cells. Furthermore, overexpression of BAMBI inhibited the response of tumor cells to transforming growth factor-beta signaling. These results suggest that beta-catenin interferes with transforming growth factor-beta-mediated growth arrest by inducing the expression of BAMBI, and this may contribute to colorectal and hepatocellular tumorigenesis. 
14762058	 Various computational approaches have been developed for predicting cis-regulatory DNA elements in prokaryotic genomes. We describe a novel method for predicting transcription-factor-binding sites in Escherichia coli. Our method takes advantage of the principle that transcription factors frequently coregulate gene expression, but without requiring prior knowledge of which groups of genes are coregulated. Using position weight matrices for 49 known transcription factors, we examined spacings between pairs of matrix hits. These pairs were assigned probabilities according to the overrepresentation of their separation distance. The functions of many open reading frames (ORFs) downstream from predicted binding sites are unknown, and may correspond to novel regulon members. For five predictions, knockouts with mutated replacements of the predicted binding sites were created in E. coli MG1655. Quantitative real-time PCR (RT-PCR) indicates that for each of the knockouts, at least one gene immediately downstream exhibits a statistically significant change in mRNA expression. This approach may be useful in analyzing binding sites in a variety of organisms. 
14707179	 Microarray-based comparative genomic hybridization (CGH) has become a powerful method for the genome-wide detection of chromosomal imbalances. Although BAC microarrays have been used for mouse CGH studies, the resolving power of these analyses was limited because high-density whole-genome mouse BAC microarrays were not available. We therefore developed a mouse BAC microarray containing 2803 unique BAC clones from mouse genomic libraries at 1-Mb intervals. For the general amplification of BAC clone DNA prior to spotting, we designed a set of three novel degenerate oligonucleotide-primed (DOP) PCR primers that preferentially amplify mouse genomic sequences while minimizing unwanted amplification of contaminating Escherichia coli DNA. The resulting 3K mouse BAC microarrays reproducibly identified DNA copy number alterations in cell lines and primary tumors, such as single-copy deletions, regional amplifications, and aneuploidy. 
14737187	 Comparing genomic properties of different organisms is of fundamental importance  in the study of biological and evolutionary principles. Although differences among organisms are often attributed to differential gene expression, genome-wide comparative analysis thus far has been based primarily on genomic sequence information. We present a comparative study of large datasets of expression profiles from six evolutionarily distant organisms: S. cerevisiae, C. elegans, E. coli, A. thaliana, D. melanogaster, and H. sapiens. We use genomic sequence information to connect these data and compare global and modular properties of the transcription programs. Linking genes whose expression profiles are similar,  we find that for all organisms the connectivity distribution follows a power-law, highly connected genes tend to be essential and conserved, and the expression program is highly modular. We reveal the modular structure by decomposing each set of expression data into coexpressed modules. Functionally related sets of genes are frequently coexpressed in multiple organisms. Yet their relative importance to the transcription program and their regulatory relationships vary among organisms. Our results demonstrate the potential of combining sequence and  expression data for improving functional gene annotation and expanding our understanding of how gene expression and diversity evolved. 
14672138	 Author information:  (1)Chien-Shiung Wu Laboratory, Department of Biomedical Engineering, Southeast University, Nanjing 210096, People's Republic of China. 
12807911	 We have studied the assembly and GTPase of purified FtsZ from the hyperthermophilic archaeon Methanococcus jannaschii, a structural homolog of eukaryotic tubulin, employing wild-type FtsZ, FtsZ-His6 (histidine-tagged FtsZ),  and the new mutants FtsZ-W319Y and FtsZ-W319Y-His6, with light scattering, nucleotide analyses, electron microscopy, and image processing methods. This has  revealed novel properties of FtsZ. The GTPase of archaeal FtsZ polymers is suppressed in Na+-containing buffer, generating stabilized structures that require GDP addition for disassembly. FtsZ assembly is polymorphic. Archaeal FtsZ(wt) assembles into associated and isolated filaments made of two parallel protofilaments with a 43 A longitudinal spacing between monomers, and this structure is also observed in bacterial FtsZ from Escherichia coli. The His6 extension facilitates the artificial formation of helical tubes and sheets. FtsZ-W319Y-His6 is an inactivated GTPase whose assembly remains regulated by GTP  and Mg2+. It forms two-dimensional crystals made of symmetrical pairs of tubulin-like protofilaments, which associate in an antiparallel array (similarly  to the known Ca2+-induced sheets of FtsZ-His6). In contrast to the lateral interactions of microtubule protofilaments, we propose that the primary assembly  product of FtsZ is the double-stranded filament, one or several of which might form the dynamic Z ring during prokaryotic cell division. 
12746439	 Organisms generally respond to iron deficiency by increasing their capacity to take up iron and by consuming intracellular iron stores. Escherichia coli, in which iron metabolism is particularly well understood, contains at least 7 iron-acquisition systems encoded by 35 iron-repressed genes. This Fe-dependent repression is mediated by a transcriptional repressor, Fur (ferric uptake regulation), which also controls genes involved in other processes such as iron storage, the Tricarboxylic Acid Cycle, pathogenicity, and redox-stress resistance. Our macroarray-based global analysis of iron- and Fur-dependent gene  expression in E. coli has revealed several novel Fur-repressed genes likely to specify at least three additional iron-transport pathways. Interestingly, a large group of energy metabolism genes was found to be iron and Fur induced. Many of these genes encode iron-rich respiratory complexes. This iron- and Fur-dependent  regulation appears to represent a novel iron-homeostatic mechanism whereby the synthesis of many iron-containing proteins is repressed under iron-restricted conditions. This mechanism thus accounts for the low iron contents of fur mutants and explains how E. coli can modulate its iron requirements. Analysis of 55Fe-labeled E. coli proteins revealed a marked decrease in iron-protein composition for the fur mutant, and visible and EPR spectroscopy showed major reductions in cytochrome b and d levels, and in iron-sulfur cluster contents for  the chelator-treated wild-type and/or fur mutant, correlating well with the array and quantitative RT-PCR data. In combination, the results provide compelling evidence for the regulation of intracellular iron consumption by the Fe2+-Fur complex. 
12886021	 Early detection of colorectal cancer is critical for the management of this disease. Biomarkers for early detection of several cancers have been developed and applied clinically in recent years. We have sought to discover candidate biomarkers without the restricted choice of markers placed on microarrays, and without the biological complications of genetic and environmental heterogeneity.  We have compared by cDNA subtraction two genetically matched sets of mice, one developing multiple intestinal neoplasia (C57BL/6J-ApcMin) and the other tumor-free (C57BL/6J). One prominent candidate biomarker, clusterin, was then subjected to a series of validation steps. In situ hybridization and immunohistochemistry were used to analyze clusterin expression at a cellular level on a series of murine intestinal and human colonic neoplasms. Elevated clusterin expression was characterized within certain regions of murine and human tumors regardless of tumor stage, location, or mode of initiation. The cells showing high clusterin levels generally lacked differentiation markers and adenomatous polyposis coli antigen. Tumor cells undergoing apoptosis expressed low levels of clusterin. Its specific expression patterns and correlation with cellular events during tumorigenesis make it a useful diagnostic tool in the mouse and a potential contributor to the set of biomarkers for early detection of human colon cancer. 
12858349	 Circulating neutrophils play a key role both in the systemic inflammatory response and in complications of bacterial infection such as septic shock and septic multiple organ dysfunction syndrome. We have analyzed gene expression patterns in human neutrophils stimulated by E. coli lipopolysaccharide (LPS), with or without prior exposure to LPS, using differential display and oligonucleotide chip techniques. We identified 307 genes that were activated or repressed after treatment with LPS at 10 ng/ml and 385 genes after LPS at 100 ng/ml, compared with untreated neutrophils. The two sets included many transcription factors, cytokines, chemokines, interleukins, and surface antigens, as well as members of the toll-like receptor, Rel/NF-kappaB, and immune mediator  gene families. Time course analysis showed that the early and late neutrophil responses to LPS share some common mechanisms, but many changes in gene expression are transient or late to develop. Neutrophils also showed a priming response to LPS, in which 97 genes significantly changed expression on re-exposure to lower dose LPS and were analyzed by unsupervised hierarchical clustering. These findings indicate that the neutrophil is a transcriptionally active cell responsive to environmental stimuli and capable of a complex series of both early and late changes in gene expression. Supplementary material for this article can be found on the Journal of Cellular Biochemistry website (http://jws-edci.interscience.wiley.com:8998/jpages/0730-2312/suppmat/89/v89.page .html). 
12855737	 Neisseria meningitidis is a Gram-negative bacterium which is an important causative agent of septicaemia and meningitis. LuxS has been shown to be involved in the biosynthesis of a quorum sensing molecule, autoinducer-2 (AI-2), known to  play a role in virulence in Escherichia coli, as well as other bacteria. Evidence that serogroup B of N. meningitidis produces AI-2, along with the observation that a luxS mutant of this strain had attenuated virulence in an infant rat model of bacteraemia, led to further investigation of the role of this quorum sensing molecule in N. meningitidis. In this study, it is demonstrated that AI-2 is not involved in regulating growth of meningococci, either in culture or in contact with epithelial cells. Furthermore, transcriptional profiling using DNA microarrays shows an absence of the concerted regulation seen in other bacteria.  Taken together, these data suggest that in N. meningitidis, AI-2 may be a metabolic by-product and not a cell-to-cell signalling molecule. 
12619160	 We have designed DOP-PCR primers specifically for the amplification of large insert clones for use in the construction of DNA microarrays. A bioinformatic approach was used to construct primers that were efficient in the general amplification of human DNA but were poor at amplifying E. coli DNA, a common contaminant of DNA preparations from large insert clones. We chose the three most selective primers for use in printing DNA microarrays. DNA combined from the amplification of large insert clones by use of these three primers and spotted onto glass slides showed more than a sixfold increase in the human to E. coli hybridization ratio when compared to the standard DOP-PCR primer, 6MW. The microarrays reproducibly delineated previously characterized gains and deletions  in a cancer cell line and identified a small gain not detected by use of conventional CGH. We also describe a method for the bulk testing of the hybridization characteristics of chromosome-specific clones spotted on microarrays by use of DNA amplified from flow-sorted chromosomes. Finally, we describe a set of clones selected from the publicly available Golden Path of the  human genome at 1-Mb intervals and a view in the Ensembl genome browser from which data required for the use of these clones in array CGH and other experiments can be downloaded across the Internet. 
12538876	 Twelve populations of Escherichia coli, derived from a common ancestor, evolved in a glucose-limited medium for 20,000 generations. Here we use DNA expression arrays to examine whether gene-expression profiles in two populations evolved in  parallel, which would indicate adaptation, and to gain insight into the mechanisms underlying their adaptation. We compared the expression profile of the ancestor to that of clones sampled from both populations after 20,000 generations. The expression of 59 genes had changed significantly in both populations. Remarkably, all 59 were changed in the same direction relative to the ancestor. Many of these genes were members of the cAMP-cAMP receptor protein  (CRP) and guanosine tetraphosphate (ppGpp) regulons. Sequencing of several genes  controlling the effectors of these regulons found a nonsynonymous mutation in spoT in one population. Moving this mutation into the ancestral background showed that it increased fitness and produced many of the expression changes manifest after 20,000 generations. The same mutation had no effect on fitness when introduced into the other evolved population, indicating that a mutation of similar effect was present already. Our study demonstrates the utility of expression arrays for addressing evolutionary issues including the quantitative measurement of parallel evolution in independent lineages and the identification  of beneficial mutations. 
14712652	 Author information:  (1)Laboratory of Molecular Biology, NIDDK, National Institutes of Health, Bethesda, Maryland 20892-0560, USA. 
12417763	 Biomolecular self-assembly can be used as a powerful tool for nanoscale engineering. In this paper, we describe the development of building blocks for nanobiotechnology, which are based on the fusion of streptavidin to a crystalline bacterial cell surface layer (S-layer) protein with the inherent ability to self-assemble into a monomolecular protein lattice. The fusion proteins and streptavidin were produced independently in Escherichia coli, isolated, and mixed to refold and purify heterotetramers of 1:3 stoichiometry. Self-assembled chimeric S-layers could be formed in suspension, on liposomes, on silicon wafers, and on accessory cell wall polymer containing cell wall fragments. The two-dimensional protein crystals displayed streptavidin in defined repetitive spacing, and they were capable of binding d-biotin and biotinylated proteins. Therefore, the chimeric S-layer can be used as a self-assembling nanopatterned molecular affinity matrix to arrange biotinylated compounds on a surface. In addition, it has application potential as a functional coat of liposomes. 
11940574	 The Wnt pathway regulates cell fate, proliferation, and apoptosis, and defects in the pathway play a key role in many cancers. Although Wnts act to stabilize beta-catenin levels in the cytosol and nucleus, a multiprotein complex containing adenomatous polyposis coli, glycogen synthase kinase 3beta, and Axin1 or its homolog Axin2/Axil/conductin promotes beta-catenin phosphorylation and subsequent proteasomal degradation. We found that the rat Axil gene was strongly induced upon neoplastic transformation of RK3E cells by mutant beta-catenin or gamma-catenin or after ligand-induced activation of a beta-catenin-estrogen receptor fusion protein. Expression of Wnt1 in murine breast epithelial cells activated the conductin gene, and human cancers with defective beta-catenin regulation had elevated AXIN2 gene and protein expression. Expression of AXIN2/Axil was strongly repressed in cancer cells by restoration of wild type adenomatous polyposis coli function or expression of a dominant negative form of  T cell factor (TCF)-4. TCF binding sites in the AXIN2 promoter played a key role  in the ability of beta-catenin to activate AXIN2 transcription. In contrast to AXIN2/Axil, expression of human or rat Axin1 homologs was nominally affected by beta-catenin-TCF. Because Axin2 can inhibit beta-catenin abundance and function,  the data implicate AXIN2 in a negative feedback pathway regulating Wnt signaling. Additionally, although Axin1 and Axin2 have been thought to have comparable functions, the observation that Wnt pathway activation elevates AXIN2 but not AXIN1 expression suggests that there may be potentially significant functional differences between the two proteins. 
11981561	 As the global threat of drug- and antibiotic-resistant bacteria continues to rise, new strategies are required to advance the drug discovery process. This work describes the construction of an array of Escherichia coli strains for use in whole-cell screens to identify new antimicrobial compounds. We used the recombination systems from bacteriophages lambda and P1 to engineer each strain in the array for low-level expression of a single, essential gene product, thus making each strain hypersusceptible to specific inhibitors of that gene target. Screening of nine strains from the array in parallel against a large chemical library permitted identification of new inhibitors of bacterial growth. As an example of the target specificity of the approach, compounds identified in the whole-cell screen for MurA inhibitors were also found to block the biochemical function of the target when tested in vitro. 
11912489	 The recognition and phagocytosis of microbes by macrophages is a principal aspect of innate immunity that is conserved from insects to humans. Drosophila melanogaster has circulating macrophages that phagocytose microbes similarly to mammalian macrophages, suggesting that insect macrophages can be used as a model  to study cell-mediated innate immunity. We devised a double-stranded RNA interference-based screen in macrophage-like Drosophila S2 cells, and have defined 34 gene products involved in phagocytosis. These include proteins that participate in haemocyte development, vesicle transport, actin cytoskeleton regulation and a cell surface receptor. This receptor, Peptidoglycan recognition  protein LC (PGRP-LC), is involved in phagocytosis of Gram-negative but not Gram-positive bacteria. Drosophila humoral immunity also distinguishes between Gram-negative and Gram-positive bacteria through the Imd and Toll pathways, respectively; however, a receptor for the Imd pathway has not been identified. Here we show that PGRP-LC is important for antibacterial peptide synthesis induced by Escherichia coli both in vitro and in vivo. Furthermore, totem mutants, which fail to express PGRP-LC, are susceptible to Gram-negative (E. coli), but not Gram-positive, bacterial infection. Our results demonstrate that PGRP-LC is an essential component for recognition and signalling of Gram-negative bacteria. Furthermore, this functional genomic approach is likely to have applications beyond phagocytosis. 
11744708	 Uropathogenic Escherichia coli (UPEC), the principal cause of urinary tract infection in women, attaches to the superficial facet cell layer of the bladder epithelium (urothelium) via its FimH adhesin. Attachment triggers exfoliation of  bacteria-laden superficial facet cells, followed by rapid reconstitution of the urothelium through differentiation of underlying basal and intermediate cells. We have used DNA microarrays to define the molecular regulators of urothelial renewal and host defense expressed in adult C57Bl/6 female mice during the early  phases of infection with isogenic virulent (FimH+) or avirulent (FimH-) UPEC strains. The temporal evolution and cellular origins of selected responses were then characterized by real time quantitative reverse transcriptase-PCR, in situ hybridization, and immunohistochemical analyses. Well before exfoliation is evident, FimH-mediated attachment suppresses transforming growth factor-beta (Bmp4) and Wnt5a/Ca(2+) signaling to promote subsequent differentiation of basal/intermediate cells. The early transcriptional responses to attachment also  include induction of regulators of proliferation (e.g. epidermal growth factor family members), induction of the ETS transcription factor Elf3, which transactivates genes involved in epithelial differentiation and host defense (inducible nitric-oxide synthase), induction of modulators, and mediators of pro-inflammatory responses (e.g. Socs3, Cebp/delta, Bcl3, and CC/CXC chemokines), induction of modulators of apoptotic responses (A20), and induction of intermediate cell tight junction components (claudin-4). Both early and late phases of the host response exhibit remarkable specificity for the FimH+ strain and provide new insights about the molecular cascade mobilized to combat UPEC-associated urinary tract infection. 
11739387	 Recently, we generated mice lacking microsomal triglyceride transfer protein (MTP) in the liver (Mttp(Delta/Delta)) and demonstrated that very low density lipoprotein secretion from hepatocytes was almost completely blocked. The blockade in lipoprotein production was accompanied by mild to moderate hepatic steatosis, but the mice appeared healthy. Although hepatic MTP deficiency appeared to be innocuous, we hypothesized that a blockade in very low density lipoprotein secretion and the accompanying steatosis might increase the sensitivity of Mttp(Delta/Delta) livers to additional hepatic insults. To address this issue, we compared the susceptibility of Mttp(Delta/Delta) mice and Mttp(flox/flox) controls to hepatic injury from Escherichia coli lipopolysaccharides, concanavalin A, and Pseudomonas aeruginosa exotoxin A. At baseline, neither the Mttp(Delta/Delta) nor the Mttp(flox/flox) mice had elevated serum transaminases or histologic evidence of hepatic inflammation. After the administration of the toxins, however, the Mttp(Delta/Delta) mice manifested higher levels of transaminases and, unlike the Mttp(flox/flox) mice, developed histologic evidence of hepatic inflammation. The toxic challenge induced tumor necrosis factor-alpha to a similar extent in Mttp(Delta/Delta) and Mttp(flox/flox) mice, but other parameters of injury (e.g. chemokine transcript levels and lipid peroxides) were disproportionately increased in the Mttp(Delta/Delta) mice. Our results suggest that blocking lipoprotein secretion in the liver may increase the susceptibility of the liver to certain toxic challenges. 
11812009	 A novel method to screen for transcription factors binding to promoter DNA sequences has been developed using DNA chip surfaces and mass spectrometry. This  technique was demonstrated with Escherichia coli lac repressor, LacI. The consensus promoter binding sequence for LacI and a scrambled version of the same  DNA sequence were prepared on two affinity chip surfaces. Total E. coli protein lysate was applied to the two surfaces. A 38.2 kDa protein, as detected by SELDI-MS, was captured on the chip surface containing the binding sequence for LacI but not on the surface containing the scrambled sequence. The protein was identified following one-step, small-scale affinity capture and peptide mapping.  Subsequent database searches identified the 38.2 kDa protein as the lac repressor of E. coli. We discuss application of DNA chip affinity capture to characterize transcription factors and to screen for differences in cellular regulatory networks. 
12142487	 The ability to simultaneously monitor expression of all genes in any bacterium whose genome has been sequenced has only recently become available. This requires not only careful experimentation but also that voluminous data be organized and interpreted. Here we review the emerging technologies that are impacting the study of bacterial global regulatory mechanisms with a view toward discussing both perceived best practices and the current state of the art. To do this, we concentrate upon examples using Escherichia coli and Bacillus subtilis because prior work in these organisms provides a sound basis for comparison. 
11600422	 To assess the feasibility of using cDNA microarrays to understand the response of endothelial cells to lipopolysaccharide (LPS) and to evaluate potentially beneficial agents in treatment of septic shock, human umbilical vein endothelial  cells were exposed to Escherichia coli LPS for 1, 4, 7, 12, or 24 h. Total RNA was isolated and reverse-transcribed into (33)P-labeled cDNA probes that were hybridized to human GeneFilter microarrays containing approximately 4,000 genes.  The mRNA levels of several genes known to respond to LPS changed after stimulation. In addition, a number of genes not previously implicated in the response of endothelial cells to LPS also appeared to be altered in expression. Nuclear factor-kappaB (NF-kappaB) was shown to play an important role in regulating genes identified from the microarray studies. Pretreatment of endothelial cells with a specific NF-kappaB translocation inhibitor eliminated most of the alterations in gene expression. Quantitative RT-PCR results independently confirmed the microarray results for monocyte chemotactic protein-1 and interleukin-8, and enzyme-linked immunosorbent assays demonstrated that augmented transcription was followed by translation and secretion. 
11435407	 The bacterium Escherichia coli is used as a model cellular system to test and validate a new technology called Phenotype MicroArrays (PMs). PM technology is a  high-throughput technology for simultaneous testing of a large number of cellular phenotypes. It consists of preconfigured well arrays in which each well tests a different cellular phenotype and an automated instrument that continuously monitors and records the response of the cells in all wells of the arrays. For example, nearly 700 phenotypes of E. coli can be assayed by merely pipetting a cell suspension into seven microplate arrays. PMs can be used to directly assay the effects of genetic changes on cells, especially gene knock-outs. Here, we provide data on phenotypic analysis of six strains and show that we can detect expected phenotypes as well as, in some cases, unexpected phenotypes. 
11230433	 Species-specific bacterial identification of clinical specimens is often limited  to a few species due to the difficulty of performing multiplex reactions. In addition, discrimination of amplicons is time-consuming and laborious, consisting of gel electrophoresis, probe hybridization, or sequencing technology. In order to simplify the process of bacterial identification, we combined anchored in situ amplification on a microelectronic chip array with discrimination and detection on the same platform. Here, we describe the simultaneous amplification and discrimination of six gene sequences which are representative of different bacterial identification assays: Escherichia coli gyrA, Salmonella gyrA, Campylobacter gyrA, E. coli parC, Staphylococcus mecA, and Chlamydia cryptic plasmid. The assay can detect both plasmid and transposon genes and can also discriminate strains carrying antibiotic resistance single-nucleotide polymorphism mutations. Finally, the assay is similarly capable of discriminating between bacterial species through reporter-specific discrimination and allele-specific amplification. Anchored strand displacement amplification allows  multiplex amplification and complex genotype discrimination on the same platform. This assay simplifies the bacterial identification process greatly, allowing molecular biology techniques to be performed with minimal processing of samples and practical experience. 
11133948	 Author information:  (1)Central Research and Development, DuPont Company, Wilmington, Delaware 19880-0173, USA.