motility of Escherichia coli ST131
Abstract 
1 School of Chemistry and Molecular Biosciences , University of Queensland , Brisbane , Queensland , Australia , 2 Australian Infectious Disease Research Centre , University of Queensland , Brisbane , 
Uropathogenic Escherichia coli ( UPEC ) is the cause of ~ 75 % of all urinary tract infections ( UTIs ) and is increasingly associated with multidrug resistance . 
This includes UPEC strains from the recently emerged and globally disseminated sequence type 131 ( ST131 ) , which is now the dominant fluoroquinolone-resistant UPEC clone worldwide . 
Most ST131 strains are motile and produce H4-type flagella . 
Here , we applied a combination of saturated Tn5 mutagenesis and transposon directed insertion site sequencing ( TraDIS ) as a high throughput genetic screen and identified 30 genes associated with enhanced motility of the reference ST131 strain EC958 . 
This included 12 genes that repress motility of E. coli K-12 , four of which ( lrhA , ihfA , ydiV , lrp ) were confirmed in EC958 . 
Other genes represented novel factors that impact motility , and we focused our investigation on characterisation of the mprA , hemK and yjeA genes . 
Mutation of each of these genes in EC958 led to increased transcription of flagellar genes ( flhD and fliC ) , increased expression of the FliC flagellin , enhanced flagella synthesis and a hyper-motile phenotype . 
Complementation restored all of these properties to wild-type level . 
We also identified Tn5 insertions in several intergenic regions 
( IGRs ) on the EC958 chromosome that were associated with enhanced motility ; this included flhDC and EC958_1546 . 
In both of these cases , the Tn5 insertions were associated with increased transcription of the downstream gene ( s ) , which resulted in enhanced motility . 
The EC958_1546 gene encodes a phage protein with similarity to esterase/deace-tylase enzymes involved in the hydrolysis of sialic acid derivatives found in human mucus . 
We showed that over-expression of EC958_1546 led to enhanced motility of EC958 as well as the UPEC strains CFT073 and UTI89 , demonstrating its activity affects the motility of different UPEC strains . 
Overall , this study has identified and characterised a number of novel 
Introduction
Uropathogenic Escherichia coli ( UPEC ) are the most common cause of urinary tract infection ( UTI ) , a disease of major significance to global human health [ 1 -- 3 ] . 
UPEC employ a range of virulence factors to colonise the urinary tract and cause symptomatic UTI , including adhesins , toxins , iron-acquisition systems , polysaccharide surface structures and flagella [ 4 -- 8 ] . 
Overall , the combined affect of genetic variation , redundancy and genomic diversity means that no single virulence factor is uniquely associated with the ability of UPEC to cause disease . 
This complex picture is further convoluted by increased resistance to antibiotics , which complicates the treatment of UTI and highlights the urgent need to better understand UPEC pathogenesis . 
A major contributor to increased antibiotic resistance among UPEC is the fluoroquinolone-resistant sequence type 131 ( ST131 ) clone , which has emerged recently and disseminated rap-idly across the globe [ 9 -- 11 ] . 
Flagella are complex multi-subunit , filamentous organelles that contribute to various aspects of UPEC virulence , including motility , chemotaxis , adhesion , biofilm formation and immune modulation [ 5 , 12 -- 14 ] . 
In mice , flagella provide a fitness advantage for UPEC coloni-zation of the urinary tract , leading to increased colonization and persistence in mixed competitive infection experiments comprising wild-type and isogenic flagella mutant strains [ 15 , 16 ] . 
Flagella-mediated motility is also required for UPEC ascension to the upper urinary tract and subsequent dissemination to other sites [ 17 ] . 
Complementing these studies , others have shown that flagella also contribute to UPEC invasion of mouse renal epithelial collecting duct cells [ 5 ] and enhanced adhesion to and invasion of bladder epithelial cells [ 14 ] . 
Flagella are also required for UPEC biofilm formation on abiotic surfaces [ 12 ] . 
The biosynthesis , assembly and regulation of E. coli flagella have been the subject of extensive research over many decades [ 18 -- 21 ] . 
The flagella structure contains three distinct components , the basal body , hook and an extracellular filament composed of the major subunit protein FliC or flagellin . 
The FliC is highly immunogenic and sequence variation within its hyper-variable central region defines the E. coli H antigen diagnostic serotype marker [ 22 ] . 
The synthesis and assembly of flagella occurs via a highly ordered process that involves a combination of transcriptional , translational and post-translational regulatory mechanisms . 
At the transcriptional level , the regulation of flagella is coordinated via a hierarchical cascade that involves three stages of control [ 23 ] ; the FlhDC master regulators control the first stage of this process . 
Numerous global regulatory proteins influence flagella expression by either positively or negatively regulating the transcription of flhDC [ 24 , 25 ] . 
Major transcriptional activators of flhDC include the cyclic AMP-catabolite activator protein ( CRP ) [ 26 ] , the histone-like nucleoid-structuring ( H-NS ) protein [ 26 , 27 ] , the quorum sensing E. coli regulators B and C ( QseBC ) [ 28 -- 30 ] and the MatA regulator of the E. coli common pilus [ 31 ] . 
Conversely , major transcriptional repressors of flhDC include the LysR-type regulator LrhA [ 32 ] , the osmoregulator protein OmpR [ 33 ] , the colanic acid activator Rcs [ 34 ] , the P fimbriae-associated regulator PapX [ 35 , 36 ] , the ferric uptake regulatory protein ( Fur ) [ 37 ] and integration host factor ( IHF ) [ 38 ] . 
Mutation of these regulatory genes alters the transcription of flhDC and leads to either reduced or enhanced motility . 
Our understanding of E. coli motility has been enhanced by the application of large-scale genetic screens to study flagella expression and chemotaxis . 
Overall , these studies have shown that many different cell processes influence this complex phenotype . 
For example , Girgis et al. . 
( 2007 ) performed a powerful genome-wide investigation that combined competitive selection and microarray analysis , and resulted in the characterization of thirty-six novel motility-asso-ciated genes [ 39 ] . 
These genes encoded for a diverse range of non-flagellar factors , and notably comprised a large number of cell envelope proteins including transporters , periplasmic enzymes and intrinsic membrane proteins . 
Another study by Inoue et al. ( 2007 ) screened a comprehensive collection of E. coli K-12 mutants ( the Keio collection ) and compiled a detailed compendium of genes involved in swimming and swarming motility [ 40 ] . 
Again , a range of non-flagellar genes were identified , including those encoding factors associated with metabo-lism , iron acquisition , protein-folding and the biosynthesis of lipopolysaccharide ( LPS ) as well as other cell-surface components . 
Large-scale genetic screens to study motility in Salmonella have also been performed , with similar classes of genes identified [ 41 , 42 ] . 
Interestingly , a set of genes associated with enhanced motility ( hyper-motility ) of Salmonella were identified in one of these studies ; in some cases this phenotype was associated with increased expression of flagellin on the cell surface [ 41 ] . 
While the flagella regulon from E. coli has been extensively studied , the identification and characterisation of genes associated with hyper-motility has not been examined in great detail . 
We recently described the combined application of saturated Tn5 mutagenesis and transposon directed insertion site sequencing ( TraDIS ) to comprehensively define the complete set of genes associated with resistance to human serum in the UPEC ST131 strain EC958 [ 43 ] . 
Here , we applied TraDIS as a large scale genetic screen and identified a series of genes that when mutated , led to increased motility of the UPEC ST131 reference strain EC958 . 
Results
Identification of genes associated with enhanced motility of EC958 
We devised a swimming assay in combination with a forward genetic screen using a previously generated hyper-saturated mini-Tn5 mutant library [ 43 ] to identify genes associated with enhanced motility of EC958 ( Fig 1 ) . 
In this assay , a pool of approximately 1x10 Tn 7 5 mutants 
( input pool ) was spotted in the center of 20 soft LB agar plates and incubated for 10 hours at 37 ˚C . 
Motile cells were recovered from the edge of the swimming zone of each plate by extracting the LB agar at a distance of 30mm from the point of inoculation ( output pool ) . 
EC958 genomic DNA was purified from the input and output pools and sequenced using a multiplexed TraDIS procedure . 
The input and output pools yielded 8.4 x10 -- 7x10 Tn 5 6 5-specific 
Using a stringent threshold cutoff ( log2 fold change [ logFC ] > 5 ; P < 0.001 ) , 30 genes were identified that , when mutated , led to enhanced motility of EC958 ( Table 1 ) . 
For each of these genes , the number of reads corresponding to Tn5 insertions was significantly increased in cells at the periphery of the swimming zone ( output pool ) compared to the input pool . 
Twelve of these genes have previously been shown to repress motility , namely lrhA [ 32 ] , ihfA [ 38 ] , ydiV [ 44 , 45 ] , ihfB [ 38 ] lrp [ 46 ] , clpXP [ 47 ] , papX [ 35 , 36 ] , rcsB [ 34 ] pfrA [ 48 ] , yeaI [ 49 ] and fliT [ 50 ] . 
The remaining genes represent novel factors that influence the motility of EC958 , with their function ranging across eight Clusters of Orthologous Groups ( COGs ) ( Table 1 ) . 
Genetic characterisation of selected hyper-motility mutants
In order to extend our TraDIS data we validated a selection of the genes involved in repression of motility by generating targeted mutants for further investigation . 
Thus , EC958 mutants containing deletions in four genes previously shown to repress motility in E. coli K-12 ( lrhA , ihfA , ydiV , lrp ) and three novel motility-associated genes ( mprA , hemK , yjeA ) were constructed by λ 
Red-mediated recombination and characterized in motility assays . 
In these experiments , all seven mutants displayed an enhanced swimming phenotype on 0.25 % LB agar compared to the wild-type EC958 strain ( Fig 2 ) . 
To further confirm the role of the novel motility-associated mprA , hemK and yjeA genes , the genes were cloned in the low copy number plasmid pSU2718G and introduced into their respective mutants to enable genetic complementation . 
The wild-type , mutant and complemented strains were then grown on 0.25 % LB agar to compare their swimming phenotype . 
In each case , the motility rate of the complemented mutants was restored to wild-type level ( Fig 3 ) . 
Taken together , this data confirms the involvement of mprA , hemK and yjeA in EC958 motility and suggests the TraDIS analysis has accurately iden ¬ 
Mutation of mprA, hemK and yjeA enhances the transcription and translation of flagella genes
To further understand the mechanism by which mutation of mprA , hemK and yjeA could enhance motility , we analysed our set of wild-type , mutant and complemented strains by examining ( i ) transcription of the flhD and fliC genes , ( ii ) expression of the FliC flagellin protein , and ( iii ) the number of flagella on the cell surface . 
Mutation of the mprA , hemK and yjeA genes led to a significant increase in the transcription of flhD ( 10.2 , 6.4 and 6.6 fold increase , respectively ) and fliC ( 16.4 , 21.0 , 15.2 fold increase , respectively ) , while complementation of the mutants restored the transcript of flhD and fliC to wild-type levels ( Fig 4A and 4B ) . 
In line with these data , the levels of FliC flagellin observed by western blotting using an H4-specific antibody were also elevated in all three mutants compared to the wild-type and complemented strains ( Fig 4C and 4D ) . 
To link these elevated levels of flagella biosynthesis to the number of flagella organelles per cell , transmission electron microscopy was employed . 
Based on a count of 200 randomly selected cells for each strain , wild-type EC958 had an average of 0.8 ± 0.1 fla-gella per cell , which of interest was relatively low compared to strains used for routine studies of motility and chemotaxis [ 51 ] . 
In contrast , the three mutants all possessed significantly higher numbers of flagella per cell ; EC958mprA 2.4 ± 0.3 flagella/cell , EC958hemK 3.3 ± 0.7 fla-gella/cell and EC958yjeA 2.0 ± 0.4 flagella/cell . 
Complementation of each of the mutants reduced the average number of flagella per cell back to wild-type level ( Fig 4E , S1 Fig ) . 
Taken together , our data suggest these three genes play a role in controlling the number of flagella per cell and disruption of any of the genes results in hyper-motility by increasing the number of flagella on the cell surface . 
Transposon insertions in intergenic regions associated with enhanced motility 
The very high level of saturation in our miniTn5 library enabled us to compare the insertion frequency within intergenic regions ( IGRs ) between input and output pools , and thus determine the impact of insertions in these regions on hyper-motility . 
There are 3973 IGRs on the chromosome of EC958 , eight of which contained significantly more miniTn5 insertions in the output pools than in the input pools . 
Out of these eight IGRs , six were located upstream of coding sequences ( CDS ) which are known to repress motility and were discovered in our primary TraDIS analysis ( Table 2 ) . 
The orientation of the miniTn5 cassette within these six IGRs was unidirectional , such that the chloramphenicol resistance gene was orientated in the opposite direction of the downstream genes and thus the insertion most likely abolished their transcription . 
The identification of an increased miniTn5 insertion frequency in both the promoter region and CDS of these genes provides further evidence to support the conclusion that their disruption leads to a hyper-motile phenotype . 
The two remaining IGRs identified by TraDIS ( EC958_IGR1610 , upstream of flhD and 
EC958_IGR1146 , upstream of EC958_1546 ) contained miniTn5 insertions uniquely located such that the chloramphenicol resistance gene was orientated in the same direction as the downstream gene . 
Furthermore , in both cases , the downstream gene was devoid of miniTn5 insertions , suggesting that the function of these genes was required for motility and that their increased transcription ( via read-through from the chloramphenicol resistance gene promoter in the miniTn5 transposon ) could result in hyper-motility . 
In the case of insertions in the IGR upstream of flhDC , this interpretation is consistent with other literature that has shown overexpression of these master regulator genes leads to hyper-motility [ 52 -- 57 ] . 
However , we also confirmed this by introducing a strong constitutive promoter ( PcL ) upstream of the flhDC CDS to generate EC958PcLflhDC ; as expected , this strain exhibited enhanced motility and pro ¬ 
Overexpression of the EC958_1546 gene enhances EC958 motility 
The EC958_1546 gene is located within the phi4 prophage ( EC958_Phi4 : 1436674 . 
.1490889 ) and encodes a hypothetical phage protein . 
We hypothesized that like insertions in the IGR upstream of flhDC , the unidirectional miniTn5 insertions in the IGR upstream of EC958_1546 enhanced its transcription and imparted a positive effect on motility . 
To investigate this further , we generated an isogenic EC958_1546 mutant ( EC958Δ1546 ) by λ-red mediated homologous recombination . 
EC958Δ1546 motility was unchanged compared to wild-type EC958 ( Fig 
5 ) , suggesting its deletion did not alter this phenotype . 
Next we cloned the EC958_1546 gene into the low copy number expression vector pSU2718 to generate plasmid p1546 . 
Transformation of plasmid p1546 into EC958Δ1546 led to significantly enhanced motility ( Fig 5 ) . 
Finally , we constructed an EC958_1546 overexpressing strain by inserting a constitutive PcL promoter upstream of the chromosomal EC958_1546 gene ( strain EC958PcL1546 ) . 
The motility rate of 
EC958PcL1546 was also significantly higher than wild-type EC958 ( Fig 5 ) . 
Taken together , these data strongly support a role for the product of the EC958_1546 gene in enhancing motil ¬ 
EC958_1546 overexpression enhances transcription of the flhD master regulator 
To investigate the mechanism by which EC958_1546 enhances motility , we used the same approach described above and examined flhD and fliC transcription by qRT-PCR , FliC expression by western blot analysis and flagella expression by TEM . 
Compared to wild-type EC958 , the transcription of flhD was ~ 2-fold higher for EC958PcL1546 and ~ 4-fold higher for EC958Δ1546 ( p1546 ) ( Fig 6A ) . 
Similarly , the transcription of fliC was also significantly increased ( ~ 11-fold for EC958PcL1546 and ~ 32-fold for EC958Δ1546 ( p1546 ) ; Fig 6B ) . 
Consistent with our motility analysis , no significant difference was observed in the transcription of flhD and fliC in EC958Δ1546 ( Fig 6B ) . 
Overexpression of EC958_1546 also led to an increase in FliC expression ( Fig 6C and 6D ) and flagella production ( Fig 6E , S3 Fig ) compared to wild-type EC958 . 
Thus , our data strongly support a mechanism whereby overexpression of EC958_1546 leads to enhanced transcription of the flhDC master regulator genes , resulting in 
Overexpression of EC958_1546 also leads to hyper-motility of other UPEC strains 
To extend our analysis on the function of EC958_1546 , we also examined its overexpression in two other well-characterised UPEC strains , namely CFT073 and UTI89 . 
Plasmid p1546 was transformed into both strains to generate CFT073 ( p1546 ) and UTI89 ( p1546 ) , respectively . 
In both strains , overexpression of EC958_1546 led to increased motility compared to vector control strains ( Fig 7 ) , demonstrating that EC958_1546 can enhance motility in multiple UPEC strains ( Fig 7 ) . 
Discussion
The use of TraDIS to identify genes involved in motility represents a novel application for this high throughput forward genetic screen . 
We initially hypothesized that all mutants defective in swimming would be absent from the output pool , and thus that our screen would identify the complete flagella regulon of EC958 . 
However , analysis of our TraDIS data did not reveal any genes that exhibited a significant reduction in insertion frequency in the output pool ( compared to the input pool ) , suggesting that non-motile mutants are likely to be ` carried ' by the wave of swimming cells in our assay . 
Indeed , this is consistent with the previous findings of Girgis et al. [ 39 ] , who demonstrated a requirement for up to five rounds of selection and enrichment of swimming cells to identify genes essential for motility . 
Instead , our TraDIS analysis identified 30 genes associated with the enhanced motility of EC958 . 
This included 12 genes encoding factors known to repress motility of E. coli K-12 , four of which ( lrhA , ihfA , ydiV , lrp ) were confirmed in this study . 
The remaining genes represent novel factors that impact motility , and we focused our investigation on characterisation of the mprA , hemK and yjeA genes . 
Mutation of each of these genes in EC958 led to increased transcription of flhD and fliC , increased expression of the FliC flagellin , enhanced flagella synthesis and a hypermotile phenotype . 
Importantly , all of these properties were restored to wild-type level upon complementation . 
MprA ( also known as EmrR ) is a transcriptional regulator that belongs to the MarR family of winged helix DNA binding proteins , which control the expression of a range of bacterial genes involved in virulence , resistance to antibiotics , response to oxidative stresses and the catabolism of environmental aromatic compounds [ 58 , 59 ] . 
In E. coli , the mprA gene is located in an operon together with the ermAB genes that encode a multidrug resistance pump [ 60 , 61 ] . 
MprA represses transcription of ermAB by direct binding to its promoter region [ 62 ] . 
A recent study reported that MprA also controls UPEC capsule synthesis , and specific inhibitors of MprA prevented polysaccharide capsule production [ 63 ] . 
In this case , the effect of MprA on capsule production was indirect and most likely coordinated through a broader regulatory network . 
Here , we identified a new role for MprA in UPEC motility . 
Although the precise molecular mechanism by which MprA represses UPEC motility remains to be determined , our data suggest its effect is mediated at the transcriptional level , and could occur either directly by binding to the flhDC promoter region or indirectly by affecting the expression of other flhDC regulators . 
In this respect , we note that mutation of ermAB did not change the motility of 
EC958 ( S4 Fig ) , ruling out an affect via altered expression of the ErmAB multidrug resistance pump . 
Among the other characterised MarR-like transcriptional regulators , PapX has also been shown to repress the motility of UPEC [ 35 , 46 ] . 
PapX directly binds to the flhDC promoter and represses transcription , and its over-expression results in reduced flagellin production and decreased motility [ 35 ] . 
Consistent with these data , papX was also identified in our TraDIS screen . 
Taken together , our results provide strong evidence that in addition to PapX , MprA also affects UPEC motility . 
HemK is a protein ( N5 ) - glutamine methyltransferase that modulates the termination of release factors in ribosomal protein synthesis [ 64 -- 66 ] . 
In E. coli , mutation of hemK causes defects in translational termination , leading to reduced growth rate and induction of the oxidative stress response [ 64 , 66 ] . 
We also observed a significant growth defect for the EC958hemK mutant in comparison to wild-type EC958 and the complemented mutant EC958hemK ( pHemK ) ( S5 Fig ) . 
Based on this knowledge , the observation that deletion of hemK leads to enhanced motility is difficult to understand . 
It is possible that the induction of multiple stresses in a hemK mutant background results in increased FlhDC expression . 
Indeed , FlhDC expression is responsive to a range of environmental stimuli ( e.g. temperature , osmolarity and pH ) [ 67 ] . 
YjeA ( also known as PoxA ) is a lysine 2,3-aminomutase that mediates post-translational modification of elongation factor-P ( EF-P ) [ 68 -- 70 ] . 
EF-P is an essential component of bacterial protein synthesis and binds to ribosomes to facilitate peptide bond formation [ 71 , 72 ] . 
In E. coli , the lysine residue 34 ( Lys34 ) of EF-P is posttranslationally modified by YjeA , resulting in increased affinity of EF-P to the ribosome [ 73 , 74 ] and prevention of ribosome stalling at polyproline stretches [ 73 , 74 ] . 
EF-P Lys34 can also be modified by a second enzyme , YjeK [ 69 ] . 
Notably , both yjeA and yjeK were identified in our TraDIS motility screen ( Table 1 ) , suggesting that a defect in EF-P modification actually enhances the motility of EC958 . 
In Salmonella , a contrasting motility phenotype for yjeA and yjeK mutants has been reported , with mutation of these genes leading to impaired motility [ 75 , 76 ] . 
It is possible that these differences may be related to the relative abundance of flagella-related proteins that contain polyproline stretches between both organisms , although a direct comparison of flagella proteins in EC958 and the Salmonella strain UK-1 did not reveal any major differences ( S3 Table ) . 
Alternatively , as observed for hemK , mutation of yjeA and yjeK may induce a stress response that leads to increased FlhDC expression . 
Overall , the precise mechanism by which mutation of yjeA results mutated , led to enhanced motility of EC958 . 
The function of these genes ranged across seven COG functional categories , including ` cell wall/membrane/envelope biogenesis ' ( 2 genes ) , 
` mobilome : prophages , transposons ' ( 2 genes ) , Signal transduction ( 3 genes ) , aminoacid transport and metabolism ( 2 genes ) and others ( Table 1 ) . 
Confirmation of the role of these genes in motility via the construction and characterisation of specific mutants is now required . 
The use of a highly saturated mutant library in our TraDIS procedure also enabled the interrogation of miniTn5 insertions within IGRs on the EC958 chromosome . 
In total , eight 
IGRs were identified that contained significantly more insertions in the output pool compared to the input pool , indicating insertions within these IGRs led to enhanced motility . 
Six of these 
IGRs were located upstream of CDS for genes known to repress motility , all of which were also identified in our screen . 
Close inspection of the Tn5 insertions revealed their orientation was unidirectional and opposite to the direction of the downstream genes , consistent with the notion that the insertion disrupted transcription of the corresponding gene . 
The analysis also identified Tn5 insertions in IGRs upstream of flhDC and EC958_1546 . 
These Tn5 insertions were also unidirectional , but instead orientated in the same direction as the respective downstream gene , which in both cases was devoid of Tn5 insertions . 
We hypothesized that these Tn5 insertions most likely resulted in enhanced transcription of the downstream gene ( s ) ; indeed this was confirmed by introducing the strong constitutive PcL promoter upstream of both genes , which resulted in enhanced motility . 
Thus , our approach has revealed a novel application of TraDIS to identify genes that enhance a specific phenotype when their transcription is increased . 
EC958_1546 encodes a hypothetical phage protein predicted to be 617 amino acids in length . 
EC958_1546 displays 58 % identity over 326 amino acids to NanS , an N-acetylneurami-nic acid deacetylase that catalyses the hydrolysis of the 9-O-acetyl group of 9-O-acetyl-N-acet-ylneuraminate , an alternative sialic acid commonly found in mammalian host mucosal sites such as the human intestine [ 77 -- 79 ] . 
We speculate that over-expression of the EC958_1546 protein may enhance motility via an altered chemotactic response , however this remains to be experimentally proven . 
Interestingly , there are three additional genes on the EC558 chromosome that display similarity to EC958_1546 , namely EC958_1029 ( 82.7 % amino acid identity over the whole protein ) , EC958_3294 ( 57.4 % amino acid identity over 317 amino acids ) and EC958_0037 ( 58.4 % amino acid identity over 319 amino acids ) ( S6 Fig ) . 
None of these three genes were identified in our TraDIS screen . 
Furthermore , PCR amplification , cloning and overexpression of these genes in EC958 did not alter motility ( S7 Fig ) , confirming the specific affect of EC958_1546 on this phenotype . 
We also showed that over-expression of EC958_1546 in two other UPEC strains could also invoke an enhanced motility phenotype , demonstrating the affect is not strain specific . 
In this respect , an Stx-phage-encoded protein ( 933Wp42 ) from enterohemorrhagic E. coli that possesses 53 % amino acid identity with EC958_1546 has been shown to have esterase activity [ 78 ] , and other phage-encoded variants of nanS have been described [ 80 ] . 
Thus , it is possible that the over-expression of other phage proteins with the capacity to degrade different carbon sources could also impact motility . 
Overall , this study demonstrates the application of TraDIS to identify novel genes associated with enhanced motility . 
A better understanding of the mechanisms by which many of the 
Materials and methods
Bacterial strains and growth conditions
All strains and plasmids used in this study are listed in Table 3 . 
Strains were routinely cultured at 37 ˚C on solid or in liquid Lysogeny Broth ( LB ) medium supplemented with the appropriate antibiotics ( chloramphenicol 30 μg / ml or gentamicin 20 μg / ml ) unless indicated otherwise . 
Where necessary , gene expression was induced with 1mM isopropyl β-D-1-thiogalactopyrano - 
Molecular methods
DNA purification , PCR and Sanger DNA sequencing was performed as previously described [ 88 ] . 
Targeted mutations were generated using a modified λ-Red recombineering method [ 81 , 
84 ] . 
A list of primers used in this study is provided in S2 Table . 
In brief , the final PCR products were generated by a 3-way PCR that resulted in amplification of the chloramphenicol resistance gene cassette flanked by 500-bp homologous regions matching the target gene to be mutated . 
The PCR products were electroporated into EC958 harbouring pKOBEG-Gent . 
Mutants were selected by growth in the presence of chloramphenicol and confirmed by sequencing . 
Complementation was performed by cloning the gene of interest into pSU2718 
[ 87 ] or pSU2718G . 
The resultant plasmid was then transformed into the respective mutant and gene expression was induced using 1 mM IPTG . 
Screening assay for identification of mutants with enhanced motility Approximately 1x10 cells from a previously constructed miniTn 
( input pool ; [ 43 ] ) were inoculated into the center of each of 20 LB soft agar plates ( 80 mm diameter ) and incubated for 10 hours at 37 ˚C . 
Motile cells were recovered by extracting the LB agar at a distance of 30 mm from the point of inoculation ( the edge of the swimming zone ; output pool ) . 
Approximately 5g of soft agar ( plus motile cells ) was collected from each plate and vigorously mixed with LB broth to achieve a suspension of 1g agar/ml . 
Five ml of this mixture was drawn from each tube ( n = 20 ) and pooled . 
The pooled mixture was centrifuged at 6000 rpm for 10 min at room temperature to separate the bacterial pellet from soft agar . 
This centri-fugation step produced a tight bacterial pellet surrounded by a loose mass of soft agar and a layer of supernatant . 
The agar and supernatant was removed , and the pellet was resuspended in LB to an OD600 of 1.8 ; genomic DNA was extracted from 5 ml of this suspension using the Qiagen genomic DNA purification kit . 
DNA from the input pool was extracted in the same 
Multiplexed TraDIS
TraDIS was performed essentially as previously described [ 43 ] , but with some modifications for adaptation to the MiSeq platform [ 89 ] . 
Briefly , 50 ng of genomic DNA from each sample ( 2 biological replicates of input and output pools , respectively ) was fragmented and tagged with adapter sequence via one enzymatic reaction ( tagmentation ) . 
Following tagmentation , DNA was purified using Zymo DNA Clean & Concentrator ™ kit ( Zymo Research ) . 
The PCR enrichment step was run using index primer 1 ( one index per sample ) and a custom transposon specific primer 4844 ( 5 ' - AATGATACGGCGACCACCGAGATCTACACTAGATCGCaacttcggaat aggaactaagg-3 ' ) to enrich for transposon insertion sites and allow for multiplexing sequencing ; the thermocycler program is 72 ˚C for 3 minutes , 98 ˚C for 30 seconds followed by 
22 cycles of 98 ˚C for 10 seconds , 63 ˚C for 30 seconds and 72 ˚C for 1 minute . 
Each library was purified using Agencourt Ampure XP magnetic beads . 
Verification and quantification of 1 1 resulting libraries were calculated using a Qubit 2.0 Fluorometer , 2100 Bioanalyser ( Agilent 1 
Technologies ) and qPCR ( KAPA Biosciences ) . 
All libraries were pooled in equimolar to a final concentration of 3.2 nM and submitted for sequencing on the MiSeq platform at the Queensland Centre for Medical Genomics ( Institute for Molecular Bioscience , The University of Queensland ) . 
The MiSeq sequencer was loaded with 12 pM of pooled library with 5 % PhiX spike-in and sequenced ( single-end , 101 cycles ) using a mixture of standard Illumina sequencing primer and Tn5-specific sequencing primer 4845 ( 5 ' - actaaggaggatattcatatgga ccatggctaattcccatgtcAGATGTG-3 ' ) . 
A total of two MiSeq runs were performed to achieve sufficient read depth for analysis . 
All experiments were performed in duplicate . 
The TraDIS sequence data from this study was deposited on the Sequence Read Archive ( SRA ) under the Bio Project number PRJNA339173 ( http://www.ncbi.nlm.nih.gov/sra/SRP082245 ) . 
Analysis of TraDIS data
The raw , de-multiplexed fastq files from both MiSeq runs were combined and filtered to capture reads containing the 12-bp Tn5-specific barcode ( 5 ' - TATAAGAGACAG-3 ' ) , allowing for 2 mismatches ( fastx_barcode_splitter.pl , FASTX-Toolkit v. 0.0.13 ) . 
These reads were trimmed to remove the 12-bp barcode and 58-bp at the 3 ' end ( fastx_trimmer , FASTX-Toolkit v. 0.0.13 ) , resulting in high quality sequence reads of 30-bp in length that were mapped to the EC958 chromosome ( gb | HG941718 ) by Maq version 0.7.1 [ 90 ] . 
Subsequent analysis steps were carried out using an in-house Perl script as previously described [ 43 ] to calculate the number of unique insertion sites and the read count at each site for every gene and IGR . 
Statistical analysis
EC958 genes and IGRs associated with enhanced motility were identified by comparing their relative read abundance in the input and output pools using the Bioconductor package edgeR 
[ 91 ] as previously described [ 43 ] . 
Briefly , the read counts from each sample were loaded into the edgeR package ( version 2.6.12 ) using the R environment ( version 2.15.1 ) . 
The composition bias in each sequence library was normalized using the trimmed mean of M value ( TMM ) method [ 92 ] . 
The quantile-adjusted conditional maximum likelihood ( qCML ) for negative binomial models was then used to estimate dispersions ( biological variation between replicates ) and to perform exact tests for determining genes and IGRs with significantly lower read counts in the input pools compared to the output pools as previously described [ 93 , 94 ] . 
Stringent criteria of log fold - change ( logFC ) 5 and false discovery rate 0.001 were used to define a list of the most significant genes for further investigation by phenotypic assays . 
All other experimental data were analyzed using unpaired Students t-test and P-values 0.05 
Motility assay
To evaluate motility , 6 μl of an overnight culture prepared in LB broth was spotted onto the centre or the edge of a freshly prepared 0.25 % LB Bacto-agar plate ( n = 3 ) , supplemented with the appropriate inducer and/or antibiotic . 
Plates were incubated at 37 ˚C in a humid environment ( a closed box containing a dish of water ) and the rate of motility was determined by measuring the diameter of the motility zone over time . 
qRT-PCR was carried out essentially as previously described [ 14 ] . 
In brief , exponentially growing cells ( OD600 0.6 ) were stabilized with two-volumes of RNAprotect Bacteria Reagent ( Qiagen ) prior to RNA extraction using the RNeasy Mini Kit ( Qiagen ) followed by on-column DNase digestion . 
First-strand cDNA synthesis was performed using SuperScript III First-1 
Strand Synthesis System ( Invitrogen ) as per manufacturer 's recommendation . 
Real-time PCR was performed using SYBR Green PCR Master Mix ( Applied Biosystems ) on the ViiA 1 ™ 7 Real-Time PCR System ( Applied Biosystems ) using the following primers : flhD , primers 5613 ( 50-acttgcacagcgtctgattg ) and 5614 ( 50-agcttaaccatttgcggaag ) ; fliC , primers 5683 ( 50-caccaacct-gaacaacacca ) and 5684 ( 50-gcacggcgaatatccagttg ) . 
Transcript levels of each gene were normalized to gapA as the endogenous gene control ( primers 820 , 50-ggtgcgaagaaagtggttatgac and 821 , 50-ggccagcatatttgtcgaagttag ) . 
Gene expression levels were determined using the 2-ΔΔCT method with relative fold-difference expressed against EC958 . 
Protein preparation and western blotting
Whole cells lysates were prepared by pelleting 1 ml of an overnight culture diluted to an optical density at 600nm ( OD600 ) of 1.0 , and resuspending in 50 μl of distilled water plus 50 μl of 2x SDS loading buffer . 
SDS PAGE and transfer of proteins to a PVDF membrane for western blotting was performed as previously described [ 53 ] . 
Monospecific antiserum against H4 fla-gellin was purchased from the Statens Serum Institute , Denmark . 
OmpA antiserum was purchased from the Antibody Research Corporation , USA ( item # 111120 ) . 
Primary antibodies were detected with commercially purchased alkaline phosphatase-conjugated anti-rabbit antibody ( Sigma Aldrich ) . 
SIGMAFAST ™ BCIP1/NBT ( Sigma Aldrich ) was used as substrate for 
Supporting information
S1 Fig . 
TEM analysis demonstrating flagella expression for representative EC958 wildtype , mutant and complemented strains . 
S2 Fig . 
Overexpression of the flhDC master regulator genes in EC958 leads to enhanced motility . 
Left panel , motility phenotype expressed as the diameter of the swimming zone per hour for EC958 and EC958PcLflhDC . 
The data represents the mean and standard deviation from three independent experiments . 
Right panel , western blot analysis of cell lysates prepared from mid-log phase cultures of EC958 and EC958PcLflhDC probed with an antibody against 
S4 Fig . 
Motility phenotype of EC958 and EC958emrAB strains . 
Motility is expressed as the diameter of the swimming zone per hour for EC958 and EC958emrAB . 
The data represents the mean and standard deviation from three independent experiments . 
( TIF ) 
S5 Fig . 
Growth of EC958 , EC958hemK and the complemented mutant EC958hemK ( pHemK ) . 
EC958hemK displayed a reduced growth rate compared to the wild-type and com plemented strains . 
( TIF ) 
S6 Fig . 
Amino acid alignment of the translated sequences for EC958_1546 , EC958_1029 , EC958_3294 and EC958_0037 . 
Sequence alignments were performed using CLC main workbench 7.0.2 . 
Residues identical to EC958_1546 are indicated by dots ; gaps are indicated by dashed lines . 
S7 Fig . 
Motility phenotype of EC958 ( p1546 ) , EC958 ( p1029 ) , EC958 ( p3294 ) , EC958 ( p0037 ) and EC958 ( pSU2718 ) . 
Motility is expressed as the diameter of the swimming zone per hour for each strain . 
The data represents the mean and standard deviation from three independent experiments . 
S1 Table. Primers used in this study. (XLSX)
S2 Table. Summary of sequencing and mapping results of TraDIS runs. (XLSX)
S3 Table . 
Frequency of Proline residues in flagella-related proteins of EC958 and Salmo-nella enterica serovar Typhimurium strain UK-1 . 
( XLSX ) 
Acknowledgments
This work was supported by a grant from the National Health and Medical Research Council ( NHMRC ) of Australia ( GNT1067455 ) . 
MAS is supported by an NHMRC Senior Research 
Writing – review & editing: AK MDP AWL SAB MAS.
Sanchez-Torres V, Hu H, Wood TK. GGDEF proteins YeaI, YedQ, and YfiN reduce early biofilm forma- tion and swimming motility in Escherichia coli. Appl Microbiol Biotechnol. 2011; 90(2):651–8. Epub 2010/12/25. https://doi.org/10.1007/s00253-010-3074-5 PMID: 21181144
Hung CC, Haines L, Altier C. The flagellar regulator fliT represses Salmonella pathogenicity island 1 through flhDC and fliZ. PLoS One. 2012; 7(3):e34220. Epub 2012/04/06. https://doi.org/10.1371/ journal.pone.0034220 PMID: 22479568
53 . 
Ulett GC , Webb RI , Schembri MA . 
Antigen-43-mediated autoaggregation impairs motility in Escherichia coli . 
Microbiology . 
2006 ; 152 ( Pt 7 ) :2101 -- 10 . 
https://doi.org/10.1099/mic.0.28607-0 PMID : 16804184 
54 . 
Fahrner KA , Berg HC . 
Mutations that stimulate flhDC expression in Escherichia coli K-12 . 
J Bacteriol . 
2015 ; 197 ( 19 ) :3087 -- 96 . 
Epub 2015/07/15 . 
https://doi.org/10.1128/JB.00455-15 PMID : 26170415 
57 . 
Wang X , Wood TK . 
IS5 inserts upstream of the master motility operon flhDC in a quasi-Lamarckian way . 
ISME J. 2011 ; 5 ( 9 ) :1517 -- 25 . 
https://doi.org/10.1038/ismej.2011.27 PMID : 21390082 
58 . 
Wilkinson SP , Grove A. Ligand-responsive transcriptional regulation by members of the MarR family of winged helix proteins . 
Curr Issues Mol Biol . 
2006 ; 8 ( 1 ) :51 -- 62 . 
Epub 2006/02/03 . 
PMID : 16450885 
59 . 
Ellison DW , Miller VL . 
Regulation of virulence by members of the MarR/SlyA family . 
Curr Opin Microbiol . 
2006 ; 9 ( 2 ) :153 -- 9 . 
Epub 2006/03/15 . 
https://doi.org/10.1016/j.mib.2006.02.003 PMID : 16529980 
60 . 
Lomovskaya O , Lewis K. Emr , an Escherichia coli locus for multidrug resistance . 
Proc Natl Acad Sci U S A. 1992 ; 89 ( 19 ) :8938 -- 42 . 
Epub 1992/10/01 . 
PMID : 1409590 
61 . 
Lomovskaya O , Lewis K , Matin A. EmrR is a negative regulator of the Escherichia coli multidrug resistance pump EmrAB . 
J Bacteriol . 
1995 ; 177 ( 9 ) :2328 -- 34 . 
Epub 1995/05/01 . 
PMID : 7730261 
64 . 
Nakahigashi K , Kubo N , Narita S , Shimaoka T , Goto S , Oshima T , et al. . 
HemK , a class of protein methyl transferase with similarity to DNA methyl transferases , methylates polypeptide chain release factors , 
67 . 
Soutourina OA , Bertin PN . 
Regulation cascade of flagellar expression in Gram-negative bacteria . 
FEMS Microbiol Rev. 2003 ; 27 ( 4 ) :505 -- 23 . 
Epub 2003/10/11 . 
PMID : 14550943 
71 . 
Glick BR , Ganoza MC . 
Identification of a soluble protein that stimulates peptide bond synthesis . 
Proc Natl Acad Sci U S A. 1975 ; 72 ( 11 ) :4257 -- 60 . 
Epub 1975/11/01 . 
PMID : 1105576